Three-part system for protein dimerization and methods of use
By using a target protein derived from non-human proteins and a small molecule inhibitor to form a three-part complex, the problems of increased safety and dosage requirements in existing technologies are solved, achieving highly safe and controlled protein interaction regulation in humans, which is suitable for gene therapy and cell therapy.
Patent Information
- Application Number
- CN202080050513.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-07-15
- Filing Date
- 2020-07-15
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2040-07-15
AI Technical Summary
In existing technologies, the use of small molecule compounds targeting human cells to regulate cell function poses safety risks and increases dosage requirements. Furthermore, traditional dimerizing chemical inducers produce non-productive complexes at high concentrations, failing to achieve a linear dose response.
Using target proteins derived from non-human proteins and small molecule inhibitors, a three-part complex is formed by encoding an expression cassette. Protein interactions are controlled by binding members with high affinity to non-human target proteins, such as viral proteases like HCV NS3/4A proteases and cimetvir, combined with specific antibody molecules such as Tn3 protein or scFv, to form a controlled dimerization-inducible protein.
It achieves greater safety and controllability in the human body, reduces endogenous target interference, enables controlled regulation and rapid dissociation of protein activity, and is suitable for gene therapy and cell therapy.
Smart Images

Figure GDA0005407866440000231 
Figure GDA0005407866440000241 
Figure GDA0005407866440000251
Abstract
Description
[0001] This application claims priority to U.S. Provisional Application No. 62 / 874,025, filed July 15, 2019, the contents and elements of which are incorporated herein by reference for all purposes. Technical Field
[0002] This disclosure relates to compositions and methods that allow controlled interactions of peptides (with a target protein and a binding member). These compositions and methods utilize a target protein that binds to a small molecule to form a complex and a binding member that specifically binds to the complex, wherein the target protein is derived from a non-human protein and the small molecule is a non-human protein. The non-human protein may be derived from bacteria, viruses, fungi, or protozoan proteins. The non-human protein may be derived from a viral protease and the small molecule is a viral protease inhibitor. This disclosure also relates to dimerization-inducible proteins containing a target protein and a binding member, such as split transcription factors and split chimeric antigen receptors. The methods and compositions described herein can be applied, for example, to cell and gene therapy methods involving the controlled expression and / or activation of proteins. Background Technology
[0003] Protein-protein interactions (PPIs) represent a universal regulatory mechanism controlling a wide range of biological functions. For example, gene transcription, protein folding, protein localization, protein degradation, and signal transduction all depend on the interaction or proximity of one protein with another, or in fact, several other proteins. By controlling protein-protein interactions over time, researchers can easily monitor the functional consequences of PPIs, thus enabling the dissection of complex biological mechanisms. Furthermore, the ability to control biological functions is being used in cell and gene therapies to control therapeutic activity, thereby enabling safer and more personalized treatments.
[0004] A common technique for controlling protein-protein interactions is the use of so-called dimerizing chemical inducers (CIDs), which are small molecules that cause two proteins that do not interact in the absence of a CID to form a three-part ternary complex (Stanton, Chory, and Crabtree 2018). The most widely used CID is rapamycin (an immunosuppressive drug from Streptomyces hygroscopicus) and its analogues, which form heterodimeric complexes with proteins FKBP12 (a 12-kDa FK506-binding protein) and FRB (from mTOR (a mammalian target of rapamycin)) (Sabers et al., 1995). An attractive feature of rapamycin and other naturally occurring CIDs, such as the plant hormones S-(+)-abscisic acid (ABA) and gibberellin (GA3-AM), is their co-binding mechanism, by which protein 2 can only bind to the protein 1:CID complex (Banaszynski, Liu, and Wandless 2005). De novo CIDs can also be generated by the chemical linking of two small molecules of the same or different proteins, where these proteins form a dimerized protein pair (Belshaw, Ho, et al. 1996; Belshaw, Spencer, et al. 1996). However, in these systems, at high concentrations of bifunctional CIDs, the nonproductive complex between a protein partner and the CID exceeds the generation of a trimetite complex, meaning that a linear dose-response cannot be achieved.
[0005] Therefore, there is a growing need for novel, cooperative CID systems that can be used to regulate cellular function and expand the number of orthogonal systems available for complex genetic circuits. Furthermore, few CIDs have been approved for long-term human use. Recently, a method for generating de novo CID systems (AbCIDs) using an antibody-based phage display screening approach was described (Hill et al., 2018). The CID used in this study was ABT-737, a Bcl-2 and Bcl-xL inhibitor, with Bcl-xL itself used as one of the protein couplers. A second protein was then screened from a phage display library of single-chain Fab (scFab) molecules, exhibiting selectivity for the Bcl-xL:ABT-737 complex over Bcl-xL alone.
[0006] The approach described by Hill et al. (2018) and WO 2018 / 213848 A1, which utilizes existing small molecules and their targets to identify complex-specific molecules, is an attractive method. However, the overexpression of certain human proteins (e.g., the anti-apoptotic Bcl-xL protein) and the use of small molecules that bind to human targets in vivo are not without risks. For example, overexpression of a functional human protein can affect the cells that express it, potentially impacting cellular health and viability. Furthermore, using small molecules whose targets are expressed in vivo can lead to increased dosage requirements because they compete for binding with both endogenous and overexpressed targets. Additionally, the binding of small molecules to endogenous targets can impair the function of the protein, which may be detrimental to cells expressing the target. Summary of the Invention
[0007] This paper discloses a method designed to overcome the limitations of the AbCID system described by Hill et al. First, the small molecules described herein are those already approved for human use, to facilitate a smoother regulatory approval pathway. Second, and importantly, the inventors recognize the advantages associated with screening small molecules that bind to non-human proteins, particularly viral proteins, rather than identifying small molecules with human targets. For example, using small molecules without human targets is expected to improve safety for use in humans. There is also reason to believe that using viral, bacterial, fungal, or protozoan target proteins will eliminate the risk of endogenous small molecule “sinking” into humans, where the small molecule binds to endogenous targets in addition to the target protein. Furthermore, the expression of viral, bacterial, fungal, or protozoan proteins within human cells is less likely to affect cellular physiology compared to human proteins with endogenous function.
[0008] Antiviral drugs have been approved that bind to and inhibit various viral proteins, including viral polymerases, integrases, transcriptases, and proteases. The inventors recognized that target proteins derived from viral proteases are particularly beneficial because these proteases are located in the cytoplasm, are small, and consist of discrete domains.
[0009] Therefore, this disclosure provides one or more expression carriers, which include:
[0010] i) A first expression cassette encoding a target protein, wherein the target protein is capable of binding to a small molecule to form a target protein-small molecule complex (T-SM complex); and
[0011] ii) A second expression cassette encoding a binding member, wherein the binding member has a higher affinity for the T-SM complex than the binding member has for either the target protein alone or the small binding molecule alone.
[0012] In one embodiment, the target protein is derived from a non-human protein, and the small molecule is an inhibitor of that non-human protein. In another embodiment, the non-human protein is derived from a viral protein, and the small molecule is an inhibitor of that viral protein. In yet another embodiment, the non-human protein is derived from a viral protease, and the small molecule is an inhibitor of that viral protease. In one embodiment, the non-human protein is derived from a bacterial protein, and the small molecule is an inhibitor of that bacterial protein. In yet another embodiment, the non-human protein is derived from a protozoan protein, and the small molecule is an inhibitor of that protozoan protein.
[0013] As demonstrated in this paper, the binding of the binding member to the T-SM complex forms a three-part complex consisting of the binding member, the target protein, and a small molecule, and the formation of this three-part complex can be controlled by the presence of the small molecule. The controlled formation of the three-part complex is useful, for example, as it allows for controlled interactions with peptides to which the target protein and binding member are fused.
[0014] This disclosure also provides a system comprising:
[0015] i) a target protein, wherein the target protein is capable of binding to a small molecule to form a target protein-small molecule complex (T-SM complex); and
[0016] ii) A binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone or the small molecule alone.
[0017] In one embodiment, the target protein is derived from a non-human protein, and the small molecule is an inhibitor of that non-human protein. In another embodiment, the non-human protein is derived from a viral protein, and the small molecule is an inhibitor of that viral protein. In yet another embodiment, the non-human protein is derived from a viral protease, and the small molecule is an inhibitor of that viral protease. In one embodiment, the non-human protein is derived from a bacterial protein, and the small molecule is an inhibitor of that bacterial protein. In yet another embodiment, the non-human protein is derived from a protozoan protein, and the small molecule is an inhibitor of that protozoan protein.
[0018] In some embodiments, the viral protease is an HCV NS3 / 4A protease or an HIV protease. These proteases are known to be targeted by several approved small molecules that are generally well-tolerated in humans and suitable for long-term administration, and therefore represent the target proteins applicable hereto.
[0019] In some embodiments, the viral protease is the HCVNS3 / 4A protease, such as a protease having the amino acid sequence of SEQ ID NO:1. The HCVNS3 / 4A protease is a small monomeric protein that can be expressed in the cytoplasm and has a limited number of endogenous human targets, thus making it an ideal target protein.
[0020] In some embodiments, the small molecule is selected from the group consisting of: cimetidine, asunaprevir, varenirivir, boprevir, nalazorevir, and telazorevir. All of these small molecules are approved for human treatment. In some embodiments, the small molecule is selected from the group consisting of: cimetidine, boprevir, and telazorevir. These small molecules are approved for human treatment and are generally well tolerable in humans.
[0021] In some embodiments, the small molecule is cimepuvir. It is an orally administered small molecule with cell permeability and a pharmacokinetic (PK) profile that supports once-daily dosing. It has been used in combination with ribavirin and pegylated interferon for long-term (up to 39 months) treatment of HCV infection and is included in the WHO Essential Medicines List, indicating that it is a well-tolerated and widely used drug.
[0022] The inventors recognized that any potential off-target activity caused by the overexpression of viral proteases could be mitigated by using target proteins with attenuated viral activity compared to their derived viral proteases. Therefore, in some embodiments, the target proteins have attenuated viral activity compared to their derived viral proteases.
[0023] For example, the target protein may contain one or more amino acid mutations compared to the viral protease from which it originates. In a specific embodiment where the viral protease is the HCVNS3 / 4A protease, the target protein may have an amino acid mutation at one or more amino acids selected from positions 72, 96, 112, 114, 154, 160, and 164, corresponding to the amino acid numbering in SEQ ID NO:1. For example, the target protein may have an amino acid mutation at position 154, such as a mutation to alanine, corresponding to the amino acid numbering in SEQ ID NO:1. As described below, positions 72, 96, 112, 114, 154, 160, and 164 of SEQ ID NO:1 correspond to positions 57, 81, 97, 99, 139, 145, and 149 of the full-length NS3 protein listed in SEQ ID NO:199, respectively. These examples refer to amino acid positions based on the amino acid numbering of the full-length NS3 protein. For example, the 'S139A' mutation mentioned in the examples corresponds to the 'S154A' mutation, corresponding to the amino acid numbering in SEQ ID NO:1.
[0024] In some cases, it may be desirable for a competitive small molecule to bind to the target protein in the T-SM complex, thereby displacing a small molecule in the T-SM complex, where the second small molecule is different from the small molecule in the T-SM complex. In this way, the second small molecule can reduce the half-life of the tripartite complex formed between the binding member, the target protein, and the small molecule. This may be desirable, for example, when it is considered useful to use a second small molecule to accelerate the dissociation of the tripartite complex, such as to rapidly inhibit the activity of dimerization-inducible proteins activated by the formation of the tripartite complex.
[0025] As demonstrated herein, cimetvir binds to its target protein, the HCV NS3 / 4A protease (S139A) (SEQ ID NO:2), with a very high affinity, preventing other small molecules binding to the target protein from displacing cimetvir from the T-SM complex. The inventors determined that certain affinity-reducing mutations can be introduced into the target protein, which lower the affinity of cimetvir to the HCV NS3 / 4A protease and allow other small molecules to “compete” with cimetvir and disrupt the formed tripartite complex. Therefore, in some embodiments where the viral protease is the HCV NS3 / 4A protease and the small molecule is cimetvir, the target protein may contain affinity-reducing amino acid substitutions at one or more amino acids selected from positions 151 and 183, where the amino acid number corresponds to SEQ ID NO:1. In some embodiments, the affinity-reducing amino acid mutation at position 151 is a mutation to aspartic acid, asparagine, or histidine (e.g., aspartic acid or asparagine), and the affinity-reducing mutation at position 183 is a mutation to glutamic acid, glutamine, or alanine (e.g., glutamic acid). The target protein may also contain amino acid mutations that reduce affinity, in addition to the other mutations described herein, such as amino acid mutations at one or more amino acids selected from positions 72, 96, 112, 114, 154, 160, and 164.
[0026] In some embodiments, the binding member is an antibody molecule, such as a single-chain variable fragment (scFv), or an antibody mimic, such as a Tn3 protein. In specific embodiments, the binding member is either a Tn3 protein or a scFv, such as Tn3 protein and scFv as defined herein. Both Tn3 protein and scFv are smaller in size compared to the single-chain Fab (scFab) used in the system described by Hill et al. This can be advantageous, for example, when the expression cassette is delivered by an expression vector with limited coding capacity, such as a viral vector. The development and use of specific Tn3 proteins and scFvs that bind to the complex between the HCVNS3 / 4A protease and cimetvir are described herein and are demonstrated as binding members in the context of this disclosure. These Tn3 proteins and scFvs are referred to as HCVNS3 / 4A PR:cimetvir complex-specific binding (PRSIM) molecules.
[0027] It is recognized that the methods described herein can be used for cases where target proteins and binding members are individually fused to peptides (referred to as “component peptides”). In particular, it is recognized that this method can be implemented to control the activity of proteins that require dimerization or clustering to drive their activity. Such proteins are referred to herein as “dimerization-inducible proteins” and include “dissociative proteins,” “dimerization-deficient proteins,” and “dissociative complexes.” Dissociative proteins comprise single proteins that can be separated or fragmented into two or more domains, rendering the component portion nonfunctional or minimally active; however, when the separated component peptides are brought into close proximity, function or activity can be initiated or restored. Examples include dissociative fluorescent proteins (e.g., dissociative GFP), dissociative luciferases (e.g., NanoBiT), and dissociative kinases. Another example describes dissociative transcription factors in which distinct DNA-binding domains (DBD) and activation domains (AD) are separated, such that individual transcription factor domains cannot initiate transcription alone. Only when these two domains are brought into close proximity can they re-activate transcription of the associated gene (i.e., they form a functional “transcription factor”). Dimerization-deficient proteins are proteins that require dimerization to function, but their endogenous dimerizing ability has been lost, for example, through mutations or removal of one or more dimerizing domains. An example of this is the iCasp9 molecule, a caspase 9 protein with its dimerizing (CARD) domain removed. Fragmented complexes refer to single proteins or two or more distinct proteins that are not optimally functional or functionally different until they come close together or “cluster.” An example of this is the fragmented chimeric antigen receptor (CAR). Here, specific intracellular domains of the CAR responsible for activating cell signaling are physically separated, thus preventing full cellular activation. Once these domains come close together, cell signaling is activated (i.e., they form a fully functional CAR).
[0028] Therefore, in some embodiments, the target protein is fused with the first component peptide and the binding member is fused with the second component peptide. In a preferred embodiment, one or more expression vectors encode dimerization-inducible proteins, such as split transcription factors or split CARs.
[0029] In one embodiment: (1) the first component polypeptide contains a DNA-binding domain and is fused with a target protein to form a DBD-T (DBD-target protein) fusion protein; and the second component polypeptide contains a transcriptional regulatory domain and is fused with a binding member to form a TRD-BM (transcriptional regulatory domain-binding molecule) fusion protein, or (2) the first component polypeptide contains a transcriptional regulatory domain and is fused with a target protein to form a TRD-T fusion protein; and the second component polypeptide contains a DNA-binding domain and is fused with a binding member to form a DBD-BM fusion protein, wherein the first component polypeptide and the second component polypeptide form a transcription factor after dimerization.
[0030] In another embodiment, the first component polypeptide includes a first co-stimulatory domain and is fused to a target protein; and the second component polypeptide includes an intracellular signal transduction domain and is fused to a binding member. The first component polypeptide may further include an antigen-specific recognition domain and a transmembrane domain; the second component polypeptide further includes a transmembrane domain and a second co-stimulatory domain, wherein the first and second component polypeptides dimerize to form a chimeric antigen receptor (CAR).
[0031] Alternatively, the first component peptide includes an intracellular signal transduction domain fused to a target protein, and the second component peptide includes a first co-stimulatory domain fused to a binding member. The first component peptide further includes a transmembrane domain and a second co-stimulatory domain; the second component peptide also includes an antigen-specific recognition domain and a transmembrane domain, wherein the first and second component peptides dimerize to form a chimeric antigen receptor (CAR).
[0032] In another embodiment, the first component polypeptide comprises a first caspase component; the second component polypeptide comprises a second caspase component, and the first component polypeptide and the second component polypeptide dimerize to form caspase.
[0033] In some embodiments, one or more expression vectors are viral vectors, such as AAV vectors.
[0034] This disclosure also provides a method for preparing viral particles in vitro, the method comprising transfecting host cells with one or more viral vectors as defined herein and expressing viral proteins necessary for the formation of viral particles in the host cells; and culturing the transfected cells in a culture medium to produce viral particles.
[0035] This disclosure also provides one or more viral particles containing
[0036] i) A first expression cassette encoding a target protein, wherein the target protein is capable of binding to a small molecule to form a target protein-small molecule complex (T-SM complex); and
[0037] ii) A second expression cassette encoding a binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone or the small molecule alone.
[0038] The target protein is derived from a non-human protein, and the small molecule is an inhibitor of the non-human protein. The first and second expression cassettes form part of the viral genome in one or more viral particles. In one embodiment, the non-human protein is derived from a viral protein, and the small molecule is an inhibitor of the viral protein. In one embodiment, the non-human protein is derived from a viral protease, and the small molecule is a viral protease inhibitor. In another embodiment, the non-human protein is derived from bacterial, fungal, or protozoan proteins.
[0039] One or more expression cassettes, target proteins, small molecules, and binding members in viral particles may be as further described herein. As further described herein, the target proteins and binding members may be fused to first and second component peptides, respectively (e.g., for encoding dimerization-inducible proteins).
[0040] Virus particles can be AAV particles.
[0041] In one aspect, this disclosure provides a binding member that specifically binds i) a target protein derived from a non-human protein and ii) a small molecule that is an inhibitor of the non-human protein to a complex, wherein the binding member has a higher affinity for the complex than the binding member has for either the target protein alone or the small molecule alone. In one embodiment, the non-human protein is derived from a viral protein and the small molecule is an inhibitor of the viral protein. In one embodiment, the non-human protein is derived from a viral protease and the small molecule is a viral protease inhibitor. In another embodiment, the non-human protein is derived from a bacterial, fungal, or protozoan protein. As described herein, such complex-specific binding members can be used as a pathway to control the formation of a three-part complex between the binding member, the target protein, and the small molecule, overcoming the drawbacks of the binding molecules described by Hill et al.
