L-ALANINE-PRODUCING MICROORGANISM AND METHOD FOR PRODUCING L-ALANINE USING THE SAME

Introducing alanine dehydrogenase into Corynebacterium microorganisms enhances L-alanine production, addressing high costs and low yield issues in existing methods, enabling efficient industrial production.

BR112025019092A2Pending Publication Date: 2026-07-14CJ CHEILJEDANG CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
BR112025019092
Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-10
Filing Date
2024-03-06
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Existing methods for producing L-alanine, such as chemical synthesis and enzymatic conversion, face high costs due to reliance on petroleum-derived substrates and low yield, while natural microorganism strains have limited productivity.

Method used

Introduce alanine dehydrogenase activity into Corynebacterium microorganisms, derived from sources like Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari, to enhance L-alanine production capacity.

Benefits of technology

The modified microorganisms produce L-alanine in high yield, providing a cost-effective alternative for industrial production.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to: a microorganism of the genus Corynebacterium that has ability to produce L-alanine with introduced alanine dehydrogenase activity; a method for producing L-alanine comprising a step of culturing the microorganism in a medium; a composition for producing L-alanine comprising the microorganism, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof; and a use of the microorganism for producing L-alanine.
Need to check novelty before this filing date? Find Prior Art

Description

1 / 68 L-ALANINE-PRODUCING MICROORGANISM AND METHOD FOR PRODUCING L-ALANINE USING THE SAME [Technical Field]

[001] The present description refers to a microorganism of the genus Corynebacterium having the capacity to produce L-alanine, in which alanine dehydrogenase activity is introduced; a method for producing L-alanine, comprising culturing the microorganism in a medium; a composition for producing L-alanine, including the microorganism, a culture product of the microorganism, a fermented product of the microorganism or a combination of two or more thereof; and the use of the microorganism for the production of L-alanine. [Fundamentals of the Technique]

[002] L-alanine is an important amino acid widely applied in the fields of chemistry, food, medicine, etc. It is an amino acid that produces a sweet taste and is especially used in the food industry as a flavor enhancer and nutritional supplement. In 2020, the global alanine market was valued at over US$250 million, with an annual alanine production of approximately 500 tons (The Expresswire, 2020; Wendisch, 2014).

[003] In this sense, chemical synthesis or enzymatic conversion are mainly used to produce L Petition 870250101709, dated 06 / 11 / 2025, page 9 / 76 2 / 68 alanine. Chemical synthesis is carried out by modifying the Strecker synthesis or the Bucherer-Bergs reaction (Legnani et al., 2021), and enzymatic conversion is performed using ammonium fumarate derived from L-aspartic acid (Takamatsu et al., 1982). Most industrial production is carried out through the enzymatic conversion process. Here, L-aspartic acid, the substrate, is produced from petroleum, and fumaric acid production also depends on petroleum, which requires high costs, and there is the problem of low yield when replacing petroleum.

[004] Thus, as an alternative, fermentation by microorganisms can provide abundant carbon sources at low cost. Microorganisms naturally produce L-alanine by aminotransferase or alanine dehydrogenase. However, there are limitations in the production of L-alanine using naturally occurring strains due to low productivity.

[005] Therefore, further research is needed to effectively increase the production capacity of L-alanine. [Description] [Technical Problem]

[006] The present inventors have confirmed that when alanine dehydrogenase activity is introduced into a microorganism of the genus Corynebacterium, the ability to Petition 870250101709, dated 06 / 11 / 2025, page 10 / 76 3 / 68 L-alanine production by the microorganism is increased compared to that of an unmodified microorganism, thus completing the present description. [Technical Solution]

[007] It is an objective of the present description to provide a microorganism of the genus Corynebacterium with the ability to produce L-alanine, in which alanine dehydrogenase activity is introduced.

[008] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari.

[009] In another embodiment, alanine dehydrogenase can be encoded by the aldl, ald2, or alaD gene.

[0010] In yet another embodiment, alanine dehydrogenase may comprise an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7.

[0011] In yet another embodiment, the gene encoding alanine dehydrogenase comprises a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8.

[0012] As the microorganism according to any of the embodiments described above, the microorganism of the genus Corynebacterium may be Corynebacterium Petition 870250101709, dated 06 / 11 / 2025, p. 11 / 76 4 / 68 glutamicum.

[0013] As the microorganism according to any of the embodiments described above, the microorganism of the genus Corynebacterium may have an increased capacity for L-alanine production compared to an unmodified microorganism.

[0014] Another objective of the present description is to provide a method for producing L-alanine, including: culturing a microorganism of the genus Corynebacterium having a capacity for producing L-alanine, in which alanine dehydrogenase activity is introduced, in a medium.

[0015] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari.

[0016] In another embodiment, the method may further comprise recovering a target substance from the microorganism being cultured, a culture product of the microorganism, a fermented product of the microorganism, or the culture medium.

[0017] It is yet another objective of the present description to provide a composition for producing L-alanine including a microorganism of the genus Corynebacterium having an L-alanine production capacity, into which alanine dehydrogenase activity is introduced, a culture product Petition 870250101709, dated 06 / 11 / 2025, page 12 / 76 5 / 68 of the microorganism, a fermented product of the microorganism, or a combination of two or more of them.

[0018] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari.

[0019] It is yet another objective of the present description to provide the use of a microorganism of the genus Corynebacterium, in which alanine dehydrogenase activity is introduced, characterized by the fact that it is for the production of lalanine.

[0020] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari. [Beneficial Effects]

[0021] The microorganism of the genus Corynebacterium with the capacity to produce L-alanine, in which the activity of alanine dehydrogenase is introduced, of the present description can produce L-alanine in high yield and, therefore, can be effectively employed for the industrial production of L-alanine. [Detailed Description of Preferred Embodiment Forms]

[0022] The present description will be described in detail below. Meanwhile, each description and embodiment described in this document may be applied Petition 870250101709, dated 06 / 11 / 2025, page 13 / 76 6 / 68 to other descriptions and embodiments, respectively. That is, all combinations of the various elements described in this document fall within the scope of this description. Furthermore, the scope of this description is not limited by the specific description described below.

[0023] Furthermore, people with ordinary knowledge in the field may be able to recognize or confirm, using only conventional experimentation, many equivalents to the particular aspects of the invention described herein. Furthermore, it is also intended that these equivalents be included in the present description.

[0024] As used in the descriptive report and the attached claims, including the attached claims, the singular forms (a, an, and the) include plural referents unless the context clearly dictates otherwise. Unless the context requires otherwise, singular terms include the plural and plural terms include the singular. As used in the descriptive report and the attached claims, unless otherwise indicated, the use of or may be used to include and / or.

[0025] As used in this document, the term approximately may be displayed before a specific numeric value. The term approximately used Petition 870250101709, dated 06 / 11 / 2025, p. 14 / 76 7 / 68 in this document includes not only the exact number indicated after the term, but also a range that is close to or approximates that number. Considering the context in which the number is presented, it is possible to determine whether any number is close to or approximates the specific number presented. In one example, the term approximately might refer to a range of -10% to +10% of a numerical value. In another example, the term approximately might refer to a range of -5% to +5% of a given numerical value, but it is not limited to that.

[0026] As used in this document, descriptions such as the terms first, second, third^, i), ii), iii), or (a), (b), (c), (d)... are used to distinguish similar constitutions, and these terms do not mean that the constitutions are performed continuously or sequentially. For example, when the terms are used in reference to steps of a method, use, or trial, there may be no time interval between these steps, or they may be performed simultaneously, or they may be performed with a difference of several seconds, several minutes, several hours, several days, or several months.

[0027] As used in this document, the term consisting essentially of may mean that, in the event that the characteristics of the object claimed in this document are not substantially affected by Petition 870250101709, dated 06 / 11 / 2025, p. 15 / 76 8 / 68 presence of an unspecified component, the unspecified component may be present.

[0028] As used in this document, the term “consisting of” means that the total ratio of the specific component(s) is 100%. The components or features indicated after the term “consisting of” may be essential or mandatory. In some embodiments, in addition to the components or features indicated after the term “consisting of,” any other components or non-essential components may be excluded.

[0029] As used in this document, the term “comprising / including” means the presence of features, steps or components indicated after the term, and does not exclude the presence or addition of one or more features, steps or components. The components or features indicated after the term “comprising / including” in this document may be essential or mandatory. However, in some embodiments, the term may also include any other non-essential components or features.

[0030] One aspect of the present description provides a microorganism of the genus Corynebacterium with an L-alanine production capacity, into which alanine dehydrogenase activity is introduced. Petition 870250101709, dated 06 / 11 / 2025, page 16 / 76 9 / 68

[0031] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari.

[0032] Alanine dehydrogenase activity can be defined as an increased capacity for L-alanine production of the microorganism into which the alanine dehydrogenase activity is introduced, as described herein, compared with the L-alanine production capacity of a natural wild-type microorganism or an unmodified microorganism (e.g., a strain before the alanine dehydrogenase activity of the present description is introduced), but is not limited to that.

