Plant, plant parts, plant tissues, plant cells and seeds of the species S. lycopersicum and method for producing and selecting it, TBRFV resistance gene in combination with at least one temperature sensitivity reducing gene (TSR), method for reducing yield loss of a tomato plant under TBRFV infestation and use of at least one TSR gene

Engineering tomato plants with a TBRFV resistance gene and TSR genes enhances resistance to Tobamovirus at high temperatures, reducing hypersensitivity and maintaining crop health and yield, addressing the challenge of viral infection under heat stress.

BR112025019129A2Pending Publication Date: 2026-07-14ENZA ZADEN BEHEER BV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
BR112025019129
Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-26
Filing Date
2024-04-05
Publication Date
2026-07-14

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
  • Figure 00000000_0001_ABST
    Figure 00000000_0001_ABST
Patent Text Reader

Abstract

The present invention relates to a plant of the S. lycopersicum species that is resistant to Tobamovirus at temperatures of at least 28℃, wherein the plant comprises a TBRFV resistance gene and further comprises at least one temperature sensitivity reducing (TSR) gene. The present invention further relates to a combination of the TBRFV resistance gene in combination with at least one temperature sensitivity reducing (TSR) gene for providing resistance to a Tobamovirus in a S. lycopersicum plant at a temperature of at least 28 ℃ and methods for providing a tomato plant that is TBRFV resistant at temperatures of at least 28 ℃.
Need to check novelty before this filing date? Find Prior Art

Description

1 / 16 Plant, plant parts, plant tissues, plant cells and seeds of the species S. lycopersicum and method for producing and selecting it, TBRFV resistance gene in combination with at least one temperature sensitivity reducing gene (TSR), method for reducing yield loss of a tomato plant under TBRFV infestation and use of at least one TSR gene

[001] The present invention relates to a plant of the species S. lycopersicum resistant to Tobamovirus at elevated temperatures, wherein the plant comprises a TBRFV resistance gene and further comprises at least one temperature sensitivity reducing gene (TSR). The present invention further relates to a combination of the TBRFV resistance gene in combination with at least one temperature sensitivity reducing gene (TSR) to confer Tobamovirus resistance in an S. lycopersicum plant at a temperature of at least 28°C and to methods for providing a tomato plant resistant to TBRFV at temperatures of at least 28°C.

[002] In 2014, an outbreak of a new viral disease infecting tomatoes occurred in Israel and Jordan, which quickly spread worldwide. This new disease was identified as a novel Tobamovirus, called ToBRFV (also known as TBRFV). ToBRFV infection is associated with necrotic lesions on the leaves, and tomato plants exhibit mild foliar symptoms late in the season, but severe brown, rough symptoms on the fruit, making them unfit for consumption. Tobamovirus is a genus of Virgaviridae species that infects plants, including plants of the Solanaceae family, such as tobacco, potato, tomato, and eggplant, and is among the most serious threats to vegetables worldwide.Tobamoviruses are a particular problem in tomato crops grown in protected environments and are transmitted over long distances through external seed contamination and mechanically from plant to plant through common cultivation practices via workers' hands, clothing, and tools, and are able to preserve infectivity in contaminated seeds and soil. Petition 870250080869, dated 09 / 09 / 2025, page 11 / 46 2 / 16

[003] In the battle against Tobamovirus, resistance was introduced into tomatoes by the introgression of resistance genes, which provided complete resistance. However, it is highly likely that, over time, resistance will be broken, as the virus will adapt and evolve, resulting in viral advancement. Therefore, an ongoing battle remains to identify resistance genes or gene combinations needed to provide and maintain resistant crops, especially against the new ToBRFV. Furthermore, recent field studies seem to indicate that ToBRFV is capable of infecting and causing disease symptoms in previously resistant tomato plants under high temperature conditions, i.e., above 28°C, resulting in increased hypersensitivity response in plants and increased crop damage.