[0042] On the other hand, this disclosure provides dimerization-inducible proteins that include target proteins and binding members, as defined herein. For example, dimerization-inducible proteins may be dissociative transcription factors, dissociative CARs, or dissociative caspase proteins.
[0043] In one aspect, this disclosure provides cells, such as allogeneic or autologous cells, including stem cells, induced pluripotent stem (iPS) cells, or immune cells, that contain one or more of the expression cassettes, expression vectors, binding members, target proteins, or dimerization-inducible proteins as defined herein. The cells may express the binding members, target proteins, or dimerization-inducible proteins described herein. This disclosure also provides a method for genetically modifying cells to produce cells expressing the binding members or dimerization-inducible proteins described herein, the method comprising administering an expression vector to the cells. This method may be performed in vitro or ex vivo.
[0044] It is also recognized that the methods described herein, in which target proteins and binding members are fused with component peptides of split transcription factors, can be used in gene therapy methods involving the regulation of the expression of desired expression products (e.g., desired peptides) in cells.
[0045] Therefore, in one aspect, this disclosure provides a method for regulating the expression of a desired expression product in cells, the method comprising:
[0046] i) Expression of a dimerization-inducible protein as defined herein in cells, wherein the first and second component polypeptides dimerize to form a transcription factor, and wherein the DNA-binding domain binds to a target sequence in the cell, enabling the transcription factor to regulate the expression of the desired expression product in the cell; and
[0047] ii) Apply small molecules to cells to regulate the expression of the desired expression product.
[0048] In some embodiments of this method, the DNA-binding domain target sequence is located in a promoter that is operatively linked to the coding sequence of the desired expression product.
[0049] This method may include delivering an expression cassette encoding a dimerization-inducible protein to control the expression of a desired expression product also exogenously delivered to the cell.
[0050] Therefore, in some embodiments, the method includes administering a third expression cassette to cells, wherein the third expression cassette encodes a desired expression product, and wherein the third expression cassette contains a target sequence of a DNA-binding domain.
[0051] Alternatively, the method may include delivering an expression cassette encoding a dimerization-inducible protein to control the expression of a desired expression product (i.e., an endogenous desired expression product) that is already present as part of the cell's genome.
[0052] Therefore, in other embodiments of the method, the target sequence is located in the cell's genome.
[0053] Furthermore, it has been recognized that the methods described herein can be used in cell therapy approaches. Such approaches typically involve obtaining cells from an individual (autologous cells), modifying these cells in vitro to express specific proteins, such as dimerization-inducible proteins, and re-administering them back to the individual.
[0054] Therefore, another aspect of this disclosure provides a treatment method comprising:
[0055] i) Provide cells containing expression cassettes encoding dimerization-inducible proteins as defined herein to individuals in need; and
[0056] ii) The small molecule is administered to the individual.
[0057] In one respect, this disclosure provides nucleic acids encoding binding members, target proteins, and dimerization-inducible proteins as defined herein.
[0058] In one respect, this disclosure provides a kit as defined herein.
[0059] It has also been recognized that additional small molecules (referred to herein as “competitive small molecules”) can be used to induce the disassembly and assembly of a three-part complex formed between the binding member, the target protein, and the small molecule. This could be useful, for example, when rapid inactivation of the dimerizing chemical inducers (CIDs) disclosed herein is required, such as to shut down transgene expression or therapeutic activity associated with the activity of dimerization-inducible proteins.
[0060] Another aspect of this disclosure provides a method for inducing the disassembly of a tripartite complex, the method comprising administering a competitive small molecule to cells containing the tripartite complex.
[0061] The three-part complex forms between the binding member and the complex formed by the target protein and the small molecule (T-SM complex), wherein the binding member has a higher affinity for the T-SM complex than for either the target protein or the small molecule alone.
[0062] The competitive small molecules can bind to the target protein in the T-SM complex and displace the small molecules from the T-SM complex.
[0063] A method for determining whether a competitive small molecule can bind to and displace a target protein in a T-SM complex includes an assay in which a pre-formed three-part complex is generated and the ability of the binding member to bind to the T-SM complex is measured (e.g., by homogeneous time-resolved fluorescence (HTFR) binding assay) with increasing concentration of the added competitive small molecule. When measured using an HTFR binding assay, the competitive small molecule may be able to exhibit small molecule displacement from the T-SM complex if it inhibits the binding of the binding member to the T-SM complex by at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the competitive small molecule is asunaprevir, veluprevir, vanniprevir, goreprevir, danoprevir, or glimepiride. The binding member, target protein, and small molecule used in this method may be further defined as described herein with reference to other aspects of this disclosure.
[0064] In certain embodiments, the target protein may be derived from the HCV NS3 / 4A protease, and the small molecule in the T-SM complex may be cimetidine, and optionally, the binding member may be PRSIM_23. For example, the target protein may have an amino acid sequence that is at least 90% identical to SEQ ID NO:1. As demonstrated herein, cimetidine binds to the target protein HCV NS3 / 4A protease (S139A) (SEQ ID NO:2) with very high affinity, preventing other small molecules binding to the target protein from displacing cimetidine from the T-SM complex. As further demonstrated herein, it is possible to introduce mutations into the HCV NS3 / 4A protease that reduce the affinity of cimetidine for the HCV NS3 / 4A protease and allow competitive small molecules to disrupt the three-part complex formed between the HCV NS3 / 4A protease, cimetidine, and the binding member PRSIM_23.
[0065] Therefore, in embodiments where the target protein is derived from the HCVNS3 / 4A protease and the small molecule is cepprevir, the target protein may have an affinity-lowering amino acid mutation (e.g., substitution) at one or more amino acids selected from positions 151 and 183, wherein the amino acid number corresponds to SEQ ID NO:1. In some embodiments, the affinity-lowering amino acid mutation at position 151 is a mutation to aspartic acid, asparagine, or histidine, and the affinity-lowering mutation at position 183 is a mutation to glutamic acid, glutamine, or alanine. In some embodiments, the affinity-lowering amino acid mutation at position 151 is a mutation to aspartic acid or asparagine, and the affinity-lowering mutation at position 183 is a mutation to glutamic acid. The target protein may also contain affinity-lowering amino acid mutations other than the other amino acid mutation described herein (e.g., in addition to the amino acid mutation at position 154, such as a mutation to alanine).
[0066] This disclosure includes combinations of the described aspects and preferred features, except where such combinations are clearly not permitted or explicitly avoided. Attached Figure Description
[0067] The embodiments and experiments illustrating the principles of this disclosure will now be discussed with reference to the accompanying drawings, in which:
[0068] Figure 1 A schematic diagram of the three components of an exemplary PRSIM-based dimerization chemical inducer (CID) is shown. A represents the target protein (e.g., the example HCV NS3 / 4A PR(S139A) mutant), B represents the small molecule (e.g., the exemplified cimetvir), and C represents the binding member (e.g., scFv or Tn3 specific to the complex of cimetvir and HCV NS3 / 4A PR(S139A)).
[0069] Figure 2 It describes the HCV NS3 / 4A PR (PDB code: 3KEE); The three-dimensional structure of the composite cimetidine was determined and the shallow binding site of HCV NS3 / 4A PR and the large surface exposure area of cimetidine were described.
[0070] Figure 3A SDS-PAGE gels of recombinant WT and S139A HCV NS3 / 4A PR are shown. S139A HCV NS3 / 4APR contains a serine-to-alanine mutation at position 139, corresponding to amino acid position 139 of the full-length NS3 protein (SEQ ID NO: 199). This serine-to-alanine mutation corresponds to position 154 of the HCV NS3 / 4A protease provided herein as SEQ ID NO: 1.
[0071] Figure 3B This demonstrates the minimum activity of the S139A mutant of HCV NS3 / 4A PR compared to its WT counterpart in peptide cleavage assays.
[0072] Figure 3C The data displayed areothermal calorimetric data indicate that cimetvir has equivalent affinity for the WT and S139A versions of HCV NS3 / 4A PR.
[0073] Figure 4A The screening strategy for isolating HCV NS3 / 4A PR(S139A):cimepvir selective binding molecule (PRSIM) is shown.
[0074] Figure 4BThe outputs of different rounds of screening for three different libraries are shown, as represented by the fold change in the ELISA signal in the presence of simipvir, compared to the binding signal obtained in the presence of HCV NS3 / 4A PR (S139A) alone.
[0075] Figure 5 A schematic diagram of a homogeneous time-resolved fluorescence (HTRF) assay is shown for measuring the binding of PRSIM molecules to HCV NS3 / 4A PR (S139A) alone or in combination with cimetidine.
[0076] Figure 6 The image shows HTRF data obtained using a set of PRSIM molecules exhibiting selective binding to HCVNS3 / 4A PR(S139A):cimipvir. Cimipvir is present uphill and absent downhill.
[0077] Figure 7A -B shows affinity data derived from BIAcore for the following: HCV NS3 / 4A PR(S139A) and Figure 7A :PRSIM_57 and Figure 7B PRSIM_23 binds in the presence of cimetidine (left) and does not bind significantly in the absence of cimetidine (middle). BSA with cimetidine is used as a control (right). The gray curves represent the measured data points, and the black dashed lines represent the global fit line used for analysis.
[0078] Figure 7C Titration curves showing cimetvir-induced heterodimerization of HCV NS3 / 4A PR(S139A) / PRSIM_57 (left; EC50 = 4.57 nM) or HCV NS3 / 4A PR(S139A) / PRSIM_23 (right; EC50 = 4.03 nM) are displayed. ◇ = 40 nM HCVNS3 / 4A PR(S139A) + 0 nM cimetvir.
[0079] Figure 8 A schematic diagram (left) of the nanoBiT system (Promega) is shown, which is used to identify PRSIM molecules capable of reconstructing nanoLuc function by bringing the LgBiT and SmBiT domains into close proximity. Different orientations of the generated and tested LgBiT and SmBiT fusion proteins are also depicted (right).
[0080] Figure 9 Data obtained from nanoBiT screening are shown, depicting the fold change in luminescence signal in the presence of cimetidine compared to the absence of cimetidine, and demonstrating that several PRSIM-binding molecules can reconstruct nanoLuc activity.
[0081] Figure 10 The components of two plasmids used for transient transfection were described to measure the ability of cimetidine to reconstruct dissociative transcription factors and activate luciferase reporter gene transcription when the component portions were fused with HCV NS3 / 4A PR(S139A) and different PRSIM molecules.
[0082] Figure 11A -B shows the Tn3-based PRSIM molecule ( Figure 11A ) and scFv-based PRSIM molecules ( Figure 11B Dosage-response data were obtained from the fractional transcription factor assay. Several tested PRSIM molecules were able to achieve dose-dependent activation of luciferase reporter gene transcription.
[0083] Figure 12A The dose-response data obtained from the split transcription factor assays of PRSIM_23 and PRSIM_57 compared with the rapamycin-induced FRB:FKBP12 positive control are shown, resulting in excellent fold change and EC50 values.
[0084] Figure 12B The data obtained from the split transcription factor assays of PRSIM_23 and PRSIM_57 in the absence of simexour or rapamycin were compared with the rapamycin-induced FRB:FKBP12 positive control, indicating that PRSIM-based CIDs have lower basal expression levels and are therefore more tightly regulated.
[0085] Figure 13 This study describes the expected increase in reporter gene expression when using three copies of a molecule fused with DBD, compared to a single copy, by recruiting more AD domains and associated regulatory molecules.
[0086] Figure 14A The data obtained from a single copy of PRSIM_23 or FKBP12 fused with DBD compared to three copies of the plasmid show that increasing the copy number has a synergistic effect on the fold change in expression.
[0087] Figure 14B Data obtained from plasmids encoding different copies of PRSIM_23 fused with DBD and invalid Tn3 are shown, indicating that increasing the copy number has a synergistic effect on the fold change in expression.
[0088] Figure 15A The plasmid used to express the PRSIM-based split chimeric antigen receptor, and the protein expressed from the plasmid, are described.
[0089] Figure 15BThe effects of adding cimetidine on the association of PRSIM-based split CAR components and the resulting cell activation were demonstrated.
[0090] Figure 16 The study showed a dose-dependent increase in the release of IL-2 (a marker of T cell activation) from cells expressing a PRSIM-based detached CAR in the presence of cimetidine compared to an equivalent FRB:FKBP12-based CAR.
[0091] Figure 17 This study demonstrated the dose-response effect of cimetidine in inducing MEDI8852 expression through reconstruction of a split transcription factor assay using a CID containing PRSIM_23.
[0092] Figure 18A Vectors for generating individual AAV particles encoding either an inducible luciferase transgene or a detached transcription factor component based on PRSIM_23 / HCV NS3 / 4APR (S139A) are depicted. Protein expression after transduction with these two AAV particles, as well as luciferase expression after cimetidine treatment, are also depicted.
[0093] Figure 18B The results showed that when the PRSIM_23 switch and inducible luciferase transgene were delivered to cells in separate AAV particles, the PRSIM_23 switch could activate dose-dependent expression of luciferase in the presence of cimetidine.
[0094] Figure 18C Vectors used to generate both AAV particles encoding an inducible IL-2 transgene and a fragmented transcription factor component based on PRSIM_23 / HCV NS3 / 4A PR(S139A) were depicted. Protein expression after transduction with these AAV particles, and IL-2 expression after cimetidine treatment, were also depicted.
[0095] Figure 18D The results showed that when the PRSIM_23 switch and the inducible IL-2 transgene were delivered to cells in the same AAV particle, the PRSIM_23 switch could activate dose-dependent expression of IL-2 in the presence of cimetidine.
[0096] Figure 18E The results showed that when the PRSIM_23 switch and the inducible IL-2 transgene were delivered to cells in the same AAV particle, the IL-2 expression level induced by the PRSIM_23 switch was similar to the IL-2 expression level achieved by constitutively expressed IL-2 from the CAG promoter via AAV delivery.
[0097] Figure 19AThe components of a PRSIM-based activation plasmid and an IL-2-targeting gRNA plasmid were described to determine the ability of cimetidine to regulate endogenous gene expression within the CRISPRa method.
[0098] Figure 19B The study showed that IL-2 expression was induced only in the presence of cimetidine from cells expressing PRSIM-based activation plasmids and IL-2-targeting gRNA plasmids.
[0099] Figure 20 The results showed dose-dependent induction of complex formation using a group of small molecule HCV protease inhibitors.
[0100] Figure 21 The diagram illustrates a two-dimensional interaction between the HCVNS3 / NS4A binding sites and the cimetidine binding sites.
[0101] Figure 22 The ability of a group of mutant HCV proteases to form complexes with PRSIM_23 and cimetidine was demonstrated.
[0102] Figure 23 shows the relationship between cimetidine and HCV NS3 / NS4A'WT'(S139A)PR ( Figure 23A ), HCVNS3 / NS4AK136D PR ( Figure 23B HCVNS3 / NS4A K136N PR ( Figure 23C ) and HCVNS3 / NS4A D168E PR ( Figure 23D The data combines Octet-derived affinity data. The data represent 2-3 independent experiments.
[0103] Figure 24A Titration curves of heterodimerization of cimetidine-induced mutant HCV NS3 / 4A PR / PRSIM_23 binding molecules are shown; HCVNS3 / 4A PR'WT'(S139A)(●), HCV PRNS3 / 4A K136D(■), HCV PRNS3 / 4A K136N(▲) and HCV PRNS3 / 4A D168E(◇).
[0104] Figure 24B -E indicates the presence of HCVNS3 / 4APR'WT'(S139A) in the presence of cimetidine (20, 800, 40, and 20 nM). Figure 24B HCV PRNS3 / 4A K136D Figure 24C HCV PRNS3 / 4A K136N ( Figure 24D ) and HCVPRNS3 / 4A D168E ( Figure 24EAffinity data derived from BIAcore for binding with PRSIM_23 (left), and no significant binding in the absence of simipvir (right). The gray curve represents the measured data points, and the black dashed line represents the global fit line used for analysis. The data represent 3 independent experiments.
[0105] Figure 25A We compared the use of small molecule inhibitors with added HCVNS3 / 4A PR to inhibit the formation of the switch complex with and without cimetvir / HCVNS3 / 4A PR pre-incubation.
[0106] Figure 25B Small molecule inhibitors of HCV NS3 / 4APR can disrupt the switch complex by competing with cimetidine to bind to HCV NS3 / 4APR variants (with amino acid mutations at positions 168 or 136).
[0107] Figure 26A Data obtained from the split transcription factor assay of the PRSIM_23HCV NS3 / 4A PR mutant compared to the wild type are shown.
[0108] Figure 26B Vectors for generating monoclonal cell lines expressing GFP-PEST under the control of PRSIM_23HCV NS3 / 4PR WT and mutants obtained via CRISPR through AAVS1 transgene knock-in are described. The expressed protein and the effect of cimetidine addition leading to cell activation are also described.
[0109] Figure 26C Representative histograms are shown, demonstrating GFP fluorescence intensity measured by flow cytometry in cell lines expressing GFP-PEST under the control of the split transcription factor PRSIM_23HCV NS3 / 4PRWT and mutants. Monoclonal cell lines were induced with cimetidine for 24 hours.
[0110] Figure 26D GFP fluorescence data were obtained in cell lines expressing GFP-PEST under the control of the split transcription factor PRSIM_23HCVNS3 / 4APRwt or its mutant. Cells were treated with cimetidine to induce expression. Cimetidine was removed, and GFP fluorescence was measured by flow cytometry at different time points after removal.
[0111] Figure 27AThe overall structure of the HCV NS3 / 4A(S193A)PR:PRSIM_57:cimepvir ternary complex is shown. Top image: HCV NS3 / 4A(S193A)PR (light gray) and PRSIM_57 (dark gray) are shown in surface representation, with the cimepvir molecule shown as a ball-and-stick (black) sandwiched between the two proteins. Bottom image: HCV NS3 / 4A(S193A)PR (light gray) and PRSIM_57 (dark gray) are shown in cartoon form. Cimepvir is shown as a ball-and-stick (black), with the 2mFo-DFc electron density profile at 2σ.
[0112] Figure 27B Details of the molecular interactions between HCV NS3 / 4A(S193A)PR, PRSIM_57, and cimetvir are shown. Top panel: Details of the interactions between HCV NS3 / 4A(S193A)PR and PRSIM_57 and cimetvir. The interaction of HCV NS3 / 4A(S193A)PR residues with cimetvir (ball and stick, black) is as previously determined (PDB 3KEE), and the side chains are shown in ball and stick form (carbon-light gray, oxygen / nitrogen-black). The hydrophobic residues in PRSIM_57 that form a hydrophobic cavity around cimetvir (Phe77, Ile74, Ile125, and Trp249) are shown in ball and stick form (carbon-dark gray, oxygen / nitrogen-black). A direct interaction occurs between the side chain of Phe77 and cimetvir quinoline. Bottom panel: Details of the interaction between HCV NS3 / 4A(S193A)PR and PRSIM_57 (colored in the left panel). The interacting residues are shown in a ball-and-stick configuration.
