Method for differentiating stem cells by regulating MIR-124

Abstract

The present invention provides a method for differentiating trophoblast stem cells by modulating miR-124, and the resulting differentiated cells. The present invention also provides a method for treating diseases using the differentiated cells. The differentiated cells are pancreatic progenitor cells that express insulin, beta-thrombomodulin, and C-peptide.

Description

[0001] This application is a divisional application of the patent application for invention titled "Method for Differentiating Stem Cells by Modulating MIR-124" with the application date of November 26, 2013, application number 201380071949.4.

[0002] Cross-reference

[0003] This application claims the benefit of U.S. Provisional Application No. 61 / 732,162, filed on November 30, 2012, and U.S. Provisional Application No. 61 / 877,156, filed on September 12, 2013, both of which are hereby incorporated by reference in their entirety.

[0004] Sequence Listing

[0005] This application contains a Sequence Listing that has been electronically submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on November 25, 2013, is named 44980-703601_SL.txt and is 26,919 bytes in size. BACKGROUND OF THE INVENTION

[0006] During gastrulation, epiblast cells give rise to the primitive streak mesendoderm, which subsequently gives rise to the three germ layers, including the definitive endoderm (DE). The DE differentiates into the primitive gut endoderm, from which the ventral and dorsal pancreatic buds develop into the pancreas. Advanced human embryonic stem (hES) cell research has inspired the vision of generating glucose-responsive and insulin-secreting β-cells through DE specification for the treatment of type 1 diabetes. However, current hES cell methods are time-consuming and complex.

[0007] Incorporated by reference

[0008] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict between the terms herein and those of the incorporated documents, the terms herein shall prevail. SUMMARY OF THE INVENTION

[0009] The embodiments of the invention provided in this summary are only intended to be exemplary and are intended to provide an overview of the alternative embodiments disclosed herein. The summary (which is exemplary and alternative) does not limit the scope of any claims, does not provide the entire scope of the embodiments of the invention disclosed or contemplated herein, and should not be construed as limiting or restricting the scope of this disclosure or any claimed embodiment of the invention.

[0010] In one aspect among many aspects, the present disclosure provides a method for differentiating mammalian trophoblast stem cells, the method comprising modulating miR-124 to induce the differentiation of mammalian trophoblast stem cells into differentiated cells. In one instance, the mammalian trophoblast stem cells are human trophoblast stem (hTS) cells. In one instance, the mammalian trophoblast stem cells herein are from a rodent (e.g., mouse, rat, guinea pig, hamster, or squirrel), rabbit, bovine, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, or orangutan), or human. In one instance, the differentiated cells are progenitor cells, e.g., pancreatic progenitor cells. In one instance, the differentiated cells are pluripotent stem cells. In one instance, the differentiated cells are endoderm, mesoderm, or ectoderm progenitor cells. In one instance, the differentiated cells are definitive endoderm progenitor cells. In one instance, the differentiated cells are pancreatic endoderm progenitor cells. In one instance, the differentiated cells are multipotent progenitor cells. In one instance, the differentiated cells are oligopotent progenitor cells. In one instance, the differentiated cells are unipotent, bipotent, or tripotent progenitor cells. In one instance, the differentiated cells are endocrine, exocrine, or duct progenitor cells, e.g., endocrine progenitor cells. In one instance, the differentiated cells are β-cells. In one instance, the differentiated cells are insulin-producing cells. One or more differentiated cells can be used in any of the methods disclosed herein. In some embodiments, the modulating activates miR-124. In one instance, the modulating activates miR-124 spatiotemporally, e.g., between about 1 hour and about 8 hours at the definitive endoderm stage. In one instance, the modulating upregulates miR-124 expression. In one instance, the modulating inactivates miR-124. In one instance, the modulating downregulates miR-124 expression. In one instance, the modulating comprises contacting the mammalian trophoblast stem cells with one or more agents, e.g., proteins or steroid hormones. In one instance, the one or more agents comprise growth factors, e.g., fibroblast growth factor (FGF). In one instance, the FGF is FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, or FGF10. In one instance, the one or more agents comprise FGF2 (basic fibroblast growth factor, bFGF). In one instance, the concentration of bFGF herein is no greater than about 100 ng / mL, e.g., about 1 to about 100 ng / mL. In one instance, the concentration of bFGF herein is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 ng / mL.In one case, the concentration of bFGF herein is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL. In one case, the one or more agents further comprise an antioxidant or a reducing agent, for example, 2-mercaptoethanol.

[0011] In one case, the concentration of 2-mercaptoethanol is not greater than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In one case, the concentration of 2-mercaptoethanol is about 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L. In one case, the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L. In one case, the one or more agents further comprise a vitamin, such as nicotinamide. In one case, the concentration of nicotinamide is not greater than about 100 mmol / L, such as about 1 to about 100 mmol / L. In one case, the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In one case, the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In one case, the modulation comprises contacting mammalian trophoblast stem cells with bFGF, 2-mercaptoethanol and nicotinamide. In one case, the one or more agents modulate the activity or expression level of cAMP response element-binding protein 1 (CREB1). In one case, the one or more agents modulate CREB1 phosphorylation. In one case, the one or more agents comprise a vitamin metabolite, such as retinoic acid. In one case, the one or more agents comprise CREB1-binding protein. In one case, the one or more agents modulate one or more factors including mixl1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β. In one case, the one or more agents comprise an exogenous miR-124 precursor or an exogenous anti-miR-124. In one case, mammalian trophoblast stem cells are transfected with an exogenous miR-124 precursor or an exogenous anti-miR-124. In one case, the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO:158) of the promoter of miR-124 is modulated. In one case, the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e. In one case, the miR-124 is miR-124a, such as Homo sapiens miR-124a (hsa-miR-124a). In one case, the hsa-miR-124 is hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof.In one case, the hsa-miR-124 is hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In one case, the miR-124 comprises a sequence selected from Tables 1 and 2 or a fragment thereof. In one case, mammalian trophoblast stem cells differentiate into differentiated cells within one day after the start of regulation.

[0012] In one aspect, provided herein are one or more differentiated cells isolated by one or more of the methods herein. In one case, the isolated differentiated cells are human cells. In one case, the isolated differentiated cells have a normal karyotype. In one case, the isolated differentiated cells have one or more immune-privileged properties, such as low or absent CD33 expression and / or CD133 expression. One or more of the isolated differentiated cells disclosed herein can be used in any of the methods disclosed herein.

[0013] In another aspect, provided herein are isolated progenitor cells expressing one or more transcription factors including Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof. In one case, the isolated progenitor cells are induced pluripotent stem cells. In one case, the isolated progenitor cells are derived from mammalian trophoblast stem cells, such as hTS cells. In one case, the isolated progenitor cells are pancreatic progenitor cells. In one case, the isolated progenitor cells are endoderm, mesoderm, or ectoderm progenitor cells. In one case, the isolated progenitor cells are definitive endoderm progenitor cells. In one case, the isolated progenitor cells are pancreatic endoderm progenitor cells. In one case, the isolated progenitor cells are pluripotent progenitor cells. In one case, the isolated progenitor cells are oligopotent progenitor cells. In one case, the isolated progenitor cells are unipotent, bipotent, or tripotent progenitor cells. In one case, the isolated progenitor cells are endocrine, exocrine, or duct progenitor cells, such as endocrine progenitor cells. In one case, the isolated progenitor cells are β-cells. In one case, the isolated progenitor cells are insulin-producing cells. In one case, the isolated progenitor cells are from rodents (e.g., mice, rats, guinea pigs, hamsters, squirrels), rabbits, cows, sheep, pigs, dogs, cats, monkeys, apes (e.g., chimpanzees, gorillas, orangutans), or humans. In one case, the isolated progenitor cells are human cells. In one case, the isolated progenitor cells have a normal karyotype. In one case, the isolated progenitor cells have one or more immune-privileged properties, such as low or absent CD33 expression and / or CD133 expression. The isolated progenitor cells disclosed herein can be used in any of the methods disclosed herein.

[0014] In another aspect, the present disclosure provides isolated progenitor cells that express betatrophin, betatrophin mRNA, C-peptide, or insulin, wherein the isolated progenitor cells are differentiated from mammalian trophoblast stem cells. In one case, the isolated progenitor cells are from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, bovine, sheep, porcine, canine, feline, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human. In one case, the isolated progenitor cells are pancreatic progenitor cells. In one case, the isolated progenitor cells are human cells. In one case, the isolated progenitor cells have a normal karyotype. In one case, the isolated progenitor cells have one or more immune privilege characteristics, e.g., low or absent CD33 expression and / or CD133 expression. One or more of the isolated progenitor cells disclosed herein can be used in any of the methods disclosed herein.

[0015] In one case, the isolated progenitor cells herein are insulin-producing cells. One or more of the isolated progenitor cells herein can be used in any of the methods disclosed herein.

[0016] In one case, the differentiated cells herein are insulin-producing cells. One or more of the differentiated cells herein can be used in any of the methods disclosed herein.

[0017] In one aspect, the present disclosure provides a method of screening for a substance for treating or preventing a disease, the method comprising: a) contacting at least one of the isolated progenitor cells herein with the substance; and b) detecting a change in the level of at least one transcript or protein in the isolated progenitor cells.

[0018] In one case, the level of at least one transcript or protein in the isolated progenitor cells is decreased compared to the corresponding isolated progenitor cells not contacted with the substance. In one case, the level of at least one transcript or protein in the isolated progenitor cells is increased compared to the corresponding isolated progenitor cells not contacted with the substance. In one case, the disease is an insulin disorder. In one case, the disease is diabetes, e.g., type 1 diabetes or type 2 diabetes.

[0019] In one aspect, provided herein is a method for screening a substance for cytotoxicity or modulation to cells, the method comprising: a) contacting at least one isolated progenitor cell herein with the substance; b) determining the phenotypic and / or metabolic changes of the isolated progenitor cell caused by contacting with the substance; and c) correlating the changes with cytotoxicity or modulation. In one case, the cell is an insulin-producing cell. In one case, the substance is a drug. In one case, the substance is a chemical. In one case, the substance is an antibody or a fragment thereof. In one case, the substance is added to a culture medium. In one case, the method comprises determining the effect of the substance on the growth of the isolated progenitor cell. In one case, the method comprises determining whether the substance affects the expression of a marker or receptor of the isolated progenitor cell. In some embodiments, the isolated progenitor cell is a pancreatic progenitor cell.

[0020] In one aspect, provided herein is a method for treating or preventing a disease in a mammal in need thereof, the method comprising administering the isolated progenitor cell herein to the mammal in need thereof. In one case, the isolated progenitor cell is immune privileged. In one case, the isolated progenitor cell has a low level of CD33 expression and / or CD133 expression. In one case, the administration comprises injection, implantation or surgical operation. In one case, the disease is an insulin disorder. In one case, the disease is diabetes, such as type 1 diabetes or type 2 diabetes. In one case, the mammal in need thereof is a mouse, a rat, a pig, a dog, a monkey, an orangutan, an ape or a human. In one case, the mammal in need thereof has one or more symptoms associated with diabetes, such as polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infections, fatigue, slow healing of wounds or ulcers, and any combination thereof. In some embodiments, the isolated progenitor cell is a pancreatic progenitor cell.

[0021] In one aspect, provided herein is a method for producing insulin, the method comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing isolated progenitor cells that secrete insulin in response to glucose stimulation. In another aspect, provided herein is a method for producing betacellulin protein and / or betacellulin mRNA, the method comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing pancreatic progenitor cells that produce betacellulin protein and / or betacellulin mRNA.

[0022] In one case, the β-opsonin protein or β-opsonin mRNA is produced during a period of about 12 - 28 hours after induction, such as during about 12 - 16, 16 - 20, 20 - 24 or 24 - 28 hours after induction.

[0023] In one case, the isolated progenitor cells are pancreatic progenitor cells. In one case, the isolated progenitor cells produce C-peptide and / or insulin. In some embodiments, the mammalian trophoblast stem cells are hTS cells. In some embodiments, the mammalian trophoblast stem cells herein are from rodents, rabbits, cows, sheep, pigs, dogs, cats, monkeys or apes. In some embodiments, the rodents herein are mice, rats, guinea pigs, hamsters or squirrels. In some embodiments, the apes herein are chimpanzees, gorillas or orangutans. In some embodiments, miR-124 is activated spatiotemporally at the definitive endoderm stage, for example, between about 1 hour and about 8 hours at the definitive endoderm stage. In some embodiments, the expression of miR-124 is enhanced. In some embodiments, the one or more agents include proteins or steroid hormones, such as growth factors. In some embodiments, the growth factor is fibroblast growth factor (FGF), such as FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10. In some embodiments, the one or more agents include bFGF (basic fibroblast growth factor). In some embodiments, bFGF is not greater than about 100 ng / mL, such as about 1 to about 100 ng / mL. In some embodiments, the concentration of bFGF used herein is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL. In some embodiments, the concentration of bFGF used herein is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL. In some embodiments, bFGF is about 10 ng / mL. In some embodiments, the one or more agents further include an antioxidant or a reducing agent (e.g., 2-mercaptoethanol). In some embodiments, the one or more agents further include a vitamin (e.g., nicotinamide). In some embodiments, the mammalian trophoblast stem cells are contacted with bFGF, 2-mercaptoethanol and nicotinamide. In some embodiments, the concentration of 2-mercaptoethanol is not greater than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In some embodiments, the concentration of 2-mercaptoethanol is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L. In some embodiments, the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L. In some embodiments, 2-mercaptoethanol is about 1 mmol / L.In some embodiments, the concentration of nicotinamide is no greater than about 100 mmol / L, such as from about 1 to about 100 mmol / L. In some embodiments, the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In some embodiments, the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In some embodiments, the nicotinamide is about 10 mmol / L. In some embodiments, mammalian trophoblast stem cells are contacted with one or more agents to modulate the activity or expression level of cAMP response element binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the one or more agents include vitamin metabolites, such as retinoic acid. In some embodiments, the one or more agents include CREB1-binding protein. In some embodiments, the one or more agents modulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β. In some embodiments, miR-124 herein is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e, such as miR-124a. In some embodiments, miR-124a is Homo sapiens miR-124a (hsa-miR-124a), such as hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In some embodiments, miR-124 comprises a sequence selected from Tables 1 and 2 or a fragment thereof.

[0024] The present invention also relates to the following items:

[0025] 1. A method of differentiating mammalian trophoblast stem cells, comprising modulating miR-124 to induce differentiation of the mammalian trophoblast stem cells into differentiated cells.

[0026] 2. The method according to item 1, wherein the mammalian trophoblast stem cells are human trophoblast stem cells (hTS cells).

[0027] 3. The method according to item 1, wherein the mammalian trophoblast stem cells are from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0028] 4. The method according to any one of items 1-3, wherein the differentiated cells are progenitor cells.

[0029] 5. The method according to item 4, wherein the differentiated cell is a pancreatic progenitor cell.

[0030] 6. The method according to any one of items 1-3, wherein the differentiated cell is a pluripotent stem cell.

[0031] 7. The method according to any one of items 1-3, wherein the differentiated cell is an endoderm, mesoderm or ectoderm progenitor cell.

[0032] 8. The method according to any one of items 1-3, wherein the differentiated cell is a definitive endoderm progenitor cell.

[0033] 9. The method according to any one of items 1-3, wherein the differentiated cell is a pancreatic endoderm progenitor cell.

[0034] 10. The method according to any one of items 1-3, wherein the differentiated cell is a multipotent progenitor cell.

[0035] 11. The method according to any one of items 1-3, wherein the differentiated cell is an oligopotent progenitor cell.

[0036] 12. The method according to any one of items 1-3, wherein the differentiated cell is a unipotent, bipotent or tripotent progenitor cell.

[0037] 13. The method according to any one of items 1-3, wherein the differentiated cell is an endocrine, exocrine or duct progenitor cell.

[0038] 14. The method according to item 13, wherein the differentiated cell is an endocrine progenitor cell.

[0039] 15. The method according to any one of items 1-3, wherein the differentiated cell is a β-cell.

[0040] 16. The method according to any one of items 1-15, wherein the differentiated cell is an insulin-producing cell.

[0041] 17. The method according to any one of items 1-16, wherein the regulation activates miR-124.