[004] The hypersensitivity response (HR) is a defense mechanism in plants that is activated upon recognition of a pathogen or other stressor, such as a Tobamovirus infection. HR is characterized by rapid programmed cell death in affected tissues, which limits the spread of the pathogen and prevents further damage to the plant. Tomato plants are known to exhibit HR when infected with Tobamovirus, a genus of viruses that infects a wide range of plants, including tomatoes. HR in tomato plants is triggered by the recognition of viral proteins by plant resistance proteins, which initiates a signaling cascade leading to the activation of cell death. However, research has shown that HR in tomato plants can be compromised at high temperatures of 28 degrees Celsius or more, especially in the case of Tobamovirus infection.This likely occurs because heat stress induced at high temperatures can interfere with the signaling pathway that triggers HR, allowing the virus to spread more easily and cause more damage to the plant. It is believed that high temperatures inhibit the function of resistance proteins, preventing them from recognizing viral proteins and initiating the signaling cascade. Furthermore, heat stress can also induce the production of heat shock proteins, which may interfere with HR activation.

[005] In general, HR is an important defense mechanism in tomato plants against Tobamovirus infection, but its effectiveness can be compromised under high temperature conditions. Understanding the Petition 870250080869, dated 09 / 09 / 2025, page 12 / 46 3 / 16 Molecular mechanisms involved in HR and their regulation under different environmental conditions may help in the development of strategies to improve plant resistance to viral infections, particularly Tobamovirus infection in tomato plants.

[006] Considering the above, there is a need in the state of the art for a tomato plant that is resistant to ToBRFV, while maintaining its agronomic properties under high temperature conditions, i.e., above 28°C. Furthermore, there is a need in the state of the art for a method to provide a tomato plant that is resistant to ToBRFV, while maintaining its agronomic properties, including fruit size, productivity and leaf health, under these high temperature conditions.

[007] One of the objectives of the present invention, among others, is to meet the need mentioned in the prior art. The objective of the present invention, among others, is met by the present invention, as described in the appended claims.

[008] Specifically, the above objective, among others, is met, according to a first aspect, by the present invention by a plant of the species S. lycopersicum resistant to Tobamovirus, wherein the plant comprises a TBRFV resistance gene encoding a TBRFV resistance protein, wherein the protein has at least 90%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, most preferably 100% amino acid sequence identity with SEQ ID NO. 2, wherein the plant further comprises at least one temperature sensitivity reducing (TSR) gene encoding a TSR protein with at least 95%, more preferably at least 98%, even more preferably at least 99%, most preferably 100% sequence identity with the TSR protein selected from the group comprising SEQ ID NO. 4 (also referred to herein as TSR-1 protein), SEQ ID NO.6 (also referred to here as TSR-2 protein) and SEQ ID NO. 8 (also referred to here as TSR-3 protein), preferably SEQ ID NO. Petition 870250080869, dated 09 / 09 / 2025, p. 13 / 46 4 / 16

[009] The present invention relates to a tomato plant comprising in its genome a combination of a TBRFV gene and a Temperature Sensitivity Reduction (TSR) gene to reduce the hypersensitivity (HR) response of tomato plants at high temperatures > 28°C for at least 24 h, preferably at least 48 h, when in contact with a Tobamovirus, preferably TBRFV. This HR response is associated with undesirable effects such as leaf discoloration, dark spots on tomato fruits, reduced plant viability and eventually yield loss. Surprisingly, it was found that when the ToBRFV resistance gene was combined with the TSR gene, significantly improved disease resistance was obtained at high temperatures, compared to plants that do not possess the TSR gene (but comprise the ToBRFV gene).It has also been demonstrated that the homozygous presence of the TBRFV resistance gene itself has a favorable effect in reducing the HR response per se. Experiments show that if the TBRFV resistance gene is combined with at least one of the TSR genes mentioned, resistance to the viral disease is improved, especially under high temperature conditions, i.e., where the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, where said temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, most preferably for at least 6 consecutive days.Temperatures may vary within these subsequent days (i.e., higher daytime temperatures and lower nighttime temperatures), but on average, they would be at least 28°C with a variation of no more than 1 to 7°C between the maximum and minimum temperatures, providing the average temperature. Furthermore, the temperature cannot fall below 27°C, thus remaining within the average temperature.