[0033] For example, alanine dehydrogenase activity can be assessed by measuring the capacity or yield of L-alanine production, but it is not limited to that.

[0034] As used in this document, the term “alanine dehydrogenase” may refer to an oxidation-reduction enzyme that catalyzes a reversible conversion of alanine from pyruvate with a coenzyme NAD+ / NADH.

[0035] Specifically, the alanine dehydrogenase of the present description may be a protein possessing alanine dehydrogenase activity encoded by the aldl, ald2, or alaD gene, but its type is not particularly limited, provided the protein possesses activity. Petition 870250101709, dated 06 / 11 / 2025, page 17 / 76 10 / 68 corresponding to the activity of alanine dehydrogenase, and whose activity is introduced into a microorganism of the genus Corynebacterium, thus increasing the capacity for L-alanine production. The alanine dehydrogenase encoded by the aldl, ald2, or alaD gene is known in the art, and the amino acid and polynucleotide sequences of alanine dehydrogenase can be obtained from a known database, such as the NCBI GenBank, etc., but are not limited to these.

[0036] In the present description, the alanine dehydrogenase may be an alanine dehydrogenase derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari, but is not limited to these.

[0037] In one example of the present description, alanine dehydrogenase derived from Bacillus licheniformis may be a protein comprising the amino acid sequence SEQ ID NO: 1 or SEQ ID NO: 3, but is not limited to that. Alanine dehydrogenase derived from Bacillus amyloliquefaciens may be a protein comprising the amino acid sequence SEQ ID NO: 5, but is not limited to that. Alanine dehydrogenase derived from Laceyella sacchari may be a protein comprising the amino acid sequence SEQ ID NO: 7, but is not limited to that.

[0038] For example, the protein that has alanine dehydrogenase activity in the present description may be a Petition 870250101709, dated 06 / 11 / 2025, page 18 / 76 11 / 68 protein comprising the amino acid sequence of alanine dehydrogenase derived from Bacillus licheniformis (SEQ ID NO: 1 or SEQ ID NO: 3), the amino acid sequence of alanine dehydrogenase derived from Bacillus amyloliquefaciens (SEQ ID NO: 5) or the amino acid sequence of alanine dehydrogenase derived from Laceyella sacchari (SEQ ID NO: 7), but not limited to these.

[0039] In one example, alanine dehydrogenase may comprise the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, or an amino acid sequence that has 60% or more homology with respect to them, but is not limited to them as long as it possesses alanine dehydrogenase activity. Specifically, a polypeptide possessing alanine dehydrogenase activity may have, comprise, consist of, or consist essentially of the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7; or an amino acid sequence that has at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with respect to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7.

[0040] With respect to the amino acid sequences in the present description, although it is described as a polypeptide “comprising / including” an amino acid sequence described by a specific sequence number, Petition 870250101709, dated 06 / 11 / 2025, p. 19 / 76 12 / 68 a polypeptide “consisting of an amino acid sequence described by a specific sequence number, or a polypeptide or protein “with an amino acid sequence described by a specific sequence number, it is evident that any protein having an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted or added may fall within the scope of the present description if it has identical or corresponding activity to the protein consisting of the amino acid sequence of the corresponding sequence number.For example, upstream or downstream sequence additions to amino acid sequences that do not alter protein function, naturally occurring mutations, silent mutations of the same, or conservative substitutions are not excluded, provided that the protein has identical or corresponding activity to the activity of the modified protein, it being evident that such sequence additions or mutations fall within the scope of the present description.

[0041] For example, this could be cases of sequence additions that do not alter the function of the variant polypeptide of the present description, naturally occurring mutations, silent mutations thereof, or conservative substitutions at the N-terminus, C-terminus, and / or within amino acid sequences. For example, the Petition 870250101709, dated 06 / 11 / 2025, p. 20 / 76 13 / 68 Polypeptides can be conjugated to a signal (or leader) sequence at the N-terminus involved in co-translational or post-translational protein translocation. Furthermore, polypeptides can also be conjugated to another sequence or linking agent to identify, purify, or synthesize the polypeptides.

[0042] As used in this document, the term “conservative substitution” refers to the substitution of one amino acid for another amino acid that has similar structural and / or chemical properties. Such amino acid substitution can generally occur based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of a residue. Amino acids can be classified into the following groups:

[0043] In one example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another example, Petition 870250101709, dated 06 / 11 / 2025, page 21 / 76 14 / 68 amino acids that have electrically charged side chains (electrically charged amino acids) include arginine, lysine, histidine, glutamic acid, and aspartate; and amino acids that have uncharged side chains (uncharged amino acids; also called neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In yet another example, aromatic amino acids include phenylalanine, tryptophan, and tyrosine. In yet another example, branched-chain amino acids include valine, leucine, and isoleucine.In another example, the 20 amino acids can be classified according to their size into 5 groups, starting with the groups of amino acids with relatively small volume, namely glycine, alanine, serine; cysteine, proline, threonine, aspartate, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine, but the classification of amino acids is not limited to this. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide.

[0044] Furthermore, the nucleotide sequence that codes for alanine dehydrogenase may be a nucleotide sequence that codes for a protein that exhibits alanine dehydrogenase activity and whose activity is Petition 870250101709, dated 06 / 11 / 2025, page 22 / 76 15 / 68 introduced into a microorganism of the genus Corynebacterium, thereby increasing the capacity for L-alanine production. For example, it could be a nucleotide sequence encoding alanine dehydrogenase derived from Bacillus licheniformis (SEQ ID NO: 1 or SEQ ID NO: 3), alanine dehydrogenase derived from Bacillus amyloliquefaciens (SEQ ID NO: 5), or alanine dehydrogenase derived from Laceyella sacchari (SEQ ID NO: 7), but it is not limited to these.

[0045] For example, L-alanine dehydrogenase with the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 may be encoded by a polynucleotide that may have, comprise, consist of, or consist essentially of a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, or a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, but it is not limited to that. Furthermore, the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8 can be obtained from a known database, such as NCBI's GenBank, etc., but it is not limited to that.

[0046] In the present description, for example, the gene comprising the nucleotide sequence SEQ ID NO: 2, Petition 870250101709, dated 06 / 11 / 2025, page 23 / 76 16 / 68 SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8 can be used interchangeably with a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, a gene or polynucleotide with the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, and a gene or polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8.

[0047] The polynucleotide of the present description may undergo various modifications in the coding region without altering the amino acid sequence of the alanine dehydrogenase of the present description, due to codon degeneracy or in consideration of preferred codons in an organism in which the alanine dehydrogenase of the present description will be expressed. Thus, based on codon degeneracy, it is evident that polynucleotides that can be translated into polypeptides consisting of the amino acid sequence of the alanine dehydrogenase of the present description or into polypeptides that possess homology or identity with respect to it may also be included. For example, the polynucleotide of the present description may be SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8; or a degenerate sequence thereof.

[0048] In addition, the polynucleotide of the present Petition 870250101709, dated 06 / 11 / 2025, page 24 / 76 17 / 68 description may include a probe that can be prepared from a known gene sequence, for example, any polynucleotide sequence that can hybridize with a sequence complementary to all or part of the polynucleotide sequence of the present description under stringent conditions to encode alanine dehydrogenase of the present description without limitation.

[0049] As used in this document, the term homology or identity refers to the degree of relatedness between two given amino acid or nucleotide sequences, and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0050] Homology or sequence identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms and can be used in conjunction with a standard gap penalty established by the program used. In general, substantially homologous or identical sequences are normally expected to hybridize in all or at least about 50%, 60%, 70%, 80%, or 90% of the total sequence length under moderate or highly stringent conditions. Polynucleotides containing degenerate codons in place of hybridizing polynucleotide codons may also be considered. Petition 870250101709, dated 06 / 11 / 2025, p. 25 / 76 18 / 68

[0051] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined by a known computational algorithm, such as the “FASTA” program, using standard parameters as described in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is executed using the Needleman program from the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later) (GCG program package, Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J. Mol. Biol. 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J. Applied Math 48:1073).For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information.

[0052] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using, for example, the GAP computer program, as described in Needleman et al. (1970), J. Mol. Biol. 48:443, and in Smith and Petition 870250101709, dated 06 / 11 / 2025, page 26 / 76 19 / 68 Waterman, Adv. Appl. Math. (1981) 2:482. In summary, the GAP program defines homology, similarity, or identity as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the smaller of the two sequences. The standard parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix (or EDNAFULL substitution matrix - EMBOSS version of NCBI NUC4.4) from Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as described in Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp.353 — 358 (1979); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for gaps at the ends.

[0053] Furthermore, whether any two polynucleotide or polypeptide sequences possess homology, similarity, or identity can be determined by comparing the sequences through Southern hybridization experiments under defined, rigorous conditions, and the appropriate hybridization conditions to be defined. Petition 870250101709, dated 06 / 11 / 2025, page 27 / 76 20 / 68 can be determined by a method within the scope of the present description, known to a person skilled in the art (for example, J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor). Laboratory Press, Cold Spring Harbor, NY, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but it is not limited to that.