[0042] 18. The method according to item 17, wherein miR-124 is activated spatiotemporally at the definitive endoderm stage.

[0043] 19. The method according to item 18, wherein miR-124 is activated between about 1 hour and about 8 hours at the definitive endoderm stage.

[0044] 20. The method according to any one of Items 1-16, wherein the regulation enhances the expression of miR-124.

[0045] 21. The method according to any one of Items 1-16, wherein the regulation inactivates miR-124.

[0046] 22. The method according to any one of Items 1-16, wherein the regulation reduces the expression of miR-124.

[0047] 23. The method according to any one of Items 1-22, wherein the regulation comprises contacting the mammalian trophoblast stem cells with one or more agents.

[0048] 24. The method according to Item 23, wherein the one or more agents comprise a protein or a steroid hormone.

[0049] 25. The method according to Item 24, wherein the protein or steroid hormone comprises a growth factor.

[0050] 26. The method according to Item 25, wherein the growth factor is fibroblast growth factor (FGF).

[0051] 27. The method according to Item 26, wherein the FGF is FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10.

[0052] 28. The method according to Item 27, wherein the FGF is bFGF (basic fibroblast growth factor).

[0053] 29. The method according to Item 28, wherein the concentration of bFGF is not greater than about 100 ng / mL.

[0054] 30. The method according to Item 29, wherein the concentration of bFGF is about 1 to about 100 ng / mL.

[0055] 31. The method according to Item 30, wherein the concentration of bFGF is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL.

[0056] 32. The method according to Item 31, wherein the concentration of bFGF is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL.

[0057] 33. The method according to item 32, wherein the concentration of bFGF is about 10 ng / mL.

[0058] 34. The method according to any one of items 24 - 33, wherein the one or more agents further comprise an antioxidant or a reducing agent.

[0059] 35. The method according to item 34, wherein the antioxidant or reducing agent is 2 - mercaptoethanol.

[0060] 36. The method according to item 35, wherein the concentration of 2 - mercaptoethanol is not greater than about 10 mmol / L.

[0061] 37. The method according to item 36, wherein the concentration of 2 - mercaptoethanol is about 0.1 to about 10 mmol / L.

[0062] 38. The method according to item 37, wherein the concentration of 2 - mercaptoethanol is about: 0.1 - 1, 1 - 2, 2 - 3, 3 - 4, 4 - 5, 5 - 6, 6 - 7, 7 - 8, 8 - 9 or 9 - 10 mmol / L.

[0063] 39. The method according to item 38, wherein the concentration of 2 - mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L.

[0064] 40. The method according to item 39, wherein the concentration of 2 - mercaptoethanol is about 1 mmol / L.

[0065] 41. The method according to any one of items 24 - 40, wherein the one or more agents further comprise a vitamin.

[0066] 42. The method according to item 41, wherein the vitamin is nicotinamide.

[0067] 43. The method according to item 42, wherein the concentration of nicotinamide is not greater than about 100 mmol / L.

[0068] 44. The method according to item 43, wherein the concentration of nicotinamide is about 1 to about 100 mmol / L.

[0069] 45. The method according to item 44, wherein the concentration of nicotinamide is about: 1 - 10, 10 - 20, 20 - 30, 30 - 40, 40 - 50, 50 - 60, 50 - 70, 80 - 90 or 90 - 100 mmol / L.

[0070] 46. The method according to item 45, wherein the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L.

[0071] 47. The method according to item 46, wherein the concentration of nicotinamide is about 10 mmol / L.

[0072] 48. The method according to item 23, wherein one or more agents regulate the activity or expression level of cAMP response element binding protein 1 (CREB1).

[0073] 49. The method according to item 48, wherein the one or more agents regulate CREB1 phosphorylation.

[0074] 50. The method according to item 48 or 49, wherein the one or more agents comprise vitamin metabolites.

[0075] 51. The method according to item 50, wherein the vitamin metabolite is retinoic acid.

[0076] 52. The method according to item 48 or 49, wherein the one or more agents comprise CREB1-binding protein.

[0077] 53. The method according to any one of items 23-52, wherein the one or more agents regulate one or more factors including mixl1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β.

[0078] 54. The method according to item 23, wherein the one or more agents comprise exogenous miR-124 precursor or exogenous anti-miR-124.

[0079] 55. The method according to item 54, wherein the mammalian trophoblast stem cells are transfected with exogenous miR-124 precursor or exogenous anti-miR-124.

[0080] 56. The method according to item 55, wherein the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO: 158) of the promoter of miR-124 is regulated.

[0081] 57. The method according to any one of the foregoing items, wherein the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e.

[0082] 58. The method according to item 57, wherein the miR-124 is miR-124a.

[0083] 59. The method according to item 58, wherein the miR-124a is Homo sapiens miR-124a (hsa-miR-124a).

[0084] 60. The method according to item 59, wherein the hsa-miR-124a is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof.

[0085] 61. The method according to item 59, wherein the hsa-miR-124a is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.

[0086] 62. The method according to any one of items 1-55, wherein the miR-124 comprises a sequence selected from Tables 1 and 2 or a fragment thereof.

[0087] 63. The method according to any one of items 1-62, wherein the mammalian trophoblast stem cells differentiate into differentiated cells within one day after the start of the regulation.

[0088] 64. Differentiated cells isolated according to any one of items 1-63.

[0089] 65. An isolated progenitor cell that expresses one or more transcription factors including Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof.

[0090] 66. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from induced pluripotent stem cells.

[0091] 67. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from mammalian trophoblast stem cells.

[0092] 68. The isolated progenitor cell according to item 67, wherein the mammalian trophoblast stem cells are from rodents, rabbits, cows, sheep, pigs, dogs, cats, monkeys, apes, or humans.

[0093] 69. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from hTS cells.

[0094] 70. The isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a pancreatic progenitor cell.

[0095] 71. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is an endoderm, mesoderm or ectoderm progenitor cell.

[0096] 72. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is a definitive endoderm progenitor cell.

[0097] 73. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is a pancreatic endoderm progenitor cell.

[0098] 74. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is a pluripotent progenitor cell.

[0099] 75. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is an oligopotent progenitor cell.

[0100] 76. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is a unipotent, bipotent or tripotent progenitor cell.

[0101] 77. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is an endocrine, exocrine or duct progenitor cell.

[0102] 78. An isolated progenitor cell according to item 77, wherein the isolated progenitor cell is an endocrine progenitor cell.

[0103] 79. An isolated progenitor cell according to any one of items 65 - 69, wherein the isolated progenitor cell is a β - cell.

[0104] 80. An isolated progenitor cell according to any one of items 65 - 79, wherein the isolated progenitor cell is a cell that produces insulin.

[0105] 81. An isolated progenitor cell that expresses β - opsonin, β - opsonin mRNA, C - peptide or insulin, wherein the isolated progenitor cell is differentiated from mammalian trophoblast stem cells.

[0106] 82. An isolated progenitor cell according to any one of items 65 - 81, wherein the isolated progenitor cell is a human cell.

[0107] 83. An isolated progenitor cell according to any one of items 65 - 81, wherein the isolated progenitor cell is from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0108] 84. An isolated progenitor cell according to any one of items 65 - 82, wherein the isolated progenitor cell has a normal karyotype.

[0109] 85. An isolated progenitor cell according to any one of items 65 - 84, wherein the isolated progenitor cell has one or more immune privilege properties.

[0110] 86. The isolated progenitor cell according to item 85, wherein the one or more immune privilege properties include low or lack of CD33 expression or CD133 expression.

[0111] 87. A method for screening a substance for treating a disease, comprising:

[0112] a) contacting the isolated progenitor cell according to any one of items 65 - 86 with the substance; and

[0113] b) detecting a change in the level of at least one transcript or protein in the isolated progenitor cell.

[0114] 88. The method according to item 87, wherein the level of at least one transcript or protein in the isolated progenitor cell is reduced compared to the corresponding isolated progenitor cell not contacted with the substance.

[0115] 89. The method according to item 87, wherein the level of at least one transcript or protein in the isolated progenitor cell is increased compared to the corresponding isolated progenitor cell not contacted with the substance.

[0116] 90. The method according to any one of items 87 - 89, wherein the disease is an insulin disorder.

[0117] 91. The method according to item 90, wherein the disease is diabetes.

[0118] 92. The method according to item 91, wherein the disease is type 1 diabetes.

[0119] 93. The method according to item 91, wherein the disease is type 2 diabetes.

[0120] 94. The method according to any one of items 87 - 93, wherein the isolated progenitor cell is a pancreatic progenitor cell.

[0121] 95. A method for screening a substance for cell regulation of cells, comprising:

[0122] a) contacting the isolated progenitor cell according to any one of items 65 - 86 with the substance;

[0123] b) determining a phenotypic or metabolic change of the isolated progenitor cell caused by contacting with the substance; and

[0124] c) Correlate the change with cell regulation.

[0125] 96. A method for screening substances for cytotoxicity to cells, comprising:

[0126] a) Contacting the isolated progenitor cells according to any one of items 65 - 86 with the substance;

[0127] b) Determining a phenotypic or metabolic change of the isolated progenitor cells caused by contact with the substance; and

[0128] c) Correlating the change with cytotoxicity.

[0129] 97. The method according to item 95 or 96, wherein the substance is a drug.

[0130] 98. The method according to item 97, wherein the substance is a hormone, steroid or antibody or a fragment thereof.

[0131] 99. The method according to item 95 or 96, wherein the substance is a chemical.

[0132] 100. The method according to any one of items 95 - 98, wherein the substance is added to the culture medium.

[0133] 101. The method according to any one of items 95 - 99, wherein the change is the growth of the isolated progenitor cells.

[0134] 102. The method according to any one of items 95 - 101, wherein the change is that the isolated progenitor cells express a marker or a receptor.

[0135] 103. The method according to any one of items 95 - 101, wherein the isolated progenitor cells are pancreatic progenitor cells.

[0136] 104. A method for treating a disease in a mammal in need thereof, comprising administering the isolated progenitor cells according to any one of items 65 - 86 to the mammal in need thereof.

[0137] 105. The method according to item 104, wherein the isolated progenitor cells are immune privileged.

[0138] 106. The method according to item 105, wherein the immune privilege includes low or lack of CD33 expression or CD133 expression.

[0139] 107. The method according to any one of items 104 - 106, wherein the disease is an insulin disorder.

[0140] 108. The method according to item 107, wherein the disease is diabetes.

[0141] 109. The method according to item 108, wherein the disease is type 1 diabetes or type 2 diabetes.

[0142] 110. The method according to any one of items 104 - 109, wherein the mammalian in need has one or more symptoms associated with diabetes.

[0143] 111. The method according to item 110, wherein the one or more symptoms are selected from polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infections, fatigue, slow healing of wounds or ulcers, and any combination thereof.

[0144] 112. The method according to any one of items 104 - 111, wherein the mammalian in need is a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0145] 113. The method according to any one of items 104 - 111, wherein the mammalian in need is a human.

[0146] 114. The method according to any one of items 104 - 113, wherein the administration comprises injection or implantation.

[0147] 115. The method according to any one of items 104 - 114, wherein the isolated progenitor cells are pancreatic progenitor cells.

[0148] 116. A method for producing insulin, which comprises contacting mammalian trophoblast stem cells with one or more agents to activate miR - 124, thereby producing progenitor cells that secrete insulin in response to glucose stimulation.

[0149] 117. A method for producing betacellulin protein or betacellulin mRNA, which comprises contacting mammalian trophoblast stem cells with one or more agents to activate miR - 124, thereby producing progenitor cells that produce betacellulin protein or betacellulin mRNA.

[0150] 118. The method according to item 117, wherein the betacellulin protein or betacellulin mRNA is produced during a period of about 12 - 28 hours after induction.

[0151] 119. The method according to item 118, wherein the betacellulin protein or betacellulin mRNA is produced during a period of about 12 - 16, 16 - 20, 20 - 24 or 24 - 28 hours after induction.

[0152] 120. The method according to any one of items 117 - 119, wherein the progenitor cells produce C - peptide or insulin.

[0153] 121. The method according to any one of items 116 - 120, wherein the progenitor cells are pancreatic progenitor cells.

[0154] 122. The method according to any one of items 116 - 121, wherein the mammalian trophoblast stem cells are hTS cells.

[0155] 123. The method according to any one of items 116 - 121, wherein the mammalian trophoblast stem cells are from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0156] 124. The method according to any one of items 116 - 122, wherein miR - 124 is activated spatiotemporally at the definitive endoderm stage.

[0157] 125. The method according to item 123, wherein miR - 124 is activated between about 1 hour and about 8 hours at the definitive endoderm stage.

[0158] 126. The method according to any one of items 116 - 125, wherein the activation of miR - 124 includes an increase in miR - 124 expression.

[0159] 127. The method according to any one of items 116 - 126, wherein the one or more agents include a protein or a steroid hormone.

[0160] 128. The method according to item 127, wherein the protein or steroid hormone includes a growth factor.

[0161] 129. The method according to item 128, wherein the growth factor is FGF.

[0162] 130. The method according to item 129, wherein the FGF is FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10.

[0163] 131. The method according to item 130, wherein the FGF is bFGF.

[0164] 132. The method according to item 131, wherein the concentration of bFGF is not greater than about 100 ng / mL.

[0165] 133. The method according to item 132, wherein the concentration of bFGF is about 1 to about 100 ng / mL.

[0166] 134. The method according to item 133, wherein the concentration of bFGF is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL.

[0167] 135. The method according to item 134, wherein the concentration of bFGF is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL.

[0168] 136. The method according to item 135, wherein the concentration of bFGF is about 10 ng / mL.

[0169] 137. The method according to any one of items 127-136, wherein the one or more agents further comprise an antioxidant or a reducing agent.

[0170] 138. The method according to item 137, wherein the antioxidant or reducing agent is 2-mercaptoethanol.

[0171] 139. The method according to item 138, wherein the concentration of 2-mercaptoethanol is not greater than about 10 mmol / L.

[0172] 140. The method according to item 139, wherein the concentration of 2-mercaptoethanol is about 0.1 to about 10 mmol / L.

[0173] 141. The method according to item 140, wherein the concentration of 2-mercaptoethanol is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L.

[0174] 142. The method according to item 141, wherein the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L.

[0175] 143. The method according to item 142, wherein the concentration of 2-mercaptoethanol is about 1 mmol / L.

[0176] 144. The method according to any one of items 127-143, wherein the one or more agents further comprise a vitamin.

[0177] 145. The method according to item 144, wherein the vitamin is nicotinamide.

[0178] 146. The method according to item 145, wherein the concentration of nicotinamide is about 100 mmol / L or lower.

[0179] 147. The method according to item 146, wherein the concentration of nicotinamide is about 1 to about 100 mmol / L.

[0180] 148. The method according to item 147, wherein the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L.

[0181] 149. The method according to item 148, wherein the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L.

[0182] 150. The method according to item 149, wherein the concentration of nicotinamide is about 10 mmol / L.

[0183] 151. The method according to any one of items 116-126, wherein the one or more agents regulate the activity or expression level of cAMP response element-binding protein 1 (CREB1).

[0184] 152. The method according to item 151, wherein the one or more agents regulate CREB1 phosphorylation.

[0185] 153. The method according to item 151 or 152, wherein the one or more agents comprise vitamin metabolites.

[0186] 154. The method according to item 153, wherein the vitamin metabolite is retinoic acid.

[0187] 155. The method according to item 151 or 152, wherein the one or more agents comprise CREB1-binding protein.

[0188] 156. The method according to any one of items 116-155, wherein the one or more agents regulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β.

[0189] 157. The method according to any one of items 116-156, wherein the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e.

[0190] 158. The method according to item 157, wherein the miR-124 is miR-124a.

[0191] 159. The method according to item 158, wherein the miR-124a is Homo sapiens miR-124a (hsa-miR-124a).

[0192] 160. The method according to item 159, wherein the hsa-miR-124 is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof.

[0193] 161. The method according to item 159, wherein the hsa-miR-124 is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.