[010] No symptoms of infection and / or necrosis due to TBRFV were observed in plants that presented the combination of the TBRFV and TSR resistance genes. Plants that possess the TBRFV gene but do not possess the TSR gene, Petition 870250080869, dated 09 / 09 / 2025, page 14 / 46 5 / 16 appear to be affected by TBRFV infection under these high-temperature conditions. The TBRFV and TRG genes appear to synergistically increase the ability of plants to remain fully resistant to TBRFV infection under high-temperature conditions and not exhibit necrosis, i.e., >28°C for at least 6 consecutive days.

[011] According to a preferred embodiment, the present invention relates to the plant, wherein the TBRFV resistance gene comprises a coding sequence having at least 90%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, most preferably 100% nucleotide sequence identity with SEQ ID NO. 1.

[012] According to another preferred embodiment, the present invention relates to a plant in which the TBRFV resistance gene is present in heterozygosity or homozygosity in the genome of said plant. From experimental data, it can be concluded that resistance is dominant and that the TBRFV resistance gene is preferentially at least heterozygous in the plant genome to provide resistance against Tobamovirus TBRFV. A similar picture was observed in experiments with respect to one or more TSR genes. If one or more TSR genes were present in homozygosity, the plant's resistance to TBRFV virus under high temperature conditions was significantly improved.

[013] According to another preferred embodiment, the present invention relates to a plant in which at least one TSR gene is heterozygous or homozygous present in the genome of said plant, preferably homozygous. For example, the plant of the present invention comprises the TBRFV gene (homozygous or heterozygous) and / or the TSR-1 gene (homozygous or heterozygous) and / or the TSR-2 gene (homozygous or heterozygous) and / or the TSR-3 gene (homozygous or heterozygous) and / or the TSR-4 locus (homozygous or heterozygous).

[014] According to another preferred embodiment, the present invention relates to the plant, wherein the plant comprises TBRFV and the TSR gene comprising the coding sequence of SEQ ID NO. 2 (sequence Petition 870250080869, dated 09 / 09 / 2025, p. 15 / 46 6 / 16 (coding sequence for TBRFV) and SEQ ID NO. 4 (coding sequence for TSR-1), respectively, where both genes are present in homozygous states.

[015] According to another preferred embodiment, the present invention relates to a plant, wherein the plant comprises the TBRFV gene comprising the coding sequence SEQ ID NO. 2 (TBRFV) and a TSR gene comprising the coding sequence SEQ ID NO. 4 (TSR-1), and a locus (herein referred to as locus TSR4) comprising another TSR gene (herein referred to as TSR4), wherein the TSR4 gene is linked to the marker sequences SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, and preferably wherein all said genes and locus are present in homozygosity. The results showed that if the plant comprises the genes encoding the coding sequences SEQ ID NO. 2 and SEQ ID NO. 4, further comprising the TSR4 locus, which is linked to the marker sequences SEQ ID NO. 10 (forward marker: TGTTAGGATGCGATATATGTAC), SEQ ID NO. 11 (reverse marker, CTGGATAGGAGTGGATTTAC) and SEQ ID NO.12 (probe, GTTTATGTGTTAtGTTGCTATtAATGAGG), an additional improved effect on resistance to TBRFV diseases and reduced / non-necrosis at high temperatures are observed. These improved disease and necrosis phenotypes are also observed in plants comprising the TBRVF gene (i.e., SEQ ID NO. 2) and the TSR-4 locus comprising the TSR4 gene (linked to marker sequences SEQ ID NO. 10, SEQ ID NO. 11, and SEQ ID NO. 12), and further improved in combination with SEQ ID NO. 4 present in said plant. Preferably, the improved plants comprise the TBRVF, TSR-1, and TSR-4 genes and homozygous loci in their genome, while homozygous plants outperform heterozygous plants in this respect.

[016] According to a preferred embodiment, the present invention relates to the plant in which the TSR4 locus is linked (co-segregating with) to the marker sequences SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12 and comprises the TSR-4 gene. The TSR4 locus is preferably located between positions 8,500,000 bp and 10,500,000 bp (Heinz reference genome 2.40). More preferably, the TSR-4 locus can be obtained from the plant Solanum pimpinellifolium PI 79532 (as also described by Andrus CF, Reynard GB, Wade BL (1942) “Relative resistance of tomato varieties, selections, Petition 870250080869, dated 09 / 09 / 2025, p. 16 / 46 7 / 16 and cross-pollination for defoliation by Alternaria and Stemphylium.” (U.S. Department of Agriculture Circular 652).