[0113] Figure 28A -C indicates the design of the kill switch. Figure 28A Caspase 9 (Casp9) is crucial for inducing cell death through apoptosis via homodimerization of its CARD dimerization domain. Figure 28B Replace the CARD domain with the PRSIM switch component. Figure 28C The addition of cimetidine induces the formation of PRSIM23-HCVPR heterodimers, leading to dimerization of the Casp9 active domain and subsequently inducing apoptosis.
[0114] Figure 29A -E indicates the function of the kill switch after adding cimetidine. Figure 29A Phase contrast images of HEK293 cells stably transduced using the wt kill switch show rapid cell death after treatment with cimetidine. Figure 29BPhase contrast images of human tumor cell lines HCT116 and HT29, stably transduced using a wt kill switch, show rapid cell death after treatment with cimetidine. Figure 29C Schematic diagram of caspase 3 assay. Figure 29D : Caspase 3 activity in HEK293+ / - 10 nM cimetidine transduced by wt killer switch compared to treated, untransduced HEK293 cells. Figure 29E In the presence of 10 nM cimetvir, caspase 3 activity was observed in three single-cell clones of killer switch-transduced HCT116 and HT29 relative to untransduced HCT116 and HT29. ****p<0.0001; ns=not significant.
[0115] Figure 30 The confluence of untransduced ES cell line Sa121 and the same cell line transduced with a cimetidine-induced wt kill switch over time was shown after the addition of increased concentrations of cimetidine.
[0116] Figure 31A Targeted knock-in of the B2M locus of the kill switch in induced pluripotent stem cells (iPSCs) promoted simmepvir-induced cell killing. Figure 31A : Schematic diagram of the kill switch knock-in strategy. The kill switch (iCasp9) is knocked into the B2M locus of the iPSC. The adeno-associated virus (AAV) vector is used to deliver a donor template containing an iCasp9 expression cassette with B2M homologous arms flanking it. Light-colored symbols indicate CRISPR target sites. LHA, left homologous arm; RHA, right homologous arm; EF1a promt, EF-1α promoter; P2A, 2A self-cleaving peptide derived from porcine cyclophosphamide virus-1; Puro, puromycin resistance gene; blast, blastcin resistance gene; bGH pA, bovine growth hormone polyadenylation signal; PrimerF, forward primer for genotyping; PrimerR, reverse primer for genotyping. Figure 31B Genotyping of single-cell clones of iPSCs containing a kill switch. Five single-cell iPSC clones (1B7, 1D6, 1D12, 1G8, and 2D8) were isolated after gene knock-in. Genomic DNA was extracted from these clones. Primers indicated in A) were used to amplify the targeted locus. Amplicones were loaded onto a 1.2% agarose gel for electrophoresis. Genotyping data showed that single-cell clones 1B7, 1D12, 1G8, and 2D8 had biallelic B2M-targeted kill switch knock-in, while clone 1D6 had a monollelic kill switch knock-in. iPSC-WT, wild-type (unmodified) iPSC; KI, amplicon of the knock-in allele; WT, amplicon of the wild-type allele. Figure 31CCell proliferation index quantified using xCELLigence Real-Time Cell Analysis (RTCA). iPSC single-cell clones were cultured for 1 day before cimetidine induction. Cell index was monitored for 3 days before and after induction.
[0117] Figure 32A -B indicates the functionality of the kill switch S196A mutant after adding cimetidine. Figure 32A Phase contrast images of HEK293 cells stably transduced with the killer switch S196A mutant show rapid cell death after treatment with cimetidine. Figure 32B : Caspase 3 activity in HEK293+ / - 10 nM cimetidine transduced with wt and S196A mutant killer switch relative to treated, untransduced HEK293 cells. ***p<0.0005; ns=not significant. Detailed Implementation
[0118] Various aspects and embodiments of this disclosure will now be discussed with reference to the accompanying drawings. Other aspects and embodiments will be apparent to those skilled in the art. All documents mentioned herein are incorporated herein by reference.
[0119] Expression carrier and expression box
[0120] As used herein, an "expression vector" is a DNA molecule used to express foreign genetic material in cells. Any suitable vector known in the art can be used. Suitable vectors include DNA plasmids, binary vectors, viral vectors, and artificial chromosomes (e.g., yeast artificial chromosomes). In some embodiments, the expression vector is a viral vector, as described in more detail below. In some embodiments, the expression vector is a DNA plasmid.
[0121] As used herein, an "expression cassette" is a polynucleotide sequence that can influence the transcription of an expression product, which may be a protein. A "coding sequence" is intended to represent a portion of the genetic polynucleotide sequence encoding the expression product. When the expression product is a protein, this sequence may be called a "protein-coding sequence." Protein-coding sequences typically begin with a start codon at the 5' end and end with a stop codon at the 3' end. As described in more detail below, an expression cassette may be part of an expression vector or a portion of the viral genome within a viral particle.
[0122] Typically, an expression cassette contains a promoter operatively linked to a protein-coding sequence. The term "operatively linked" refers to the covalently linked selection of the coding sequence and the promoter in a manner that places the expression of the protein-coding sequence under the influence or control of the promoter. Therefore, if a promoter can influence the transcription of a protein-coding sequence, then the promoter is operatively linked to the protein-coding sequence. Where appropriate, the resulting transcript can then be translated into the desired protein.
[0123] Any suitable promoter known in the art can be used in the expression cassette, provided it functions in the cell type used. For example, when the cell is a mammalian cell, the promoter could be a cytomegalovirus (CMV) promoter. In the case of using multiple expression cassettes, each coding sequence can be independently and operatively linked to its own promoter. Alternatively, the coding sequences of one or more expression cassettes can be operatively linked to the same promoter.
[0124] In cases where multiple expression boxes are described, such as first and second expression boxes, they may be part of the same expression carrier or different expression carriers. Therefore, in some embodiments, the first and second expression boxes may be located on the same expression carrier. In other embodiments, the first expression box is located on a first expression carrier, and the second expression box is located on a second expression carrier.
[0125] When multiple expression cassettes are located on the same expression vector, the individual expression cassettes (e.g., first and second expression cassettes) can be separated by an internal ribosome entry site (IRES) or a 2A element. The use of an IRES or 2A element allows for the expression of multiple expression products using the same promoter. In other words, when the first and second expression cassettes are separated by an IRES or 2A element, both the first and second expression cassettes are operatively connected to the same promoter.
[0126] target proteins and small molecules
[0127] The aspects and embodiments disclosed herein relate to target proteins derived from non-human proteins, i.e., proteins that are not endogenous to humans. In one embodiment, the non-human protein is derived from a viral, bacterial, fungal, or protozoan protein. In one embodiment, the non-human protein is derived from a viral protein and the small molecule is an inhibitor of the viral protein. In one embodiment, the non-human protein is derived from a bacterial protein and the small molecule is an inhibitor of the bacterial protein. In one embodiment, the non-human protein is derived from a fungal protein and the small molecule is an inhibitor of the fungal protein. In one embodiment, the non-human protein is derived from a protozoan protein and the small molecule is an inhibitor of the protozoan protein. In one embodiment, the non-human protein is derived from a viral protease and the small molecule is an inhibitor of that viral protease.
[0128] The term "derived from" in the context of target protein is intended to indicate that the target protein has a similar, but not necessarily identical, amino acid sequence to its source protein, and that the target protein is still capable of binding small molecules. The target protein derived from the protein may have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical amino acid sequence to its source protein. The target protein derived from the protein may contain fewer than 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 sequence changes compared to its source protein. For example, a target protein having the amino acid sequence listed in SEQ ID NO:2 is derived from a viral protease having the sequence listed in SEQ ID NO:1. Furthermore, the target protein may have fewer amino acids than its source protein (i.e., it is a shorter protein).
[0129] Viral proteases are enzymes encoded by the genetic material of viral pathogens. The normal function of these enzymes is to catalyze the cleavage of specific peptide bonds in viral polyprotein precursors or cellular proteins. Examples of viral proteases include those encoded by the hepatitis C virus (HCV), human immunodeficiency virus (HIV), herpesviruses, retroviruses, and the human rhinovirus (HRV) family. Examples of certain viral proteases and small-molecule inhibitors of these proteases are described, for example, in Patick and Potts (1998).
[0130] A small molecule is an organic compound with a molecular weight typically 2000 Daltons or less. Small molecules can be synthetic or naturally occurring.
[0131] The choice of small-molecule viral protease inhibitors is not particularly limited, provided that they a) can bind to the target protein and b) have been evaluated for human clinical purposes. Viral protease inhibitors evaluated for human clinical purposes include those approved by regulatory agencies for human clinical use, such as inhibitors approved for treatment by the Food and Drug Administration (FDA) and / or the European Medicines Agency (EMA). Viral protease inhibitors evaluated for clinical purposes also include those being / already being tested in clinical trials involving humans, and preferably those that have undergone Phase I clinical trials. Preferably, the viral protease inhibitor is approved for human clinical use. Preferably, the viral protease inhibitor is suitable for long-term administration (daily administration for six months or longer), is cell-permeable, orally administered, and / or not used as a first-line therapy.
[0132] The viral protease used can be monomeric or multimeric (e.g., dimer, trimer, tetramer, etc.). The use of a monomeric viral protease may be preferred, for example, when the desired functional activity is elicited in a strict 1:1 ratio of the target protein fusion protein to the binding member fusion protein. Alternatives to the preferred multimeric viral protease may exist; for example, when the target protein is fused to a transcriptional regulatory domain in a split transcription factor, using a multimeric viral protease can increase the number of transcriptional regulatory domains recruited to the target gene.
[0133] In some embodiments, the viral protease is either the HCV NS3 / 4A protease or the HIV protease. Both proteases are known to be targeted by several approved small molecule inhibitors, which are known to be generally well-tolerated in humans and suitable for long-term administration. Examples of small molecule inhibitors targeting the HCV NS3 / 4A protease are described in De Clercq. 2014. Examples of small molecule inhibitors targeting the HIV protease are described by Lv et al. 2015.
[0134] In some embodiments, the viral protease is the HCV NS3 / 4A protease. HCV NS3 / 4A PR is a monomer, relatively small in size (21 kDa), can be expressed in the cytoplasm, and has not been found to be associated with DNA, making it an ideal candidate for the viral protease disclosed herein. The HCV NS3 / 4A protease may have an amino acid sequence of amino acid positions 1030-1206 of the amino acid sequence listed in UniProt accession number A8DG50-1 (sequence version 2; sequence updated April 29, 2008). In some embodiments, the HCV NS3 / 4A protease may have an amino acid sequence listed in SEQ ID NO:1. Target proteins derived from the HCV NS3 / 4A protease may have an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence listed in SEQ ID NO:1.
[0135] Several small molecule inhibitors are known to bind to HCV NS3 / 4A proteases and have been approved for human use. Some of these are listed in the table below:
[0136]
[0137]
[0138] The structures of target proteins complexed with the corresponding small molecules are provided as PDB accession numbers, which correspond to crystal structures available from the Protein Database (PDB). The small molecule structures and chemical names are also provided as PDB accession numbers.
[0139] Small molecules can be peptide mimics. The terms "peptide mimic," "peptide analog," and "peptide analog" are used interchangeably and refer to compounds that are not composed of amino acids but have essentially the same characteristics as peptide compounds that are composed entirely of amino acids.
[0140] Other small molecule inhibitors that are being or have already been tested in clinical trials involving humans include fadaprevir, sovalprevir, and vezoprevir.
[0141] In some embodiments, the small molecule is selected from the group consisting of cimetidine, boprevir, telazorevir, asunaprevir, vaniridine, vorciprevir, gliprevir, velurevir, nalarevir, danoprevir, fadaprevir, gorarevir, sovalprevir, vezoprevir, and their pharmacologically acceptable analogs or derivatives. All of these small molecules have been approved for human use and / or have been tested in clinical trials involving humans. In some embodiments, the small molecule is selected from the group consisting of cimetidine, boprevir, telazorevir, asunaprevir, vaniridine, vorciprevir, gliprevir, velurevir, gorarevir, danoprevir, and nalarevir, or their pharmacologically acceptable analogs or derivatives. These small molecules have been approved for human use.
[0142] In certain embodiments, the small molecule is selected from the group consisting of cimetvir, boprevir, and telazorevir, or pharmacologically acceptable analogs or derivatives thereof. These small molecules (cimetvir, boprevir, and telazorevir) are well tolerable in humans and have been approved for long-term human use. In certain embodiments, the small molecule may be cimetvir or a pharmacologically acceptable analog or derivative thereof. (Cimipvir) It is an orally administered small molecule with cell permeability and a pharmacokinetic (PK) profile that supports once-daily dosing. It has been used in combination with ribavirin and pegylated interferon for long-term (up to 39 months) treatment of HCV infection and is included in the WHO Essential Medicines List, indicating that it is a well-tolerated and widely used drug.
[0143] Pharmacologically acceptable analogs and derivatives of small molecules include compounds that are different from the “parent” small molecule but have similar antiviral activity, and include tautomers, regioisomers, geometric isomers, and applicable stereoisomers, including optical isomers (enantiomers) and other stereoisomers (diastereomers), as well as pharmaceutically acceptable salts and derivatives (including prodrug forms) where applicable in the context. For example, analogs of cimetvir include those compounds covered by formula (I) as defined in WO 2007014926 A1.
[0144] Cimiprovir may have the following chemical structures:
[0145]
[0146] In some embodiments, the viral protease is an HIV protease. The HIV protease exists as a 22 kDa homodimer, wherein each subunit consists of 99 amino acids. The HIV protease may have amino acid positions 501-599 of the amino acid sequence listed in UniProt accession number P03366-1 (sequence version 3; sequence updated January 23, 2007). Target proteins derived from the HIV protease may have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical amino acid sequence positions 501-599 of the amino acid sequence listed in UniProt accession number P03366-1. Target proteins derived from the HIV protease may be monomeric proteins. For example, the target protein may contain one or more amino acid mutations that reduce the likelihood of forming a homodimer protein.
[0147] Several small molecule inhibitors are known to bind to HIV proteases and have been approved for human use. Some of these are listed in the table below:
[0148]
[0149] Ampravir is a prodrug form of ampravir, and has better solubility and bioavailability than ampravir.
[0150] In some embodiments, the small molecule is selected from the group consisting of: atanavir, darunavir and phosampunavir, ampravir, indinavir, lopinavir / ritonavir, nelfinavir, ritonavir, saquinavir and tepravir, or pharmacologically acceptable analogs or derivatives thereof.
[0151] In specific embodiments, the small molecules are selected from the group consisting of atazanavir, derenavir, and fosampravir, or pharmacologically acceptable analogs or derivatives thereof. These small molecules are well tolerated and have good bioavailability in humans. Furthermore, HIV protease inhibitors are typically used long-term in patients, and these small molecule inhibitors are expected to be tolerated for long-term use.
[0152] In some embodiments, the target protein exhibits diminished viral activity compared to its source viral protease. In this context, diminished viral activity refers to the target protein having lower enzymatic activity, for example, lower protease activity than its source viral protease. For instance, enzyme activity can be tested using a fluorescent peptide cleavage assay as described in the examples or by Sabareigos et al. (2009). In short, the fluorescent peptide cleavage assay involves incubating the target protein / viral protease with a FRET substrate containing a donor-quencher pair, thereby causing peptide cleavage to separate the donor from the quencher, emitting energy detectable at a specific wavelength, such as 490 nm.
[0153] In some embodiments, if the activity of the target protein measured in an enzyme activity assay, such as a fluorescent peptide cleavage assay, is less than 10% of the viral protease activity, the target protein is considered to have weakened viral activity compared to the viral protease from which it originated. In some embodiments, when the concentration of the target protein is less than 1 nM, less than 10 nM, less than 100 nM, or less than 1 μM when measured in an enzyme activity assay, such as a fluorescent peptide cleavage assay, the target protein does not show any detectable viral activity.
[0154] Compared to the viral protease from which it originates (e.g., compared to SEQ ID NO:1), the target protein may contain one or more amino acid mutations (e.g., substitution / insertion / deletion). Target proteins containing one or more amino acid mutations should retain their ability to form three-part complexes with small molecules and binding members, which can be determined, for example, using homogeneous time-resolved fluorescence (HTRF) assays as described in the examples.
[0155] In some embodiments, the target protein contains one or more amino acid mutations compared to a viral protease of its origin, wherein the one or more amino acid mutations attenuate the viral activity of the target protein. The one or more amino acid mutations may be located at the active site of the viral protease.
[0156] For example, the HCV NS3 / 4A protease contains a catalytic triplet involving amino acid residues H57, D81, and S139 of the HCV NS3 / 4A protease. See, for example, Grakoui et al. 1993; Eckart et al. 1993; and Bartenschlager et al. 1993. These amino acid residues correspond to positions H72, D96, and S154 of the amino acid sequence in SEQ ID NO:1. Therefore, the target protein may contain amino acid mutations at one or more amino acids selected from positions 72, 96, and 154 of the HCV NS3 / 4A protease, corresponding to the amino acid numbering in SEQ ID NO:1. Other known residues of the HCV NS3 / 4A protease involved in viral activity include C97, C99, C145, and H149 of the HCV NS3 / 4A protease (corresponding to positions C112, C114, C160, and H164 in SEQ ID NO:1). See, for example, Hikikata et al. 1993; and Stempniak et al. 1997. In some embodiments, the target protein contains an amino acid mutation (e.g., substitution) at one or more amino acids selected from HCV NS3 / 4A proteases at positions 72, 96, 112, 114, 154, 160, and 164, wherein the amino acid number corresponds to SEQ ID NO:1.
[0157] In certain embodiments, the target protein contains an amino acid mutation at position 154 of the HCVNS3 / 4A protease, corresponding to amino acid numbering in SEQ ID NO:1, for example, a mutation to alanine. In some embodiments, the target protein has the amino acid sequence of SEQ ID NO:2.
[0158] The full-length sequence of the NS3 protein is provided in SEQ ID NO:199. The amino acid mutation at position 154 of SEQ ID NO:1 described herein corresponds to position 139 of SEQ ID NO:199.