[0194] 162. The method according to any one of items 116 - 156, wherein the miR-124 comprises a sequence selected from Tables 1 and 2 or a fragment thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0195] Figures 1A to 1C is a set of diagrams illustrating the pathway from hTS cells to pancreatic progenitor cells. Figure 1A Shows the time-course profile of pancreatic development-related transcription factors during the differentiation of hTS cells into pancreatic progenitor cells. Data are represented as mean ± SD, n = 3 independent experiments, ★ p < 0.05 (t-test). Figure 1B Shows the change in Mixl1 intensity during DE formation. Figure 1C Shows the separation of the mesendoderm into two cell populations: one expressing Pdx1 specific for the mesoderm + Mixl1 + , while the other expresses Pdx1 specific for the endoderm + Mixl1 - .

[0196] Figures 2A to 2C is a set of diagrams showing the dynamic distribution of pluripotent transcription factors during pancreatic differentiation. Figure 2A Shows the transition of unique pluripotent transcription factors at specific cell stages at each stage. Data are represented as mean ± SD, n = 3 independent experiments, ★ p < 0.05 (t-test). Figure 2B Shows immunofluorescence images of Mixl1, Cdx2, and Oct4 during the transition of DE. Figure 2CThe immunofluorescence images of Oct4 with representative markers in the DE stage are shown.

[0197] Figures 3A to 3M A set of figures illustrate the biogenesis and multifaceted functions of miR-124a. Figure 3A It is a schematic diagram of the mechanism of DE formation and β-opsonin activation regulation. Figure 3B It shows the correlation between miR-124a and p-CREB1 expression observed over time, and shows that the active PI3K / Akt / CREB1 signaling pathway targets different sites of miR-124a. Figure 3C It shows the parallel expression of p-CREB1 and miR-124a measured by qPCR assay, and the promoter regions of miR-124-2 containing CREB1-binding site 1 (acgccgtcatt, SEQ ID NO:148) and site 2 (ggtgacgtcagc, SEQ ID NO:149) and miR-124-3 containing CREB1-binding site (ggtgacgtcacc, SEQ ID NO:150) quantified by CREB1 ChIP and qPCR. Figures 3D to 3F It shows the construction of plasmids for luciferase reporter assays: Figure 3D It shows the pGL4.51-Luc reporter construct for the Smad4 3’UTR targeting the common binding sites Smad4(1) (5’-guuuguccagugccuuu-3’, SEQ ID NO:151) and Smad4(2) (5’-auccagaauugccuua-3’, SEQ ID NO:152) that target miR-124a (SEQ ID NO:2, presented in the 3’ to 5’ direction); Figure 3E It shows the pGL4.51-Luc reporter construct for the Cdx2 3’UTR (5’-gggaguauuugaacaca-3’, SEQ ID NO:153) targeting hsa-miR-124a (5’-cguguucacagcggacc-3’, SEQ ID NO:154, a fragment of SEQ ID NO:1); Figure 3F It shows the pGL4.51-Luc reporter construct for the GSK3β 3’UTR (5’-guuuggagugccuuc-3’, SEQ ID NO:155) targeting miR-124a (5’-uaaggcacgcgguga-3’, SEQ ID NO:156, a fragment of SEQ ID NO:2). Data are represented as mean ± SD, n = 5, ★p < 0.05 (t-test). Cells transfected with non-specific shRNA were used as positive controls. Empty vectors were used as negative controls. Figure 3G Shows the effect of pre-transfection with miR124a or anti-miR-124a on the expression of Smad4, Mixl1, Cdx2, GSK3β, and Oct4 after induction. Figure 3H Shows that the Oct4 target gene Sox17 gives rise to Sox17 (arrow) at 4 hr. Input: positive control, IgG: negative control. Figure 3I Shows that in the ChIP assay, the β-catenin target gene Foxa2 (cctgtttgttttagtt, SEQ ID NO: 157) gives rise to Foxa2 (4 hr) (arrow). Input: positive control, IgG: negative control. Figure 3J -M shows the synthesis and regulation of β-opsonin: Figure 3J Shows that according to the ChIP assay, the Foxa2 target gene C19orf80 gives rise to β-opsonin (arrow); Figure 3K Shows that according to qPCR analysis, β-opsonin mRNA transiently increases at 16 hr (normalized relative to glyceraldehyde-3-phosphate dehydrogenase). Figure 3L Is a set of Western blot data showing a parallel correlation between β-opsonin, C-peptide, and insulin. Data are represented as mean ± SD, n = 3, ★ p < 0.05 (t-test). Figure 3M Shows the co-expression of β-opsonin and insulin by immunofluorescence after 24 hr of induction.

[0198] Figures 4A to 4E Is a set of figures showing the characteristics of hTS cell-derived pancreatic progenitor cells. Figures 4A to 4C Shows an in vitro functional glucose stimulation assay. Figure 4A Shows that according to ELISA assays, cells produce immunoreactive insulin in response to high glucose concentration (15 mM, gray bars). Figure 4B Is a representative excerpt of a set of images showing morphological changes and positive DTZ staining recorded by a computer-microscope-video system (Olympus, IX-81, DP30, MIU-IBC-IF-2). Figure 4C Shows that according to radioimmunoassay, high glucose (25 mM) stimulation produces C-peptide at 7.6 ng / hr / 10 6 cells (represented by the upper line) and insulin at 393.8 μIU / hr / 10 6 cells (represented by the lower line). Data were measured by the area under the curve and are represented as mean ± SD, n = 5. ★ p < 0.05 (t-test).Figure 4D Are a set of ultrastructural micrographs of grapelike cell clusters after high glucose stimulation. White arrows in the middle image: desmosomal junctions. Arrow at the bottom: β-insulin granules (β-G). Two upper arrows: α-glucagon granules (α-G). N: nucleus. Im-G: immature granules. M: mitochondria. RER: rough endoplasmic reticulum. Scale bar: 1 μm. Figure 4E Shows immunofluorescent staining of pancreatic progenitor cell markers at 24 hr after bFGF induction in hTS cells. Control staining is not shown.

[0199] Figure 5 Is a bar graph that shows the induction efficacy of various combinations of factors, including bFGF, 2-mercaptoethanol (2-ME), and nicotinamide, on insulin-expressing cells derived from hTS cells, measured by immunofluorescence assay.

[0200] Figure 6A Is a set of TissueQuest analysis images that shows the dose-effect of bFGF on the generation of insulin-expressing cells from hTS cells, based on the co-expression of insulin and Ngn3; Figure 6B Is a bar graph that represents Figure 6A The data in as the mean ± SD determined in triplicate.

[0201] Figure 7 Is a TissueQuest analysis image that shows that bFGF (10 ng / ml) achieved a similar percentage of insulin-expressing cells, based on the co-expression of insulin and glucagon.

[0202] Figure 8 Is a set of images from a representative immunoblot analysis that illustrates the dynamic pattern of transcription factor levels over time during different cellular processes. The dashed box indicates the DE state. β-actin was used as a control. Data are represented as mean ± S.D. n = 3, ★ p < 0.05.

[0203] Figure 9 Is a schematic diagram that illustrates a negative autoregulatory feedback loop among pluripotent transcription factors (Nanog, Sox2, Cdx2, and Oct4) during the bFGF-induced cellular process.

[0204] Figure 10 Is a set of flow cytometry images that shows the reciprocal inhibitory relationship between Cdx2 (left) and Oct4 (right). Nonspecific shRNA was used as a control.

[0205] Figure 11A set of Western blot images showing that knockdown of Cdx2 upregulates Oct4. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0206] Figure 12 A set of flow cytometry images showing that knockdown of Oct4 upregulates Nanog (left) and vice versa (right).

[0207] Figure 13 A set of flow cytometry images showing that knockdown of Nanog upregulates Sox2 (right) and vice versa (left).

[0208] Figure 14 A schematic diagram illustrating an autoregulatory loop that demonstrates reciprocal inhibition among pluripotent transcription factors.

[0209] Figure 15 A set of Western blot images showing that the FGFR inhibitor (PD 166866) blocks bFGF-induced PI3K. β-actin was used as a loading control.

[0210] Figure 16 IP assay data showing that Akt directly interacts with CREB1.

[0211] Figure 17 A set of Western blot images showing that PI3K siRNA inhibits the expression of PI3K and p-Akt. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0212] Figure 18 A set of Western blot images showing that siRNA against Akt subunits inhibits the expression of bFGF-induced p-Akt and p-CREB1. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0213] Figure 19 A bar graph showing the relative miR-124a expression when plasmids containing miR-124a or anti-miR-124a cDNA were transfected into hTS cells for the experimental setup in this experiment. Data are presented as mean ± SD, n = 5.

[0214] Figure 20 A bar graph showing the relative miR-124a expression in hTS cells induced only by bFGF and in bFGF-induced hTS cells transfected with CREB1 shRNA. Non-specific shRNA was used as a control. Data are presented as mean ± SD, n = 3.★ p < 0.05.

[0215] Figure 21 These are a set of Western blot images that show the inhibition of bFGF-induced Mixl1 inhibition by using Smad4 shRNA. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0216] Figure 22 These are a set of Western blot images that show the inhibition of bFGF-induced Oct4 and Sox17 expression by using Oct4 shRNA. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0217] Figure 23 These are a set of Western blot images that show that inhibitory GSK3β between 1 - 4 hr after bFGF induction results in the accumulation of β-catenin during the same time period. β-actin was used as a loading control.

[0218] Figure 24 These are a set of Western blot images that show that bFGF-induced Foxa2 expression is attenuated in the presence of shRNA against Foxa2. Cells transfected with non-specific shRNA were used as controls. β-actin was used as a loading control.

[0219] Figure 25 These are a set of Western blot images that show the dynamic correlation of the expression among betacellulin, C-peptide, and insulin before 24 hr after bFGF induction. At 28 hr, the trend of the betacellulin level decreased while the levels of C-peptide and insulin remained at relatively high levels. β-actin was used as a loading control.

[0220] Figure 26 These are a set of immunocytochemistry images that show the co-expression of betacellulin (light dots) and insulin (dark dots) in bFGF-induced pancreatic progenitor cells. Detailed Embodiments

[0221] Details of one or more embodiments of the present invention are set forth in the accompanying drawings, claims, and description herein. Other features, objects, and advantages of the embodiments of the present invention disclosed and contemplated herein may be combined with any other embodiment unless explicitly excluded.

[0222] The terms "modulate" and "modulation" refer to directly or indirectly inducing an increase or decrease in cellular activity such as cell growth or differentiation, stimulation, inhibition, interference, or blockade, such as inducing mammalian trophoblast stem cells to become differentiated cells, such as pancreatic progenitor cells.

[0223] The term "agent" refers to a compound, such as a biomolecule or a chemical, that is used for cell growth and differentiation, such as the differentiation of mammalian trophoblast stem cells. Examples of agents include, but are not limited to, growth factors (e.g., fibroblast growth factor (FGF)), antioxidants / reducing agents (e.g., 2-mercaptoethanol), vitamins (e.g., nicotinamide) and their metabolites (e.g., retinoic acid), nucleic acids (e.g., RNA or DNA, such as microRNA), hormones, peptides, and proteins (e.g., CREB1-binding protein). Examples of growth factors can include FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, and FGF10. Further examples of antioxidants can include 2-mercaptoethanol (2-ME), dithiothreitol (DTT), and tris(2-carboxyethyl)phosphine (TCEP). Examples of vitamins can include vitamin A, vitamin B1, B2, B3, B5, B6, B7, B9, or B12, vitamin C, vitamin D, vitamin E, and vitamin K. In some embodiments, the agents herein modulate the activity or expression level of cAMP response element-binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the agents herein activate miR124. In some embodiments, the agents herein modulate one or more transcription factors, such as mix1, Cdx2, Oct4, Sox17, Foxa2, or GSK3β.

[0224] The term "drug" is intended to include compounds having utility for therapeutic and / or diagnostic and / or prophylactic purposes, such as therapeutic, diagnostic, or prophylactic compounds. Therapeutic compounds include, for example, antibiotics, antiviral agents, antifungal agents, antiangiogenic agents, analgesics, anesthetics, anti-inflammatory agents (including steroidal and non-steroidal anti-inflammatory agents (NSAIDs)), corticosteroids, antihistamines, mydriatics, antitumor agents, immunosuppressive agents, antiallergic agents, metalloproteinase inhibitors, tissue inhibitors of metalloproteinases (TIMPs), inhibitors or antagonists or intraceptors, receptor antagonists, RNA aptamers, antibodies or fragments thereof, hydroxamic acids and macrocyclic anti-succinic hydroxamic acid esters derivatives, nucleic acids, plasmids, siRNA, vaccines, DNA-binding (minor groove) compounds, hormones, vitamins, proteins, peptides, polypeptides, and peptidomimetic therapeutic agents. Diagnostic compounds include, for example, dyes, contrast agents, fluorophores, radioisotopes (e.g., P-32, Tc-99, F-18, I-131), and analogs that can be used to diagnose a disease, condition, syndrome, or its symptoms. Therapeutic compounds administered prior to detecting a disease, condition, syndrome, or symptom are prophylactic compounds.

[0225] Unless otherwise indicated, open-ended terms such as "comprising," "including," etc., as used herein, are meant to be inclusive.

[0226] Some embodiments herein relate to numerical ranges. When a numerical range is provided, the range includes the endpoints of the range. Numerical ranges include the values and sub-ranges therein, as if explicitly written out.

[0227] The term "about" as used herein means ±15%. For example, the term "about 10" includes 8.5 to 11.5.

[0228] Unless otherwise explicitly stated, the articles "a" or "an" as used herein mean one or more.

[0229] "Vector" refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector that results in modification of the cells described herein when introduced into a suitable host cell. Suitable expression vectors are well known to those of ordinary skill in the art and include those that are replicable in eukaryotic and / or prokaryotic cells and those that remain episomal or integrate into the host cell genome.

[0230] The construction of vectors can be achieved using techniques described, for example, in Sambrook et al., 1989. In some embodiments, an isolated plasmid or DNA fragment is cut, tailored, and religated in the desired form to produce a plasmid. If desired, analysis to confirm the correct sequence in the constructed plasmid is performed using any suitable method. Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells, and performing assays for evaluating gene expression and function are known. For example, the presence, amplification, and / or expression of a gene can be measured directly in a sample using conventional Southern blotting, Northern blotting for quantifying transcription of mRNA, dot blotting (for DNA or RNA analysis), or in situ hybridization using appropriately labeled probes based on the sequences provided herein.

[0231] Terms such as "transfection," "transformation," etc., as used herein, are intended to denote the transfer of nucleic acid in a functional form into a cell or organism. Such terms include various means of transferring nucleic acid into a cell, including transfection with CaPO 4 transfection, electroporation, viral transduction, lipofection, delivery using liposomes and / or other delivery vehicles.

[0232] Cells can be sorted by affinity techniques or by cell sorting (e.g., fluorescence-activated cell sorting), where they are labeled with a suitable label, such as a fluorophore conjugated to, for example, an antisense nucleic acid molecule or an immunoglobulin, or a part of, for example, an antisense nucleic acid molecule or an immunoglobulin, or an intrinsically fluorescent protein such as green fluorescent protein (GFP) or a variant thereof. As used herein, "sorting" refers to at least partial physical separation of a first cell type from a second cell type.

[0233] The term "treatment" and the like can refer to obtaining a desired pharmacological and / or physiological effect, e.g., partial or complete cure of a disease, and / or reversal of an adverse reaction attributable to the disease, and / or stabilization of the disease, and / or delay of the progression of the disease, and / or induction of regression of the disease.

[0234] Administration (e.g., transplantation) of stem cells to a region in need of treatment can be achieved, for example but not limited to, local infusion during surgery, by injection, by catheter, or by an implant, which is a porous, non-porous, or gel-like material, including membranes such as silicone rubber membranes or fibers.

[0235] "Transplanting" a composition into a mammal can refer to introducing the composition into the body of the mammal. The introduced composition is a "graft", and the mammal is a "recipient". The graft and the recipient can be syngeneic, allogeneic, or xenogeneic. In addition, transplantation can be autologous.

[0236] "Effective amount" can be the amount of a therapeutic agent sufficient to achieve the intended purpose. For example, an effective amount of a factor for increasing the number of hTS cells is an amount sufficient to cause an increase in the number of stem cells in vivo or in vitro, as appropriate. An effective amount of a composition for treating or alleviating a neurodegenerative disease or disorder is an amount of the composition sufficient to reduce or eliminate the symptoms of the neurodegenerative disease or disorder. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal receiving the therapeutic agent, and the purpose of administration.