[017] According to a preferred embodiment, the present invention relates to the plant, wherein the plant is resistant to tomato fruit brown roughness virus (TBRFV), Tobamovirus strains Tm0, Tm1, Tm2, ​​preferably TBRFV.

[018] According to a preferred embodiment, the present invention relates to a plant, wherein the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, wherein said temperature is an average temperature present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably at least 3 consecutive days, even more preferably at least 4 consecutive days, most preferably at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms. As indicated above, the temperature may vary within these subsequent days (i.e., higher daytime temperatures and lower nighttime temperatures), but on average is at least 28°C, with a variation of at most 1 to 7°C between the maximum and minimum temperatures, providing the average temperature.Furthermore, the temperature cannot fall below 27°C, making up the average temperature within the aforementioned subsequent days.

[019] According to another preferred embodiment, the present invention relates to the plant, which is an agronomic plant that produces agronomic fruits. The plant of the present invention maintains one or more selected agronomic properties from the group comprising fruit size, fruit yield and leaf health, under these high temperature conditions.

[020] According to another preferred embodiment, the present invention relates to the plant in which the TBRFV resistance gene is found in deposit accession number NCIMB 43279. Seeds of Solanum lycopersicum NCIMB 43279 were deposited on November 16, 2018 at NCIMB Ltd, Petition 870250080869, dated 09 / 09 / 2025, page 17 / 46 8 / 16 Ferguson Building, Craibstone Estate, Bucksburn, AB21 9YA, Aberdeen, United Kingdom.

[021] The present invention, according to a second aspect, relates to plants, plant parts, tissues, cells and / or seeds derived from a plant as disclosed above.

[022] The present invention, according to a further aspect, relates to a TBRFV resistance gene in combination with at least one temperature sensitivity reducing (TSR) gene in an S. lycopersicum plant to provide Tobamovirus resistance in said plant, wherein said TBRFV gene comprises a coding sequence of SEQ ID NO. 1 and the TSR gene comprises a coding sequence selected from the group comprising SEQ ID NO. 3 (also referred to as TSR-1), SEQ ID NO. 5 (also referred to as TSR-2) and SEQ ID NO. 7 (also referred to as TSR-3), preferably SEQ ID NO. 3. The at least one TSR gene may comprise the TSR 4 locus comprising another TSR gene (herein referred to as TSR4), wherein the TSR4 gene is linked to the marker sequences of SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12. Preferably, all genes and loci (TBRFV and TSR) are homozygous and present in the plant of the present invention.

[023] According to another preferred embodiment, the present invention relates to the TBRFV resistance gene in combination with at least one temperature sensitivity reducing (TSR) gene, wherein the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, more preferably at least 35°C, wherein the temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, more preferably for at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms. Petition 870250080869, dated 09 / 09 / 2025, p. 18 / 46 9 / 16

[024] The present invention, according to a further aspect, relates to a method for producing and / or selecting a plant of the species S. lycopersicum that is resistant to TBRFV, wherein the method comprises the steps of: a) selecting a first tomato plant, wherein said selection comprises establishing in said first tomato plant the presence of a TBRFV resistance gene that encodes a TBRFV resistance protein, wherein the protein has at least 90% amino acid sequence identity with SEQ ID NO. 2; b) transfer, for example by crossing, the identified TBRFV resistance gene to a second tomato plant, wherein said second tomato plant comprises at least one TSR gene encoding a TSR protein with at least 95% sequence identity to the TSR protein selected from the group comprising SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8, preferably SEQ ID NO. 4.

[025] The present invention, according to a further aspect, relates to a method for selecting a TBRFV-resistant plant of the species S. lycopersicum, as disclosed herein, wherein the method comprises selecting an S. lycopersicum plant, wherein the selection comprises establishing in the S. lycopersicum plant the presence of a TBRFV resistance gene encoding a TBRFV resistance protein, wherein the protein has at least 90% amino acid sequence identity with SEQ ID NO. 2, and establishing in the S. lycopersicum plant the presence of a TSR gene encoding a TSR protein with at least 95% sequence identity with the TSR protein selected from the group comprising SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8, preferably SEQ ID NO. 4.