[0159] The identification table of the potential amino acid mutations based on the full-length NS3 protein (SEQ ID NO:199) and the corresponding position numbers in the amino acid sequence of the NS3 / 4A protease listed in SEQ ID NO:1 is shown below:
[0160]
[0161] As a further example, the HIV protease comprises a catalytic triplet involving amino acid residues D25, T26, and G27, wherein the amino acid numbering is based on the amino acid sequence of amino acid positions 501-599 listed in the UniProt accession number P03366-1 (sequence version 3; sequence updated January 23, 2007). Therefore, the target protein may contain amino acid mutations at one or more amino acids selected from positions 25, 26, and 27 of the HIV protease, wherein the amino acid numbering is based on the amino acid sequence of amino acid positions 501-599 listed in the UniProt accession number P03366-1 (sequence version 3; sequence updated January 23, 2007).
[0162] The target protein and the small molecule interact to form a complex between the target protein and the small molecule, referred to herein as the T-SM complex. The interaction can be covalent or non-covalent. In some embodiments, such as when measured using surface plasmon resonance or biolayer interferometry, the small molecule binds to the target protein at a kD of less than 1 mM, preferably less than 500 nM, more preferably less than 200 nM, even more preferably less than 100 nM, or even more preferably less than 50 nM. In some embodiments, such as when measured using surface plasmon resonance or biolayer interferometry, the small molecule binds to the target protein at a kD between 25 nM and 200 nM, between 25 nM and 100 nM, or between 25 nM and 75 nM.
[0163] It may be desirable to introduce amino acid mutations (e.g., substitutions) into the target protein to reduce the affinity of small molecules for the target protein and allow a second small molecule to replace the small molecule in the T-SM complex. For example, as demonstrated herein, cimetvir binds to the target protein HCV NS3 / 4A protease (S139A) (SEQ ID NO:2) with a very high affinity, preventing other small molecules binding to the target protein from replacing cimetvir from the T-SM complex. Reducing the binding affinity of cimetvir to HCV NS3 / 4A protease by introducing one or more amino acid modifications into the target protein allows for the use of different HCV NS3 / 4A protease small molecule inhibitors to disrupt the tripartite complex formed between HCV NS3 / 4A protease (S139A), cimetvir, and PRSIM_23. Thus, in some embodiments, the target protein contains one or more affinity-reducing amino acid mutations (e.g., substitutions) compared to its derived viral protease (e.g., SEQ ID NO:1), such that the small molecule binds to the target molecule with a lower affinity than the small molecule binds to its parent target protein. In this case, the "parental target protein" lacks one or more amino acid mutations that reduce affinity, but is otherwise identical to the target protein. The parental target protein may be a viral protease from which the target protein is derived (e.g., the parental target protein may have the amino acid sequence listed in SEQ ID NO:1), or the parental target protein itself may be derived from a viral protease (e.g., the parental target protein may have the amino acid sequence listed in SEQ ID NO:2).
[0164] One or more affinity-reducing amino acid mutations can result in a small molecule binding to the target protein with an affinity at least 1.5 times lower than the small molecule binding to its parent target protein. One or more affinity-reducing amino acid mutations can result in a small molecule binding to the target protein with an affinity 1.5 to 10 times lower than the small molecule binding to its parent target protein, or 1.5 to 5 times lower than the small molecule binding to its parent target protein. One or more affinity-reducing amino acid mutations can result in a small molecule binding to the target protein at a KD concentration of 25 nM to 200 nM, 25 nM to 100 nM, or 25 nM to 75 nM, optionally wherein the affinity is measured using a biolayer interferometry method, such as using an Octet RED384.
[0165] As demonstrated herein, amino acid substitutions at positions 151 and 183 of the HCV NS3 / 4A protease (where the amino acid numbers correspond to those in SEQ ID NO:1) reduced the affinity of cimetidine for the HCV NS3 / 4A protease and allowed a second small molecule to disrupt the tripartite complex formed between the HCV NS3 / 4A protease, cimetidine, and the binding member PRSIM_23. Furthermore, it was demonstrated that target proteins containing these affinity-reducing mutations retain function in dimerization-inducible proteins, such as dissociative transcription factors. Amino acid positions 151 and 183 of SEQ ID NO:1 correspond to amino acid positions 136 and 168, respectively, of the full-length NS3 protein listed in SEQ ID NO:99.
[0166] Therefore, in some embodiments where the target protein is derived from the viral protease HCVNS3 / 4A protease, the target protein may have an affinity-lowering amino acid mutation (e.g., substitution) at one or more amino acids selected from positions 151 and 183, wherein the amino acid number corresponds to SEQ ID NO:1. In some embodiments, the affinity-lowering amino acid mutation at position 151 is a mutation to aspartic acid, asparagine, or histidine, and the affinity-lowering mutation at position 183 is a mutation to glutamic acid, glutamine, or alanine. In some embodiments, the affinity-lowering amino acid mutation at position 151 is a mutation to aspartic acid or asparagine, and the affinity-lowering mutation at position 183 is a mutation to glutamic acid. The target protein may also contain affinity-lowering amino acid mutations other than the other amino acid mutation described herein (e.g., in addition to the amino acid mutation at position 154, such as a mutation to alanine).
[0167] In some embodiments, the target protein has an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1 and contains alanine at position 154 and aspartic acid, asparagine, or histidine (e.g., aspartic acid or asparagine) at position 151, wherein the amino acid number corresponds to SEQ ID NO:1. In some embodiments, the target protein is derived from a viral protease having the amino acid sequence listed in SEQ ID NO:1, wherein the target protein differs from the viral protease in that it contains alanine at position 154 and aspartic acid, asparagine, or histidine (e.g., aspartic acid or asparagine) at position 151, and optionally 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 additional sequence alterations (e.g., functionally conserved substitutions), wherein the amino acid numbering corresponds to SEQ ID NO:1. In some embodiments, the target protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the sequences listed in SEQ ID NO:211 and 215.
[0168] In some embodiments, the target protein has an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to that of SEQ ID NO:1 and includes alanine at position 154 and glutamic acid, glutamine, or alanine (e.g., glutamic acid) at position 183, wherein the amino acid numbering corresponds to SEQ ID NO:1. In some embodiments, the target protein is derived from a viral protease having the amino acid sequence listed in SEQ ID NO:1, wherein the target protein differs from the viral protease in that it contains alanine at position 154 and aspartic acid, asparagine, or histidine (e.g., aspartic acid) at position 151, and optionally 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 additional sequence alterations (e.g., functionally conserved substitutions), wherein the amino acid numbering corresponds to SEQ ID NO:1. In some embodiments, the target protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence listed in SEQ ID NO:213.
[0169] Combined members
[0170] As used herein, a “binding member” refers to a polypeptide or protein that specifically binds to the T-SM complex. The term “specific” may refer to the fact that the binding member does not exhibit any significant binding to molecules other than the T-SM complex. Such molecules are referred to as “non-target molecules” and include individual target proteins and individual small molecules, i.e., target proteins or small molecules that are not part of the T-SM complex.
[0171] In some embodiments, if the degree of binding to a non-target molecule is less than about 10% of the binding of the binding member to the T-SM, as measured, for example, by isothermal calorimetry, ELISA, surface plasmon resonance (SPR), biolayer interferometry (BLI), homogeneous time-resolved fluorescence (HTRF), microthermophoresis (MST), or by radioimmunoassay (RIA), the binding member is considered not to exhibit any significant binding to the non-target molecule. In some embodiments, the degree of binding to a non-target molecule is less than about 5% or about 1% of the binding of the binding member to the T-SM. Methods for determining the degree of binding involving SPR (Biacore) and HTRF are described in examples. In some embodiments where the degree of binding is measured by HTRF, the binding member described herein binds to the T-SM complex with an affinity at least twice that of another non-target molecule (e.g., a target protein alone or a small molecule alone). In some embodiments, the binding member binds to its target molecule with an affinity at least one of three, five, ten, or twenty times that of another non-target molecule. Alternatively, where the binding member described herein binds to the T-SM complex with an affinity at least 10 times greater than that for another non-target molecule (e.g., a target protein alone or a small molecule alone), the binding specificity can be reflected by the binding affinity. Binding affinity can be measured by surface plasmon resonance, such as Biacore. In some embodiments, the binding member binds to its target molecule with an affinity at least one of 50, 100, 1000, or 10000 times greater than that for another non-target molecule.
[0172] Binding affinity is typically measured by Kd (the equilibrium dissociation constant between the binding member and its target). It is well known that the lower the Kd value, the higher the binding affinity of the binding member. For example, a binding member that binds to the T-SM complex with a Kd of 1 nM will be considered to bind to the T-SM complex with an affinity greater than that of a binding member that binds to a non-target molecule with a Kd of 100 nM.
[0173] The binding member can bind to the T-SM complex with an affinity of Kd equal to or less than 50 nM, 25 nM, 20 nM, 15 nM, or 10 nM. The binding member can also bind to a single target protein or a single small molecule with an affinity of Kd equal to or greater than 500 nM, 1 μM, 10 μM, 100 μM, or 1 mM. Binding affinity can be measured by SPR, for example, via Biacore. When measured by SPR, the binding member may show minimal or no binding with a single target protein and / or a single small molecule.
[0174] In some embodiments, the binding member specifically binds to the T-SM complex at epitopes present only on the T-SM complex and not on the individual target protein or the individual small molecule. For example, the binding member may bind to a site on the T-SM complex that comprises at least a portion of the small molecule and a portion of the target protein. Alternatively, the formation of the T-SM complex may induce a conformational change in the target protein, resulting in the formation of a new epitope that is specifically bound by the binding member. Methods for determining whether a binding member binds to a specific epitope include X-ray crystallography, peptide scanning, site-directed mutagenesis mapping, and mass spectrometry.
[0175] In embodiments where the T-SM complex comprises a target protein derived from the HCVNS3 / 4A protease (e.g., SEQ ID NO:2) and the small molecule cimetvir, the binding member can specifically bind T-SM by interacting with at least one of the following residues of the target protein: Tyr71, Gly75, Thr76, Val93, Asp94, wherein the amino acid numbers correspond to SEQ ID NO:1. The binding member can interact with 1, 2, 3, 4, or most preferably all 5 of these residues. The binding member can also specifically bind the T-SM complex by interacting with the quinoline moiety of cimetvir. At least some of these interactions can be hydrophobic interactions and / or water-mediated interactions. The interactions can be determined using X-ray crystallography, for example as described in the examples.
[0176] The binding member can be an antibody molecule, such as a single-chain variable fragment, or an antibody mimic, such as the Tn3 protein.
[0177] antibody molecules
[0178] The aspects and embodiments disclosed herein relate to binding members as antibody molecules, such as single-chain variable fragments (scFv).
[0179] The term "antibody molecule" describes immunoglobulins, whether naturally occurring or partially or wholly synthetically produced. Antibody molecules can be human or humanized. Antibody molecules can be monoclonal antibody molecules. Examples of antibodies are immunoglobulin isotypes, such as immunoglobulin G (IgG), and their isotype subclasses, such as IgG1, IgG2, IgG3, and IgG4, as well as their fragments.
[0180] Antibody molecules typically contain six complementarity-determining regions (CDRs): three in the variable weight (VH) region: HCDR1, HCDR2, and HCDR3, and three in the variable light (VL) region: LCDR1, LCDR2, and LCDR3. The six CDRs collectively define the complementary sites of the antibody molecule, which are the portions of the antibody molecule that bind to the T-SM complex. The VH and VL regions contain framework regions (FRs) on either side of each CDR, providing a scaffold for the CDR. From the N-terminus to the C-terminus, the VH region contains the following structure: N-terminus-[HFR1]-[HCDR1]-[HFR2]-[HCDR2]-[HFR3]-[HCDR3]-[HFR4]-C-terminus; the VL region contains the following structure: N-terminus-[LFR1]-[LCDR1]-[LFR2]-[LCDR2]-[LFR3]-[LCDR3]-[LFR4]-C-terminus.
[0181] There are several different conventions for defining antibody CDR and FR, such as those described below: Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991); Chothia et al., J. Mol. Biol. 196:901-917 (1987); LeFranc et al., Nucleic Acids Res. (2015) 43 (Database): D413-22, describing IMGT numbers; and Retter et al., Nucleic Acids Res. (2005) 33 (Supplement 1): D671-D674, describing VBASE2. The CDR and FR of the VH and VL regions of the antibody molecules described in this paper are based on the definitions of Kabat (Kabat, EA et al. (1991)).
[0182] As used herein, the term "antibody molecule" includes antibody fragments provided that they exhibit binding to one or more relevant target molecules. Examples of antibody fragments include Fv, scFv, Fab, scFab, F(ab')2, Fab2, biantibodies, triantibodies, scFv-Fc, microantibodies, and single-domain antibodies (e.g., VhH). Unless the context requires otherwise, the term "antibody molecule" as used herein is therefore equivalent to "antibody molecule or antigen-binding fragment thereof." In a specific exemplary embodiment, the antibody molecule is a single-chain variable fragment (scFv).
[0183] Antibody molecules and their construction and use are well known in the art and described, for example, in Holliger & Hudson, Nature Biotechnology, 23(9):1126-1136 (2005). Monoclonal and other antibody molecules can be used, along with recombinant DNA technology, to produce additional antibodies or chimeric molecules that retain the specificity of the original antibody. Such techniques can involve introducing the CDR or variable region of one antibody molecule into different antibody molecules (EP-A-184187, GB 2188638A, and EP-A-239400).
[0184] Given the current technology associated with monoclonal antibodies, antibody molecules targeting most antigens can be prepared. The antigen-binding domain can be part of an antibody (e.g., a Fab fragment) or a synthetic antibody fragment (e.g., scFv). Suitable monoclonal antibodies against selected antigens can be prepared using known techniques, such as those disclosed in "Monoclonal Antibodies: A Manual of Techniques," H. Zola (CRC Press, 1988) and "Monoclonal Hybridoma Antibodies: Techniques and Applications," J.G. R. Urrell (CRC Press, 1982). Chimeric antibodies are discussed by Neuberger et al. (8th International Biotechnology Symposium Part 2, 1988, pp. 792-799).
[0185] The sequence identifiers (SEQ ID NO) of the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, variable heavy (VH) chain, variable light (VL) chain, and scFv amino acid sequences of PRSIM_57, PRSIM_01, PRSIM_04, PRSIM_67, PRSIM_72, and PRSIM_75 are listed in the table below:
[0186]
[0187] In some embodiments, the antibody molecule comprises heavy chain complementarity-determining regions (HCDRs) 1 to 3 and / or light chain complementarity-determining regions (LCDRs) of the following:
[0188] i)PRSIM_57, listed in SEQ ID NO:151, 152, 153, 154, 155 and 156 respectively;
[0189] ii) PRSIM_01, listed in SEQ ID NO 151, 152, 198, 154, 155 and 156 respectively;
[0190] iii) PRSIM_04, listed in SEQ ID NO:151, 152, 163, 154, 155 and 164 respectively;
[0191] iv) PRSIM_67, listed in SEQ ID NO:165, 166, 167, 168, 169 and 170 respectively;
[0192] v)PRSIM_72, listed in SEQ ID NO:171, 172, 173, 174, 175 and 176 respectively; or
[0193] vi) PRSIM_75, listed in SEQ ID NO: 177, 178, 179, 180, 181 and 182 respectively.
[0194] The CDR sequence is defined according to the Kabat numbering scheme.
[0195] In some embodiments, the combination member may contain a number of sequence changes, such as one, two, three, four, or five sequence changes, in any one or more CDRs defined above.
[0196] In some embodiments, the antibody molecule comprises a variable heavy (VH) chain and / or a variable light (VL) chain of the following:
[0197] i)PRSIM_57, listed in SEQ ID NO:186 and 187 respectively;
[0198] ii) PRSIM_01, listed in SEQ ID NO 188 and 189 respectively;
[0199] iii) PRSIM_04, listed in SEQ ID NO:190 and 191 respectively;
[0200] iv) PRSIM_67, listed in SEQ ID NO:192 and 193 respectively;
[0201] v)PRSIM_72, listed in SEQ ID NO:194 and 195 respectively; or
[0202] vi)PRSIM_75, listed in SEQ ID NO:196 and 197 respectively.
[0203] In certain embodiments, the antibody molecule is a single-chain variable fragment (scFv). Typically, an scFV comprises a VH chain and a VL chain separated by a peptide linker. The peptide linker may be as defined herein. In some embodiments, the peptide linker separating the VH and VL chains may comprise the amino acid sequence SEQ ID NO:204.
[0204] In some embodiments, the scFv comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the following amino acid sequences:
[0205] i) PRSIM_57 listed in SEQ ID NO:12;
[0206] ii) PRSIM_01 listed in SEQ ID NO:10;
[0207] iii) PRSIM_04 listed in SEQ ID NO:11;
[0208] iv) PRSIM_67 listed in SEQ ID NO:13;
[0209] v) PRSIM_72 listed in SEQ ID NO:14; or
[0210] vi) PRSIM_75 listed in SEQ ID NO:15.
[0211] In a particular embodiment, scFv comprises the following amino acid sequence:
[0212] i) PRSIM_57 listed in SEQ ID NO:12;
[0213] ii) PRSIM_01 listed in SEQ ID NO:10;
[0214] iii) PRSIM_04 listed in SEQ ID NO:11;
[0215] iv) PRSIM_67 listed in SEQ ID NO:13;
[0216] v) PRSIM_72 listed in SEQ ID NO:14; or
[0217] vi) PRSIM_75 listed in SEQ ID NO:15.
[0218] antibody mimics
[0219] The binding member can be an antibody mimic. Antibody mimics are organic compounds that can specifically bind to antigens but are structurally different from antibody molecules. Examples of antibody mimics include scaffold proteins such as Tn3 protein, affibodies, affiliins, affimers, affitins, alphabodies, anticarrier proteins, avimers, DARPins, flynomers, Kunitz domain peptides, monomers, and nanoclamps (nanoCLAMPs).
[0220] In certain aspects and embodiments, the binding member is the Tn3 protein.
[0221] The Tn3 protein is based on the structure of the type III fibronectin module (FnIII) and is derived from the third FnIII domain of human tendinin C. The generation and use of the Tn3 protein are described, for example, in WO 2009 / 058379, WO 2011 / 130324, WO2011130328 and Gilbreth et al. 2014.
[0222] The Tn3 protein and the native FnIII domain from tendinin C are characterized by the same three-dimensional structure: a β-sandwich structure with three β chains (A, B, and E) on one side and four β chains (C, D, F, and G) on the other side, connected by six loop regions. These loop regions are designated according to the β chains attached to the N-terminus and C-terminus of each loop. Thus, the AB loop is located between β chains A and B, the BC loop between chains B and C, the CD loop between β chains C and D, the DE loop between β chains D and E, the EF loop between β chains E and F, and the FG loop between β chains F and G. The FnIII domain has solvent-exposed loops resistant to randomization; these loops facilitate the generation of different pools of protein scaffolds capable of binding to specific targets with high affinity.