[0237] 2-Mercaptoethanol (also known as β-mercaptoethanol, BME, 2BME, 2-ME, or β-met) is a chemical compound having the formula HOCH 2 CH 2 SH.

[0238] Nicotinamide, also known as niacinamide and nicotinic acid amide, is an amide of nicotinic acid (vitamin B 3 / niacin) and has the formula C 6 H 6 N 2 O.

[0239] In some embodiments, the mammalian trophoblast stem cells herein are from rodents (e.g., mouse, rat, guinea pig, hamster, or squirrel), rabbit, bovine, sheep, porcine, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, or orangutan), or human.

[0240] In some embodiments, the mammalian herein is a rodent (e.g., mouse, rat, guinea pig, hamster, or squirrel), rabbit, bovine, sheep, porcine, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, or orangutan), or human.

[0241] In some embodiments, during embryogenesis, pancreatic development requires key derivatives of definitive endoderm (DE) for further differentiation. MicroRNA (miR) acts at multiple levels to control the timing of cell transitions throughout the differentiation process. One of many aspects of the present invention is to differentiate mammalian trophoblast stem cells into pancreatic progenitor cells using FGF (e.g., bFGF) through DE specification driven by miR-124. Another aspect of the present invention is to promote betacellulin for beta cell proliferation through the regulation of miR-124 during pancreatic differentiation. Another aspect of the present invention is to provide insulin-secreting pancreatic progenitor cells differentiated from mammalian trophoblast stem cells.

[0242] In some embodiments, in mammalian trophoblast stem cells, FGF (e.g., bFGF) effectively induces differentiation towards insulin-secreting pancreatic progenitor cells within one day through the formation of definitive endoderm (DE).

[0243] In some embodiments, FGF (e.g., bFGF) activates the spatio-temporal elevation of microRNA (miR)-124 through the FGFR1 / PI3K / Akt / CREB1 pathway to perform two functions: 1) inhibit Smad4 and thus inhibit Mixl1 for DE formation, and 2) inhibit Cdx2, and in turn mutually activate Oct4 for DE regulation through an autoregulatory feedback loop. Subsequently, through the transformation of the primitive gut tube, DE differentiates into multipotent pancreatic progenitor cells. Each stage-specific cellular process is mainly regulated by unique pluripotent transcription factors during differentiation.

[0244] In some embodiments, the pancreatic progenitor cells derived from mammalian trophoblast stem cells are glucose-sensitive and secrete immunoreactive C-peptide and insulin in vitro and / or in vivo.

[0245] In some embodiments, FGF (e.g., bFGF) induction effectively promotes the activation of miRNA-124a, which guides the differentiation of pancreatic progenitor cells in mammalian trophoblast stem cells.

[0246] In some embodiments, the mammalian trophoblast stem cells herein are a renewable source of stem cells for cell-based therapies for diabetic patients and for drug toxicity screening.

[0247] In some embodiments, FGF (e.g., bFGF) can effectively differentiate mammalian trophoblast stem cells (e.g., hTS cells) into pancreatic progenitor cells, thus providing evidence as a renewable source of stem cells in generating insulin-secreting pancreatic progenitor cells for cell-based therapies in type 1 DM patients.

[0248] In some embodiments, mammalian trophoblast stem cells provide a major advantage for screening drugs related to pancreatic diseases because: 1) they are easy to generate a sufficient number required for evaluation in multi-well plates; 2) the cell genotype and phenotype are stable; 3) pancreatic differentiation and proliferation are characterized and elucidated by the specialization of DE; 4) the conditions of a single inducer and a simple medium are conducive to evaluation in toxicity screening; and 5) the differentiation of insulin-secreting β-cells can be completed in a very short time, such as 1 day, which is economically satisfactory.

[0249] In one case, treating mammalian trophoblast stem cells with 10 ng / ml fibroblast growth factor (e.g., bFGF) generates approximately 10% insulin-producing cells in the population, which express pancreatic progenitor cell-related markers and islet components. During the cell process, miRNA-124 effectively inhibits Cdx2 and Smad4 and their downstream effector Mixl1, thus guiding the formation of DE and differentiation towards pancreatic progenitor cells. The cells are capable of glucose-stimulated insulin secretion.

[0250] In some embodiments, FGF (e.g., bFGF) phosphorylates CREB1 via RTK activation of the PI3K / Akt pathway. CREB1-p transiently targets the promoter of miR-124. In one case, miR-124 acts in two ways: a) inhibiting Smad4 and Mixil1 for DE formation; and b) inhibiting Cdx2 and in turn activating Oct4 for DE regulation. In one case, FGF (e.g., bFGF) induces the cellular processes mediating mesendoderm, DE, and primitive gut tube to form functional pancreatic progenitor cells in mammalian trophoblast stem cells within one day.

[0251] In some embodiments, the mammalian trophoblast stem cells herein are human trophoblast stem cells (hTS cells).

[0252] miR-124a is also known as miR-124a, mir-124a, microRNA-124a, miRNA-124a, miR-124, mir-124, microRNA-124 or miRNA-124.

[0253] For miR-124, the coding sequences of interest include, but are not limited to, sequences encoding the precursor of miR-124. For example, instances of such coding sequences are reported in the miRBase database, which is hosted and maintained by the School of Life Sciences, University of Manchester, funded by the BBSRC. A given vector may include a single coding sequence or multiple repeats of the coding sequence as needed.

[0254] The precursor of miR-124 can also be found in the miRBase database.

[0255] For example, >hsa-mir-124-1MI0000443

[0256] AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG (SEQ ID NO:3)

[0257] >hsa-mir-124-2MI0000444

[0258] AUCAAGAUUAGAGGCUCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAA (SEQ ID NO:146)

[0259] >hsa-mir-124-3MI0000445

[0260] UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC (SEQ ID NO:147).

[0261] The nucleic acid sequence of miR-124 of the present invention may include fragments or full-length nucleic acid sequences of the nucleic acid sequences of any miR-124 family members, such as those identified in the accompanying drawings, Table 1 and Table 2 of the present invention, for example, those identified in flies (MI0000373), nematode worms (MI0000302), mice (MI0000150) and humans (MI0000443), or those found in miRBase, the microRNA database of the University of Manchester, UK. In some embodiments, anti-miR-124 may have a sequence with any complementarity to the sequence of miR-124, such as miRZip124. In some embodiments, anti-miR-124 is prepared using a miRZip TM lentiviral microRNA knockdown method, such as that produced by System Biosciences.

[0262] Table 1. Examples of miR-124 family members

[0263]

[0264]

[0265]

[0266] Note: The sequence names in Table 1 are represented according to standard naming rules, for example, represented as -5p or -3p.

[0267] Table 2. Examples of miR-124a family members

[0268] Name Accession number Sequence hsa-miR-124-5p MIMAT0004591 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:1) hsa-miR-124-3p MIMAT0000422 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:2) aca-miR-124a MIMAT0021725 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:5) age-miR-124a MIMAT0002466 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:8) bta-miR-124a MIMAT0003811 UAAGGCACGCGGUGAAUGCCAAG(SEQ ID NO:17) ccr-miR-124a MIMAT0026331 UCAAGGUCCGCUGUGAACAC(SEQ ID NO:20) egr-miR-124a MIMAT0020240 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:50) emu-miR-124a MIMAT0020266 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:53) gga-miR-124a MIMAT0001128 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:56) ggo-miR-124a MIMAT0002465 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:59) lla-miR-124a MIMAT0002471 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:64) mdo-miR-124a MIMAT0004102 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:65) mml-miR-124a MIMAT0002470 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:66) mmu-miR-124-3p MIMAT0000134 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:68) mmu-miR-124-5p MIMAT0004527 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:67) odi-miR-124a MIMAT0006082 UAAGGCACGCGGUGAAUGCUAA(SEQ ID NO:73) ppa-miR-124a MIMAT0002467 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:81) ppy-miR-124a MIMAT0002468 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:84) ptr-miR-124a MIMAT0002469 UUAAGGCACGCGGUGAAUGCCA(SEQ ID NO:85) rno-miR-124-3p MIMAT0000828 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:87) rno-miR-124-5p MIMAT0004728 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:86) sme-miR-124a-3p MIMAT0003992 UAAGGCACGCGGUGAAUGCUU(SEQ ID NO:93) sme-miR-124a-5p MIMAT0012112 UGCUUUUAACGCGGAGCUUUAGU(SEQ ID NO:92) ssc-miR-124a MIMAT0002156 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:103)

[0269] Note: The sequence names in Table 2 are represented according to standard naming rules, for example, represented as -5p or -3p.

[0270] Table 3. Promoter sequences of Smad4 shRNA

[0271]

[0272]

[0273] Mammalian trophoblast stem cells

[0274] In some embodiments, the mammalian trophoblast stem cells herein are from rodents (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, bovine, sheep, porcine, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human. In one case, the mammalian trophoblast stem cells herein are not from primates, e.g., monkey, ape, human. In another case, the mammalian trophoblast stem cells herein are from primates, e.g., monkey, ape, human. In another case, the mammalian trophoblast stem cells herein are human or humanized.

[0275] The mammalian trophoblast stem cells herein can be induced to differentiate into one or more differentiated cells. In one case, the differentiated cell is a progenitor cell, e.g., a pancreatic progenitor cell. In one case, the differentiated cell is a pluripotent stem cell. In one case, the differentiated cell is an endoderm, mesoderm, or ectoderm progenitor cell. In one case, the differentiated cell is a definitive endoderm progenitor cell. In one case, the differentiated cell is a pancreatic endoderm progenitor cell. In one case, the differentiated cell is a multipotent progenitor cell. In one case, the differentiated cell is an oligopotent progenitor cell. In one case, the differentiated cell is a unipotent, bipotent, or tripotent progenitor cell. In one case, the differentiated cell is an endocrine, exocrine, or ductal progenitor cell, e.g., an endocrine progenitor cell. In one case, the differentiated cell is a β-cell. In one case, the differentiated cell is an insulin-producing cell. One or more differentiated cells can be used in any of the methods disclosed herein.

[0276] In one aspect, the present disclosure provides one or more differentiated cells isolated by one or more of the methods herein. In one case, the isolated differentiated cell is a human cell. In one case, the isolated differentiated cell has a normal karyotype. In one case, the isolated differentiated cell has one or more immune privileged properties, e.g., low or absent CD33 expression and / or CD133 expression. One or more of the isolated differentiated cells disclosed herein can be used in any of the methods disclosed herein.

[0277] In another aspect, the present disclosure provides isolated progenitor cells that express one or more transcription factors including Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof. In one case, the isolated progenitor cells express two, three, or four transcription factors out of Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1. In one case, the isolated progenitor cells express Foxa2, Pdx1, Ngn3, Ptf1a, and Nkx6.1. In one case, the isolated progenitor cells are induced pluripotent stem cells. In one case, the isolated progenitor cells are derived from mammalian trophoblast stem cells, e.g., hTS cells. In one case, the isolated progenitor cells are pancreatic progenitor cells. In one case, the isolated progenitor cells are endoderm, mesoderm, or ectoderm progenitor cells. In one case, the isolated progenitor cells are definitive endoderm progenitor cells. In one case, the isolated progenitor cells are pancreatic endoderm progenitor cells. In one case, the isolated progenitor cells are pluripotent progenitor cells. In one case, the isolated progenitor cells are oligopotent progenitor cells. In one case, the isolated progenitor cells are unipotent, bipotent, or tripotent progenitor cells. In one case, the isolated progenitor cells are endocrine, exocrine, or ductal progenitor cells, e.g., endocrine progenitor cells. In one case, the isolated progenitor cells are β-cells. In one case, the isolated progenitor cells are insulin-producing cells. In one case, the isolated progenitor cells are from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, bovine, sheep, porcine, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human. In one case, the isolated progenitor cells are human cells. In one case, the isolated progenitor cells have a normal karyotype. In one case, the isolated progenitor cells have one or more immune privileged properties, e.g., low or lack of CD33 expression and / or CD133 expression. The isolated progenitor cells disclosed herein can be used in any method disclosed herein.

[0278] In another aspect, the present disclosure provides isolated progenitor cells that express betacellulin, betacellulin mRNA, C-peptide, and insulin, wherein the isolated progenitor cells are differentiated from mammalian trophoblast stem cells. In one case, the isolated progenitor cells are from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, bovine, sheep, porcine, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human. In one case, the isolated progenitor cells are pancreatic progenitor cells. In one case, the isolated progenitor cells are human cells. In one case, the isolated progenitor cells have a normal karyotype. In one case, the isolated progenitor cells have one or more immune privileged properties, e.g., low or lack of CD33 expression and / or CD133 expression. One or more of the isolated progenitor cells disclosed herein can be used in any method disclosed herein.

[0279] In one case, the isolated progenitor cells of the present invention are insulin-producing cells. One or more isolated progenitor cells of the present invention can be used in any method disclosed herein.

[0280] In one case, the differentiated cells of the present invention are insulin-producing cells. One or more differentiated cells of the present invention can be used in any method disclosed herein.

[0281] Human trophoblast stem cells

[0282] The human fallopian tube is the site of fertilization in females and a common site of ectopic pregnancy, where several biological events occur, such as the distinction between the inner cell mass (ICM) and the trophectoderm, and the transition from totipotency to pluripotency with major epigenetic changes. These observations provide support for the fallopian tube as a niche reservoir for collecting blastocyst-related stem cells during the pre-implantation period. Ectopic pregnancy accounts for 1 to 2% of all pregnancies in industrialized countries and is much higher in developing countries. Considering the lack of availability of human embryonic stem cells (hES cells) and fetal brain tissue, the present invention describes the use of human trophoblast stem cells (hTS cells) derived from ectopic pregnancies as an alternative to the scarcely available hES cells for generating progenitor cells.

[0283] In some embodiments, the hTS cells derived from ectopic pregnancies do not involve the destruction of a human embryo. In another case, the hTS cells derived from ectopic pregnancies do not involve the destruction of a viable human embryo. In another case, the hTS cells are derived from trophoblast tissue associated with a non-viable ectopic pregnancy. In another case, the ectopic pregnancy cannot be saved. In another case, the ectopic pregnancy does not result in a viable human embryo. In another case, the ectopic pregnancy threatens the life of the mother. In another case, the ectopic pregnancy is tubal, abdominal, ovarian, or cervical.

[0284] In some embodiments, during blastocyst development, contact of the ICM with itself or diffusible "inducers" derived therefrom triggers a high rate of cell proliferation in the polar trophectoderm, resulting in movement of cells towards the mural wall region throughout the blastocyst stage and even continuing after the trophectoderm and ICM have become distinct. The mural trophectoderm cells covering the ICM are able to retain the "cellular memory" of the ICM. Typically, at the onset of implantation, due to mechanical constraints from the endometrium, the mural cells opposite the ICM stop dividing. However, such constraints do not exist in the fallopian tube, leading to continued division of the polar trophectoderm cells to form the extraembryonic ectoderm (ExE) in the arrested ectopic pregnancy blastocyst. In some embodiments, ExE-derived TS cells are in a proliferative state for a window period of at least 4 days, depending on the interaction of fibroblast growth factor 4 (FGF4) secreted by the ICM with its receptor fibroblast growth factor receptor 2 (Fgfr2). In another scenario, ExE-derived TS cells are in a proliferative state for a window period of at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days. Until clinical intervention occurs, these cellular processes can generate an unlimited number of hTS cells in pre-implantation embryos; these cells retain the cellular memory from the ICM, which is reflected by the expression of ICM-related genes.

[0285] One aspect provided herein uses Affymetrix TMA platform was used to interrogate the GeneChip Human Genome U133plus 2.0 GeneChip for total gene comparison between hTS cells and placenta-derived mesenchymal stem (PDMS) cells, and the distinction between hTS cells and PDMS cells was described. In some embodiments, hTS cells exhibited approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, or approximately 75% less gene expression than in PDMS cells. In another case, hTS cells showed a total of 2,140 genes (fold change > 2-fold), which was approximately 40% less than in PDMS cells (3,730 genes). In some embodiments, the gene intensity distribution of hTS cells showed a different uniform pattern than in PDMS cells. In another case, hTS cells represented different groups of cytotrophoblasts in the pre-implantation period, whereby they had the molecular portrait of the inner cell mass (ICM) and / or trophectoderm. In another case, hTS cells exhibited pluripotency and self-renewal characteristics similar to hES cells. Methods for obtaining and isolating mammalian trophoblast stem cells

[0286] In some embodiments, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from the umbilical cord, amniotic fluid, amnion, Wharton's jelly, chorionic villi, placenta, or ectopic pregnancy.