[0054] As used in this document, “strict conditions” refers to conditions that permit specific hybridization between polynucleotides. Such conditions are described in detail in the literature (e.g., J. Sambrook et al., supra). For example, strict conditions may include conditions under which polynucleotides possessing high homology or identity, polynucleotides possessing 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more hybridize with each other, while polynucleotides possessing lower homology or identity than those above do not hybridize with each other; or they may comprise usual Southern hybridization washing conditions, i.e., washing once, specifically two or three times, at a saline concentration and temperature corresponding to 60 °C, 1XSSC, 0.1% SDS, specifically 60 °C, 0.1*SSC, 0.1% SDS, Petition 870250101709, dated 06 / 11 / 2025, p. 28 / 76 21 / 68 and more specifically 68 °C, 0.1*SSC, 0.1% SDS.

[0055] Hybridization requires that two nucleotides have complementary sequences, although base mismatches are possible depending on the degree of rigor of the hybridization. The term complementary is used to describe a relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Thus, the present description may also include an isolated nucleic acid fragment complementary to the complete sequence, as well as a base sequence substantially similar to it.

[0056] For example, polynucleotides that have homology or identity with the polynucleotide of the present description can be detected using hybridization conditions that include a hybridization step at a Tm value of 55 °C under the conditions described above. In addition, the Tm value can be 60 °C, 63 °C or 65 °C, but is not limited to these, and can be appropriately adjusted by a person skilled in the art, depending on their purpose.

[0057] The appropriate degree of rigor for polynucleotide hybridization depends on the length and degree of complementarity of the polynucleotides, and these variables Petition 870250101709, dated 06 / 11 / 2025, page 29 / 76 22 / 68 are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7—11.8).

[0058] As used in this document, the term "Lalanine" refers to an L-amino acid with the chemical formula HO2CCH(NH2)CH3, which is one of the essential amino acids.

[0059] As used in this document, the term “microorganism (or strain)” includes all wild-type microorganisms, or microorganisms that have been genetically modified naturally or artificially, and may be a microorganism in which a particular mechanism is weakened or enhanced due to the insertion of an exogenous gene, or the increase or inactivation of the activity of an endogenous gene, etc., and may be a microorganism that includes genetic modification to produce a desired polypeptide, protein, or product. In the present description, “microorganism” and “strain” have the same meaning and may be used interchangeably without limitation.

[0060] For example, the microorganism in the present description may be a microorganism into which alanine dehydrogenase activity is introduced (e.g., a recombinant strain), but is not limited to this.

[0061] As used in this document, the term microorganism possessing the capacity to produce L-alanine” refers to a prokaryotic or eukaryotic microbial strain capable of producing L-alanine in an organism. Petition 870250101709, dated 06 / 11 / 2025, page 30 / 76 23 / 68 may include all microorganisms in which an L-alanine production capacity has been conferred upon a parental strain that did not possess L-alanine production capacity, or microorganisms that endogenously possess an L-alanine production capacity. The L-alanine production capacity may be conferred or enhanced by breeding the species.

[0062] As used in this document, the term “unmodified microorganism” does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may refer to the wild-type or natural-type strain itself, or to a strain before its character is altered due to genetic modification caused by natural or artificial factors. “Unmodified microorganism” may be used interchangeably with “pre-modification strain,” “microorganism before modification,” “non-mutant strain,” “unmodified strain,” “non-mutant microorganism,” “parental strain before mutation,” “wild-type microorganism,” “reference microorganism,” or “standard microorganism.” In the present description, “unmodified microorganism” may refer to a strain in which alanine dehydrogenase activity is not introduced, or to a strain before the introduction of alanine dehydrogenase, but is not limited to that.Furthermore, in the present description, the unmodified microorganism may be... Petition 870250101709, dated 06 / 11 / 2025, p. 31 / 76 24 / 68 a microorganism that does not understand the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, but is not limited to that.

[0063] For the purposes of this description, the microorganism of this description may include all microorganisms capable of producing the desired L-alanine through the introduction of alanine dehydrogenase activity. For example, the microorganism of this description is distinguished by the fact that alanine dehydrogenase activity is introduced, thereby increasing the capacity to produce L-alanine, and may be a genetically modified microorganism or a recombinant microorganism, but is not limited to these. Specifically, the recombinant strain with an increased capacity to produce L-alanine may be a microorganism possessing an increased capacity to produce L-alanine compared to a natural wild-type microorganism or an unmodified microorganism possessing endogenous alanine dehydrogenase activity, but is not limited to these.

[0064] In one example, the microorganism that has the capacity to produce L-alanine, which is a prokaryotic or eukaryotic microbial strain capable of producing L-alanine in an organism, may include all of Petition 870250101709, dated 06 / 11 / 2025, page 32 / 76 25 / 68 microorganisms that endogenously possess the capacity to produce L-alanine, or microorganisms in which the capacity to produce L-alanine has been conferred upon a parental strain that did not possess the capacity to produce L-alanine by the activity of alanine dehydrogenase introduced in the present description. The capacity to produce L-alanine can be conferred or increased by breeding the species.

[0065] The microorganism of the present description may include all microorganisms in which alanine dehydrogenase activity is introduced by various known methods.

[0066] As used in this document, the term “introduction of activity” means that a gene not originally possessed by a microorganism is expressed in the microorganism and, thus, the microorganism exhibits the activity of a specific protein, or the activity of a polypeptide is intensified, increased, or improved compared to the endogenous activity of the corresponding protein or to the activity prior to the modification. For example, the term may indicate that a polynucleotide encoding a specific protein is introduced into the chromosome of a microorganism, or that a vector containing a polynucleotide encoding a specific protein is introduced into a microorganism, thus exhibiting the activity. Petition 870250101709, dated 06 / 11 / 2025, page 33 / 76 26 / 68 of the specific protein.

[0067] “Endogenous activity” refers to the activity of a specific polypeptide originally possessed by a parental strain before transformation or by an unmodified microorganism, when a characteristic is altered by genetic variation due to a natural or artificial factor. Endogenous activity can also be used interchangeably with “activity before modification.”

[0068] As used in this document, the term “enhancement of polypeptide activity” means that the activity of a polypeptide is increased compared to its endogenous activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, increase, etc.

[0069] In particular, activation, enhancement, upregulation, overexpression, or augmentation may include both instances where an activity not originally possessed is exhibited and instances where an activity is enhanced compared to endogenous activity or activity prior to modification. “Enhancement,” “upregulation,” “overexpression,” or “increase in the activity of a polypeptide compared to endogenous activity” means that the polypeptide activity is enhanced compared to the activity and / or concentration (level of Petition 870250101709, dated 06 / 11 / 2025, page 34 / 76 27 / 68 expression) of a specific polypeptide originally possessed by a parental strain before transformation or by an unmodified microorganism. For example, the term “activity not originally possessed is exhibited” may refer to the “introduction of a protein,” but is not limited to that.

[0070] Enhanced polypeptide activity, compared to endogenous activity, means that the polypeptide activity is increased compared to the activity and / or concentration (expression level) of a specific polypeptide originally possessed by a parent strain before transformation or by an unmodified microorganism.

[0071] In one example, enhancement may mean that the activity of a corresponding protein not originally possessed is exhibited, or that its activity or concentration is increased generally by about 1%, about 10%, about 25%, about 50%, about 75%, about 100%, about 150%, about 200%, about 300%, about 400% or about 500%, at most about 1000% or about 2000% or more, based on the activity or concentration of a wild-type protein or an initial microbial strain, but not limited to that.

[0072] The intensification of polypeptide activity can be achieved by introducing a polypeptide Petition 870250101709, dated 06 / 11 / 2025, page 35 / 76 28 / 68 exogenous or by the intensification of the activity of an endogenous polypeptide. Whether or not the polypeptide activity is intensified can be confirmed from the activity level of the corresponding polypeptide, its expression level, or the increase in the amount of products produced from the corresponding polypeptide. As used in this document, the term “approximately” refers to a range that includes all ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values ​​equivalent to those that immediately follow the term “approximately” or those in a similar range, but is not limited to them.

[0073] Enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether or not the polypeptide activity is enhanced can be confirmed from the activity level of the corresponding polypeptide, its expression level, or the increase in the amount of products produced from the corresponding polypeptide.

[0074] Enhancing polypeptide activity can be achieved by several well-known methods in the art, and is not limited as long as it can enhance the activity of a target polypeptide compared to that of Petition 870250101709, dated 06 / 11 / 2025, page 36 / 76 29 / 68 microorganism before modification. Specifically, genetic engineering and / or protein engineering, well known to those skilled in the art and which are common molecular biology methods, can be used, but the method is not limited to this (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, pp. 1-16; Sambrook et al., Molecular Cloning, 2012, etc.).