[0223] The wild-type Tn3 protein may contain the sequence SEQ ID NO:134. In the wild-type Tn3 protein, the BC, DE, and FG loops are located at positions 23 to 31, 51 to 56, and 75 to 80, respectively, with amino acid numbers corresponding to SEQ ID NO:134. The Tn3 protein may contain one, preferably two, more preferably three, or even more preferably four stable mutations selected from the list consisting of I32F, D49K, E86I, and T89K, with amino acid numbers corresponding to SEQ ID NO:134. The amino acid sequences of the wild-type Tn3 protein containing all four stable mutations are listed in SEQ ID NO:135. The Tn3 protein may additionally contain one or more stable mutations described in Gilbreth et al. 2014 (see, in particular, Table 1 of Gilbreth et al. 2014).
[0224] The Tn3 protein undergoes directed evolution through one or more loops designed to be randomized and resemble the complementarity-determining region (CDR) of the antibody variable region. This directed evolutionary pathway leads to the generation of antibody-like binding members with high affinity for targets of interest, such as the T-SM complex described herein.
[0225] Therefore, the Tn3 protein that specifically binds to the T-SM complex described herein may contain the BC, DE, and FG loops of PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, or PRSIM_47. For example, the Tn3 protein may contain the sequence of SEQ ID NO:134 or SEQ ID NO:135, wherein the BC, DE, and FG loops located at positions 23 to 31, 51 to 56, and 75 to 80, respectively, replace the BC, DE, and FG loops of PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, or PRSIM_47, wherein the amino acid numbers correspond to SEQ ID NO:134.
[0226] Those skilled in the art will be able to readily determine the amino acid sequences of the BC, DE, and FG loops of the PRSIM clone described herein. For example, the amino acid sequence of the PRSIM clone can be compared with the amino acid sequence of the wild-type Tn3 protein, such as those listed in SEQ ID NO: 134 or 135.
[0227] The Tn3 sequence, amino acid position, and BC, DE, and FG ring sequences of PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, or PRSIM_47 are listed in the table below:
[0228]
[0229] In some embodiments, the Tn3 protein comprises the following BC, DE, and FG loops:
[0230] i)PRSIM_23, listed in SEQ ID NO:136, 137 and 138 respectively;
[0231] ii) PRSIM_32, listed in SEQ ID NO:139, 140 and 141 respectively;
[0232] iii) PRSIM_33, listed in SEQ ID NO:142, 143 and 144 respectively;
[0233] iv) PRSIM_36, listed in SEQ ID NO:145, 146 and 147 respectively; or
[0234] v)PRSIM_47, listed in SEQ ID NO:148, 149 and 150 respectively,
[0235] In some embodiments, the Tn3 protein comprises the following BC, DE, and FG loops:
[0236] i)PRSIM_23, wherein the BC ring contains amino acids at positions 23 to 32 of SEQ ID NO:5; the DE ring contains amino acids at positions 52 to 57 of SEQ ID NO:5; and the FG ring contains amino acids at positions 76 to 85 of SEQ ID NO:5;
[0237] ii) PRSIM_32, wherein the BC ring contains amino acids at positions 23 to 34 of SEQ ID NO:6; the DE ring contains amino acids at positions 54 to 59 of SEQ ID NO:6; and the FG ring contains amino acids at positions 78 to 87 of SEQ ID NO:6;
[0238] iii) PRSIM_33, wherein the BC ring contains amino acids at positions 23 to 34 of SEQ ID NO:7; the DE ring contains amino acids at positions 54 to 59 of SEQ ID NO:7; and the FG ring contains amino acids at positions 78 to 87 of SEQ ID NO:7;
[0239] iv) PRSIM_36, wherein the BC ring contains amino acids at positions 23 to 34 of SEQ ID NO:8; the DE ring contains amino acids at positions 54 to 59 of SEQ ID NO:8; and the FG ring contains amino acids at positions 78 to 87 of SEQ ID NO:8; or
[0240] v)PRSIM_47, wherein the BC ring contains amino acids at positions 23 to 31 of SEQ ID NO:9; the DE ring contains amino acids at positions 51 to 56 of SEQ ID NO:9; and the FG ring contains amino acids at positions 75 to 84 of SEQ ID NO:9.
[0241] In some embodiments, the Tn3 protein contains numerous sequence alterations, such as one, two, three, four, or five, within any one or more of the BC, DE, and EF loops defined above. In some embodiments, the Tn3 protein contains numerous sequence alterations, such as one, two, three, four, or five, outside the BC, DE, and EF loops defined above.
[0242] In some embodiments, the Tn3 protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the following amino acid sequences:
[0243] i) PRSIM_23 listed in SEQ ID NO:5;
[0244] ii) PRSIM_32 listed in SEQ ID NO:6;
[0245] iii) PRSIM_33 listed in SEQ ID NO:7;
[0246] iv) PRSIM_36 listed in SEQ ID NO:8; or
[0247] v)PRSIM_47 listed in SEQ ID NO:9.
[0248] In a particular embodiment, the Tn3 protein comprises the following amino acid sequence:
[0249] i) PRSIM_23 listed in SEQ ID NO:5;
[0250] ii) PRSIM_32 listed in SEQ ID NO:6;
[0251] iii) PRSIM_33 listed in SEQ ID NO:7;
[0252] iv) PRSIM_36 listed in SEQ ID NO:8; or
[0253] v)PRSIM_47 listed in SEQ ID NO:9.
[0254] Dimerization-inducible protein
[0255] In some embodiments, the target protein is fused to a first component polypeptide and a binding member is fused to a second component polypeptide. In a particular embodiment, the first and second component polypeptides form part of a dimerization-inducible protein.
[0256] As used herein, “dimerization-inducible protein” refers to a protein or complex comprising first and second component polypeptides, wherein the first and second polypeptides dimerize to form a functional protein. The term “dimerization-inducible protein” includes “fragmented protein,” “dimerization-deficient protein,” and “fragmented complex.” The term “component polypeptide” is intended to include both single-chain and multi-chain polypeptides. The first and second component polypeptides in a dimerization-inducible protein are typically inactive or have low activity when separated, but become closely adjacent after dimerization and thus become active or have increased activity. As illustrated in the examples, the specific combination of binding members, target proteins, and small molecules described herein can modulate the dimerization of dimerization-inducible proteins, resulting in a significant increase in activity observed when the binding member binds to the T-SM complex compared to the separate components of the dimerization-inducible protein alone.
[0257] Examples of dimerization-inducible proteins include split chimeric antigen receptors (split CARs; e.g., as described in Wu et al. 2015), split kinases (e.g., as described in Camacho-Soto et al. 2014), split transcription factors (e.g., as described in Taylor et al. 2010), split apoptosis proteins (e.g., split caspases described in Chelur et al. 2007), and split reporter systems (e.g., as described in Dixon et al. 2016).
[0258] When the binding member binds to the T-SM complex, the dimerization-inducible protein will exhibit increased activity. This increased activity can be compared to the activity observed when the binding member is not bound to the T-SM complex (e.g., due to the absence of one or more target proteins, small molecules, or the binding member). In some embodiments, the activity observed when the binding member binds to the T-SM complex is increased by at least 1.5, 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 times compared to the activity observed when the binding member is not bound to the T-SM complex.
[0259] The method for measuring the activity of dimerization-inducible proteins will depend on the specific dimerization-inducible protein being studied. When the first and second component peptides form a chimeric antigen receptor (CAR) after dimerization, CAR activity can be determined by measuring immune cell activation and / or proliferation. As described in the examples, CAR activity can be measured by the production of interleukin-2 (IL-2) after antigen stimulation of the CAR, for example, by ELISA. When the first and second component peptides form a kinase after dimerization, the kinase activity can be determined by the conversion of phosphate (e.g., radioactive) into kinase, as described in Camacho-Soto et al. 2014. 32 P) Measurement can be performed by incorporation into a peptide substrate. When the first and second component peptides dimerize to form transcription factors, transcriptional activity can be determined by measuring the expression of the desired downstream expression cassette, which is regulated by a split transcription factor as described in the examples. When the first and second component peptides dimerize to form a therapeutic protein, activity can be measured by determining the functional activity of the protein using a suitable assay. When the first and second component peptides dimerize to form caspase, caspase activity can be measured using a caspase activity assay or by measuring apoptosis and cell death. When the first and second component peptides dimerize to form a reporter system, reporter activity can be determined by measuring the expression of a reporter, such as luciferase.
[0260] The first-component peptide can fuse to the C-terminus or N-terminus of the target protein or binding member. The second-component peptide can fuse to the C-terminus or N-terminus of the target protein or binding member. The component peptides can fuse with the target protein or binding member through peptide linkers. Suitable peptide linkers include those represented by [G]n, [S]n, [A]n, [GS]n, [GGS]n, [GGGS]n (SEQ ID NO.:239), [GGGGS]n (SEQ ID NO.:240), [GGSG]n (SEQ ID NO.:241), [GSGG]n (SEQ ID NO.:242), [SGGG]n (SEQ ID NO.:243), [SSGG]n (SEQ ID NO.:244), [SSSG]n (SEQ ID NO.:245), [GG]n, [GGG]n, [SA]n, [TGGGGSGGGGS]n (SEQ ID NO.:185), and combinations thereof, where n is an integer between 1 and 30. For example, n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or any number up to 30. The component peptide can be directly fused to the target protein or binding member, for example in the form of: first component peptide - peptide linker - target protein. Alternatively, the component peptide can be indirectly fused to the target protein or binding member using one or more other peptides that separate the first component peptide from the target protein or binding member, for example in the form of: first component peptide - other peptide - peptide linker - target protein.
[0261] In some embodiments, the first component peptide is fused to more than one target protein or binding member. In some embodiments, the second component peptide is fused to more than one target protein or binding member, or a combination of both. For example, the first or second component peptide may be fused to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 binding members. In some embodiments, the first or second component peptide is fused to 2 to 10 or 2 to 5 binding members. In a particular embodiment, the first or second component peptide is fused to 3 binding members. For example, the first or second component peptide may be fused to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 target proteins. In some embodiments, the first or second component peptide is fused to 2 to 10 or 2 to 5 target proteins. In a particular embodiment, the first or second component peptide is fused to 3 target proteins. When multiple binding members or target proteins are present, they can fuse to each other via peptide linkers, such as those described above.
[0262] Split transcription factors
[0263] Dimerization-inducible proteins can be fragmented transcription factors. In some embodiments, the first component polypeptide comprises a DNA-binding domain; and the second component polypeptide comprises a transcriptional regulatory domain, wherein the first and second component polypeptides dimerize to form a transcription factor. "Forming a transcription factor" means bringing the first and second component polypeptides close enough that they can reconstruct the transcriptional regulatory activity of the desired expression product. When the binding member binds to the T-SM complex, the dimerization-inducible protein will exhibit increased transcriptional regulatory activity, wherein the increased transcriptional regulatory activity is observed compared to when the binding member is not bound to the T-SM complex.
[0264] Transcriptional regulatory domains can be transcriptional activation domains capable of upregulating transcription of genes bound by fragmented transcription factors. Suitable transcriptional activation domains include the p65 subunit of nuclear factor κB (Bitko & Barik, J. Virol. [Journal of Virology] 72:5610-5618 (1998) and Doyle & Hunt, Neuroreport 8:2937-2942 (1997)); Liu et al., Cancer Gene Ther. [Cancer Gene Therapy] 5:3-28 (1998)); replication and transcriptional activators (RTA; Lukac et al., J... Virol. [Journal of Virology] 73, 9348-61 (1999)), HSVVP16 activation domain (see, e.g., Hagmann et al., J. Virol. [Journal of Virology] 71, 5952-5962 (1997)), nuclear hormone receptor (see, e.g., Torchia et al., Curr. Opin. Cell. Biol. [Current Views in Cell Biology] 10: 373-383 (1998)); or artificially chimeric functional domains, such as VP64 (Beerli et al., (1998) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 95: 14623-33) and degradation determinant (degron) (Molinari et al., (1999) EMBOJ. [Journal of the European Society for Molecular Biology] 18, 6439-6447). Other exemplary activation domains include Oct1, Oct-2A, Sp1, AP-2, and CTF1 (Seipel et al., EMBO J. [Journal of the European Society for Molecular Biology] 11, 4961-4968 (1992), as well as p300, CBP, PCAF, SRC1PvALF, AtHD2A, and ERF-2.See, for example, Robyr et al. (2000) Mol. Endocrinol. [Molecular Endocrinology] 14:329-347; Collingwood et al. (1999) J. Mol. Endocrinol. [Journal of Molecular Endocrinology] 23:255-275; Leo et al. (2000) Gene. [Gene] 245:1-11; Manteuffel-Cymborowska (1999) Acta Biochim. Pol. [Polish Journal of Biochemistry] 46:77-89; McKenna et al. (1999) J. Steroid Biochem. Mol. Biol. [Journal of Steroid Biochemistry and Molecular Biology] 69:3-12; Malik et al. (2000) Trends Biochem. Sci. [Trends in Biochemical Sciences] 25:277-283; and Lemon et al. (1999) Curr. Opin. Genet. Dev. [Recent Perspectives on Genetics and Development] 9:499-504. Other exemplary activation domains include, but are not limited to, OsGAI, HALF-1, C1, AP1, ARF-5, -6, -7 and -8, CPRF1, CPRF4, MYC-RP / GP and TRAB1, and modified Cas9 transactivators. See, for example, Ogawa et al. (2000) Gene 245:21-29; Okanami et al. (1996) Genes Cells 1:87-99; Goff et al. (1991) Genes Dev. 5:298-309; Cho et al. (1999) Plant Mol. Biol. 40:419-429; Ulmason et al. (1999) Proc. Natl. Acad. Sci. USA 96:5844-5849; Sprenger-Haussels et al. (2000) Plant J. 22:1-8; Gong et al. (1999) Plant Mol. Biol. [Plant Molecular Biology] 41:33-44; Hobo et al. (1999) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 96:15,348-15,353; and Perez-Pinera et al. (2013) Nature Methods [Nature Methods] 10:973-976). The transcriptional activation domain may comprise any combination of the exemplary activation domains described above. In some embodiments, multiple transcriptional activation domains may be used, such as tandem reporters of the same domain or fusions of different domains.In some embodiments, the transcriptional activation domain is a VPR, which is a tripartite activator consisting of VP64, p65, and Rta domains. An example of a TRD-T fusion protein containing a VPR is listed in SEQ ID NO:225 (NS4A / 3PR S139A-VPR). The generation and use of VPR as a transcriptional activator are described, for example, in Chavez et al. 2015. In some embodiments, the transcriptional activation domain is HSF-1, optionally combined with p65.
[0265] Alternatively, the transcriptional regulatory domain may be a transcriptional repressive domain capable of downregulating transcription of genes bound by fragmented transcription factors. Transcriptional repressive domains include, but are not limited to, KRAB A / B, KOX, TGF-β-inducible early gene (TIEG), v-erbA, SID, MBD2, MBD3, members of the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al. (1999) Cell 99:451-454; Tyler et al. (1999) Cell 99:443-446; Knoepfler et al. (1999) Cell 99:447-450; and Robertson et al. (2000) Nature Genetics 25:338-342. Other exemplary repressive domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al. (1996) Plant Cell 8:305-321; and Wu et al. (2000) Plant J. 22:19-27.
[0266] DNA-binding domains can be any protein that binds to a target sequence in a sequence-specific manner. For example, a DNA-binding domain can be or may contain a transcription factor or its DNA-binding fragment that binds to a target sequence in a sequence-specific manner. Any transcription factor or its DNA-binding fragment intended to bind to a target sequence in a specific manner can be used with the disassembled transcription factors disclosed herein. DNA-binding domains can be or contain naturally occurring DNA-binding domains, such as binding domains from human transcription factors. For example, a DNA-binding protein can be any human transcription factor (e.g., any of those listed in Supplementary Information S3) as described by Vaquerizas et al. (2009), or its DNA-binding fragment. For example, a DNA-binding protein can be a member of the C2H2 zinc finger family, a homology domain family, or a helical-loop-helical family, or its DNA-binding fragment. In a particular embodiment, the DNA-binding domain can be zinc finger homology domain transcription factor 1 (ZFHD1). ZFHD1 contains zinc fingers 1 and 2 from the Zif268 transcription factor and the Oct-1 homology domain. For example, the design and construction of ZFHD1 was described by Pomerantz et al. (1995).
[0267] DNA-binding domains can be or contain DNA-binding domains, such as zinc finger DNA-binding domains, TALE DNA-binding domains, DNA-binding domains derived from broad-spectrum nucleases (e.g., IsceI-based), or DNA-binding domains derived from CRISPR / Cas systems. These binding domains can be engineered to bind selected target sequences, such as target sequences naturally present (endogenous) in the cell or trans-provided target sequences (e.g., as part of a third expression cassette). For example, US 6453242 B1 describes the engineering of zinc finger DNA-binding domains to bind specific target sequences. In one embodiment, the DNA-binding domain is a TALE DNA-binding domain. For example, WO 2010079430 A1 describes the engineering of TALE DNA-binding domains to bind specific target sequences. In one embodiment, the DNA-binding domain is an engineered DNA-binding domain derived from a broad-spectrum nuclease. For example, WO 2007047859 A1 describes the engineering of broad-spectrum nucleases to bind specific target sequences. Broad-spectrum nucleases can be engineered to no longer cleave DNA. In one embodiment, the DNA-binding domain is an engineered DNA-binding domain derived from a CRISPR / Cas system. For example, WO 2013176772A1 describes an engineered DNA-binding domain from a CRISPR / Cas system to bind a specific sequence. CRISPR / Cas systems typically involve RNA-directed endonucleases (e.g., Cas9) that are directed to a specific DNA sequence through complementarity between an associated guide RNA (gRNA) and its target sequence. Therefore, an engineered DNA-binding domain from a CRISPR / Cas system typically comprises a complex of an RNA-directed endonuclease (e.g., Cas9 or a variant thereof) and the guide RNA. Cas9 variants have been produced that lack endonuclease activity but retain the ability to interact with DNA. See, for example, Chavez et al. 2015, which describes the use of nuclease-inactive (dCas9) variants in transcriptional regulation methods. Therefore, the DNA-binding domain may include nuclease-inactive Cas9 variants that bind to the target sequence upon the addition of a specific gRNA specific to the target sequence. An example of a DBD-BM fusion protein containing dCas9 as a DNA-binding domain is listed in SEQ ID NO:227 (spdCas9-PRSIM_23x3). An example of a DBD-BM-targeting guide RNA for human IL-2 is listed in SEQ ID NO:SEQ ID NO:229. Hill et al. 2018 and WO 2018 / 213848A1 describe the use of dCas9 variants as part of a split transcription factor.
[0268] The binding member can fuse with the transcriptional regulatory domain or the DNA binding domain.