[0287] In one case, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from an amniocentesis biopsy or from amniotic fluid. In one case, amniocentesis can be a procedure for obtaining a small sample of the amniotic fluid surrounding the fetus during pregnancy. In one case, amniocentesis can be offered to women between 15 and 20 weeks of pregnancy who are at increased risk of chromosomal abnormalities, such as women over 35 years of age at delivery, or those who have had an abnormal maternal serum (blood) screening test that shows an increased risk of chromosomal abnormalities or neural tube defects. In one case, a needle, such as a long, thin, hollow needle, can be used under ultrasound guidance to enter the uterus and amniotic sac through the abdomen. A predetermined amount of amniotic fluid, such as 1 ounce, can be aspirated into a syringe.

[0288] In another case, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be obtained from a blastomere biopsy during preimplantation genetic diagnosis (PGD), for example, in combination with reproductive therapies such as in vitro fertilization (IVF). In one case, the cells of the present disclosure can be generated by a method for biopsy of a blastocyst, where the remainder of the blastocyst is implanted and results in pregnancy and subsequently in a live birth, such as by removing the zona pellucida from the blastocyst and subsequently performing a biopsy on the blastocyst.

[0289] In another case, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be obtained from prenatal chorionic villus sampling (CVS). In one case, CVS can be a prenatal test involving obtaining a tissue sample from the placenta to test for chromosomal abnormalities and certain other genetic problems. In one case, CVS can be performed at 10 to 12 weeks of gestation. In one case, the CVS procedure is transcervical, for example, inserting a catheter through the cervix into the placenta to obtain a tissue sample. In one case, the CVS procedure is transabdominal, for example, inserting a needle through the abdomen and uterus into the placenta to obtain a tissue sample.

[0290] In one case, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be obtained from a placental biopsy after full-term pregnancy. In one case, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from the placenta after vaginal delivery or cesarean section.

[0291] In some embodiments, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from early pregnancy chorionic villus sampling (e.g., 8 +3 to 12 +0 weeks gestational age) or from a full-term placenta from a cesarean section. The chorionic tissue can be isolated from the amnion that has been minced and / or enzymatically digested (e.g., with 0.05% trypsin-EDTA, for example, for 20 min). Subsequently, the cells are centrifuged (e.g., at 1500 rpm, for example, for 5 min), counted, and / or re-plated (e.g., 10 2 per 4 cm

[0292] In one case, mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from a term (e.g., 38–40 weeks gestation) placenta according to the following procedure. Drain the cord blood from the placenta and then carefully cut the placenta. Wash the collected tissue pieces several times (in phosphate buffered saline) and then mince (e.g., mechanically) and subject to enzymatic digestion (e.g., with 0.25% trypsin-EDTA). Subsequently, homogenize by centrifugation and resuspend in complete medium (e.g., Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and / or 100 μg / ml streptomycin). Maintain the cell culture under suitable conditions, such as 37°C and a water-saturated atmosphere with 5% CO 2 . Replace the medium regularly, e.g., 1 to 2 times per week. When the cells reach the desired confluence level, e.g., greater than 80% confluence, harvest the cells with, e.g., 0.25% trypsin / EDTA and re-plate at a dilution, e.g., 1:3.

[0293] In another case, mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure can be isolated from a post-partum human placenta according to the following procedure. Separate the chorion from the amnion by peeling them apart. Scrape off the decidual tissue (e.g., mechanically) and wash (e.g., in Dulbecco's phosphate buffered saline), then cut into small pieces (e.g., -2×2 cm). Mince the chorion into small pieces and subject to enzyme (e.g., 0.5% trypsin-EDTA, e.g., for 5 min), followed by digestion with collagenase I (e.g., at 0.3% in a 37°C incubator for 20 to 30 min). Then collect the mobilized cells and pass them through a cell strainer (e.g., 100 μm). Collect the filtered cells by centrifugation (e.g., at 2,500 rpm, e.g., for 5 min). Resuspend the cells in medium (e.g., α-modified minimal essential medium supplemented with 10% fetal bovine serum and / or 1% penicillin-streptomycin) and culture in a container (e.g., a T25 flask) under suitable conditions (e.g., at 37°C and / or 5% CO 2 ). Replace the medium regularly, e.g., every 3 days, until the chorionic MSC reaches the desired confluence level, e.g., 70% confluence.

[0294] In another case, the present disclosure also provides a method for obtaining mammalian trophoblast stem cells (e.g., hTS cells), the method comprising: (a) obtaining an embryo at the fallopian tube of an ectopic pregnancy (e.g., pregnancy at 4 - 6, 5 - 7, or 6 - 8 weeks); and (b) obtaining stem cells from the chorionic trophoblast of the embryo. In some embodiments, the embryo can be obtained from an unruptured ectopic pregnancy. In some embodiments, the unruptured ectopic pregnancy can be at a stage less than 6 weeks post-fertilization. The chorionic trophoblast can comprise cytotrophoblasts.

[0295] In another case, embryonic chorionic villi can be obtained from the fallopian tube of an unruptured pre-implantation embryo of a female with an ectopic pregnancy (e.g., gestational age: 5 - 7 weeks). The fine villous tissue can be minced completely in a suitable medium (e.g., serum-free α-MEM) and identified under a microscope, then trypsinized (e.g., with 0.025% trypsin / EDTA) for a period of time (e.g., 15 min), and subsequently a medium (e.g., α-MEM containing 10% FBS) is added to stop the reaction. The adherent cells can be obtained and cultured under suitable conditions (e.g., in conditioned α-MEM, 10% FBS, and 1% penicillin-streptomycin at 37 °C in 5% CO 2 2). After two passages, the level of hCG becomes undetectable when measured using a commercial kit (e.g., Dako, Carpinteria, CA).

[0296] Method for differentiating mammalian trophoblast stem cells

[0297] In one aspect among many aspects, the present disclosure provides a method for differentiating mammalian trophoblast stem cells, the method comprising modulating miR-124 to induce the differentiation of mammalian trophoblast stem cells into differentiated cells. In one case, the mammalian trophoblast stem cells are human trophoblast stem (hTS) cells. In one case, the differentiated cells are pluripotent stem cells. In one case, the differentiated cells are progenitor cells, such as pancreatic progenitor cells. In one case, the differentiated cells are endoderm, mesoderm, or ectoderm progenitor cells, such as definitive endoderm progenitor cells. In one case, the differentiated cells are pancreatic endoderm progenitor cells. In one case, the differentiated cells are pluripotent progenitor cells. In one case, the differentiated cells are oligopotent progenitor cells. In one case, the differentiated cells are unipotent, bipotent, or tripotent progenitor cells. In one case, the differentiated cells are endocrine, exocrine, or ductal progenitor cells, such as endocrine progenitor cells. In one case, the differentiated cells are β-cells. In one case, the differentiated cells are insulin-producing cells. One or more differentiated cells can be used in any method disclosed herein.

[0298] In some embodiments, the mammalian trophoblast stem cells herein are from rodents (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, bovine, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human.

[0299] In some embodiments, the modulation activates miR-124. In one case, the modulation activates miR-124 spatiotemporally, for example, at the definitive endoderm stage, between about 1 hour and about 8 hours. In one case, the modulation enhances miR-124 expression. In one case, the modulation inactivates miR-124. In one case, the modulation reduces miR-124 expression. In one case, the modulation comprises contacting mammalian trophoblast stem cells with one or more agents such as proteins or steroid hormones. In one case, the one or more agents comprise growth factors, such as fibroblast growth factor (FGF). In one case, the FGF is one or more of FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, or FGF10. In one case, the one or more agents comprise FGF2 (basic fibroblast growth factor, bFGF). In one case, the modulation comprises contacting mammalian trophoblast stem cells with FGF (such as bFGF) at no greater than about 200 ng / mL, such as 100 to 200 ng / mL. In one case, the modulation comprises contacting mammalian trophoblast stem cells with FGF (such as, bFGF) at no greater than about 100 ng / mL, such as about 0.1 to 1 ng / mL; or about 1 to about 100 ng / mL of FGF (such as bFGF). In one case, the concentration of FGF (such as, bFGF) used herein is about: 0.1-1, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 ng / mL. In one case, the concentration of FGF (such as, bFGF) used herein is about: 0.1, 0.2, 0.4, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, or 90 ng / mL. In one case, the one or more agents further comprise an antioxidant or a reducing agent (such as, 2-mercaptoethanol). In one case, the one or more agents further comprise a vitamin (such as, nicotinamide). In one case, the modulation comprises contacting mammalian trophoblast stem cells with FGF (such as, bFGF), 2-mercaptoethanol, and nicotinamide. In one case, the concentration of the antioxidant / reducing agent (such as, 2-mercaptoethanol) is no greater than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In one case, the concentration of the antioxidant / reducing agent (such as, 2-mercaptoethanol) is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, or 9-10 mmol / L.In one case, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, or 9 mmol / L. In one case, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is about 1 mmol / L. In one case, the concentration of the vitamin (e.g., nicotinamide) is no greater than about 100 mmol / L, e.g., about 1 to about 100 mmol / L. In one case, the concentration of the vitamin (e.g., nicotinamide) is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 mmol / L. In one case, the concentration of the vitamin (e.g., nicotinamide) is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, or 90 mmol / L. In one case, the concentration of the vitamin (e.g., nicotinamide) is about 10 mmol / L.

[0300] In one case, the modulation includes contacting mammalian trophoblast stem cells with one or more agents to modulate the activity or expression level of cAMP response element-binding protein 1 (CREB1). In one case, the one or more agents modulate CREB1 phosphorylation. In one case, the one or more agents include vitamin metabolites, such as retinoic acid. In one case, the one or more agents include CREB1-binding protein. In one case, the one or more agents modulate one or more factors including mixl1, Cdx2, Oct4, Sox17, Foxa2, or GSK3β.

[0301] In one case, the one or more agents include exogenous miR-124 precursor or exogenous anti-miR-124. In one case, mammalian trophoblast stem cells are transfected with exogenous miR-124 precursor or exogenous anti-miR-124. In one case, the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO:158) of the promoter of miR-124 is modulated.

[0302] In some embodiments, miR-124 is miR-124a, miR-124b, miR-124c, miR-124d, or miR-124e. In one case, miR-124 is miR-124a, such as Homo sapiens miR-124a (hsa-miR-124a). In one case, miR-124a is hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof. In one case, miR-124a is hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In one case, miR-124 comprises a sequence selected from Table 1, Table 2, and the accompanying drawings, or a fragment thereof.

[0303] In one case, mammalian trophoblast stem cells differentiate into differentiated cells within one day after the start of regulation.

[0304] In some embodiments, induction of differentiation of mammalian trophoblast stem cells includes culturing undifferentiated mammalian trophoblast stem cells in a medium containing a growth factor (e.g., bFGF) under conditions sufficient to induce differentiation (e.g., 12, 24, 48, 76, or 96 hours). The medium may further comprise serum (e.g., FBS), carbohydrates (e.g., glucose), antioxidant / reducing agents (e.g., β-mercaptoethanol), and / or vitamins (e.g., nicotinamide). The yield of differentiated cells is measured, e.g., insulin as an indicator of pancreatic progenitor cells + / Ngn3 + cells or insulin + / glucagon + cells. In one case, for example, as indicated by Western blot analysis, FBS is positively correlated with insulin levels during FGF (e.g., bFGF) induction.

[0305] In some embodiments, upon cell induction (e.g., by bFGF), a time-course analysis can be performed, e.g., for 4, 8, 16, 24, 32, 40, or 48 hours, to monitor the levels of transcription factors that mark the cascading stages of cell differentiation and development. In some embodiments, a declining Mixl1 and high levels of T and Gsc may indicate a transition from mammalian trophoblast stem cells to mesendoderm. In some embodiments, the dominant pluripotent transcription factors at each differentiation stage include Cdx2 for mesendoderm, Oct4 or Nanog for DE, Cdx2 or Nanog for primitive endoderm, or Sox2 for pancreatic progenitor cells. In some embodiments, FGF (e.g., bFGF) induces the pleiotropic functions of miR-124a by upregulating Oct4, Sox17, or Foxa2, but downregulating Smad4 or Mixl1 at the DE stage.

[0306] In some embodiments, during cell differentiation, a time-course analysis (e.g., for 4, 8, 16, 24, 32, 40, or 48 hours) is also used to measure the levels of proteins or hormones specific to the target differentiated cells. For example, for production of pancreatic progenitor cells, prohormone convertase 2, C-peptide, and insulin are measured, e.g., using qPCR assays.

[0307] In some embodiments, growth factors are used herein to induce the differentiation of mammalian trophoblast stem cells. In one case, the growth factor is FGF (e.g., bFGF), bone morphogenetic protein (BMP), or vascular endothelial growth factor (VEGF). In some embodiments, the effective amount of the growth factor is no greater than about 100 ng / ml, e.g., about: 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 ng / mL. In one case, the mammalian trophoblast stem cells are hTS cells.

[0308] In some embodiments, the culture medium used herein for differentiating mammalian trophoblast stem cells may further comprise an effective amount of a second agent that acts in synergy with the first agent to induce differentiation towards the mesendoderm lineage. In some embodiments, the first and second agents are different growth factors. In some embodiments, the first agent is added to the culture medium before the second agent. In some embodiments, the second agent is added to the culture medium before the first agent. In one case, the first agent is FGF (e.g., bFGF). In some embodiments, the second agent is BMP, such as BMP2, BMP7, or BMP4, added before or after the first agent. In some embodiments, the effective amount of BMP is no greater than about 100 ng / ml, such as about: 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 ng / mL. In one case, the mammalian trophoblast stem cells are hTS cells.

[0309] In some embodiments, the culture medium used herein for differentiating mammalian (e.g., human) trophoblast stem cells may comprise feeder cells. Feeder cells are a type of cell that is co-cultured with another type of cell to provide an environment in which the second type of cell can grow.

[0310] In some embodiments, the culture medium used herein is free or substantially free of feeder cells.

[0311] In some embodiments, a GSK-3 inhibitor is used to induce the differentiation of mammalian (e.g., human) trophoblast stem cells.

[0312] Drug Compositions and Administration

[0313] In some embodiments, provided herein are compositions comprising the differentiated cells of the present disclosure. In one case, the composition further comprises a buffer solution or a pharmaceutically acceptable carrier, which is provided to maintain the biological activity of mammalian trophoblast stem cells (e.g., hTS cells). By way of example and not limitation, the buffer solution is saline, PBS (phosphate-buffered saline), or FBS (fetal bovine serum) buffer.

[0314] In some embodiments, the compositions of the present disclosure further comprise a therapeutic compound. By way of example and not limitation, the therapeutic compound is a chemical, an antibody, or a fragment thereof.

[0315] In some embodiments, the compositions of the present disclosure can be administered by injection, transplantation, or surgical procedure.

[0316] In some embodiments, the patient is a mammal. In some embodiments, the mammals herein are rodents (e.g., mice, rats, guinea pigs, hamsters, or squirrels), rabbits, cows, sheep, pigs, dogs, cats, monkeys, apes (e.g., chimpanzees, gorillas, or orangutans), or humans. In one case, the patient is a human.

[0317] In some embodiments, the present disclosure provides a composition for treating or preventing diabetes, the composition comprising mammalian trophoblast stem cells (e.g., hTS cells) or differentiated cells as described above. In one case, the mammalian trophoblast stem cells (e.g., hTS cells) are obtained from an embryo of an ectopic pregnancy. The diabetes is type 1 diabetes, type 2 diabetes, or latent autoimmune diabetes in adults (LADA).