[0075] Specifically, the intensification of the polypeptide described herein can be achieved by: 1) an increase in the number of intracellular copies of a polynucleotide that codes for the polypeptide; 2) modification of the regulatory region of expression of a gene that encodes the polypeptide on the chromosome (for example, by inducing a modification within the regulatory region of expression, replacing it with a sequence that has stronger activity, or inserting a sequence that has stronger activity); 3) modification of the nucleotide sequence that codes for the initiation codon or the 5'-UTR of the gene transcript that codes for the polypeptide; 4) modification of the amino acid sequence of the polypeptide so that the activity of the polypeptide is enhanced; 5) modification of the polynucleotide sequence that Petition 870250101709, dated 06 / 11 / 2025, page 37 / 76 30 / 68 encodes the polypeptide in such a way that the activity of the polypeptide is enhanced (for example, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide); 6) introduction of an exogenous polypeptide that exhibits the activity of the polypeptide or of an exogenous polynucleotide that encodes it; 7) Codon optimization of a polynucleotide that codes for the polypeptide; 8) analysis of the polypeptide's tertiary structure and, thus, selection and modification of the exposed site, or chemical modification thereof; or 9) a combination of two or more items selected from 1) to 8) above, but not particularly limited to this.

[0076] Method 1) of increasing the number of intracellular copies of a polynucleotide encoding the polypeptide can be achieved by introducing into a host cell a vector that is functionally linked to the polynucleotide encoding the polypeptide and that is capable of replicating and functioning independently of a host cell. Alternatively, the method can be achieved by introducing one or two copies of polynucleotides encoding the polypeptide into the chromosome. Petition 870250101709, dated 06 / 11 / 2025, page 38 / 76 31 / 68 of a host cell. Introduction into the chromosome can be achieved by introducing a vector capable of inserting the polynucleotide into the chromosome of a host cell, but it is not limited to this. The vector is as described above.

[0077] Method 2) of replacing the expression regulatory region (or expression regulatory sequence) of a gene encoding the polypeptide on the chromosome with a sequence possessing strong activity can be performed, for example, by inducing a modification in the sequence through deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or by replacing the sequence with a sequence possessing stronger activity. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating transcription and translation termination, etc. In one example, the method may include, but is not limited to, replacing the original promoter with a strong promoter.

[0078] Examples of known strong promoters may include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, Petition 870250101709, dated 06 / 11 / 2025, page 39 / 76 32 / 68 SPL7 promoter, SPL13 (sm3) promoter (US 10584338 B2), O2 promoter (US 10273491 B2), tkt promoter, yccA promoter, etc., but the strong promoter is not limited to these.

[0079] Method 3) of modifying the nucleotide sequence encoding the initiation codon or the 5'-UTR of the gene transcript encoding the polypeptide can be performed, for example, by replacing the nucleotide sequence with a nucleotide sequence encoding another initiation codon that has a higher polypeptide expression rate compared to the endogenous initiation codon, but is not limited to this.

[0080] Methods 4) and 5) of modifying the amino acid sequence or polynucleotide sequence can be performed by inducing a sequence modification through deletion, insertion, non-conservative or conservative substitution of the polypeptide amino acid sequence or the polynucleotide sequence encoding the polypeptide, or a combination thereof, to enhance the polypeptide activity, or by replacing the sequence with an amino acid sequence or polynucleotide sequence modified to have stronger activity, or an amino acid or polynucleotide sequence modified to enhance activity, but not limited to these. The substitution can be specifically performed by inserting the polynucleotide into Petition 870250101709, dated 06 / 11 / 2025, page 40 / 76 33 / 68 chromosome by homologous recombination, but is not limited to this. The vector used in this document may additionally include a selection marker to confirm insertion into the chromosome. The selection marker is as described above.

[0081] Method 6) of introducing an exogenous polynucleotide that exhibits polypeptide activity can be performed by introducing into a host cell an exogenous polynucleotide encoding a polypeptide that exhibits activity equal to or similar to that of the polypeptide. The exogenous polynucleotide can be used without limitation, regardless of its origin or sequence, provided it exhibits activity equal to or similar to that of the polypeptide. The introduction can be performed by a person of ordinary skill in the art by appropriate selection of a transformation method known in the art, and the expression of the introduced polynucleotide in the host cell enables the production of the polypeptide, thereby increasing its activity.

[0082] Method 7) of optimizing codons of the polynucleotide encoding the polypeptide can be performed by optimizing codons of an endogenous polynucleotide to increase transcription or translation within a host cell, or by optimizing its codons so that the transcription and translation of the polypeptide is optimized. Petition 870250101709, dated 06 / 11 / 2025, page 41 / 76 34 / 68 exogenous polynucleotides can be achieved within the host cell.

[0083] Method 8) for analyzing the tertiary structure of the polypeptide and thus selecting and modifying the exposed site, or chemically modifying it, can be performed, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, to determine model protein candidates according to the degree of sequence similarity and thus confirm the structure based on the information, selecting and transforming or modifying the exposed site to be modified or chemically modified.

[0084] Such intensification of polypeptide activity may mean that the activity or concentration (expression level) of the corresponding polypeptide is increased relative to the activity or concentration of a polypeptide expressed in a wild-type strain or in a microorganism before modification, or that the amount of products produced from the corresponding polypeptide is increased, but is not limited to that.

[0085] In one example, the recombinant microorganism that has the capacity to produce L-alanine may include all microorganisms that can be transformed by means of a vector and thus capable of producing L-alanine. Petition 870250101709, dated 06 / 11 / 2025, page 42 / 76 35 / 68 by the introduction of an exogenous gene encoding alanine dehydrogenase as described herein, specifically, an exogenous gene encoding alanine dehydrogenase derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari.

[0086] For the purposes of this description, the microorganism may be a microorganism in which alanine activity is enhanced compared to endogenous activity by including an expression vector to express the exogenous polynucleotide in a host cell, but is not limited to this.

[0087] The vector of the present description may include a DNA construct containing the nucleotide sequence of a polynucleotide encoding the target polypeptide functionally linked to a suitable regulatory expression region (regulatory expression sequence), so as to allow expression of the target polypeptide in a suitable host cell. The regulatory expression region may include a promoter capable of initiating transcription, any operator sequence to regulate transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence to regulate transcription and translation termination. Once transformed into a suitable host cell, the vector may replicate or function independently of the host genome, or Petition 870250101709, dated 06 / 11 / 2025, page 43 / 76 36 / 68 can integrate into the same genome.

[0088] The vector used in the present description is not particularly limited, and any vector known in the art may be used. Examples of vectors typically used may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., may be used; and as a plasmid vector, those based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pSK, pSKH, and pET, etc., may be used. Specifically, the vectors pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, etc. can be used.

[0089] In one example, a polynucleotide encoding a target polypeptide can be inserted into the chromosome using a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome can be performed by any method known in the art, for example, by homologous recombination, but is not limited to this. The vector may additionally include a selection marker to confirm insertion into the chromosome. The selection marker serves to select the cells transformed with the vector, that is, to confirm whether the target nucleic acid molecule was inserted, and can be used Petition 870250101709, dated 06 / 11 / 2025, page 44 / 76 37 / 68 markers that confer selectable phenotypes, such as drug resistance, auxotrophy, resistance to cellular toxic agents, or expression of surface polypeptides. Only cells expressing the selection marker are able to survive or exhibit different phenotypes in an environment treated with the selective agent, and thus the transformed cells can be selected.

[0090] As used in this document, the term “transformation” refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism, so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. As long as the transformed polynucleotide can be expressed in the host cell, it does not matter whether the transformed polynucleotide is integrated into the host cell's chromosome and located there or located extrachromosomally, and both cases may be included. Furthermore, the polynucleotide may include DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form, provided it can be introduced into the host cell and expressed therein.For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct that includes all the elements necessary for its autonomous expression. Petition 870250101709, dated 06 / 11 / 2025, page 45 / 76 38 / 68 expression cassettes may commonly include a functionally polynucleotide-linked promoter, a transcription terminator, a ribosome binding site, or a translation terminator. The expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell as is and functionally linked to sequences necessary for expression in the host cell, but is not limited to this.

[0091] As used in this document, the term “functionally linked” refers to the constitution in which a regulatory sequence is placed in an appropriate position to regulate the expression of a coding sequence. Thus, the term “functionally linked” includes the linkage between a regulatory region or functional domain that possesses a known or desired activity, such as a promoter, a stop codon, a signal sequence, or an enhancer, and a target (gene or polypeptide), such that the expression, secretion, or function of the target can be regulated according to the known or desired activity. For example, it may mean that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of the polynucleotide encoding the target variant polypeptide of the present description. Petition 870250101709, dated 06 / 11 / 2025, p. 46 / 76 39 / 68

[0092] As used in this document, the term “expression” includes any step involved in the production of a polypeptide, for example, transcription, post-transcriptional modification, translation, post-translational modification and secretion, etc., but is not limited to these.

[0093] As used in this document, the term “expression vector” refers to a linear or circular nucleic acid molecule that includes a coding sequence and a functionally linked regulatory sequence for its expression.