[026] The present invention, according to a further aspect, relates to a method for improving yield and / or reducing loss in tomato production. Petition 870250080869, dated 09 / 09 / 2025, p. 19 / 46 10 / 16 of a tomato plant under TBRFV infestation conditions, wherein the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, wherein said temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, most preferably for at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms, the method comprises the step of providing a plant of the species S. lycopersicum of the present invention.

[027] The present invention, according to a further aspect, relates to a method of protecting a field, tunnel, greenhouse or hothouse of tomato plants against TBRFV infestation, by cultivating a plant of the species S. lycopersicum of the present invention.

[028] The present invention, according to a further aspect, relates to the use of at least one temperature sensitivity reducing (TSR) gene in a tomato plant to reduce necrosis at a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, wherein the temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, most preferably for at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms, wherein the at least one TSR gene comprises a coding sequence with at least 95% sequence identity with the selected sequence from the group comprising SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO.7, preferably SEQ ID NO. 3.

[029] The present invention, according to a further aspect, relates to the use of at least one temperature sensitivity reducing (TSR) gene in a tomato plant to reduce the temperature sensitivity of said plant. Petition 870250080869, dated 09 / 09 / 2025, p. 20 / 46 11 / 16 tomato plant and / or to improve the vigor of said tomato plant at a temperature of at least 28°C, wherein said temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, and wherein at least one TSR gene comprises a coding sequence with at least 95% sequence identity with the sequence selected from the group comprising SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7, preferably SEQ ID NO. 3. More preferably, the invention relates to the use of at least one temperature sensitivity reducing (TSR) gene in a tomato plant, as indicated above, wherein the tomato plant is resistant to Tobamovirus, more preferably to TBRFV.

[030] According to a preferred embodiment, the present invention relates to the use in which at least one temperature sensitivity reducing (TSR) gene is combined in the tomato plant with a TBRFV gene comprising a coding sequence with at least 90% nucleotide sequence identity with SEQ ID NO.1.

[031] According to another preferred embodiment, the present invention relates to the use in which the TBRFV resistance gene is heterozygous or homozygous present in the genome of said plant, preferably homozygous, and / or in which at least one TSR gene is heterozygous or homozygous present in the genome of said tomato plant, preferably homozygous.

[032] The present invention will be detailed further in the following examples and figures where: Figure 1: Tomato plants were heat-treated for at least 6 days at 35°C, followed by a 4–5 day period at 22°C, after which the plants were scored for disease symptoms. Three hours before the start of the heat treatment, the plants were inoculated with the TBRFV virus. In Figures 1A and 1B, the plants on the left are infected and those on the right are not infected with TBRFV. Figure 1A shows tomato plants carrying the TBRFV gene (SEQ ID NO. 1, heterozygous) and lacking the gene. Petition 870250080869, dated 09 / 09 / 2025, page 21 / 46 12 / 16 temperature sensitivity reducer (TSR). Figure 1B shows tomato plants composed of the TBRFV gene (homozygous) and the TSR gene (SEQ ID NO. 3, homozygous). The synergistic effect of the TSR gene in combination with TBRFV after heat treatment is clearly visible, showing a healthy and vigorous plant if both TBRFV and TSR are present in the plant. Examples Inoculation of a tomato plant with TBRFV

[033] The TBRFV AE050 isolate (origin Saudi Arabia) was used to perform the disease assays. The OT9 line, susceptible to TBRFV, was used as plant material for virus maintenance. Symptomatic leaves obtained from the original samples were used for mechanical sap inoculation in the OT9 line. The virus was maintained in systemically infected OT9 tomato plants by means of monthly mechanical sap inoculation in new seedlings at 3 weeks of age.