[0318] In some embodiments, the present disclosure provides a composition for treating or preventing a neurological disease, the composition comprising mammalian trophoblast stem cells (e.g., hTS cells) or differentiated cells. In one case, the mammalian trophoblast stem cells herein are obtained from an embryo of an ectopic pregnancy. The neurological disease is a neurodegenerative disease. A neurodegenerative disease can refer to any condition characterized by a progressive loss of neurons in the central nervous system of a subject due to cell death. In one case, the neurodegenerative disease is Parkinson's disease, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple system atrophy, Lewy body dementia, peripheral sensory neuropathy, or spinal cord injury. In one case, the neurodegenerative disease is Parkinson's disease.

[0319] The modes of administration of the isolated stem cell preparations described herein include, but are not limited to, systemic intravenous injection and direct injection into the intended site of activity. The preparation can be administered by any convenient route, such as by infusion or bolus injection, and can be administered together with other bioactive agents. In one case, the administration is systemic topical administration.

[0320] In some embodiments, the stem cell preparation or composition is formulated as a pharmaceutical composition suitable for intravenous administration to mammals, including humans. In one case, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. When needed, the composition further includes a local anesthetic to relieve any pain at the injection site. When the composition is to be administered by infusion, it can be dispensed in an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided to allow the components to be mixed before administration.

[0321] In some embodiments, suitable pharmaceutical compositions comprise a therapeutically effective amount of progenitor stem cells and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, and combinations thereof.

[0322] In some embodiments, the isolated stem cells are delivered to a target site (e.g., the pancreas, brain, spinal cord, or any other site of nerve injury and / or degeneration) via a delivery system adapted to target the cells to a specific tissue. For example, the cells are encapsulated in a delivery vehicle that permits slow release of the cells at the target site. The delivery vehicle is modified such that it specifically targets a particular tissue. The surface of the targeted delivery system is modified in a variety of ways. In the case of a liposome targeted delivery system, lipid groups are incorporated into the lipid bilayer of the liposome to maintain a stable association of the targeting ligand with the liposome bilayer.

[0323] In another example, colloidal dispersion systems are used. Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0324] In some embodiments, administration of the stem cells described herein is optionally tailored for an individual by: (1) increasing or decreasing the amount of cells injected; (2) changing the number of injections; (3) changing the method of delivering the cells; or (4) changing the cell source, e.g., by genetically engineering the cells, or from in vitro cell culture.

[0325] In some embodiments, the stem cell preparation is used in an amount effective to facilitate engraftment of the cells in the recipient. The administration is adjusted, at the discretion of the physician, to achieve optimal efficacy and pharmacological dosing.

[0326] Screening methods

[0327] Methods for screening compounds for the treatment or prevention of a disease are provided herein. In one instance, the method comprises contacting an isolated mammalian trophoblast stem cell or a differentiated cell thereof with the compound. In another instance, the method further comprises detecting a change in the activity of at least one gene, transcript, or protein in the mammalian trophoblast stem cell or differentiated cell. In another instance, the method further comprises detecting a change in the level of at least one transcript or protein in the mammalian trophoblast stem cell or differentiated cell. In another instance, the method comprises detecting a change in the activity of at least one gene, transcript, or protein in the mammalian trophoblast stem cell or differentiated cell. In some embodiments, the disease is related to an insulin disorder, such as diabetes. In some embodiments, the mammalian trophoblast stem cell is an hTS cell. In some embodiments, the differentiated cell is a pancreatic progenitor cell. In some embodiments, the differentiated cell is an insulin-producing cell.

[0328] One situation provided herein describes a method for screening compounds for their ability to modulate cellular changes. In another situation, the method includes contacting isolated mammalian trophoblast stem cells (e.g., hTS cells) with the compound and detecting induction of growth and differentiation of the mammalian trophoblast stem cells. In one situation, the method includes contacting the differentiated cells herein (e.g., progenitor cells) with the compound and detecting changes in cell proliferation or cell function. In some embodiments, the isolated progenitor cells are pancreatic progenitor cells. In some embodiments, the isolated progenitor cells are insulin-producing cells.

[0329] In some embodiments, provided herein is a method for screening compounds for their ability to modulate pancreatic cell function (e.g., β-cell function), the method including combining the compound with the pancreatic progenitor cells or differentiated cells herein, determining any phenotypic or metabolic changes in the cells, and correlating the changes with the ability of the compound to modulate the secretion of insulin, glucagon, or betacellulin.

[0330] Also provided herein is a method for screening compounds for cytotoxicity to cells, the method including contacting the differentiated cells herein with the compound. In another situation, the method further includes determining the phenotypic or metabolic changes in the cells caused by contacting with the compound and correlating the changes with cytotoxicity or any other changes in cell function or biochemistry. In another situation, screening of therapeutic compounds, toxins, or potential differentiation modulators is facilitated. These substances (e.g., therapeutic compounds, toxins, or potential modulators) can be added to the culture medium.

[0331] Also provided herein are methods for screening for proliferation factors, differentiation factors, and therapeutic compounds. In one situation, mammalian trophoblast stem cells are used to screen for factors (e.g., small molecule drugs, peptides, polynucleotides, etc.) or conditions (e.g., culture conditions or manipulations) that affect the properties of mammalian trophoblast stem cells or differentiated cells in culture. In one situation, the system has the advantage of not being complicated by secondary effects caused by interference of the test compound with feeder cells. In another situation, substances that affect growth are tested. In another situation, the conditioned medium is removed from the culture and replaced with a simpler medium. In another situation, different wells are subsequently treated with different mixtures of soluble factors that are candidates for components of the replacement conditioned medium. If the treated cells are maintained and proliferated in a satisfactory manner (optimally also in the conditioned medium), the efficacy of each mixture is determined. Potential differentiation factors or conditions can be tested by treating the cells according to a test protocol and subsequently determining whether the treated cells develop the functional or phenotypic properties of differentiated cells of a particular lineage. In some embodiments, the mammalian trophoblast stem cells are hTS cells.

[0332] In some embodiments, the mammalian trophoblast stem cells (e.g., hTS cells) of the present disclosure are used to screen for potential regulators of cell differentiation. In one case, the cell differentiation is pancreatic differentiation. For example, in an assay for screening regulators of cell differentiation, mammalian trophoblast stem cells can be cultured, as needed, under serum-free, low-density conditions, in the presence or absence of LIF, in the presence of a regulator, and in the presence or absence of RA, and the effect on differentiation can be detected. In another case, the screening methods described herein can be used to study conditions related to cell development and to screen for potential therapeutic or corrective agents or regulators of such conditions. For example, in one case, the development of normal mammalian trophoblast stem cells is compared to the development of cells having the condition. In some embodiments, the mammalian trophoblast stem cells are hTS cells.

[0333] In some embodiments, gene and protein expression can be compared between different cell populations obtained from mammalian trophoblast stem cells (e.g., hTS cells) and used to identify and characterize factors that are upregulated or downregulated during differentiation and to generate nucleotide copies of the affected genes.

[0334] In some embodiments, feeder-free mammalian trophoblast stem cell cultures can also be used to test drug compounds in drug research. Evaluation of the activity of a candidate drug compound typically involves combining the differentiated cells of the present disclosure with the candidate compound, determining any resulting changes, and subsequently correlating the effect of the compound with the observed changes. In another case, for example, the screening is done because the compound is designed to have a pharmacological effect on certain cell types or because the compound is designed to have an effect that has an unintended side effect in other contexts. In another case, two or more drugs are tested in combination (by combining with the cells either simultaneously or sequentially) to detect possible drug-drug interaction effects. In another case, the compound is screened for potential toxicity at the outset. In another case, cytotoxicity depends on the effect on cell viability, survival, morphology, the expression or release of certain markers, receptors or enzymes, and the effect on DNA synthesis or repair. In some embodiments, the mammalian trophoblast stem cells are hTS cells.

[0335] Treatment of diseases

[0336] In one aspect, the present disclosure provides a method of treating or preventing a disease in a mammal in need thereof, the method comprising administering a cell of the present disclosure (e.g., an isolated progenitor cell) to the mammal in need thereof. In one instance, the cell is immune privileged. In one instance, the cell has low levels of CD33 expression and / or CD133 expression. In one instance, the administering comprises injection, implantation, or surgical manipulation. In one instance, the disease is an insulin disorder. In one instance, the disease is diabetes, e.g., type 1 diabetes or type 2 diabetes. In one instance, the mammal in need thereof is a rodent, rabbit, cow, sheep, pig, dog, cat, monkey, or ape. In some embodiments, the rodent of the present disclosure is a mouse, rat, guinea pig, hamster, or squirrel. In some embodiments, the ape of the present disclosure is a chimpanzee, gorilla, or orangutan. In one instance, the mammal in need thereof has one or more symptoms associated with diabetes, such as polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infections, fatigue, slow healing of wounds or ulcers, and any combination thereof.

[0337] In one aspect, the present disclosure provides a method of treating or preventing a disease or condition, the method comprising administering to a subject in need thereof an effective amount of isolated mammalian trophoblast stem cells or differentiated cells prepared by the methods of the present invention disclosed herein. In one instance, the disease is an immunodeficiency disease, a neurological disease, a hematopoietic disease, cancer, or diabetes.

[0338] In some embodiments, the present disclosure provides a method of generating insulin-secreting cells for treating, e.g., a diabetic patient with the isolated mammalian trophoblast stem cells or differentiated cells of the present disclosure.

[0339] In some embodiments, the diabetes of the present disclosure can refer to any metabolic defect in the production and utilization of carbohydrates (e.g., glucose) or any insulin disorder.

[0340] In some embodiments, a diabetic patient has type 1 diabetes, type 2 diabetes, gestational diabetes, or latent autoimmune diabetes in adults (LADA). In type 1 diabetes or insulin-dependent diabetes mellitus (IDDM), the patient produces little or no insulin (the hormone that regulates glucose utilization). In type 2 diabetes or non-insulin-dependent diabetes mellitus (NIDDM), the patient typically has the same or even elevated plasma insulin levels compared to non-diabetic subjects, but has developed resistance to the insulin-stimulated effects on glucose and lipid metabolism in the major insulin-sensitive tissues, which are muscle, liver, and adipose tissue, and the plasma insulin levels are not sufficient to overcome significant insulin resistance when increased. Gestational diabetes (or gestational glycemia, GDM) can be a condition in which women without a previously diagnosed diabetes exhibit hyperglycemic levels during pregnancy. Latent autoimmune diabetes in adults (LADA) can be a condition in which type 1 diabetes develops in adults.

[0341] In some embodiments, the cells, compositions, and methods herein can be used to treat or prevent diabetes (e.g., diabetes, diabetic nephropathy, diabetic neuropathy, diabetic angiopathy, and microangiopathy), hyperglycemia, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL, high LDL, metabolic syndrome (dyslipidemia), systemic and pulmonary hyperfunction), cardiovascular diseases (e.g., cardiac fibrosis, cardiac hypertrophy, and heart failure, arteriosclerosis after myocardial infarction), kidney diseases (e.g., glomerulosclerosis, nephrosclerosis, nephritis, nephrosis, electrolyte excretion disorders), and / or fibrotic and inflammatory processes (e.g., cirrhosis, pulmonary fibrosis, fibrotic pancreatitis, rheumatism, and osteoarthritis (arthroses), Crohn's disease, chronic bronchitis, radiation fibrosis, scleroderma, cystic fibrosis, scar formation, Alzheimer's disease). The cells, compositions, and methods herein can also inhibit cancer, the growth of tumor cells, and tumor metastasis and are thus applicable to tumor treatment.

[0342] In some embodiments, the cells, compositions, and methods herein can be used to treat insulin resistance syndrome in subjects with type 2 diabetes or impaired glucose tolerance or a family history of diabetes and at least one of the following conditions: dyslipidemia, hypertension, hyperuricemia, prothrombotic state, atherosclerosis, and abdominal obesity.

[0343] In some embodiments, the cells, compositions, and methods herein can be used to treat or prevent one or more diabetes-related conditions, including metabolic syndrome (syndrome X or hyperglycemia, hypertension, obesity, dyslipidemia), hyperglycemia, hyperinsulinemia, impaired glucose tolerance, reduced fasting glucose, insulin resistance, obesity, atherosclerosis, cardiovascular disease, cerebrovascular disease, peripheral vascular disease, lupus, polycystic ovary syndrome, carcinogenesis, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic macular edema, and proliferation.

[0344] In some embodiments, the cells, compositions, and methods herein can be used to treat or prevent one or more diseases, conditions, and disorders, including: (1) hyperglycemia, (2) low glucose tolerance, (3) insulin resistance, (4) obesity, (5) lipid disorders, (6) dyslipidemia, (7) hyperlipidemia, (8) hypertriglyceridemia, (9) hypercholesterolemia, (10) low HDL levels, (11) high LDL levels, (12) atherosclerosis and its sequelae, (13) restenosis, (14) irritable bowel syndrome, (15) inflammatory bowel disease, including Crohn's disease and ulcerative colitis, (16) other inflammatory conditions, (17) pancreatitis, (18) abdominal obesity, (19) neurodegenerative diseases, (20) retinopathy, (21) nephropathy, (22) neuropathy, (23) syndrome X, (24) ovarian hyperandrogenism (polycystic ovary syndrome), and other conditions in which insulin resistance is a component.

[0345] In some embodiments, the cells, compositions, and methods herein can be used, for example, in combination with antilipemic agents to treat or prevent cardiovascular disease (CVD). Examples of antilipemic agents include statin compounds, which are cholesterol synthesis inhibitors (e.g., cerivastatin, pravastatin, simvastatin, lovastatin, atorvastatin, fluvastatin, itavastatin, or salts thereof, etc.); squalene synthase inhibitors; or fibrate compounds having triglyceride-lowering effects (e.g., bezafibrate, clofibrate, binifibrate, clinofibrate, etc.).

[0346] In some embodiments, the cells, compositions, and methods herein can be used, for example, in combination with antihypertensive agents to treat or prevent abnormal blood vessel growth and renal sodium retention caused by high insulin levels and thereby reduce hypertension. Examples of antihypertensive agents include angiotensin-converting enzyme inhibitors (e.g., captopril, enalapril, delapril), angiotensin II antagonists (e.g., candesartan cilexetil, losartan, eprosartan, valsantan, telmisartan, irbesartan, tasosartan), calcium antagonists (e.g., manidipine, nifedipine, nicardipine, amlodipine, ifenprodil), and clonidine.

[0347] In some embodiments, the cells, compositions, and methods herein can be used in combination with, for example, anti-obesity agents. Examples of anti-obesity agents include anti-obesity drugs that act on the central nervous system (e.g., dexfenfluramine, fenfluramine, phentermine, sibutramine, anfepramon, dexamphetamine, mazindol, phenylpropanolamine, chlorbenzorex), pancreatic lipase inhibitors (e.g., orlistat), β-3 agonists (e.g., CL-316243, SR-58611-A, UL-TG-307, SB-226552, AJ-9677, BMS-196085, AZ-40140), anorectic peptides (e.g., leptin), CNTF (ciliary neurotrophic factor), and cholecystokinin agonists (e.g., lintitript, FPL-15849).

[0348] In some embodiments, provided herein are methods of treating neurodegenerative diseases, the methods comprising administering to a patient an effective amount of trophoblast stem cells or differentiated cells thereof. Mammalian trophoblast stem cells are obtained from trophoblast villi at the fallopian tube of an ectopic pregnancy. In one case, the neurodegenerative disease is Parkinson's disease, Huntington's disease, Alzheimer's disease, or chemically induced neuronal injury.

[0349] In some embodiments, provided herein are methods of treating a disorder, the methods comprising transplanting into a patient in need thereof a complex of a pure neuronal population or a population of specific neural stem cells generated by the methods herein. In one case, the patient is diagnosed with a neurological disease. In another case, the patient is diagnosed with a neuropsychiatric disorder. In another case, the patient is diagnosed with a neurodegenerative disorder. In another case, the pure neuronal population comprises dopaminergic neurons.

[0350] In one case, the disease is a neurological disease. In another case, the disease is a neurodegenerative disease or disorder. Non-limiting examples of neurological disorders include Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, Lewy body disease, spinal muscular atrophy, multiple system atrophy, dementia, schizophrenia, paralysis, multiple sclerosis, spinal cord injury, brain injury (e.g., stroke), cranial nerve disorders, peripheral sensory neuropathy, epilepsy, prion disorders, Creutzfeldt-Jakob disease, Alper's disease, cerebellar / spinocerebellar degeneration, Batten disease, corticobasal degeneration, Bell's palsy, Guillain-Barre Syndrome, Pick's disease, and autism.