[0094] As used in this document, the term “regulatory sequence” refers to a polynucleotide sequence required for the expression of a coding sequence. Each regulatory sequence can be native (derived from the same source) or exogenous (derived from different genes) in relation to the coding sequence. Examples of regulatory sequences may include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence to regulate transcription and translation termination. The smallest units of the regulatory sequence may include a promoter and a sequence for transcription and translation termination. Petition 870250101709, dated 06 / 11 / 2025, page 47 / 76 40 / 68

[0095] As used in this document, the term “recombinant,” in relation to a cell, polynucleotide, polypeptide, or vector, indicates that the cell, polynucleotide, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide, or by alteration of a native polynucleotide or polypeptide, or that the cell is derived from such a modified cell. Therefore, for example, recombinant cells may express genes that are not found in the native (non-recombinant) form of the cells, or may express native genes that would otherwise be abnormally expressed, underexpressed, or not expressed at all.

[0096] For example, the microorganism for L-alanine production may be a microorganism in which a sequence encoding a protein consisting of the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or a protein consisting of an amino acid sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with respect to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, is inserted.

[0097] For example, the microorganism for L-alanine production may be a microorganism that endogenously comprises a nucleotide sequence capable of Petition 870250101709, dated 06 / 11 / 2025, p. 48 / 76 41 / 68 encode a protein comprising an amino acid sequence having at least 80% homology with respect to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8; and a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with respect to the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.

[0098] In one example, the microorganism with an increased capacity for L-alanine production of the present description may be a microorganism with an increased capacity for L-alanine production compared to, but is not limited to, an unmodified microorganism. In one example, the unmodified microorganism that is the target strain for comparison of the increased capacity for L-alanine production may be, but is not limited to, strain ATCC13869.

[0099] In one example, the microorganism with an increased capacity for L-alanine production may possess an increased capacity for L-alanine production of approximately 150% or more, specifically approximately 150% or more, approximately 200% or more, approximately 250% or more, approximately 260% Petition 870250101709, dated 06 / 11 / 2025, page 49 / 76 42 / 68 or more, approximately 270% or more, approximately 280% or more, approximately 290% or more, approximately 300% or more, approximately 310% or more, approximately 320% or more, approximately 325% or more, approximately 326% or more, approximately 327% or more, approximately 328% or more, approximately 329% or more, approximately 330% or more, approximately 331% or more, approximately 332% or more, approximately 333% or more, approximately 334% or more, approximately 335% or more, or approximately 336% or more (the upper limit is not particularly restricted, for example, approximately 1000% or less, approximately 500% or less, approximately 400% or less, approximately 390% or less, approximately 380% or less, approximately 370% or less, approximately 360% or less, approximately 350% or less, or approximately 340% or less), compared to the L-alanine production capacity of a parent strain before modification or of an unmodified microorganism, but not limited to that,provided that it possesses an increased value compared to the production capacity of a parent strain before modification or of an unmodified microorganism. In another example, the microorganism with an increased capacity for L-alanine production may possess an increased capacity for L-alanine production of approximately 1.5 times or more, approximately 2 times or more, approximately 2.5 times or more, approximately 2.6 times or more, approximately 2.7 times or more, approximately 2.8 times or more, approximately 2.9 times or more, approximately 3 times or more, approximately 3.1 times, Petition 870250101709, dated 06 / 11 / 2025, p. 50 / 76 43 / 68 or more, about 3.2 times or more, 3.26 times or more, about 3.3 times or more, or about 3.36 times or more (the upper limit is not particularly restricted, for example, about 10 times or less, about 5 times or less, about 4 times or less, about 3.7 times or less, about 3.5 times or less, or about 3.4 times or less), compared to the lalanine production capacity of a parent strain before modification or of an unmodified microorganism, but not limited to that.

[00100] In one example, the microorganism capable of producing L-alanine can be a prokaryotic cell or a eukaryotic cell, but it can specifically be a prokaryotic cell. The prokaryotic cell can include, for example, a microbial strain belonging to the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, the genus Pseudomonas, the genus Leptospira, the genus Salmonella, the genus Brevibacteria, the genus Hypomononas, the genus Chromobacterium, and the genus Norcardia, or fungi or yeasts. Specifically, the microorganism can be a microbial strain belonging to the genus Escherichia, the genus Corynebacterium, the genus Leptospira, and yeasts. More specifically, it can be a microbial strain belonging to the genus Corynebacterium.

[00101] As the microorganism according to any Petition 870250101709, dated 06 / 11 / 2025, page 51 / 76 44 / 68 In one of the embodiments described above, the microorganism of the present description may be a microorganism of the genus Corynebacterium.

[00102] In an example, the microorganism of the present description may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens. Specifically, the microorganism of the present description may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum or Corynebacterium stationis, but is not limited to that.

[00103] However, although it is already known that microorganisms of the genus Corynebacterium can produce L-alanine, they have a significantly low capacity for L-alanine production, and the gene involved in the production mechanism or the principle of the mechanism is unknown. Consequently, the microorganism of the genus Corynebacterium capable of producing L-alanine in the present description may include all of the following: a wild microorganism of the genus Corynebacterium itself; a Petition 870250101709, dated 06 / 11 / 2025, page 52 / 76 45 / 68 a microorganism of the genus Corynebacterium in which the activity of the gene associated with the mechanism of L-alanine production is increased or inactivated, thus having the capacity to produce L-alanine; or a microorganism of the genus Corynebacterium in which the activity of a foreign gene is introduced or increased, thus having the capacity to produce L-alanine.

[00104] The L-alanine-producing microorganism described herein may be, but is not limited to, an L-alanine-producing microorganism with increased alanine dehydrogenase activity.

[00105] The microorganism of the present description may include all microorganisms in which the introduced alanine dehydrogenase activity is further increased by means of various methods in the art.

[00106] Another aspect of the present description provides a method for producing L-alanine, comprising: culturing the microorganism of the genus Corynebacterium which has the capacity to produce L-alanine, in which the alanine dehydrogenase activity of the present description is introduced into a medium.

[00107] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari. Petition 870250101709, dated 06 / 11 / 2025, page 53 / 76 46 / 68

[00108] As used in this document, the term “culture” means that the strain of the present description is subjected to culture formation under suitably controlled environmental conditions. The culture process of the present description can be carried out in a culture medium and under suitable culture conditions known in the art. Such a culture process can be easily adjusted for use by a person skilled in the art, according to the strain to be selected. Specifically, the culture can be a batch culture, continuous culture and / or fed-batch culture, but is not limited to these.

[00109] As used in this document, the term “medium” refers to a mixture of materials that contains as its main ingredient nutritive substances necessary for the culture of the microorganism described herein, and provides nutritive materials and growth factors, along with water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for the culture of the strain described herein may be any media used for the conventional culture of microorganisms, without any specific limitation. However, the microorganism described herein may be cultured under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, source Petition 870250101709, dated 06 / 11 / 2025, page 54 / 76 47 / 68 of phosphorus, inorganic compound, amino acid and / or vitamin, adjusting temperature, pH, etc. For example, the culture medium for microorganisms of the genus Corynebacterium can be found in the literature [“Manual of Methods for General Bacteriology of the American Society for Bacteriology (Washington DC, USA, 1981)].

[00110] In the present description, the carbon source may comprise carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, etc.; sugar alcohols, such as mannitol, sorbitol, etc.; organic acids, such as pyruvic acid, lactic acid, citric acid, etc.; amino acids, such as glutamic acid, methionine, lysine, etc. In addition, the carbon source may comprise natural organic nutrients, such as starch hydrolysate, molasses, cane molasses, rice bran, cassava, sugarcane molasses, and fermented corn liquor, etc. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted to reducing sugar) may be used, and, in addition, various other carbon sources in appropriate quantities may be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited to this.

[00111] The nitrogen source may comprise inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, phosphate Petition 870250101709, dated 06 / 11 / 2025, page 55 / 76 48 / 68 ammonium, ammonium carbonate, ammonium nitrate, etc.; amino acids, such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources, such as peptone, NZamine, meat extract, yeast extract, malt extract, fermented corn liquor, casein hydrolysate, fish or its decomposition product, defatted soybean meal or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited to them.

[00112] The phosphorus source may comprise monopotassium phosphate, dipotassium phosphate, or the corresponding sodium-containing salts, etc. Examples of inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or appropriate precursors, etc., may be included. These constituent ingredients or precursors may be added to a medium in batch or continuous form, but these phosphorus sources are not limited to this.

[00113] In addition, the pH of the medium can be adjusted by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., during the microorganism culture. Petition 870250101709, dated 06 / 11 / 2025, pp. 56 / 76 49 / 68 present description, in an appropriate manner. Additionally, bubble formation can be prevented during culture by using an antifoaming agent, such as fatty acid polyglycol ester. Furthermore, oxygen gas or a gas containing oxygen can be injected into the medium to maintain aerobic conditions; or nitrogen gas, hydrogen gas, or carbon dioxide can be injected to maintain anaerobic or microaerobic conditions without gas injection, but the use of gas is not limited to this.