[0269] In some embodiments:
[0270] (1) The first component polypeptide contains a DNA-binding domain and fuses with the target protein to form the DBD-T fusion protein; and
[0271] The second component polypeptide contains a transcriptional regulatory domain and fuses with a binding member to form a TRD-BM fusion protein, or
[0272] (2) The first component polypeptide contains a transcriptional regulatory domain and fuses with the target protein to form a TRD-T fusion protein; and
[0273] The second-component polypeptide contains a DNA-binding domain and fuses with a binding member to form the DBD-BM fusion protein.
[0274] The DNA-binding domain, target protein, transcriptional regulatory domain, and binding members are further defined in this paper.
[0275] In some embodiments:
[0276] (1) The first component polypeptide contains a DNA-binding domain and is fused with a target protein to form a DBD-T fusion protein, wherein the target protein contains an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:1, and
[0277] The second component polypeptide contains a transcriptional regulatory domain and fuses with a binding member to form a TRD-BM fusion protein, or
[0278] (2) The first component polypeptide contains a transcriptional regulatory domain and is fused with the target protein to form a TRD-T fusion protein, wherein the target protein has an amino acid sequence that is at least 90% identical to SEQ ID NO:1, and
[0279] The second-component polypeptide contains a DNA-binding domain and fuses with a binding member to form the DBD-BM fusion protein.
[0280] In (1) or (2):
[0281] a) Combine BC, DE, and FG rings or Tn3 sequences whose members contain PRSIM_23;
[0282] b) Combine BC, DE, and FG rings or Tn3 sequences whose members contain PRSIM_32;
[0283] c) Combine BC, DE, and FG rings or Tn3 sequences whose members contain PRSIM_33;
[0284] d) Combine members containing BC, DE, and FG rings or Tn3 sequences;
[0285] e) Combined with BC, DE, and FG rings or Tn3 sequences whose members include PRSIM_47;
[0286] f) Combine HCDR and / or LCDR, or VH and / or VL sequences whose members include PRSIM_57;
[0287] g) Combine HCDR and / or LCDR, or VH and / or VL sequences whose members include PRSIM_01;
[0288] h) Combine HCDR and / or LCDR, or VH and / or VL sequences whose members include PRSIM_04;
[0289] i) Combine HCDR and / or LCDR, or VH and / or VL sequences whose members include PRSIM_67;
[0290] j) Combining HCDR and / or LCDR sequences whose members include PRSIM_72, or VH and / or VL sequences; or
[0291] k) Combine members containing HCDR and / or LCDR, or VH and / or VL sequences containing PRSIM_75.
[0292] The DBD-T fusion protein may contain an amino acid sequence that has at least 90% identity with the amino acid sequence listed in SEQ ID NO:45. In a particular embodiment, the TRD-BM fusion protein defined above (1) may contain an amino acid sequence that has at least 90% sequence identity with the amino acid sequence listed in any one of SEQ ID NO:57-67.
[0293] The TRD-T fusion protein may contain an amino acid sequence that has at least 90% identity with the amino acid sequence listed in SEQ ID NO:44. In a particular embodiment, the DBD-BM fusion protein defined above (2) may contain an amino acid sequence that has at least 90% sequence identity with the amino acid sequence listed in any one of SEQ ID NO:46-56.
[0294] As illustrated in the examples, some exemplary binding members exhibit a preference for fusing to DNA-binding domains or transcriptional regulatory domains, thus observing that increased transcriptional regulatory activity depends on whether a particular binding member fuses with a DNA-binding domain or a transcriptional regulatory domain. Therefore, in some embodiments:
[0295] (1) The first component polypeptide contains a DNA-binding domain and is fused with a target protein to form a DBD-T fusion protein, wherein the target protein contains an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:1, and
[0296] The second-component polypeptide contains a transcriptional regulatory domain and fuses with a binding member to form the TRD-BM fusion protein.
[0297] in:
[0298] a) The binding member in the TRD-BM fusion protein contains the BC, DE, and FG loops of PRSIM_23 or the Tn3 sequence;
[0299] b) The binding member in the TRD-BM fusion protein contains the BC, DE, and FG loops of PRSIM_47 or the Tn3 sequence, or
[0300] c) The binding members in the TRD-BM fusion protein include the HCDR and / or LCDR of PRSIM_04, or the VH and / or VL sequences;
[0301] d) The binding members in the TRD-BM fusion protein include the HCDR and / or LCDR of PRSIM_72, or the VH and / or VL sequences;
[0302] e) The binding member in the TRD-BM fusion protein includes the HCDR and / or LCDR of PRSIM_67, or the VH and / or VL sequence; or
[0303] f) The binding member in the TRD-BM fusion protein includes the HCDR and / or LCDR of PRSIM_75, or the VH and / or VL sequence, or
[0304] (2) The first component polypeptide contains a transcriptional regulatory domain and is fused with a target protein to form a TRD-T fusion protein, wherein the target protein has an amino acid sequence that is at least 90% identical to that of SEQ ID NO:1, and
[0305] The second-component polypeptide contains a DNA-binding domain and fuses with a binding member to form the DBD-BM fusion protein.
[0306] in:
[0307] g) The binding member in the DBD-BM fusion protein includes the BC, DE, and FG loops of PRSIM_23 or the Tn3 sequence;
[0308] h) The binding members in the DBD-BM fusion protein include the HCDR and / or LCDR of PRSIM_01, or the VH and / or VL sequences;
[0309] i) The binding members in the DBD-BM fusion protein include the HCDR and / or LCDR of PRSIM_57, or the VH and / or VL sequences;
[0310] j) The binding member in the DBD-BM fusion protein contains the BC, DE, and FG loops of PRSIM_32 or the Tn3 sequence;
[0311] k) The binding member in the DBD-BM fusion protein contains the BC, DE, and FG loops of PRSIM_33 or the Tn3 sequence; or
[0312] l) The binding member in the DBD-BM fusion protein includes the BC, DE, and FG loops of PRSIM_36 or the Tn3 sequence.
[0313] In some embodiments, the binding member or target protein is fused to the C-terminus of the DNA-binding domain. In other embodiments, the binding member or target protein is fused to the N-terminus of the transcriptional regulatory domain. The binding member or target protein can be fused to the DNA-binding domain or the transcriptional regulatory domain via a peptide linker, for example, via one or more of the above-described peptide linkers. In a particular embodiment, the linker has the amino acid sequence TGGGGSGGGGS (SEQ ID NO: 185) or SA.
[0314] As described in the examples, PRSIM_23 was found to provide strong gene expression regulation in both directions. Therefore, in some embodiments:
[0315] (1) The first component polypeptide contains a DNA-binding domain and is fused with a target protein to form a DBD-T fusion protein, wherein the target protein contains an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:1; and
[0316] The second component polypeptide contains a transcriptional regulatory domain and fuses with a binding member to form a TRD-BM fusion protein, or
[0317] (2) The first component polypeptide contains a transcriptional regulatory domain and is fused with a target protein to form a TRD-T fusion protein, wherein the target protein has an amino acid sequence that is at least 90% identical to SEQ ID NO:1; and
[0318] The second-component polypeptide contains a DNA-binding domain and fuses with a binding member to form the DBD-BM fusion protein.
[0319] In (1) or (2), the binding member contains the BC, DE and FG rings of PRSIM_23 or the Tn3 sequence.
[0320] In a specific embodiment:
[0321] (1) The DBD-T fusion protein contains an amino acid sequence that is at least 90% identical to that in SEQ ID NO:45; the TRD-BM fusion protein contains an amino acid sequence that is at least 90% identical to that in SEQ ID NO:57, or
[0322] (2) The DBD-BM fusion protein contains an amino acid sequence that is at least 90% identical to the amino acid sequence listed in SEQ ID NO:46; and the TRD-T fusion protein contains an amino acid sequence that is at least 90% identical to the amino acid sequence listed in SEQ ID NO:44.
[0323] As illustrated in the examples, PRSIM-based CIDs can also be applied to activate CRISPR (CRISPRa) systems. For instance, this can be used to promote endogenous gene regulation.
[0324] Therefore, in some embodiments, the DBD-BM fusion protein comprises an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:227; and the TRD-T fusion protein comprises an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:225. The DBD-BM fusion protein can be directed to the target sequence by using a specific guide RNA specific to the target sequence.
[0325] As illustrated in the examples, split transcription factors containing a DNA-binding domain fused to multiple copies of a target protein or binding member exhibit increased expression compared to split transcription factors containing a DNA-binding domain fused to a single copy of a target protein or binding member.
[0326] Therefore, in some embodiments...
[0327] DBD-T fusion proteins contain DNA-binding domains that are fused to multiple copies of the target protein (e.g., two, three, four, five, or more copies of the target protein); or
[0328] The DBD-BM fusion protein contains a DNA-binding domain that is fused to multiple copies (e.g., two, three, four, five or more binding members) of the target protein.
[0329] Multiple binding members or multiple target proteins can be separated by a linker, for example, by one or more of the aforementioned peptide linkers. In a specific exemplary embodiment, the DBD-T fusion protein includes a DNA-binding domain fused to three target proteins, or the DBD-BM fusion protein includes a DNA-binding domain fused to three binding members.
[0330] The first and / or second component polypeptides may additionally contain nuclear localization signals (e.g., signals from T-antigens in SV40 medium).
[0331] The split transcription factor can also be provided with a third expression cassette, which encodes the desired expression product. The DNA-binding domain of the split transcription factor binds to the target sequence in the third expression cassette, enabling the transcription factor to regulate the expression of the desired expression product. "Capable of regulating expression" means that the DNA-binding domain can bind to the target sequence and, after forming a transcription factor with the transcriptional regulatory domain (i.e., after dimerization of a dimerization-inducible protein), possesses transcriptional regulatory activity that regulates (increases or decreases) the expression of the desired expression product. The desired expression product can be RNA or a peptide (peptide, polypeptide, or protein). Preferably, the desired expression product is a peptide. The desired expression product can also be a therapeutic protein, i.e., a protein that exerts a therapeutic effect in a subject.
[0332] The target sequence can be located within or very close to the promoter, which is operatively linked to the coding sequence of the desired expression product. “Very close” means that the target sequence is within 500 bp, 250 bp, 100 bp, 50 bp, or 25 bp of the sequence corresponding to the promoter.
[0333] Split-type chimeric antigen receptor
[0334] Dimerization-inducible proteins can be dissociated chimeric antigen receptors (dissociated CARs).
[0335] CARs combine antibody-like recognition and T-cell activation functions. They typically consist of: an antigen-specific recognition domain (e.g., derived from an antibody), a transmembrane domain anchoring the CAR to a T cell, a co-stimulatory domain, and one or more intracellular signaling domains that induce persistent, transport, and effector functions in transduced T cells. The design and use of CARs are well known in the art and have been described, for example, by Sadelain et al. 2013.
[0336] Detached CARs have been designed that require user-provided exogenous signals to activate the CAR, as described by Wu et al. (2015). In these detached receptors, the antigen-binding component and the intracellular signaling component assemble only in the presence of heterodimerized small molecules, allowing users to precisely control the timing, location, and dosage of T cell activity. Such detached CARs hold promise for mitigating toxicity, for example, by reducing off-target effects.
[0337] In one embodiment, the dimerization-inducible protein comprises:
[0338] A first-component polypeptide containing a co-stimulatory domain and fused to a target protein as defined herein; and
[0339] A second-component polypeptide containing intracellular signal transduction domains and fused with binding members as defined herein.
[0340] The first component polypeptide may further include an antigen-specific recognition domain and a transmembrane domain, and the second component polypeptide further includes a transmembrane domain and a second co-stimulatory domain, wherein the first and second component polypeptides dimerize to form a chimeric antigen receptor (CAR). "Forming a CAR" means bringing the first and second component polypeptides close enough that they can reconstruct a fully functional CAR.
[0341] In another embodiment, the dimerization-inducible protein comprises:
[0342] The first component polypeptide contains intracellular signal transduction domains and is fused with a target protein as defined herein; and
[0343] A second-component polypeptide containing a first co-stimulatory domain and fused with a binding member as defined herein.
[0344] The first component polypeptide may further include a transmembrane domain and a second costimulatory domain, and the second component polypeptide may further include a transmembrane domain and a second costimulatory domain, wherein the first component polypeptide and the second component polypeptide dimerize to form a chimeric antigen receptor (CAR).
[0345] When the binding member binds to the T-SM complex, the split CAR will have increased activity, which is an increase in activity compared to the activity observed when the binding member is not bound to the T-SM complex.
[0346] In one embodiment, the first component polypeptide comprises, from the N-terminus to the C-terminus:
[0347] i) Antigen-specific recognition domain;
[0348] ii) Transmembrane domains; and
[0349] ii) First costimulatory domain;
[0350] Furthermore, the second component polypeptide comprises, from the N-terminus to the C-terminus:
[0351] i) Transmembrane structural domains;
[0352] ii) The second costimulatory domain; and
[0353] iii) Intracellular signal transduction domains,
[0354] The first and second component peptides dimerize to form CAR.
[0355] In some embodiments, the target protein and the binding member are fused at the C-terminal positions of the corresponding transmembrane domains in the first and second component peptides. For example, the target protein or the binding member may be fused to the N-terminus or C-terminus of the corresponding co-stimulatory domain in the first and second component peptides. In a particular embodiment, one of the target protein and the binding member is fused to the C-terminus of the first co-stimulatory domain, and the other is fused to the C-terminus of the second co-stimulatory domain.
[0356] For example, in one embodiment, the first component polypeptide comprises, from the N-terminus to the C-terminus:
[0357] i) Antigen-specific recognition domain;
[0358] ii) Transmembrane domain
[0359] iii) First costimulatory domain;
[0360] Furthermore, the second component polypeptide comprises, from the N-terminus to the C-terminus:
[0361] i) Transmembrane structural domains;
[0362] ii) The second costimulatory domain; and
[0363] iii) Intracellular signal transduction domains,
[0364] The target protein fuses with the C-terminus of the first costimulatory domain, and the binding member fuses with the C-terminus of the second costimulatory domain.
[0365] For example, in another embodiment, the first component polypeptide comprises, from the N-terminus to the C-terminus:
[0366] i) Antigen-specific recognition domain;
[0367] ii) Transmembrane domain
[0368] iii) First costimulatory domain;
[0369] Furthermore, the second component polypeptide comprises, from the N-terminus to the C-terminus:
[0370] i) Transmembrane structural domains;
[0371] ii) The second costimulatory domain; and
[0372] iii) Intracellular signal transduction domains,
[0373] Specifically, the binding member fuses with the C-terminus of the first costimulatory domain, and the target protein fuses with the C-terminus of the second costimulatory domain.
[0374] The target protein and / or binding member can be directly fused to the corresponding costimulatory domain. More preferably, the target protein and binding member are separated from their respective costimulatory domains via peptide linkers. Peptide linkers can be further defined herein. In some embodiments, the target protein and binding member are separated from their respective costimulatory domains via linkers containing the amino acid sequence listed in SEQ ID NO:204. Similarly, peptide linkers can separate different domains in the first and second component peptides. For example, a transmembrane domain can be separated from a second costimulatory domain via a peptide linker (e.g., a peptide linker containing the amino acid sequence GS), and / or the second costimulatory domain can be separated from an intracellular signaling domain via a peptide linker (e.g., a peptide linker containing the amino acid sequence listed in SEQ ID NO:204).
[0375] Non-limiting examples of suitable co-stimulatory domains include, but are not limited to, activation domains from 4-1BB (CD137), CD28, ICOS, OX-40, BTLA, CD27, CD30, GITR, and HVEM. In one embodiment, the first and second co-stimulatory domains are 4-1BB activation domains.
[0376] Non-limiting examples of suitable intracellular signal transduction domains include, but are not limited to, cytoplasmic sequences of T-cell receptors (TCRs) and co-receptors that work synergistically to initiate signal transduction upon antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences having the same function. Specific intracellular signal transduction domains include those comprising signal transduction motifs called immune receptor tyrosine-based activation motifs or ITAMs. Examples of ITAM-containing signal transduction domains include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD5, CD22, CD79a, CD79b, and CD66d. In a particular embodiment, the intracellular signal transduction domain is derived from CD3ζ.
[0377] The transmembrane domain can be derived from natural or synthetic sources. If the source is natural, the domain can originate from any membrane-binding or transmembrane protein. The transmembrane region can originate from (i.e., containing at least one or more of the following transmembrane regions) the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or from immunoglobulins such as IgG4. Alternatively, the transmembrane domain can be synthetic, in which case it will primarily contain hydrophobic residues such as leucine and valine. Triads of phenylalanine, tryptophan, and valine can be found at each end of a synthetic transmembrane domain. Optionally, short oligopeptides or polypeptide linkers, preferably between 2 and 10 amino acids in length, can form a connection between the transmembrane domain of the CAR and the intracellular signal transduction domain. Glycine-serine duplexes provide particularly suitable linkers. In a particular embodiment, the transmembrane domain is derived from CD28.
[0378] The first and second polypeptides may additionally include a hinge domain, such as an IgG4 or CD8a hinge domain, located at the N-terminus of the transmembrane domain of the first and / or second polypeptide. Examples of hinge domains are described, for example, in Qin et al. 2017. In a particular embodiment, the hinge domain is a human IgG4 hinge domain.
[0379] The antigen-specific recognition domain suitable for the dimerization-inducible proteins disclosed herein can be any antigen-binding polypeptide, many of which are known in the art. In some cases, the antigen-binding domain is a single-chain Fv (scFv). Other antibody-based recognition domains (cAb VHH (camel antibody variable domain) and humanized versions, IgNAR VH (shark antibody variable domain) and humanized versions, sdAb VH (single-domain antibody variable domain) and "camelized" antibody variable domains) are suitable for use. In some cases, T-cell receptor (TCR)-based recognition domains, such as single-chain TCRs (scTv, single-chain bidomain TCRs containing ννβ), are also suitable for use.
[0380] In a particular embodiment, the antigen-specific recognition domain is a single-chain Fv (scFv). As described elsewhere, the scFv typically comprises a VH chain separated from the VL chain by a peptide linker (e.g., a peptide linker containing the amino acid sequence listed in SEQ ID NO:204).
[0381] The antigen-specific recognition domains applicable to the dimerization-inducible proteins disclosed herein can possess a variety of antigen-binding specificities. In some cases, the antigen-binding domain is specific to epitopes present in antigens expressed (synthesized) by cancer cells (i.e., cancer cell-associated antigens). Cancer cell-associated antigens can be antigens associated with, for example, breast cancer cells, B-cell lymphoma, Hodgkin lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma, lung cancer cells (e.g., small cell lung cancer cells), non-Hodgkin B-cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (e.g., small cell lung cancer cells), melanoma cells, chronic lymphocytic leukemia cells, acute lymphoblastic leukemia cells, neuroblastoma cells, glioma, glioblastoma, medulloblastoma, colorectal cancer cells, etc. Cancer cell-associated antigens can also be expressed by non-cancer cells.