[034] Tomato plant seeds to be infected were sown in vermiculite, seedlings were transplanted into rockwool blocks and inoculated 4 weeks after sowing. As starting material, symptomatic leaves of infected OT9 were collected and ground in a mortar in chilled demineralized water with carborundum (1 g / 100 mL). The oldest leaf of 3-week-old seedlings from each test plant was mechanically inoculated with AE050 by gently rubbing it once with a finger. Plants were phenotyped by visual scoring of plants and leaves. The presence of yellowing, mosaic pattern on leaves, and leaf deformation (narrowing, mottling) was recorded (see below). In addition, qPCR tests on plants were performed to determine virus infection. Determination of TBRFV infection in tomato (S. lycopersicum) by qPCR

[035] qPCR was used to determine viral infection in tomato plants that contained the TBRFV resistance gene and / or a TSR gene (heterozygous Petition 870250080869, dated 09 / 09 / 2025, p. 22 / 46 13 / 16 or homozygous). The plants were infected with TBRFV and the susceptible tomato line OT9 was included as a control (OT9).

[036] After 3 weeks of inoculation, a leaf puncture (6 mm) from the top of each plant was collected in a 4 ml Micronic tube containing a 4 mm metal bullet. 2 ml of extraction buffer (GH+ buffer containing 25 mM TCEP) were added and the tubes were shaken at high speed (1300 rpm) in a double seed shaker to pulverize the plant material. After 20 min centrifugation at 4,000 g, RNA extraction was performed using a Hamilton Microlab Star machine. One-step RT-qPCR (taqman) was conducted using a primer-probe combination to amplify TBRFV, see Table 1 (SEQ ID NO. 11 to 13). Table 1. Primers and probes used in RT-qPCR for TBRFV detection. qPCR Primer Name Sequence TBRFV- Fw (SEQ ID NO. 12) GGTGGTGTCAGTGTCTG1 1 1 TBRFV-Probe HEX-BHQ1 (SEQ ID NO. 13) AGAGAATGGAGAGAGCGGACGAGG TBRFV-Rev (SEQ ID NO. 14) GCGTCCTTGGTAGTGATGTT

[037] The more viral RNA present in the samples, the lower the Ct value in qPCR, since fewer PCR cycles are needed to amplify the cDNA (from the viral RNA) and capture a signal. In this experiment, a control sample (uninfected OT9) showed a Ct value of about 25 cycles or more. The infected control sample (infected OT9) usually shows a Ct value between 5 and 15; in this case, a Ct value of 8.9 was observed. Therefore, plants that showed a Ct value above 22 cycles were considered resistant, while plants that showed a Ct value below 15 were considered susceptible (see Table 3).

[038] Tomato plants that contained the TBRFV resistance gene and / or a TSR gene, homozygous (P) or heterozygous (P), showed a Ct value above 20 cycles and are considered resistant. If either gene was homozygous, an improvement in resistance was observed, demonstrated by a higher Ct value. Plants that did not contain the resistance gene Petition 870250080869, dated 09 / 09 / 2025, p. 23 / 46 14 / 16 to TBRFV and the TSR (A) gene showed a Ct value of 8.9, indicating that the plant was fully susceptible to infection by TBRFV. To evaluate disease resistance after heat treatment in tomato plants infected with TBRFV, including the TBRFV resistance gene and / or the TSR-1 gene.

[039] Plants with the various genotypes, i.e., comprising one or more TBRFV (SEQ ID NO.1) and TSR (SEQ ID NO.3) resistance genes, were heat-treated for at least 6 consecutive days at an average of 35°C (average day and night temperature, without dropping below 27°C), followed by a period of 3 to 4 days at 22°C, after which the plants were evaluated for disease symptoms and sampled for RT-qPCR. Three hours before the start of the heat treatment, the plants were inoculated with the TBRFV virus.

[040] For heat treatment, plants were placed on benches in a climate cell with Son-T lights. Plants were grown in rockwool blocks and subjected to heat treatment at 4 weeks of age (3-leaf stage). Temperatures were set to a specific temperature, but due to the heat produced by the Son-T lights (220 V, 400 W), temperatures could vary about 3 degrees Celsius above or below the set temperature (which would reflect a more natural temperature profile within a greenhouse). The lights were on for 12 hours a day (from 7 am to 7 pm).