[00114] The temperature during the culture of the present description may be in the range of 27 °C to 37 °C, specifically 30 °C to 33 °C, and the culture may be continued for 20 hours to 120 hours, but is not limited to this.

[00115] As used in this document, the term “culture product” means a culture solution, a concentrated culture solution, a dried product of a culture solution, a culture filtrate, a concentrated culture filtrate, or a dried product of a culture filtrate obtained by culturing a specific microorganism in a culture medium, and means that the culture solution may include the specific microorganism, while the culture filtrate does not substantially include the specific microorganism (in particular, it means substantially excluding a specific microorganism). Petition 870250101709, dated 06 / 11 / 2025, pp. 57 / 76 50 / 68 isolated by filtration etc., but this does not mean that the microorganism is completely excluded from the filtrate). The formulation of the culture product is not limited and may be, for example, liquid, emulsion or solid. Specifically, for the purposes of this description, the culture product may comprise L-alanine.

[00116] As used in this document, the term “fermentation” means that microorganisms are not putrefactive during the process of decomposing organic matter using their own enzymes. The fermentation reaction and the decomposition reaction occur through similar processes, but when decomposition produces useful substances, it is called fermentation, and when it produces odorous or harmful substances, it is called decomposition.

[00117] In the present description, the method for obtaining a fermented product from the strain is not particularly limited and can be obtained according to a method commonly used in the art or in similar fields.

[00118] As used in this document, the term “fermented product” may include not only the fermented material itself, but also all types of materials that comprise fermented products produced from the strain, such as a culture medium of the strain in which the strain and the Petition 870250101709, dated 06 / 11 / 2025, pp. 58 / 76 51 / 68 cultures coexist; a fermented product produced from the culture medium; a fermented product obtained by filtering the strain from the culture medium; a fermented product obtained by sterilizing the strain from the culture medium and subsequent filtration; an extract obtained by extracting the fermented product or the culture medium containing it; a diluted solution obtained by diluting the fermented product or an extract thereof; a concentrated solution; a dry product obtained by drying the fermented product or an extract thereof; and a lysate obtained by collecting and lysing the cells of the strain, etc.

[00119] In the method described herein, the microorganism culture can be carried out under any culture conditions and culture methods known in the art. Such a culture process can be easily adjusted and used by a person skilled in the art according to the selected strain.

[00120] The L-alanine produced by the culture described herein can be released into the medium or remain in the cells.

[00121] In one embodiment, the method for producing L-alanine of the present description may further comprise a step for preparing the microorganism of the present description, a step for preparing a medium for culturing the strain, or a combination thereof. Petition 870250101709, dated 06 / 11 / 2025, page 59 / 76 52 / 68 (regardless of the order, in any order), for example, before the culture stage.

[00122] The method for producing L-alanine described herein may further comprise a step for recovering the desired substances, specifically L-alanine, from the microorganism undergoing culture, from a culture product of the microorganism, from a fermented product of the microorganism, or from the culture medium. The recovery step may further comprise a step following the culture step.

[00123] In the recovery step, the desired L-alanine can be collected using the microorganism culture method of the present description, for example, using a suitable method known in the art, according to a batch culture, continuous culture or fed-batch culture method. For example, methods such as centrifugation, filtration, treatment with a protein crystallization precipitant (salting-out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, various types of chromatography, such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, etc., HPLC or a combination thereof can be used, and the desired substances, specifically L-alanine, can be recovered from the medium or Petition 870250101709, dated 06 / 11 / 2025, pp. 60 / 76 53 / 68 of microorganisms using appropriate methods known in the art.

[00124] Furthermore, the method for producing Lalanine of the present description may additionally comprise a purification step, which may be carried out using an appropriate method known in the art. In one example, when the method for producing Lalanine of the present description comprises both a recovery step and a purification step, the recovery step and the purification step may be carried out continuously or intermittently, regardless of the order, or simultaneously, or may be integrated into a single step, but the method is not limited to this.

[00125] In the method described herein, alanine dehydrogenase, the introduction of activity and L-alanine etc. are as described in other aspects above.

[00126] Another aspect of the present description provides a composition for producing L-alanine, comprising a microorganism of the genus Corynebacterium that has the capacity to produce L-alanine, in which alanine dehydrogenase activity is introduced, of the present description, a culture product of the microorganism, a fermented product of the microorganism or a combination of two or more of the same.

[00127] In one embodiment, alanine Petition 870250101709, dated 06 / 11 / 2025, pp. 61 / 76 54 / 68 dehydrogenase can be derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari.

[00128] The composition of the present description may additionally include any suitable excipient commonly used in compositions for the production of Lalanine, and such excipients may include, for example, preservatives, humectants, dispersing agents, suspending agents, buffers, stabilizers or isotonic agents, etc., etc., but are not limited to these.

[00129] In one embodiment, each component present in the composition of the present description may be contained in a microbiologically effective amount or in an amount that may be appropriately present in the composition for production.

[00130] In the composition of the present description, alanine dehydrogenase, the introduction of activity and lalanine, etc., are as described in other aspects above.

[00131] Another aspect of the present description provides for the use of the microorganism of the genus Corynebacterium with the capacity to produce L-alanine, in which the activity of alanine dehydrogenase is introduced, from the present description for the production of L-alanine.

[00132] In one embodiment, alanine dehydrogenase can be derived from Bacillus licheniformis, Petition 870250101709, dated 06 / 11 / 2025, pp. 62 / 76 55 / 68 Bacillus amyloliquefaciens or Laceyella sacchari.

[00133] In the use of the present description, alanine dehydrogenase, the introduction of activity and L-alanine etc. are as described in other respects above. [Method of Implementing the Invention]

[00134] The present description will be further described in detail by means of Examples. However, these Examples are only preferred Examples presented for illustrative purposes, and therefore the scope of the present description is not intended to be limited to or by these Examples. Meanwhile, technical features not described in this document may be sufficiently understood and easily executed by a person skilled in the art in the technical field of the present description or in a similar technical field. Example 1: Evaluation of the L-Alanine Production Capacity of L-Alanine-Producing Microorganisms Introduced with Exogenous Alanine Dehydrogenase -1 Example 1-1: Construction of Vectors for Introduction of the Exogenous Alanine Dehydrogenase Gene

[00135] To construct strains in which an exogenous alanine dehydrogenase was introduced into Corynebacterium glutamicum ATCC13869, vectors were constructed to introduce genes encoding four types of alanine dehydrogenase. Petition 870250101709, dated 06 / 11 / 2025, pp. 63 / 76 56 / 68

[00136] Specifically, vectors containing the respective genes linked to the Pcj7 promoter were constructed.

[00137] First, an intergenic region was selected as the copy insertion site, and the restriction enzyme sequences XbaI and XhoI (tctagactcgag) were inserted into the downstream region of NCgl2195, and homologous 1.0 kb regions were inserted on each side. Then, the chromosomal gene from the Corynebacterium glutamicum ATCC13869 strain was isolated using a G-spin total DNA extraction mini kit (Cat. No. 17045, Intron), according to the protocols provided in the kit, and a PCR was performed using a primer pair with SEQ ID NOS: 22 and 23 and a primer pair with SEQ ID NOS: 24 and 25 to obtain gene fragments (NCgl2195down_A, NCgl2195down_B), respectively. PCR was performed under denaturation conditions at 95 °C for 5 minutes, followed by 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, and then polymerization at 72 °C for 5 minutes.The two gene fragments, which were cleaved with the restriction enzymes BamHI and SalI, were ligated to the linear vector pDCM2 (Korean Publication No. 10-2020-0136813) using T4 ligase (New England Biolabs, Beverly, MA). The resulting vector was named pDCM2-ΔNCgl2195down.

[00138] The four types of chromosomal genes — Petition 870250101709, dated 06 / 11 / 2025, pp. 64 / 76 57 / 68 aldl gene derived from Bacillus licheniformis (SEQ ID NO:2), ald2 gene derived from Bacillus licheniformis (SEQ ID NO:4), alaD gene derived from Bacillus amyloliquefaciens (SEQ IDNO: 6) or ald2 gene derived from Laceyella sacchari (SEQ ID NO: 8) — were each obtained using a G-spin total DNA extraction mini kit (Cat. No. 17045, Intron).

[00139] Specifically, genes were isolated according to the protocols provided in the mini kit, and PCR was performed using primer pairs of SEQ ID NOS: 9 and 10 and SEQ ID NOS: 11 and 12, primer pairs of SEQ ID NOS: 9 and 13 and SEQ ID NOS: 14 and 15, primer pairs of SEQ ID NOS: 9 and 16 and SEQ ID NOS: 17 and 18, and primer pairs of SEQ ID NOS: 9 and 19 and SEQ ID NOS: 20 and 21 for the respective genes, in order to obtain four Pcj7 promoter fragments that could be ligated to each of the four gene fragments, and four gene fragments ligated to them (aldl(B.li), ald2(B.li), ald2(L.sa), alaD(B.am)), respectively. PCR was performed under denaturation conditions at 95 °C for 5 minutes, followed by 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, and then polymerization at 72 °C for 5 minutes.As a result, four 364 bp fragments of Pcj7 and polynucleotides of respective genes (1,276 bp of aldl(B.li), 1,283 bp of ald2(B.li), 1,271 bp of alaD(B.am). Petition 870250101709, dated 06 / 11 / 2025, pp. 65 / 76 58 / 68 and 1,274bp of ald2(L.sa)) were obtained.