[0382] In a particular exemplary embodiment, the target protein used in the split CAR is derived from the HCV NS3 / 4A protease, the small molecule is cimetvir, and the binding member is based on PRSIM_23 (e.g., a BC, DE, and FG loop or Tn3 sequence containing PRSIM_23, optionally having the sequence identity and / or alterations described herein).
[0383] In some embodiments, the first component polypeptide comprises, from the N-terminus to the C-terminus:
[0384] i) Antigen-specific recognition domain;
[0385] ii) Transmembrane domain
[0386] iii) First costimulatory domain;
[0387] Furthermore, the second component polypeptide comprises, from the N-terminus to the C-terminus:
[0388] i) Transmembrane structural domains;
[0389] ii) The second costimulatory domain; and
[0390] iii) Intracellular signal transduction domains,
[0391] The target protein is fused to the C-terminus of the first costimulatory domain, and the binding member is fused to the C-terminus of the second costimulatory domain. The first component polypeptide fused to the target protein comprises an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:70. The second component polypeptide fused to the binding member comprises an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:200. Optionally, the antigen-specific recognition domain (e.g., scFv) is located at the N-terminus of an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:70.
[0392] In some embodiments, the first component polypeptide comprises a first signal peptide located at the N-terminus of the antigen-specific recognition domain. The first signal peptide may comprise the amino acid sequence listed in SEQ ID NO:201 or SEQ ID NO:202. In an exemplary embodiment, the first signal peptide comprises the amino acid sequence listed in SEQ ID NO:201.
[0393] In some embodiments, the second component polypeptide comprises a second signal peptide located at the N-terminus of a transmembrane domain. The second signal peptide may comprise the amino acid sequence listed in SEQ ID NO:201 or SEQ ID NO:202. In an exemplary embodiment, the second signal peptide comprises the amino acid sequence listed in SEQ ID NO:202. In one embodiment, the second component polypeptide comprises an amino acid sequence having at least 90% identity with the amino acid sequence listed in SEQ ID NO:203.
[0394] Also provided are engineered immune cells comprising the disassembled CAR disclosed herein. In one embodiment, the immune cells are T cells. A method for genetically modifying immune cells to express the disassembled CAR disclosed herein is also provided. This method can be performed in vitro. The method may include administering one or more expression vectors described herein to the immune cells, such that the disassembled CAR is expressed on the surface of the immune cells.
[0395] Split Reporting Subsystem
[0396] Dimerization-inducible proteins can be detached reporter subsystems. Detached reporter subsystems can be enzymes or fluorescent proteins that provide an observable phenotype during the dimerization of the first and second component peptides. The observable phenotype can be a chromatic signal, an luminescent signal, or a fluorescent signal. Dixon et al. (2017) provided a specific example of a detached reporter subsystem.
[0397] In some embodiments, the first component polypeptide includes a first reporter component; and the second component polypeptide includes a second reporter component, wherein the first component polypeptide and the second component polypeptide dimerize to form a reporter subsystem, optionally wherein the reporter subsystem provides an increased chromaticity, luminescence, or fluorescence signal when the binding member binds to the T-SM complex.
[0398] Disassembled apoptosis protein
[0399] Dimerization-inducible proteins can be dissociative apoptotic proteins. Dissociative apoptotic proteins are any proteins that can induce apoptosis when the first and second component polypeptides of a dissociative apoptotic protein dimerize. Examples of dissociative apoptotic proteins are dissociative caspases (e.g., dissociative caspase 9 or dissociative caspase 3), which can induce apoptosis upon dimerization and thus can be used to kill specific cells containing dissociative apoptotic proteins (e.g., diseased cells or therapeutic cells that have been administered for cell therapy purposes). Examples of dissociative caspases were provided by Chelur et al. (2007). For example, Gargett et al. (2014) described the use of the inducible caspase 9 suicide gene system.
[0400] In some embodiments, the first component polypeptide comprises a first caspase component; the second component polypeptide comprises a second caspase component, wherein the first and second component polypeptides dimerize to form caspase. When the binding member binds to the T-SM complex, the dissociated caspase may be able to induce cell death.
[0401] In some embodiments, the first and second caspase components are identical, for example, both caspase components contain a caspase 9 activation domain. An exemplary caspase 9 activation domain is provided as amino acid residues 152-414 of the human caspase 9 amino acid sequence (provided as NCBI accession number AAO21133.1 (version 1; last updated December 1, 2009)). When the first and second caspase components are identical, they can be encoded by the same expression cassette. For example, a split-type apoptosis protein can be encoded by one or more expression cassettes encoding a target protein, a binding member, and a caspase 9 activation domain, wherein both the target protein and the binding member are fused to the caspase 9 activation domain. Upon expression, multiple proteins comprising the target protein, the binding member, and the caspase 9 activation domain are generated, and dimerization of the caspase 9 activation domain (i.e., at least the first and second caspase 9 activation domains) can be modulated by adding small molecules.
[0402] In some exemplary embodiments, the split apoptosis protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:223.
[0403] Other dimerization-inducible proteins
[0404] Other dimerizing proteins to be considered for use with this disclosure include split therapeutic proteins, split TEV proteases, and split Cas9. A split therapeutic protein is any protein that can exert a therapeutic effect when the first and second component peptides of a split therapeutic protein dimerize.
[0405] Viral vectors and viral particles
[0406] In one embodiment, the expression vector is a viral vector. Suitable viral vectors include adeno-associated virus vectors, adenovirus vectors, herpes simplex virus vectors, retroviral vectors, lentiviral vectors, alphavirus vectors, flavivirus vectors, rhabdovirus vectors, measles virus vectors, Newcastle disease virus vectors, poxvirus vectors, and microRNA viral vectors.
[0407] As used herein, a viral vector refers to a DNA expression vector comprising first and second expression cassettes, such that the expression cassettes are converted into a viral genome, which is packaged within the viral particle when expressed in a cell along with components required for the assembly of the viral particle. Furthermore, in one embodiment, the viral vector comprises a third expression cassette encoding a desired expression product.
[0408] In a particular embodiment, the expression vector is an adeno-associated virus (AAV) vector. AAV is one of the most actively investigated gene therapy vectors, characterized by an excellent safety profile and efficient transduction in a wide range of target tissues. For example, Naso et al. (2017) and Colella et al. (2018) described the use of AAV as a gene therapy vector.
[0409] Various AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV6.2FF, AAV8, AAV8.2, AAV9, and AAV rh10, as well as pseudotypes of AAV, such as AAV2 / 8, AAV2 / 5, and AAV2 / 6, are also available according to this disclosure. Further examples of serotypes and their isolation are described in Srivastava, 2006.
[0410] AAV particles are small (25-nm) viruses from the Parvoviridae family. They consist of a non-enveloped icosahedral capsid (protein shell) containing a linear single-stranded DNA genome of approximately 4.8 kb. The AAV genome encodes several protein products: four non-structural Rep proteins, three capsid proteins (VP1-3), and an assembly activation protein (AAP). The AAV genome is flanked by two AAV-specific palindromic inverted terminal repeats (ITRs).
[0411] Therefore, when the expression vector is an AAV vector, this may mean that the flanking sides of the first and second expression cassettes are ITRs (e.g., ITR-first expression cassette-second expression cassette-ITR), such that the expression cassettes are converted into single-stranded genomes, which are then packaged in the AAV particles when expressed in the cells along with the components required for assembly with the AAV particles.
[0412] AAV vectors can be engineered, for example, to improve their function. Kotterman and Schaffer, 2014, describe examples of AAVs engineered for clinical gene therapy.
[0413] The packaging capacity of AAV vectors is less than 5 kb, which limits the size of genetic material (e.g., expression cassettes) that can be introduced into the viral genome. As demonstrated herein, using components with relatively small sizes, such as Tn3 protein and scFv as binding members, allows one or more expression cassettes encoding tripartite complexes (e.g., as part of a dimerization-inducible protein, such as a dissociative transcription factor) to fit into a single AAV vector. As further demonstrated herein, one or more small expression cassettes encoding tripartite complexes allow the introduction of transgenes (e.g., as part of a third expression cassette) as components of dissociative transcription factors into the same AAV vector, allowing for “cis” delivery of the dissociative transcription factor and the transgene.
[0414] This disclosure also includes methods for preparing viral particles in vitro. In one embodiment, the method for preparing viral particles includes transfecting host cells, such as mammalian cells, with the viral vector described herein, expressing viral proteins necessary for particle formation in the cells, and culturing the transfected cells in a culture medium to induce the production of viral particles. The viral particles may be released into the culture medium, or the method may additionally involve lysis and separation of particles from cell lysates. An example of a suitable mammalian cell is human embryonic kidney (HEK) 293 cells.
[0415] Typically, multiple plasmid expression vectors are used to generate various protein components that produce viral particles. Cell lines that constitutively express viral packaging components can also be utilized, allowing the use of fewer plasmids.
[0416] For example, the construction of AAV particles requires Rep and Cap proteins, as well as additional genes from adenovirus, to mediate AAV replication. For instance, Robert et al. (2017) described the production of AAV particles.
[0417] Robert et al. (2017) described an exemplary method for producing AAV particles. In short, this involves transfecting a mammalian cell line, such as HEK293 cells, with three plasmids. One vector encodes the rep and cap genes of AAV (pRepCap) using its endogenous promoter; another vector (pHelper) encodes three additional adenovirus accessory genes (E4, E2A, and VA RNA) that are absent in HEK293 cells; and a third vector (viral vector) (pAAV-GOI) contains one or more expression cassettes flanked by two ITRs. See Robert et al. Figure 2 .
[0418] After the virus particles are released, the culture medium containing the virus particles can be collected, and optionally, the virus particles can be separated from cell lysates. Optionally, the virus particles can be concentrated.
[0419] After production and optional concentration, the virus particles can be stored, for example by freezing at -80°C, in preparation for use by administration to cells and / or for therapeutic purposes.
[0420] This disclosure also provides viral particles, such as AAV particles, as those generated by the methods described herein. As used herein, viral particles contain a viral genome packaged within a viral envelope, which is capable of infecting cells, such as mammalian cells.
[0421] This article discloses one or more viral particles that contain a viral genome encoding the following:
[0422] i) a target protein, wherein the target protein is capable of binding to a small molecule to form a target protein-small molecule complex (T-SM complex); and
[0423] ii) A binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone or the small molecule alone.
[0424] The target protein is derived from a viral protease, and the small molecule is a viral protease inhibitor. In one embodiment, the target protein is fused to a first component peptide, and the binding member is fused to a second component peptide.
[0425] This article also discloses one or more viral particles, which include:
[0426] i) A first expression cassette encoding a target protein, wherein the target protein is capable of binding to a small molecule to form a target protein-small molecule complex (T-SM complex); and
[0427] ii) A second expression cassette encoding a binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone or the small molecule alone.
[0428] The target protein is derived from a non-human protein, and the small molecule is an inhibitor of the non-human target protein. The first and second expression cassettes form part of the viral genome in one or more viral particles. In one embodiment, the non-human protein is derived from a viral protease, and the small molecule is a viral protease inhibitor. In one embodiment, the target protein is fused to a first component polypeptide, and a binding member is fused to a second component polypeptide.
[0429] In some embodiments, the first and second expression cassettes form part of the same viral genome of the viral particle. In other embodiments, the first expression cassette is located in the first viral genome of the first viral particle, and the second expression cassette is located in the second viral genome of the second viral particle.
[0430] Expression cassettes, target proteins, binding members, small molecules, and first and second component peptides can be further defined as above. Depending on the viral particle used, the viral genome can be a single-stranded or double-stranded nucleic acid, or it can be RNA or DNA. For example, when the viral particle is an AAV particle, the viral genome is a single-stranded DNA viral genome. The viral genome can encode discrete proteins as defined above.
[0431] Gene therapy
[0432] Medications (i.e., one or more expression vectors, expression products, or viral particles, plus small molecules) can be administered to patients as part of a treatment or disease prevention approach. After binding to the T-SM complex, the individual recipient may experience symptom relief of the treated disease or disorder. This may have a beneficial effect on the individual's disease status.
[0433] As used in this article in the context of treating symptoms, the term "treatment" generally refers to human care and therapies in which some desired therapeutic effect is achieved, such as inhibiting the progression of symptoms, and includes a reduction in the rate of progression, cessation of the rate of progression, regression of symptoms, improvement of symptoms, and cure of symptoms. It also includes treatment as a preventative measure (i.e., prevention, avoidance).
[0434] In the context of this instruction manual, “prevention” should not be construed as limiting complete success, i.e., complete protection or complete prevention. Rather, prevention as used herein refers to measures taken before the detection of a symptomatic condition, with the aim of maintaining health by helping to delay, alleviate or avoid that particular condition.
[0435] Treatment methods may include expressing one or more dimerization-inducible proteins as further defined herein in cells. Dimerization-inducible proteins may, for example, be included in a first component polypeptide and a second component polypeptide that, upon dimerization, form a therapeutic polypeptide. In this way, the addition of small molecules can result in increased activity of the therapeutic protein and may be used, for example, in methods for treating diseases in which the therapeutic protein is deficient.
[0436] This article discloses a method for regulating the expression of a desired expression product in cells, the method comprising i) expressing the dimerization-inducible protein described herein in cells, wherein the first and second component polypeptides dimerize to form a transcription factor, and wherein a DNA-binding domain binds to a target sequence in the cell, such that the transcription factor is able to regulate (i.e. increase or decrease) the expression of the desired expression product in the cell; and ii) administering a small molecule to the cells to regulate the expression of the desired expression product.
[0437] This document further discloses a dimerization-inducible protein used in a method for regulating the expression of a desired expression product in cells of a human or animal subject. The method includes expressing the dimerization-inducible protein described herein in cells, wherein first and second component peptides dimerize to form transcription factors, and administering a small molecule to the cells to regulate (e.g., increase or decrease) the expression of the desired expression product. This document also discloses a small molecule used in a method for regulating the expression of a desired expression product in cells of a human or animal subject. The method includes expressing the dimerization-inducible protein described herein in cells, wherein first and second component peptides dimerize to form transcription factors, and administering a small molecule to the cells to regulate (e.g., increase or decrease) the expression of the desired expression product.
[0438] This method may include administering one or more expression vectors or viral particles as described herein to express a dimerization-inducible protein in cells. In other embodiments, the method may include administering an expression product (e.g., mRNA encoding a dimerization-inducible protein) produced by one or more expression vectors to cells. Specific administration will be determined by the physician, who will also use his / her common sense and dosing regimens known to skilled practitioners to select the dosage.
[0439] The desired expression product can be RNA or a peptide (peptide, polypeptide, or protein). Preferably, the desired expression product is a peptide. The desired expression product can also be a therapeutic protein, i.e., a protein that exerts a therapeutic effect in the subject.
[0440] The desired expression product can be part of an endogenous gene present in the target cell genome. For example, when this method is performed in human cells, the desired expression product can be part of a human gene. Alternatively, the desired expression product can be part of a transgene (e.g., a therapeutic transgene) delivered to the target cell. Regulating gene expression can be used in methods for treating or preventing diseases. Following the expression of a dissociative transcription factor and the administration of a small molecule, the recipient individual may exhibit a reduction in symptoms of the treated disease or disorder. This may have a beneficial effect on the individual's disease status.
[0441] When the target sequence is part of a transgene delivered to a cell, the method may further include administering a third expression cassette to the cell, wherein the third expression cassette encodes a desired expression product and wherein the third expression cassette contains the target sequence. The transgene may contain a promoter operatively linked to the coding sequence of the desired expression product, which may be a therapeutic protein, such as a therapeutic antibody. An example of a therapeutic antibody is MEDI8852, whose heavy chain amino acid sequence is listed in SEQ ID NO:205 and its light chain amino acid sequence is listed in SEQ ID NO:206. The third expression cassette may be part of an expression vector or viral particle identical to one or both of the first and second expression cassettes. In other words, the transgene may be delivered to the cell “cis” along with a split transcription factor, for example, within the same viral (e.g., AAV) particle. Alternatively, the third expression cassette may be part of a different expression vector or viral particle than one or both of the first and second expression cassettes. In other words, the transgene may be delivered to the cell “trans” along with a split transcription factor, for example, within separate viral (e.g., AAV) particles. As demonstrated herein, the dissociative transcription factors disclosed herein are applicable to “cis” and “trans” delivery of transgenes.
[0442] The target sequence can be located within or very close to the promoter, which is operatively linked to the coding sequence of the desired expression product. “Very close” means that the target sequence is within 500 bp, 250 bp, 100 bp, 50 bp, or 25 bp of the sequence corresponding to the promoter.
[0443] The expression cassette can be administered to cells by any suitable method. For example, it can be delivered virally, such as as part of a viral particle as described herein, or via non-viral methods. Non-viral delivery methods include electroporation, lipid transfection, microinjection, biological projectiles, virions, liposomes, immunoliposomes, polycationic or lipid:nucleic acid conjugates, naked DNA, naked RNA, artificial virions, and reagents that enhance DNA uptake. In one embodiment, the expression cassette is delivered as mRNA. In one embodiment, the expression cassette is delivered as a DNA plasmid.
[0444] In any of the in vivo methods disclosed herein, small molecules may be administered orally to human subjects, for example, in acceptable dosage forms such as capsules, tablets, aqueous suspensions, or solutions. The amount used will depend on the host being treated and the specific method of administration. Small molecules may be administered as a single dose, multiple doses, or over a defined time period.
[0445] In cases where the method involves administering viral particles to cells, the unit dose can be calculated based on the amount of viral particles administered. The viral dose includes a specific number of viral particles or plaque-forming units (PFUs) or viral genome copies (VGCs). For embodiments involving AAVs, a specific unit dose includes 10... 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 One viral genome copy (vgc) / kg body weight. Due to the presence of infection-defective particles, the particle dose may be slightly higher (10 to 100 times).
[0446] To avoid being bound by theory, it is believed that viral infection and transduction of cells by viral particles (e.g., AAV particles) occurs through a series of sequential events: interaction between the viral capsid and target cell surface receptors, internalization via endocytosis, intracellular transport through the endocytic / proteasome compartment, endosome escape, nuclear importation, viral uncoating, and viral DNA double-strand conversion, leading to the transcription and expression of proteins encoded by the viral genome within the viral particle.
[0447] While one or more expression vectors, expression products, viral particles, and small molecules can be used alone (e.g., administered), it is generally preferred that the individual components be presented as a composition or formulation, for example, with a pharmaceutically acceptable carrier or diluent. For example, one or more viral particles can be administered as a pharmaceutical composition comprising one or more viral particles and a pharmaceutically acceptable carrier or diluent. As another example, a small molecule can be administered as a pharmaceutical composition comprising a small molecule and a pharmaceutically acceptable carrier or diluent.