[041] The susceptible tomato line OT9 was included as a control. Plants were categorized as resistant when no symptoms were observed on the leaves. Plants that showed any of the symptoms on the leaves were categorized as susceptible. Leaf samples were collected from asymptomatic (i.e., resistant) plants to test for the presence of the virus by qPCR (Ct value). Plants were phenotyped by visual scoring of the plants and leaves. The presence of yellowing, mosaic pattern on the leaves, and leaf deformation (narrowing, spots) was recorded. Necrosis was scored on a scale of 1 to 9; 1 indicates intense necrosis and 9 indicates absence of necrosis symptoms, see Table 2 below. Petition 870250080869, dated 09 / 09 / 2025, page 24 / 46 15 / 16 Table 2. Visual score Necrosis score: Symptoms of necrosis 9 No symptoms 7 Necrosis on inoculated leaf 5 Separate necrotic spots on systemic leaf 3 Intense necrosis on systemic leaf 1 Intense necrosis on systemic leaf + collapse

[042] The average of 12 plants is used to determine the necrosis score per plant group tested. Tomato plants containing the TBRFV gene (SEQ ID NO. 1), the TSR gene (SEQ ID NO. 3) homozygous or heterozygous, and combinations thereof, were included in the screening for disease resistance and necrosis after heat treatment in tomato plants infected with TBRFV. In addition, phenotypic results were confirmed by qPCR (Ct value; average of 6 plants) to relatively quantify viral loads in infected plants (see Table 3). Table 3. Quantification of viral loads in infected plants Genotype Plant TBRFV TSR-1 Necrosis Score Value Ct 0 (OT9) AA 1.0 8.9 1 HA 5.0 22.2 2 HH 6.8 24.5 3 PA 5.4 23.5 4 PP 9.0 25.4 A=absent, H=heterozygous, and P=homozygous

[043] From the data, it can be concluded that if the plant contains the TBRFV gene, at high temperatures (> 28°C) for at least 2 to 3 days, the plant's response is hypersensitive to TBRFV infection. However, if the plant also contains the TSR-1 gene, this hypersensitive response is greatly reduced, or even absent if the TSR-1 gene is present homozygous. Petition 870250080869, dated 09 / 09 / 2025, p. 25 / 46 16 / 16 in the plant. The TSR gene appears to be semi-dominant, since the presence of the heterozygous TSR-1 gene in combination with ToBRFV also shows reduced / absent necrosis and a better response to the disease at high temperatures. Plants composed of the homozygous ToBRFV gene and the homozygous TSR-1 gene showed no disease or necrotic symptoms after 10 days of heat treatment, as described above, and being inoculated with ToBRFV. Furthermore, plants composed of the ToBRFV gene and the TSR-4 locus containing the TSR4 gene also showed improved necrosis and a better response to the disease (data not shown). Petition 870250080869, dated 09 / 09 / 2025, page 26 / 46

Claims

1 / 5 CLAIMS 1. A plant of the species S. lycopersicum that is resistant to Tobamovirus, characterized in that the plant comprises a TBRFV resistance gene encoding a TBRFV resistance protein, wherein the protein has at least 90% amino acid sequence identity with SEQ ID NO. 2, wherein the plant further comprises at least one temperature sensitivity reducing (TSR) gene encoding a TSR protein with at least 95% sequence identity with the TSR protein selected from the group comprising SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8, preferably SEQ ID NO.

4.

2. Plant, according to claim 1, characterized in that the TBRFV resistance gene comprises a coding sequence that has at least 90% nucleotide sequence identity with SEQ ID NO.

1.

3. Plant, according to claim 1 or 2, characterized in that the TBRFV resistance gene is heterozygous or homozygous present in the genome of said plant, preferably homozygous.

4. A plant, according to any one of claims 1 to 3, characterized in that at least one TSR gene is heterozygous or homozygous present in the genome of said plant, preferably homozygous.

5. Plant, according to any one of claims 1 to 4, characterized in that it comprises the TBRFV and TSR genes comprising the coding sequence SEQ ID NO. 2 and SEQ ID NO. 4, respectively, wherein both genes are present in homozygosity.