[00140] The two gene fragments (Pcj7 and respective genes), which were cleaved with restriction enzymes XbaI and XhoI, were ligated to linear pDCM2-ΔNCgl2195down using T4 ligase (New England Biolabs, Beverly, MA). The resulting vectors were named pDCM2ΔNCgl2195down::Pcj7_ald1(B.li), pDCM2ΔNCgl2195down::Pcj7_ald2(B.li), pDCM2ΔNCgl2195down::Pcj7_alaD(B.am), pDCM2ΔNCgl2195down::Pcj7_ald2(L.sa), respectively. [Table 1] SEQ ID NO: Name Sequence 9 Pcj7 F N2195down GAGATAGAGGTCTTTACGtctgaagaaaccagcgc 10 Pcj7 R ald1(B.li) CTTTAGGAATTCCAATGATCATgagtgtttccttcgttggg 1.li) Fcj71 ald1 gtacccaacgaaggaaacactcATGATCATTGGAATTCCTAAAG 12 ald(B.li) R N2195down GTGAAGGAAAGAGTTCgagTTAAAGCAGAATGGAAAAAAGG 13 Pcj7 R ald2(B.li) CTTTCGGTACtt1GCCGATAAttgtgaccAT ald2(B.li) F Pcj7 gtacccaacgaaggaaacactcATGATTATCGGCGTACCG 15 ald2(B.li) R N2195down GAAGGAAAGAGTTCgagCTGCAATTGCGGCAAAATTG 16 Pcj7 R alaD(B.amttggAAttGACCCCG1 alaD(B.am) F Pcj7 caacgaaaggaaacactcATGATTATCGGGGTTC 18 alaD(B.am) R N2195down GTGAAGGAAAGAGTTCctcgagTCCGGGATGATTGATATTC 19 Pcj7 R ald2(L.sa) CTGTTGGCACTCCTACTTTCATgagtgtttcctttcgttgggtac 20 ald2(L.sa) F Pcj7 gtacccaacgaaggaaacactcATGAAAGTAGGTGCCAACAG 21 ald2(L.sa) R N2195down GAAGGAAAGAGTTCctcgagGCTCCATCGTTTCAAACG 22 N2195down AF ctcggtacccggggatccTTCCCATGGAAACTCTCG 23 N2195down AR GTGTGAAGGAAAGAGTTCctcgagtctagaCGTAAAGACCTCTATC 24 N2195down BF GAGATAGAGGTCTTTACGtctagactcgagGAACTCTTTCCTTCAC 25 N2195down BR catgcctgcaggtcgacTTGATGAGCAGCAGTGG. Example 1-2: Construction of Microorganisms Introduced with Exogenous Alanine Dehydrogenase

[00141] The four types of vectors pDCM2ΔNCgl2195down::Pcj7_ald1(B.li), pDCM2ΔNCgl2195down::Pcj7_ald2(B.li), pDCM2 Petition 870250101709, dated 06 / 11 / 2025, pp. 66 / 76 59 / 68 The strains ΔNCgl2195down::Pcj7_alaD(B.am) and pDCM2ΔNCgl2195down::Pcj7_ald2(L.sa), constructed in Example 1-1, were each transformed into Corynebacterium glutamicum ATCC13869, the parental strain, by electroporation, and then the strains into which the variant gene and vector were inserted into the chromosome were selected as primary candidates in a selection medium containing 25 mg / L of kanamycin. Subsequently, the strains were inserted into the endogenous intergenic region ΔNCgl2195down on the chromosome via a double recombination process utilizing the homology between the gene existing on the chromosome and the gene being inserted via the vector. Final strains were obtained from which the vector containing the kanamycin resistance gene was removed. The resulting strains were first examined by PCR using a primer pair with SEQ ID NO: 26 and SEQ ID NO: 27 and finally confirmed by sequencing. The strains thus obtained were introduced with Pcj7_ald1(B.li), Pcj7_ald2(B.li), Pcj7_alaD(B.am) and Pcj7_ald2(L.sa), were named CJ0183, CJ0184, CJ0192 and CJ0185, respectively. [Table 2] SEQ ID NO: Name Sequence 26 N2195down CF CACCTGGGATGGCAGCAAACTTGAACTTG 27 N2195down CR CAGGATGTTTGGGCTGGTGAATCATAG Example 1-3: Evaluation of L Production Capacity Petition 870250101709, dated 06 / 11 / 2025, pp. 67 / 76 60 / 68 L-alanine-producing microorganisms introduced with exogenous alanine dehydrogenase.

[00142] To confirm the L-alanine productivity of the Corynebacterium glutamicum strains CJ0183, CJ0184, CJ0192, and CJ0185, constructed in Example 1-2 above, the strains were subjected to culture formation as described below: The Corynebacterium glutamicum ATCC13869 strain and the four variant strains were inoculated into a 250 mL flask with corner baffles containing 25 mL of the pre-culture medium described below and subjected to culture formation under agitation at 200 rpm, 30 °C, for 20 hours to obtain the pre-culture solution. Then, 1 mL of the pre-culture solution was inoculated into a 250 mL flask with corner baffles containing 24 mL of the production medium described below and subjected to culture formation under agitation at 200 rpm, 30 °C, for 48 hours to produce L-alanine.

[00143] After the culture was completed, L-alanine production was measured by high-performance liquid chromatography (Agilent, 1260 Infinity LC system), and the amount of L-alanine in the culture solution for each strain tested was determined. The compositions of the preculture medium and the production medium are as follows, and the concentrations of L-alanine in the culture solution for each strain tested are presented in Table 3 below. Petition 870250101709, dated 06 / 11 / 2025, pp. 68 / 76 61 / 68<Meio de Pré-cultura> Glucose (anhydrous glucose) 20g / L, Polypeptone 10g / L, Yeast extract 10g / L, (NHA2SO4 10g / L, Urea 1.5g / L, KH2PO4 5.2g / L, K2HPO4 10.7g / L, d-Biotin 1.8mg / L, Thiamine-HCl 9mg / L, CAPA 9mg / L, NCA 60mg / L, MGSO4 0.5g / L<Meio de Produção> CaCOs 30g / L, Sucrose 57g / L, BM 6g / L, MgSO4 0.5g / L, (NH4)2SO4 50g / L, KH2PO4 1g / L, Yeast Extract 2g / L, Ammonium acetate 6.28g / L, d-Biotin 0.05mg / L, Thiamine-HCl 0.1mg / L, MnSO4 6.7mg / L, FeSO4 10mg / L [Table 3] ATCC13869 (Parental strain) CJ0183 CJ0184 CJ0192 CJ0185 L-alanine concentration (g / L) 6.1 20.5 19.9 18.9 15.2

[00144] As a result, as shown in Table 3, the parental strain Corynebacterium glutamicum ATCC13869 produced L-alanine at a concentration of 6.1 g / L, but the strains introduced with exogenous alanine dehydrogenase CJ0183, CJ0184, CJ0192 and CJ0185, according to the present description, produced L-alanine at concentrations of 20.5 g / L, 19.9 g / L, 18.9 g / L and 15.2 g / L, respectively, confirming that the productivity of L-alanine was increased by 336%, 326%, 310% and 250%, respectively, compared to the parental strain.

[00145] Thus, it was confirmed that L-alanine could Petition 870250101709, dated 06 / 11 / 2025, pp. 69 / 76 62 / 68 can be produced in high concentrations in microorganisms of the genus Corynebacterium by means of the introduction of alanine dehydrogenase as described herein. Example 2: Evaluation of the L-Alanine Production Capacity of L-Alanine-Producing Microorganisms Introduced with Exogenous Alanine Dehydrogenase -2 Example 2-1: Construction of Recombinant Vectors with Additional Copies of the Exogenous Alanine Dehydrogenase Gene

[00146] To construct strains in which an additional copy of exogenous alanine dehydrogenase was introduced into the CJ0183 and CJ0184 strains constructed in Example 1-2, an additional copy of the alanine dehydrogenase-encoding gene from the Bacillus licheniformis-derived aldl gene (SEQ ID NO: 2) was introduced in a promoter-bound form.