[0351] In some embodiments, the methods described herein can be used to alleviate or improve the symptoms of a neurological disease or disorder. Non-limiting examples of symptoms associated with a neurological disease or disorder include tremors, gait disorders, maldispositional gait, dementia, excessive swelling (edema), muscle weakness, atrophy of the lower extremities, dyskinesia (chorea), muscle rigidity, slowness of physical movement (bradykinesia), loss of physical movement (akinesia), forgetfulness, impaired cognition (intellect), loss of cognition (agnosia), impaired function such as decision-making and planning, hemifacial paralysis, sensory loss, numbness, tingling, painful paresthesia of the extremities, weakness, cranial nerve palsy, dysarthria, eye movement, visual field defect, blindness, bleeding, exudates, proximal muscle atrophy, movement disorders, tonic abnormalities of limb muscles, hypomyotonia, incoordination, false pointing in finger-to-finger or finger-to-nose tests, dysmetria, Holmes-Stewart phenomenon, incomplete or complete general paralysis, optic neuritis, multiple vision, ocular motor disturbance such as nystagmus, spastic paralysis, painful tonic seizures, Lhermitte syndrome, ataxia, stuttering, vesicorectal disturbance, orthostatic hypotension, decreased motor function, enuresis, poor speech expression, poor sleep patterns, sleep disorders, appetite disorders, weight changes, psychomotor agitation or retardation, decreased energy, feelings of worthlessness or excessive or inappropriate guilt, difficulty thinking or concentrating, recurrent thoughts of death or suicidal ideation or attempts, fear, anxiety, irritability, rumination or obsessive compulsive ruminations, excessive concern about physical health, panic attacks, and phobias.

[0352] In some embodiments, the methods herein can be used to treat or prevent cancer, wherein the cancer is carcinoma. Further, the carcinoma is adenocarcinoma or choriocarcinoma. In one case, the choriocarcinoma is malignant syncytioma.

[0353] Production of insulin, C-peptide, betacellulin protein, and betacellulin mRNA

[0354] In one aspect, the present disclosure provides a method for generating insulin, the method comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby generating progenitor cells that secrete insulin in response to glucose stimulation. In another aspect, the present disclosure provides a method for generating betacellulin protein and / or betacellulin mRNA, the method comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby generating pancreatic progenitor cells that produce betacellulin protein and / or betacellulin mRNA. In one instance, the betacellulin protein or betacellulin mRNA is produced during a period of about 12-28 hours after induction, such as during about 12-16, 16-20, 20-24, or 24-28 hours after induction. In one instance, the progenitor cells are pancreatic progenitor cells. In one instance, the progenitor cells produce C-peptide and / or insulin.

[0355] In some embodiments, the mammalian trophoblast stem cells are hTS cells. In some embodiments, the mammalian trophoblast stem cells of the present disclosure are from a rodent (e.g., mouse, rat, guinea pig, hamster, or squirrel), rabbit, bovine, ovine, porcine, canine, feline, monkey, or ape (e.g., chimpanzee, gorilla, or orangutan).

[0356] In some embodiments, miR-124 is activated spatiotemporally at the definitive endoderm stage, e.g., between about 1 hour and about 8 hours at the definitive endoderm stage. In some embodiments, the expression of miR-124 is enhanced. In some embodiments, the one or more agents include a protein or a steroid hormone, such as a growth factor. In some embodiments, the one or more agents include FGF, such as FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, or FGF10. In some embodiments, FGF (e.g., bFGF) is not greater than about 200 ng / mL, e.g., 100 - 200 ng / mL. In some embodiments, FGF (e.g., bFGF) is not greater than about 100 ng / mL, e.g., about 0.1 to 1 ng / mL; or about 1 to about 100 ng / mL. In some embodiments, the concentration of FGF (e.g., bFGF) used herein is about: 0.1 - 1, 1 - 10, 10 - 20, 20 - 30, 30 - 40, 40 - 50, 50 - 60, 50 - 70, 80 - 90, or 90 - 100 ng / mL. In some embodiments, the concentration of FGF (e.g., bFGF) used herein is about: 0.1, 0.2, 0.4, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, or 90 ng / mL. In some embodiments, FGF (e.g., bFGF) is about 10 ng / mL. In some embodiments, the one or more agents further include an antioxidant or a reducing agent (e.g., 2-mercaptoethanol). In some embodiments, the one or more agents further include a vitamin (e.g., nicotinamide). In some embodiments, mammalian trophoblast stem cells are contacted with FGF (e.g., bFGF), 2-mercaptoethanol, and nicotinamide. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is not greater than about 10 mmol / L, e.g., about 0.1 to about 10 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is about: 0.1 - 1, 1 - 2, 2 - 3, 3 - 4, 4 - 5, 5 - 6, 6 - 7, 7 - 8, 8 - 9, or 9 - 10 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, or 9 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is about 1 mmol / L.In some embodiments, the concentration of the vitamin (e.g., niacinamide) is no greater than about 100 mmol / L, such as about 1 to about 100 mmol / L. In some embodiments, the concentration of the vitamin (e.g., niacinamide) is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In some embodiments, the concentration of the vitamin (e.g., niacinamide) is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In some embodiments, the concentration of the vitamin (e.g., niacinamide) is about 10 mmol / L.

[0357] In some embodiments, mammalian trophoblast stem cells are contacted with one or more agents to modulate the activity or expression level of cAMP response element binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the one or more agents include vitamin metabolites, such as retinoic acid. In some embodiments, the one or more agents include CREB1-binding protein. In some embodiments, the one or more agents modulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β.

[0358] In some embodiments, the miR-124 herein is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e, such as miR-124a. In some embodiments, miR-124a is Homo sapiens miR-124a (hsa-miR-124a), such as hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In some embodiments, miR-124 comprises a sequence selected from Table 1, Table 2 and the accompanying drawings or a fragment thereof.

[0359] Regenerative Medicine Research and Therapy

[0360] In some embodiments, the mammalian trophoblast stem cells (e.g., hTS cells) or their differentiated cells herein can be used for the growth and / or generation of organs and / or tissues. In one case, mammalian trophoblast stem cells can be used to generate an organ or tissue or a construct thereof without a scaffold or on a scaffold (e.g., a natural tissue scaffold or a scaffold made of a biodegradable material). In one case, the material in the biologic scaffolds herein can be a hydrogel, such as type I collagen, collagen / fibrin, fibrin, Extracel TM hydrogel, Extracel TM UV, tyramine-substituted hyaluronic acid (TS-NaHy)-Corgel TM , methylcellulose-hyaluronic acid (MC-HA), chitosan, chitosan / collagen, alginate, alginate / gelatin, polyethylene glycol diacrylate (PEGDA), or any combination thereof. In one case, the mammalian trophoblast stem cells herein can be used to generate an organ and / or tissue using 3D cell bioprinting techniques. 3D cell bioprinting techniques include those disclosed in U.S. Patent Application Publication Nos. 20130017564, 2012 / 0190078, 2012 / 0116568, 2011 / 0250688, 2011 / 0136162, and 2009 / 0263849. In one case, 3D cell bioprinting techniques can maintain high cell viability and / or pluripotency, and / or produce spheroids with uniform sizes. In one case, the mammalian trophoblast stem cells herein can be used to generate pancreatic tissue.

[0361] In one case, the mammalian trophoblast stem cells herein can be used to generate a functional pancreas. In some embodiments, the mammalian trophoblast stem cells are hTS cells.

[0362] Examples

[0363] The following examples are non-limiting and only represent various aspects and features of the present invention.

[0364] Example 1

[0365] Isolation of hTS Cells

[0366] This experiment was approved by the Institutional Review Board on Human Subjects Research and Ethics Committees, Kaohsiung Medical University Hospital. hTS cells derived from ectopic pregnancy were obtained from informed consent donors. Embryonic chorionic villi were obtained from the fallopian tubes of unruptured pre-implantation embryos of women with ectopic pregnancy (gestational age: 5 - 7 weeks) approved by the Institutional Review Board on Human Subjects Research and Ethics Committees. The small villous tissues were minced completely in serum-free α-MEM (Sigma-Aldrich, St. Louis, MO), identified under a microscope, then trypsinized with 0.025% trypsin / EDTA (Sigma-Aldrich) for 15 min, and subsequently α-MEM containing 10% FBS was added to stop the reaction. Adherent cells were obtained and cultured in conditioned α-MEM, 10% FBS, and 1% penicillin-streptomycin at 37 °C in 5% CO 2 2. After two passages, the level of hCG became undetectable by measurement with a commercial kit (Dako, Carpinteria, CA).

[0367] Example 2

[0368] In vitro differentiation of hTS cells into pancreatic progenitor cells by modulating miR-124a

[0369] The combination of α-MEM medium containing 5.5 mM glucose, 1 mmol / L β-mercaptoethanol (ME), 10 mmol / L nicotinamide, 20% FBS, and 10 ng / ml bFGF generated 11.2% of the maximum immunoreactive insulin-positive ( Figure 5 ), compared to other combinations that expressed 2.1% and 1.9% insulin-positive cells in the population. bFGF induction was performed using multiple levels of bFGF (i.e., 10, 20, 40, and 80 ng / ml) and FBS (i.e., serum-free, 1%, 5%, 10%, and 20%). The results showed that different doses of bFGF produced 8.6%, 2.2%, and 0.6% insulin + / Ngn3 + cells (Figure 6). Similar results were obtained by using immunoreactive insulin + / glucagon + cells (8.5%) as an indicator ( Figure 7 ). Insulin + Glucagon +Total cell count of expressing cells = 1,232 cells. Insulin + Ngn3 + Total cell count of expressing cells = 502 cells (bFGF 10 ng / ml), 712 cells (bFGF 20 ng / ml), 485 cells (bFGF 40 ng / ml), and 571 cells (80 ng / ml). Western blot analysis indicated a positive correlation between FBS and insulin levels during bFGF induction.

[0370] After bFGF induction, time-course analysis revealed the dynamic profile of transcription factors that mark the cascade stages of pancreatic development ( Figure 1A and Figure 8 ). At the beginning of induction, Mix-like homeobox protein 1 (Mixl1) - a mesendoderm-related protein - increased at 15 min after induction. By binding to the increased Brachyury (T) or Goosecoid (Gsc), evidence suggested the stage of migration of the nascent mesendoderm. Mixl1 decreased at 1 hr, while T and Gsc remained at high levels, suggesting an early transition from hTS cells to mesendoderm.

[0371] At 1 - 8 hr, Mixl1 levels decreased to the lowest point at 4 hr and returned to the initial level at 8 hr. This result may keep the cells in the endoderm stationary during gastrulation. The change in Mixl1 intensity at 1 - 4 hr ( Figure 1B ) led to the separation of the mesendoderm into two cell populations: one expressing Pdx1 for mesoderm + Mixl1 + , while the other expressing Pdx1 for endoderm + Mixl1 - ( Figure 1C ). Mixl1 mRNA expression was restricted to the mesoderm; it was not present in the endoderm. The upregulation of SRY-box transcription factor 17 (Sox17), forkhead box protein A2 (Foxa2), and pancreatic and duodenal homeobox 1 (Pdx1) marked the growth of the pancreatic bud. Sox17 was required to initiate the separation into Pdx1 + ventral pancreas and Sox17 + biliary primordium, rather than the liver. Co-expression of Foxa2 and Pdx1 enhanced the differentiation into different pancreatic cell subtypes. Overexpression of Pdx1 determined pancreatic specification but did not induce insulin production even at the later stage of differentiation.

[0372] At 8 - 16 hr, SRY (sex determining region Y)-box 9 (Sox9) and Pdx1, markers of the foregut pancreatic endoderm, are elevated. Sox9 maintains pluripotent pancreatic progenitors. Genetic ablation of Pdx1 results in defects in the pancreas, caudal stomach, and duodenum during intestinal organogenesis. The evidence indicates differentiation towards the foregut pancreatic endoderm stage.

[0373] At 16 - 24 hr, the levels of Neurogenin 3 (Ngn3) and NK6 homeobox 1 (Nkx6.1) remain at high levels, while the levels of T, Sox17, Foxa2, Pdx1, Sox9, and Ptf1a gradually decrease, driving cell differentiation towards pancreatic progenitors. Pdx1 regulates Ngn3 to convert endodermal cells into endocrine cells, thereby forming pancreatic islets through the expression of glucagon and somatostatin in the mesenchyme. The elevation of Nkx6.1 increases β-cell proliferation. Collectively, these results indicate that within 24 hr, bFGF drives the differentiation of hTS cells towards pancreatic progenitors through DE formation and primitive endoderm induction.

[0374] Figure 2A and Figure 9 shows the dynamic distribution of Cdx2, Oct4, Nanog, and Sox2 during the time-course analysis. The dominant pluripotent transcription factors at each differentiation stage include Cdx2 for mesendoderm, Oct4 and Nanog for DE, Cdx2 and Nanog for primitive endoderm, and Sox2 for pancreatic progenitors. Immunocytochemical studies indicate a reciprocal negative autoregulatory feedback loop during cell transition ( Figure 2B 、 Figure 14 ), which is consistent with findings in hES cells. Figures 10 - 13 ) that is consistent with findings in hES cells. Figure 2C Immunocytochemical overexpression of Oct4 with Sox17, Foxa2, Pdx1, and Gsc at 4 hr is shown, confirming Oct4 at the DE stage. These results show a unique interaction between pluripotent transcription factors and phenotypic changes that determine cell fate during pancreatic differentiation.

[0375] Figure 3A illustrates the molecular pathway for specification towards DE by miR-124a. Immunoblot analysis reveals that bFGF activates the PI3K / Akt pathway and its downstream effector cAMP response element-binding protein 1 (CREB1) ( Figures 15 - 18 ) through FGFR1. A correlation between miR-124a and p-CREB1 expression is observed over time ( Figure 3B ), indicating that CREB1 promotes the production of miR-124a.Figure 3C , Figures 19 - 20 ). These results indicate that bFGF induces miR-124a biogenesis through phosphorylation of CREB1.

[0376] miRNAs are post-transcriptional regulators of genes that target mRNA sequences within the 3’untranslated region (3’UTR), inhibiting translation and / or causing RNA degradation. Sequence analysis and luciferase reporter assays showed that miR-124a inhibits Smad4 ( Figure 3D ), Cdx2 ( Figure 3E ), and GSK3β ( Figure 3F ). These results were confirmed by pre-transfection with miR-124a and anti-miR-124a ( Figure 3G ). Consistent with the report, knockdown of Smad4 inhibited Mixl1 ( Figure 21 ), explaining the downregulation of Mixl1 during the DE transition. Then inhibition of Cdx2 promoted Oct4 activation. Chromatin immunoprecipitation (ChIP) assays revealed that Oct4 targets the promoter of Sox17 ( Figure 3H ) for Sox17 expression ( Figure 22 ). In turn, inhibition of GSK3β at 1–4 h led to the stabilization and accumulation of β-catenin in the cytoplasm ( Figure 23 ). Nuclear translocation of β-catenin targets the gene Foxa2 ( Figure 3I ) for Foxa2 expression ( Figure 8 ). miR-124a regulation of Foxa2 in β-cell lines has been previously reported. For this purpose, bFGF induces the multifaceted functions of miR-124a by upregulating Oct4, Sox17, and Foxa2 but downregulating Smad4 and Mixl1 at the DE stage.

[0377] β-Opiorphin—a protein hormone—is mainly expressed in the liver and functionally induces a high pancreatic β-cell proliferation rate. Foxa2 targets the promoter of the gene C19orf80 to produce β-opiorphin at 12 h ( Figure 3J , Figure 24 ). qPCR analysis revealed that the spatio-temporal elevation of β-opiorphin mRNA began at 12 h, reached a peak of approximately 100% at 16 h, and then decreased until 24 h ( Figure 3K ). During the period of 20–28 h (covering both the primitive endoderm and pancreatic progenitor cell stages), parallel expression among β-opiorphin, C-peptide, and insulin was observed ( Figure 3L , Figure 25 ). Immunocytochemically, hTS cell-derived pancreatic progenitor cells co-expressed β-opiorphin and insulin ( Figure 3M , Figure 26)。Without being limited by or to any particular theory, it is believed that β-opsonin can also regulate pancreatic progenitor cell proliferation during pancreatic development.