6. Plant, according to any one of claims 1 to 5, characterized in that the plant is resistant to tomato fruit brown roughness virus (TBRFV), Tobamovirus strains Tm0, Tm1, Tm2, ​​preferably TBRFV. Petition 870250080869, dated 09 / 09 / 2025, p. 27 / 46 2 / 5 7. Plant, according to any one of claims 1 to 6, characterized in that it is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, wherein the temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, most preferably for at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms.

8. A plant, according to any one of claims 1 to 7, characterized in that it is an agronomic plant that produces agronomic fruits.

9. Plant, according to any one of claims 1 to 8, characterized in that the TBRFV resistance gene is found in NCIMB deposit accession number 43279.

10. Plants, plant parts, tissues, plant cells and / or derived seeds characterized in that they are from a plant as defined in any one of claims 1 to 9.

11. A TBRFV resistance gene in combination with at least one temperature sensitivity reducing (TSR) gene in a S. lycopersicum plant to provide resistance to a Tobamovirus in said plant, characterized in that said TBRFV gene comprises a coding sequence of SEQ ID NO. 1 and the TSR gene comprises a coding sequence selected from the group comprising SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7, preferably SEQ ID NO.

3.

12. TBRFV resistance gene in combination with at least one temperature sensitivity reducing gene (TSR), according to claim 11, characterized in that the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, more preferably at least 35°C, Petition 870250080869, dated 09 / 09 / 2025, p. 28 / 46 3 / 5 wherein the temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, more preferably for at least 3 consecutive days, even more preferably for at least 4 consecutive days, more preferably for at least 6 consecutive days, and wherein the plant is resistant to TBRFV and does not exhibit Tobamovirus disease and / or necrotic symptoms.

13. Method for producing a plant of the species S. lycopersicum that is resistant to TBRFV, as defined in any one of claims 1 to 9, characterized in that the method comprises the steps of: a) selecting a first tomato plant, wherein said selection comprises establishing in said first tomato plant the presence of a TBRFV resistance gene encoding a TBRFV resistance protein, wherein the protein has at least 90% amino acid sequence identity with SEQ ID NO. 2, b) transferring, for example by crossing, the identified TBRFV resistance gene to a second tomato plant, wherein said second tomato plant comprises at least one TSR gene encoding a TSR protein with at least 95% sequence identity with the TSR protein selected from the group comprising SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8, preferably SEQ ID NO.

4.

14. Method for selecting a plant of the species S. lycopersicum that is resistant to TBRFV, as defined in any of claims 1 to 9, characterized in that the method comprises selecting an S. lycopersicum plant, wherein said selection comprises establishing in said S. lycopersicum plant the presence of a TBRFV resistance gene encoding a TBRFV resistance protein, wherein the protein has at least 90% amino acid sequence identity with SEQ ID NO. 2, and establishing in said S. lycopersicum plant the presence of a TSR gene encoding a TSR protein with at least 95% sequence identity with the TSR protein selected from the group comprising SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO.

7. 8, preferably SEQ ID NO.

4.

15. Method for reducing tomato production loss from a tomato plant under TBRFV infestation conditions, characterized in that the tomato plant is resistant to a temperature of at least 28°C, wherein the temperature is an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, the method comprises the step of providing a plant of the species S. Lycopersicum, as defined in any one of claims 1 to 9.

16. Use of at least one temperature sensitivity reducing (TSR) gene in a tomato plant characterized in that it reduces necrosis symptoms at a temperature of at least 28°C, the temperature being an average temperature that is present for at least 1 consecutive day, preferably for at least 2 consecutive days, and wherein the at least one TSR gene comprises a coding sequence with at least 95% sequence identity with the sequence selected from the group comprising SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7, preferably SEQ ID NO.

3.

17. Use according to claim 16, characterized in that at least one temperature sensitivity reducing (TSR) gene is combined in the tomato plant with a TBRFV gene comprising a coding sequence with at least 90% nucleotide sequence identity with SEQ ID NO.

1.

18. Use, according to claim 16 or 17, characterized in that the TBRFV resistance gene is heterozygous or homozygous present in the plant genome, preferably homozygous, and / or in which at least one TSR gene is heterozygous or homozygous present in the tomato plant genome, preferably homozygous.