[00147] First, an intergenic region was selected as the copy insertion site, and the NotI and XhoI restriction enzyme sequences (gcggccgcctcgag) were inserted into the downstream region of NCgl1292, and 1.0 kb homologous regions were inserted on each side. Then, the chromosomal gene of the Corynebacterium glutamicum ATCC13869 strain was isolated using a G-spin total DNA extraction mini kit (Cat. No. 17045, Intron), according to the protocols provided in the kit, and PCR was performed using a SEQ primer pair. Petition 870250101709, dated 06 / 11 / 2025, pp. 70 / 76 63 / 68 NOS IDs 28 and 29 and a primer pair SEQ IDs 30 and 31 were used to obtain gene fragments (NCgl1292down_A, NCgl1292down_B), respectively. PCR was performed under denaturation conditions at 95 °C for 5 minutes, followed by 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, and then polymerization at 72 °C for 5 minutes. The two gene fragments, which were cleaved with the restriction enzymes BamHI and SalI, were ligated to the linear vector pDCM2 (Korean Publication No. 10-2020-0136813) using T4 ligase (New England Biolabs, Beverly, MA). The resulting vector was named pDCM2-ΔNCgl1292down.

[00148] PCR was performed using the pDCM2-ΔNCgl2195down::Pcj7_ald1(B.li) vector, constructed in Example 1-1 above, as a template, with a primer pair of SEQ ID NOS: 32 and 33. PCR was performed under denaturation conditions at 95 °C for 5 minutes, followed by 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, and then polymerization at 72 °C for 5 minutes. As a result, a 1,598 bp Pcj7_ald1(B.li) polynucleotide was obtained. The fragment, which was cleaved with the restriction enzymes Notl and Xhol, was ligated to the linear vector pDCM2-ΔNCgl1292down using T4 ligase (New England Biolabs, Beverly, MA). The resulting vector was named pDCM2. (Petition 870250101709, 06 / 11 / 2025, p. 71 / 76) 64 / 68 ΔNCgl1292down::Pcj7_ald1(B.li). [Table 4] SEQ ID NO: Name Sequence 28 N1292dw AF gagctcggtacccggggatccGTTTTCTACAATAAATTGAGTTAG 29 N1292dw AR CAACCGGACGCATGGCActcgaggcggccgcGAAAAAGGCTTTCG 30 N1292dw BF CGAAAGCCTTTTTCgcggccgcctcgagTGCCATGCGTCCGGTTG 31 N1292dw BR catgcctgcaggtcgacCGCTCATTGGGTACGG 32 Pcj7_ald1(B.li)_F_N 1292 GAAAGCCTTTTTCgcggccgcAGAAACATCCCAGCGCTAC 33 ald1(B.li) R N1292 CTTCACAACCGGACGCATGGCActcgagTTAAAGCAGAATGG Example 2-2: Construction of Microorganisms with Additional Copies of the Exogenous Alanine Dehydrogenase Gene

[00149] The pDCM2ΔNCgl1292down::Pcj7_ald1(B.li) vector, constructed in Example 2-1, was transformed into each of the CJ0183 and CJ0184 strains, which are the parental strains, by electroporation, and then the strains into which the variant gene and the vector were inserted into the chromosome were selected as primary candidates in a selection medium containing 25 mg / L of kanamycin. Next, an additional copy of ald1(B.li) was introduced into the endogenous intergenic region ΔNCgl1292down on the chromosome via a double recombination process utilizing the homology between the gene existing on the chromosome and the gene being inserted via the vector. Final strains were obtained from which the vector containing the kanamycin resistance gene was removed. The final strains were first examined by PCR using a primer pair with SEQ ID NO: 34 and SEQ ID NO: 35 and, finally, Petition 870250101709, dated 06 / 11 / 2025, pp. 72 / 76 65 / 68 confirmed by sequencing. The strains thus obtained, introduced with additional copies of Pcj7_ald1(B.li), were named CJ0242 and CJ0229, respectively. That is, CJ0242 is a strain in which two copies of B.li ald1 were added relative to ATCC13869, and CJ0229 is a strain in which one copy of B.li ald1 and one copy of B.li ald2 were added relative to ATCC13869. [Table 5] SEQ ID NO: Sequence Name 34 N1292down CF CAGTCAATAGGTAGTCCCGATCCCAAG 35 N1292down CR GAACTAACGAAGAAGGACGCCTAAGAGAC Example 2-3: Evaluation of the L-Alanine Production Capacity of L-Alanine-Producing Microorganisms with Additional Copies of the Exogenous Alanine Dehydrogenase Gene

[00150] To confirm the L-alanine productivity of the Corynebacterium glutamicum CJ0242 and CJ0229 strains, constructed in Example 2-2 above, the strains were subjected to culture formation as described below:

[00151] The Corynebacterium glutamicum ATCC13869 strain and the five variant strains were inoculated into a 250 mL flask with corner baffles containing 25 mL of the preculture medium described below and subjected to culture formation under agitation at 200 rpm, 30 °C, for 20 hours to obtain the preculture solution. Then, 1 mL of the preculture solution was Petition 870250101709, dated 06 / 11 / 2025, pp. 73 / 76 66 / 68 inoculated into a 250 mL flask with corner baffles containing 24 mL of the production medium described below and subjected to culture formation under agitation at 200 rpm, at 30 °C, for 48 hours, for alanine production.

[00152] After the culture was completed, L-alanine production was measured by high-performance liquid chromatography, and the amount of L-alanine in the culture solution for each strain tested was determined. The compositions of the pre-culture medium and the production medium are as follows, and the concentrations of L-alanine in the culture solution for each strain tested are shown in Table 6 below. [Table 6] CJ0183 (Parental strain) CJ0242 CJ0184 (Parental strain) CJ0229 L-alanine concentration (g / L) 38.2 40.8 37.4 41.5

[00153] As a result, as shown in Table 6 above, the parental strain CJ0183 produced L-alanine at a concentration of 38.2 g / L, but the strain CJ0242, in which an additional copy was introduced into the strain introduced with exogenous alanine dehydrogenase according to the present description, produced L-alanine at a concentration of 40.8 g / L, confirming that the productivity of L-alanine was increased by 107% compared to the parental strain. Furthermore Petition 870250101709, dated 06 / 11 / 2025, pp. 74 / 76 67 / 68 of this, the parental strain CJ0184 produced L-alanine at a concentration of 37.4 g / L, and the strain CJ0229, in which an additional copy was introduced into the strain introduced with exogenous alanine dehydrogenase according to the present description, produced L-alanine at a concentration of 41.5 g / L, confirming that the productivity of L-alanine was increased by 111% compared to the parental strain.

[00154] Thus, it was confirmed that L-alanine can be produced in high concentrations by introducing additional copies into the microorganism of the genus Corynebacterium introduced with the exogenous alanine dehydrogenase of the present description.

[00155] From the foregoing, a person skilled in the art to which the present description refers will be able to understand that the present description can be incorporated into other specific forms without modifying the technical concepts or essential characteristics of the present description. In this sense, the exemplary embodiments described herein are for illustrative purposes only and should not be interpreted as limiting the scope of the present description. On the contrary, the present description is intended to encompass not only exemplary embodiments, but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present description. Petition 870250101709, dated 06 / 11 / 2025, pp. 75 / 76 68 / 68 description, as defined by the attached claims. Petition 870250101709, dated 06 / 11 / 2025, page 76 / 76

Claims

1 / 3 CLAIMS 1. Microorganism of the genus Corynebacterium characterized by the fact that it has a capacity for L-alanine production, in which alanine dehydrogenase activity is introduced, wherein the alanine dehydrogenase is derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari.

2. Microorganism, according to claim 1, characterized in that alanine dehydrogenase is encoded by the aldl, ald2 or alaD gene.

3. Microorganism, according to claim 1, characterized in that the alanine dehydrogenase comprises an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO:

7.

4. Microorganism, according to claim 1, characterized in that the gene encoding alanine dehydrogenase comprises a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO:

8.

5. Microorganism, according to claim 1, characterized in that the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

6. Microorganism, according to any one of claims 1 to 5, characterized in that the microorganism of the genus Corynebacterium has an increased capacity for L-alanine production compared to an unmodified microorganism.

7. Method for producing L-alanine, characterized in that it comprises: culturing a microorganism of the genus Corynebacterium having the capacity to produce L-alanine, in which alanine dehydrogenase activity is introduced, in a medium wherein the alanine dehydrogenase is derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari.

8. A method according to claim 7, characterized in that it further comprises recovering a target substance from the microorganism being cultured, a culture product of the microorganism, a fermented product of the microorganism, or the culture medium.

9. Composition for producing L-alanine, characterized in that it comprises a microorganism of the genus Corynebacterium having a capacity for producing L-alanine, in which alanine dehydrogenase activity is introduced, a culture product of the microorganism, a fermented product of the microorganism, or a combination of two or more thereof, wherein the alanine dehydrogenase is derived from Bacillus licheniformis, Bacillus amyloliquefaciens, or Laceyella sacchari. Petition 870250080733, dated 09 / 09 / 2025, page 19 / 24 3 / 3 10. Use of a microorganism of the genus Corynebacterium, in which alanine dehydrogenase activity is introduced, characterized by the fact that it is for the production of lalanine, wherein the alanine dehydrogenase is derived from Bacillus licheniformis, Bacillus amyloliquefaciens or Laceyella sacchari. Petition 870250080733, dated 09 / 09 / 2025, pp. 20 / 24