[0378] Example 3

[0379] Pancreatic progenitor cells derived from hTS cells secrete insulin in response to glucose stimulation

[0380] Pancreatic progenitor cells monitor glucose levels by secreting immunoreactive insulin into the culture medium ( Figure 4A ). Interestingly, evidence shows that the cells rapidly aggregate to form 3D grape-like cell clusters that are positive for dithizone (DTZ) staining, which is a specific staining for β-cells. Once the high glucose is removed, the cell clusters revert to fibroblast-like characteristics ( Figure 4B ). This cell process was recorded by a computer-microscope-video system.

[0381] Radioimmunoassay measured a significant increase in immunoreactive C-peptide and insulin levels in response to high glucose (25 mM) stimulation ( Figure 4C ). Ultrastructural studies of DTZ-positive cell clusters revealed the presence of round cells with a large cytoplasmic / nuclear ratio, intercellular bridges (desmosomal junctions), abundant mitochondria, immature granules, and secretory granules that mimic the α- and β-cell secretory granules of the pancreas ( Figure 4D ).

[0382] In immunocytochemistry, pancreatic progenitor cells derived from hTS cells express multiple markers, including Sox2, Nkx6.1, Ptf1a, Ngn3, Pdx1, Sox9, β-opsonin, and endocrine components such as insulin (β-cells), somatostatin (δ-cells), glucagon (α-cells), pancreatic polypeptide (PP-cells), glucose metabolism transporter Glut2, and the catalytic enzyme amylase ( Figure 4E ). All evidence indicates the presence of pancreatic progenitor cells, and they respond positively to glucose stimulation tests by expressing C-peptide and insulin.

[0383] Materials and methods for the experiments described in Examples 2-3

[0384] Cell culture and differentiation

[0385] Undifferentiated hTS cells were maintained in α-MEM (Gibco) supplemented with 10% (v / v) fetal bovine serum (SAFC Biosciences). The cultures were manually passaged every 2-3 days at a split ratio of 1:3–1:6. By incubating at 37 °C, 5% CO 2Pancreatic progenitor cells were differentiated in an incubator for 24 hours in α-MEM medium containing 20% FBS, 1 mM 2-mercaptoethanol, 10 mM nicotinamide, and 10 ng / ml bFGF. The differentiation protocol was determined by empirical practice as shown in Figures 5 - 7 . The stage-specific differentiation of lineages was referenced to multiple cell markers as previously described (M. Borowiak, Rev. Diabet. Stud. 7, 93-104 (2010); K. A. D’Amour et al., Nat. Biotech. 23, 1534-1541 (2005); E. Kroon et al., Nat. Biotech. 26, 443-452 (2008)). Cells were collected at the times indicated for different experiments.

[0386] Reagents

[0387] DTZ (Merck KGaA, Darmstadt, Germany), bFGF (Sigma), fluorescein isothiocyanate (FITC), Texas Red 594 (Invitrogen), DyLight 488-, DyLight 594- (Thermo Scientific), phycoerythrin (PE)-conjugated secondary antibody (Jackson ImmunoResearch, Baltimore, MD).

[0388] Western blotting

[0389] The method of this experiment was previously described (T. T. Y. Lee et al., PLoS ONE 7, e52491 (2012)). Briefly, cells were collected into RIPA lysis solution (Millipore, Billerica, MA) supplemented with protease and phosphatase inhibitors (Roche). After electrophoresis of 30-μg lysates on polyacrylamide gels, electroblotting onto PVDF membranes (Millipore) was performed. Target proteins were detected by using primary antibodies after blocking for 1 hour in 5% non-fat milk in PBS at room temperature. All membranes were incubated with chemiluminescent reagent (Millipore), and images were captured by a ChemiDoc XRS system (Bio-RAD). The antibodies used are listed in Table S1. Data were analyzed by AlphaEaseFC (version 4.0.0).

[0390] Immunofluorescence

[0391] The slides with cell cultures were fixed in 95% (v / v) ethanol for 30 min at room temperature, washed three times in PBS, and incubated for 60 min in PBS blocking buffer containing 0.1% (wt / v) Triton X-100 (Sigma) and 5% (v / v) normal donkey serum (Millipore). The first and second antibodies were diluted in the blocking buffer. The first antibody was incubated at 4 °C (24 hr) or at room temperature for 2 hr. After incubation with the specific first antibody in PBS, a suitable secondary antibody conjugated with fluorescein isothiocyanate (FITC, Invitrogen) or Alexa Fluor 488, 594, 647 (Invitrogen) or Dylight 488, 594 (BioLegend) was added for 1 hr at room temperature. The nuclei (5 min) were examined microscopically by 4′,6-diamidino-2-phenylindole (DAPI) staining. Subsequently, incubation (1 hr) with the secondary antibody and washing were performed at room temperature, and the slides were mounted with 50% glycerol. Images were captured on a confocal laser scanning microscope (LSM700; Zeiss Z1 or Olympus FluoView1000 confocal laser scanning microscope) or a TissueFAXS system (TissueQnostics GmbH, Vienna, Austria), and the data were analyzed by TissueQuest software as described previously (T.T.Y. Lee et al., PLoS ONE 7, e52491 (2012)).

[0392] TaqMan miRNA and quantitative real-time PCR assays

[0393] RNA was isolated from hTS cells in triplicate or quintuplicate samples using TRIZOL reagent (Invitrogen) according to the manufacturer's protocol and on-column digestion with DNAase I (Qiagen, Valencia, CA). Total RNA (500 ng) was used for reverse transcription using the iScript cDNA Synthesis Kit (Bio-Rad). PCR was performed in duplicate using 1 / 40 of the cDNA per reaction and 400 nM forward and reverse primers. For miRNA stem-loop qPCR, single-tube TaqMan miRNA assays were used according to the manufacturer's instructions (Applied Biosystems). All RT reactions, including no-template controls and RT-controls, were performed in a GeneAmp PCR 9700 thermal cycler (Applied Biosystems). Comparative real-time PCR was performed in triplicate or quintuplicate, including no-template controls, using specific primers for miR-124 or RNU6B (Applied Biosystems). U6 snRNA (RNU6B; Applied Biosystems) was used as an endogenous control. Relative expression was calculated using SDS 2.2.2 software (Applied Biosystems) for comparative ΔC t Sequences of primers for β-opsonin mRNA: Primer 1, forward: 5'-acatctccctccccagactc-3' (SEQ ID NO:122) and reverse: 5'-tgctctgtgctcagaagtgg-3' (SEQ ID NO:123); Primer 2: forward: 5'-ctgtcggctgagggtttccat-3' (SEQ ID NO:124) and reverse: 5'-gagtctggggagggagatgt-3' (SEQ ID NO:125).

[0394] Immunoprecipitation (IP) assay

[0395] Cell lysates of bFGF-treated hTS cells were collected. Total protein (100 μg) was treated overnight with specific primary antibodies listed in (Table S1) by incubation with protein G-agarose (Minipore) for 30 min. After treatment with protein G-agarose beads for 2 h, the samples were washed 3 times with RIPA lysis buffer (Minipore), followed by addition of protein loading dye and boiling for 5 min. The samples were resolved by 8% SDS-PAGE and subjected to immunoblot analysis.

[0396] Chromatin immunoprecipitation (ChIP) assay

[0397] The ChIP assay was performed using a ChIP assay kit (Millipore) according to the manufacturer's instructions. Briefly, immunoprecipitated DNA fragments were extracted from hTS cells (1x10 6 ), and antibodies against CREB1 or Oct4 or β-catenin were used as previously described (T.T.Y. Lee et al., PLoS ONE 7, e52491 (2012)). Specific primers were used to amplify the conserved binding sites at the promoter regions of miR-124a or Sox17 or Foxa2 and are listed as follows:

[0398] For the promoter of miR124-2: forward, 5'-tctgcggctctttggtttca-3' (SEQ ID NO:126), and reverse, 5'-tctgccttcagcacaagagg-3' (SEQ ID NO:127); and forward, 5'-gcggctctttggtttcaagg-3' (SEQ ID NO:128); reverse, 5'-ctgccttcagcacaagagga-3' (SEQ ID NO:129); For the promoter of miR124-3: 5'-cccgcagttctcaaggacac-3' (SEQ ID NO:130), and reverse, 5'-agaagggagccaggcaagtc-3' (SEQ ID NO:131); For the promoter of Sox17: 5'-ttgtagattgctctctctcctcc-3' (SEQ ID NO:132), and reverse, 5'-gtgaagccttggctagggg-3' (SEQ ID NO:133); For the promoter of Foxa2: 5'-cccatcattgattcctggat-3' (SEQ ID NO:134), and reverse, 5'-ttgggaggctgagatttgtc-3' (SEQ ID NO:135); For the promoter of β-thrombomodulin: 5'-gtcagccctccctgactgat-3' (SEQ ID NO:136), and reverse, 5'-catgtggatttccagcctgc-3' (SEQ ID NO:137).

[0399] Dual luciferase assay

[0400] To prepare the luciferase-3'UTR reporter plasmid, the amplified 3’UTR fragment was amplified from the genomic DNA extract of hTS cells. The 3'UTR PCR fragment was cloned downstream of the luciferase gene in the pGL4.51 vector (Promega, Madison, WI) by using PsiI and MfeI (Thermo Scientific, Rockford, IL). The primers used for the 3’UTR reporter constructs are listed below:

[0401] For Cdx2 3’UTR: forward, 5’-aaattataagctgtttgggttgttggtct-3’ (SEQ ID NO:138), and reverse, 5’-aaacaattgcccccataatttctgactgc-3’ (SEQ ID NO:139); for Smad4 3’UTR region 1: forward, 5’-aaattataactcccaaagtgctgggatta-3’ (SEQ ID NO:140), and reverse, 5’-aaacaattgctgcactgttcacaggagga-3 (SEQ ID NO:141); for Smad4 3’UTR region 2: forward, 5’-aaattataacagttgtcccagtgctgcta-3’ (SEQ ID NO:142), and reverse, 5’-aaacaattgatgacttgcccaaaggtcac-3’ (SEQ ID NO:143); for GSK3β 3’UTR: forward, 5’-aaattataacccacaactggggtaaaaga-3’ (SEQID NO:144), and reverse, 5’-aaacaattgctgtggaaggggcaaagata-3’ (SEQ ID NO:145).

[0402] For the dual-luciferase assay, the firefly luciferase reporter gene (500 ng) or an empty vector without any 3’UTR was co-transfected with the pGL4.74 Renilla luciferase plasmid (500 ng; Promega), and a non-specific control miRNA (30 pmol) or the miR-124a precursor (30 pmol; System Biosciences, Mountain View, CA) was co-transfected into hTS cells (1.5x10 using a transfection reagent (Mirus Bio LLC, Madison, WI, US) per well). 4cells). After transfection (36 hr), luciferase activity was analyzed by the dual-luciferase reporter assay system (Promega) and Centro LB 960 Microplate Luminometer (Berthold Technologies, Bad Wildbad, Germany). For evaluation, first, the Renilla luciferase value was normalized relative to the firefly luciferase activity, and further, the activity of each 3’UTR reporter gene calculated was normalized relative to the activity of the control vector. Data are represented as mean ± SD, n = 8, p < 0.05 as statistical significance. Whole cell extracts prepared in cell lysis buffer were subjected to immunoblot analysis using antibodies against Cdx2, Smad4, GSK3β, and β-actin.

[0403] Transfection of miR-124a precursor or anti-miR-124a

[0404] The miR-124a precursor and anti-miR-124a were purchased from System Biosciences. Briefly, hTS cells in 12-well culture dishes were transfected with the miR-124a precursor (60 pmol) or anti-miR-124a (60 pmol) using the TransIT-LT1 transfection reagent (Mirus, Madison, WI). Total RNA was used to quantify miR-124a at 36 hr post-transfection.

[0405] Radioimmunoassay of C-peptide and insulin

[0406] In the glucose stimulation test, high glucose (25 mM) was added to α-MEM medium (5 ml) at over 80% cell confluence after bFGF treatment. Medium was collected at different times (5, 10, 20, 30, 60, and 120 min). The collected medium was lyophilized using a freeze dryer (VirTis, Warminster, PA) and rehydrated with sterile water (400 μl) for radioimmunoassay. C-peptide and insulin levels in the medium were determined by C-PEP II-RIA-CT (DIAsource ImmunoAssays S.A., Belgium) and Coat-A-Count insulin (Siemens Healthcare Diagnostics Inc., LA, CA), respectively. n = 5, p < 0.05 was considered statistically significant.

[0407] Flow cytometry

[0408] After transfection with non-specific shRNA or shRNA against Cdx2 or Oct4 or Sox2 or Nanog, cells (5×10 6 cells / ml) were incubated with specific primary antibodies (listed in Table S1) for 30 min. Samples were washed and resuspended in PBS by incubating with the primary antibodies conjugated to the appropriate fluorescent dyes at adjusted dilutions for 1 hr at 4°C, and then passed through polystyrene round-bottom tubes with cell strainer caps (BD Falcon) prior to flow cytometry (FACScan, BD Biosciences, San Jose, CA). Data were analyzed using Cell-Quest software (BD Biosciences).

[0409] Transmission electron microscopy

[0410] After high glucose stimulation, the hTS cell-derived islet-like cell clusters on the culture dishes were cut with tungsten needles. For transmission electron microscopy, the cell blocks were fixed in 0.1 M sodium cacodylate buffer (pH 7.4) containing 3% wt / vol formaldehyde, 1.5% (wt / vol) glutaraldehyde, and 2.5% (wt / vol) sucrose at room temperature for 1 hr and overnight at 4°C. The samples were washed with sodium cacodylate buffer before and after osmication in Palade fixative containing 1% (vol / vol) OsO 4 for 2 hr, treated with tannic acid, stained with uranyl acetate, dehydrated through a graded series of ethanol solutions, and embedded in TABB epoxy resin (Agar Scientific Ltd.). Ultrathin sections were stained with uranyl acetate and lead citrate and examined using a JEM-2000 EXII (JEOL, Tokyo). Imaging of vesicular granules was referenced as previously described (K. A. D’Amour et al., Nat. Biotech. 23, 1534 - 1541 (2005)).

[0411] Statistical analysis

[0412] All experiments were performed in triplicate and repeated two times or as indicated. Data obtained from Western blot, qPCR, luciferase assay, and flow cytometry were calculated by Student t-test. A p-value < 0.05 was considered statistically significant.

[0413] Table S1. Antibodies used in this study

[0414]

[0415]

[0416] One or more embodiments, examples, or aspects disclosed herein can be combined with any other embodiments, examples, or aspects disclosed herein, where appropriate.

[0417] Although some embodiments have been shown and described herein, these embodiments are provided by way of example only. Many variations, changes, and substitutions can be made without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be used to practice the invention.

Claims

1. An isolated pancreatic progenitor cell, wherein the isolated pancreatic progenitor cell expresses betacellulin, and wherein the isolated pancreatic progenitor cell is differentiated from mammalian trophoblast stem cells by contacting the mammalian trophoblast stem cells with a culture medium comprising 2-mercaptoethanol, nicotinamide, and bFGF, wherein the concentration of the bFGF is 10 ng / ml - 80 ng / ml.

2. The isolated pancreatic progenitor cell according to claim 1, wherein the isolated pancreatic progenitor cell further expresses C-peptide.

3. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell further expresses Ngn3.

4. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell further expresses C-peptide and Ngn3.

5. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is differentiated from human trophoblast stem cells.

6. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cell has a normal karyotype compared to the trophoblast stem cells.

7. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell has one or more immune privilege characteristics.

8. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cell has low or absent CD133 expression compared to the trophoblast stem cells.

9. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cell has low or absent CD33 expression compared to the trophoblast stem cells.

10. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is a human cell.

11. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the isolated pancreatic progenitor cell is from a rodent, rabbit, bovine, sheep, pig, dog, cat, monkey, or ape.

12. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the pancreatic progenitor cell further expresses betacellulin mRNA.

13. The isolated pancreatic progenitor cell according to claim 1 or 2, wherein the contacting activates miR-124.

Images