[0448] As used herein, the term "pharmaceutically acceptable" refers to compounds, ingredients, materials, compositions, dosage forms, etc., that are suitable for contact with the tissues of the subjects (e.g., humans) under discussion, within the bounds of reasonable medical judgment, without excessive toxicity, irritation, allergic reactions, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio. Each carrier, diluent, excipient, etc., must also be "acceptable" in the sense of compatibility with other components of the formulation.
[0449] The agents (i.e., one or more expression vectors, DNA plasmids, or viral particles, plus a small molecule) can be administered simultaneously or sequentially, and can be administered individually with different dosage regimens and via different routes. For example, when administered sequentially, the agents can be administered at close intervals (e.g., within a 5-10 minute timeframe) or at longer intervals (e.g., 1, 2, 3, 4, or more hours apart, or even longer time intervals if necessary), with the precise dosage regimen proportionate to the characteristics of the one or more agents administered. In one embodiment, the small molecule is administered after the administration of one or more expression vectors, DNA plasmids, or viral particles.
[0450] Cell therapy
[0451] It also provides methods for cell therapy. Cell therapy involves administering genetically modified cells to patients to express expression products such as dimerization-inducible proteins.
[0452] Cells, such as stem cells, can be used in cell therapy approaches. A potential advantage associated with using stem cells is that they can differentiate into other cell types in vitro and can be introduced into mammals (e.g., cell donors) where they will be transplanted into bone marrow. Suitable stem cells include embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, mesenchymal stem cells, neuronal stem cells, cardiac stem cells, and mesenchymal stem cells.
[0453] For example, cell therapy may include administering one or more expression vectors described herein to cells (e.g., stem cells) in an ex vivo manner, such that a dimerization-inducible protein is expressed by the cells, and then administering the cells to a patient. Following administration of cells expressing the dimerization-inducible protein, small molecules may be administered to the individual to induce dimerization of the first and second component peptides, thereby reconstructing their function after dimerization. For example, the first and second component peptides may form transcription factors after dimerization, or the first and second component peptides may form CARs after dimerization.
[0454] This article discloses a treatment method comprising administering cells expressing a dimerization-inducible protein as defined herein to a patient, the method comprising:
[0455] i) The cell is administered to the individual; and
[0456] ii) The small molecule is administered to the individual.
[0457] Dimerization-inducible proteins can be, for example, split transcription factors, split CARs, split apoptosis proteins, or split therapeutic proteins. Treatment methods can include cancer treatments.
[0458] Cell therapy may involve isolating cells from a patient, transfecting the cells in vitro with one or more expression vectors, and then administering the cells to the patient. The various cell types suitable for in vitro transfection are well known to those skilled in the art (see, for example, Freshney et al., Culture of Animal Cells, A Manual of Basic Technique (3rd ed. 1994)) and the references cited therein discussing how to isolate and culture cells from a patient.
[0459] For example, cell therapy may include isolating cells from a patient, administering one or more expression vectors described herein to the cells in an ex vivo manner, causing dimerization-inducible proteins to be expressed by the cells, and then administering the cells back to the patient. Following administration of cells expressing dimerization-inducible proteins, small molecules may be administered to the individual to induce dimerization of the first and second component peptides described herein.
[0460] In one embodiment, the cell is an immune cell (e.g., a T cell) and the dimerization-inducible protein expressed by the cell is a dissociated CAR. Treatment methods involving CAR T cell therapy are known in the art and are described, for example, in Miliotou and Papadopoulou, 2018.
[0461] This article discloses a treatment method comprising administering to a patient cells expressing a dimerization-inducible protein as defined herein, wherein first and second component peptides form a CAR upon dimerization, the method comprising:
[0462] i) The cell is administered to the individual; and
[0463] ii) The small molecule is administered to the individual.
[0464] Treatment methods can include those used to treat cancer.
[0465] Nucleic acid
[0466] This disclosure also provides one or more nucleic acid molecules encoding binding members or dimerization-inducible proteins as defined herein. The nucleic acid molecule may be one or more separate nucleic acid molecules. The nucleic acid encoding the binding member and dimerization-inducible protein may have the necessary characteristics and sequence identity associated with the expression vector as described herein. Those skilled in the art will have no difficulty preparing such nucleic acid molecules using methods well known in the art.
[0467] In some embodiments, one or more nucleic acid molecules encode one or more VH and / or VL domains of PRSIM_57, PRSIM_01, PRSIM_04, PRSIM_67, PRSIM_72, or PRSIM_75. The amino acid sequences of those VH or VL domains are defined herein.
[0468] In some embodiments, one or more nucleic acid molecules or molecules encode a binding member of PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, PRSIM_47, PRSIM_57, PRSIM_01, PRSIM_04, PRSIM_67, PRSIM_72, or PRSIM_75. The amino acid sequences of those binding members are defined herein.
[0469] In some embodiments, one or more nucleic acid molecules comprise a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the exemplary nucleic acid sequences listed in PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, PRSIM_47, PRSIM_57, PRSIM_01, PRSIM_04, PRSIM_67, PRSIM_72, or PRSIM_75. In some embodiments, one or more nucleic acid molecules comprise a nucleic acid sequence of PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, PRSIM_47, PRSIM_57, PRSIM_01, PRSIM_04, PRSIM_67, PRSIM_72, or PRSIM_75. The exemplary binding member nucleic acid sequences are listed in the table below:
[0470] Combined members The provided nucleic acid sequences are as follows: PRSIM_23 SEQ ID NO:73 PRSIM_32 SEQ ID NO:74 PRSIM_33 SEQ ID NO:75 PRSIM_36 SEQ ID NO:76 PRSIM_47 SEQ ID NO:77 PRSIM_57 SEQ ID NO:80 PRSIM_01 SEQ ID NO:78 PRSIM_04 SEQ ID NO:79 PRSIM_67 SEQ ID NO:81 PRSIM_72 SEQ ID NO:82 PRSIM_75 SEQ ID NO:83
[0471] In some embodiments, one or more nucleic acid molecules encode a first component polypeptide and / or a second component polypeptide fused to a target protein or binding member as described above. The amino acid sequences of those component polypeptides are defined herein.
[0472] In some embodiments, one or more nucleic acid molecules encode one or more of the DBD-T fusion protein, TRD-BM fusion protein, DBD-BM fusion protein, and TRD-T fusion protein as described above. The amino acid sequences of those fusion proteins are defined herein.
[0473] In some embodiments, the nucleic acid sequence of one or more nucleic acid molecules encoding the TRD-T fusion protein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleic acid sequence listed in SEQ ID NO:108. In some embodiments, the one or more nucleic acid molecules encoding the TRD-T fusion protein have the nucleic acid sequence of SEQ ID NO:108.
[0474] In some embodiments, the nucleic acid sequence of one or more nucleic acid molecules encoding the DBD-T fusion protein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleic acid sequence listed in SEQ ID NO: 109. In some embodiments, one or more nucleic acid molecules encoding the DBD-T fusion protein have the nucleic acid sequence of SEQ ID NO: 109.
[0475] In some embodiments, the nucleic acid sequence of one or more nucleic acid molecules encoding the DBD-BM fusion protein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the nucleic acid sequences listed in SEQ ID NO: 110-120. In some embodiments, the one or more nucleic acid molecules encoding the DBD-BM fusion protein have the nucleic acid sequence of any one of SEQ ID NO: 110-120.
[0476] In some embodiments, the nucleic acid sequence of one or more nucleic acid molecules encoding the TRD-BM fusion protein has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the nucleic acid sequences listed in SEQ ID NO: 121-131. In some embodiments, the one or more nucleic acid molecules encoding the TRD-BM fusion protein have the nucleic acid sequence of any one of SEQ ID NO: 121-131.
[0477] In some embodiments, one or more nucleic acid molecules encode a split CAR as defined herein. In some embodiments, one or more nucleic acid molecules encoding a split CAR have a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleic acid sequence listed in SEQ ID NO:133 and a nucleic acid sequence encoding an antigen-specific recognition domain. In some embodiments, one or more nucleic acid molecules encoding a split CAR have the nucleic acid sequence of SEQ ID NO:133 and a nucleic acid sequence encoding an antigen-specific recognition domain. In some embodiments, one or more nucleic acid molecules encoding a split CAR comprise a nucleic acid sequence encoding an antigen-specific recognition domain (e.g., scFv) located between positions 66 and 67, wherein nucleotide numbering corresponds to SEQ ID NO:133.
[0478] The isolated nucleic acid molecules can be used to express the binding members or dimerization-inducible proteins disclosed herein. Nucleic acids are typically provided in the form of one or more expression vectors, such as those having the characteristics of the expression vectors described herein.
[0479] Reagent test kit
[0480] This disclosure also provides a kit comprising one or more expression vectors, one or more viral particles, cells or one or more nucleic acids (all as defined herein) and a small molecule (also as defined herein). In some embodiments, the small molecule is cimetvir. When one or more expression vectors or nucleic acids encode a polypeptide containing a DNA-binding domain from the CRISPR / Cas system, the kit may additionally include a target sequence-specific guide RNA, or a nucleic acid encoding a target sequence-specific guide RNA.
[0481] Sequence identity and change
[0482] Sequence identity is typically defined using the GAP algorithm (GCG software package, Accelerys Inc, San Diego, USA). GAP uses the Needleman and Wunsch algorithm to compare two complete sequences, maximizing the number of matches and minimizing the number of gaps. Default parameters are typically used, where the penalty for a gap is 12 and the penalty for gap extension is 4. GAP is preferred, but other algorithms such as BLAST (using the method of Altschul et al. (1990)), FASTA (using the method of Pearson and Lipman (1988)), the Smith-Waterman algorithm (Smith and Waterman (1981)), or the TBLASTN procedure (Altschul et al. (1990), ibid.) can also be used, usually with default parameters. Specifically, the psi-Blast algorithm can be used.
[0483] When this disclosure refers to a specific amino acid sequence that has at least 90% sequence identity with a reference amino acid sequence, this includes amino acid sequences that have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% sequence identity with a reference amino acid sequence.
[0484] As used herein, the term "sequence alteration" is intended to encompass substitutions, deletions, and / or insertions of amino acid residues. Therefore, a protein containing one or more amino acid sequence alterations compared to a reference sequence contains one or more substitutions, deletions, and / or insertions of amino acid residues compared to the reference sequence. The term "amino acid mutation" may also be used interchangeably with "sequence alteration" herein unless the context clearly indicates otherwise.
[0485] In some embodiments where one or more amino acids are replaced by another amino acid, the substitution can be a conservative substitution, such as according to the table below. In some embodiments, the amino acids in the same box in the middle column are substituted, i.e., a nonpolar amino acid replaces, for example, another nonpolar amino acid. In some embodiments, the amino acids in the same row in the rightmost column are substituted, i.e., G replaces A or P.
[0486]
[0487] In some embodiments, one or more substitutions may be functionally conserved. That is, in some embodiments, substitutions may not affect (or may substantially not affect) one or more functional properties (e.g., binding affinity) of the protein containing the substitutions compared to an equivalent unsubstituted protein.
[0488] The binding member may also include variants of the BC, DE, or FG rings, Tn3, CDR, VH domain, VL domain, and / or scFv sequence as disclosed herein. Suitable variants can be obtained by sequence alteration or mutation and screening. In preferred embodiments, the binding member containing one or more variant sequences retains one or more functional characteristics of the parent binding member, such as binding specificity and / or binding affinity to the T-SM complex. For example, the binding member containing one or more variant sequences preferably binds to the T-SM complex with the same affinity as or a higher affinity than the (parental) binding member. The parental binding member is a binding member that does not contain one or more amino acid substitutions, one or more deletions, and / or one or more insertions incorporated into the variant binding member.
[0489] For example, a binding member may include a BC, DE, or FG ring, Tn3, CDR, VH domain, VL domain, or scFv sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with the BC, DE, or FG ring, Tn3, CDR, VH domain, VL domain, or scFv sequence disclosed herein.
[0490] The binding member may include one or more amino acid sequence alterations (addition, deletion, substitution and / or insertion of amino acid residues) relative to the BC, DE or FG loop, Tn3, CDR, VH domain, VL domain or scFv sequence disclosed herein, preferably 20 or fewer alterations, 15 or fewer alterations, 10 or fewer alterations, 5 or fewer alterations, 4 or fewer alterations, 3 or fewer alterations, 2 or fewer alterations or 1 alteration of the BC, DE or FG loop, Tn3, CDR, VH domain, VL domain or scFv sequence.
[0491] ***
[0492] Features disclosed in the preceding description, the following claims, or the accompanying drawings, expressed in their particular form or according to the manner in which the disclosed function is performed, or the method or process for obtaining the disclosed result, may, as appropriate, be used alone or in any combination of such features to realize this disclosure in its various forms.
[0493] Although this disclosure has been described together with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when this disclosure is given. Therefore, the exemplary embodiments of this disclosure set forth above are to be considered illustrative rather than restrictive. Various changes may be made to the described embodiments without departing from the spirit and scope of this disclosure.
[0494] To avoid any doubt, any theoretical explanations provided in this article are intended to enhance the reader's understanding. The inventors do not wish to be bound by any of these theoretical explanations.
[0495] Any chapter headings used in this article are for organizational purposes only and should not be construed as limiting the subject matter described.
[0496] Unless the context otherwise requires, throughout this specification (including the following claims), the words “comprising” and “including” and their variations shall be understood to mean including the stated integer or step or group of integers or steps, but not excluding any other integer or step or group of integers or steps.
[0497] It must be noted that, as used herein and in the appended claims, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include plural indicators. A range may be expressed herein as “about” a particular value, and / or to “about” another particular value. In expressing such a range, another embodiment includes starting from and / or ending at that particular value. Similarly, when a value is expressed as an approximation using the antecedent “about,” it should be understood that the particular value forms another embodiment. The term “about” relative to a numerical value is optional and means, for example, + / - 10%.
[0498] Example
[0499] Example 1—Materials and Methods
[0500] Solvent accessible surface area calculation
[0501] The solvent-accessible surface area (SASA) was calculated using the built-in `sasa` command in Visual Molecular Dynamics (VMD) software (University of Illinois at Urbana-Champaign) from the three-dimensional structure (PDB code 3KEE) of the HCVNS3 / 4A PR:cimipvir complex, available from the protein database (PDB; http: / / www.rcsb.org / ). The `-restrict` option and... The radius is used to calculate the surface area of cimetidine that is not bound to HCVNS3 / 4A PR; in other words, the solvent-accessible surface area.
[0502] Production of biotinylated HCVNS3 / 4A protease
[0503] The sequence used to design the HCV NS3 / 4A PR construct was derived from Uniprot accession number A8DG50 (hepatitis C virus subtype 1a genomic polyprotein) with additional modifications to US patent US 6800456. The protease domain corresponds to residues 1030-1206 of the polyprotein. A single strand consisting of an 11-residue peptide derived from the viral NS4A protein fused to the N-terminus of the NS3 protease (SEQ ID 1) was used to generate a fully folded and activated polypeptide. This sequence with an N-terminal hexahistine residue (6His) and an AviTag (SEQ ID 3) (used for affinity purification and biotinylation, respectively) was purchased as a linear DNA string (GeneArt). A DNA string encoding an equivalent sequence with the active site mutation S139A (SEQ ID 4) was also ordered. The DNA string was cloned into the pET-28a vector (for bacterial expression) using Gibson assembly. A second set of DNA strands, encoding His and Avitag-tagged WT and S139A proteases with optimized human codons, was ordered and cloned into a mammalian expression vector with a CMV promoter. The sequence of the final construct was validated by Sanger sequencing of the entire coding sequence.
[0504] For bacterial expression, the pET-28a plasmid was transformed into BL21(DE3) *E. coli* cells and screened on plates containing kanamycin (50 μg / ml). For each expression, a single colony was inoculated with 5 ml of 2xTY + 50 μg / ml kanamycin culture, which was grown overnight at 37°C. This culture was then inoculated with 500 ml of 1:500 diluted TB self-induction medium (Formedium, supplemented with 10 ml / L glycerol and 100 μg / ml kanamycin). The culture was grown at 37°C until an OD600 of 1.3–1.5 was reached, then transferred to 20°C and held for 20 hours to induce expression. Cells were harvested by centrifugation and the pellet was stored at -80°C.
[0505] For mammalian expression, plasmid DNA was prepared using the Qiagen Plasmid Plus Gigaprep kit. Gigaprep DNA was transfected into Expi293F cells (Thermo Fisher Scientific) cultured in FreeStyle293 medium (Thermo Fisher Scientific) at a density of 2.5 x 10⁻⁶ cells at the transfection site using PEI-mediated delivery.6 Cells / ml. Cells were cultured for 6 days at 37°C, 5% CO2, 140 rpm, and 70% humidity. Cells were harvested at 4,000g and the pellet was stored at -80°C.
[0506] For protein purification, each bacterial pellet from 500 ml of culture was thawed and resuspended in 50 ml of lysis buffer (2x DPBS, 200 mM NaCl, pH 7.4). Cells were lysed using a probe sonicator, and the lysates were clarified by centrifugation at 50,000 g for 40 min at 4 °C. Mammalian cell pellets were lysed by resuspending in lysis buffer containing detergent (2x DPBS, 200 mM NaCl, 1 mM TCEP, cOmplete, EDTA-free protease inhibitor, 25 U / ml Turbonuclease, 1% Triton X-100, pH 7.4) and incubated at 4 °C for 2 h at 10 rpm. Mammalian lysate samples were centrifuged at 50,000 g for 30 min at 4 °C. All samples were filtered through a 0.22 μm top-mounted filter before column chromatography. The filtered supernatant was loaded onto a 5 ml HisTrap HP column (GE Healthcare) at a flow rate of 5 ml / min. The column was washed with 100 mL of wash buffer (2x DPBS, 200 mM additional NaCl, 20 mM imidazole, pH 7.4) and eluted with an imidazole gradient of 5 column volumes of 20–400 mM imidazole. Fractions were analyzed by SDS-PAGE, and fractions rich in the correct protein were pooled and buffer-exchanged to lysis buffer (2x DPBS, 200 mM NaCl, pH 7.4) using a HiPrep26 / 10 desalting column (General Health Medical Group). The desalted protein fractions were pooled, concentrated by centrifugation, and purified on a HiLoad Superdex 7526 / 600 pg column (General Health Medical Group) equilibrated in 2x DPBS, 2 mM DTT, and 10 μM ZnCl2. Fractions with a purity >95% were pooled by SDS-PAGE, their concentration determined by UV absorbance, and flash-frozen in liquid nitrogen before storage at -70°C. The purity of the final sample was verified using RP-HPLC on an XBridge BEH300, C4 (Waters).
[0507] The purified protein was biotinylated onto its AviTag by incubating the MBP-labeled BirA enzyme with the sample at 22°C for 2.5 h in the presence of ATP and biotin. The biotinylated protein was purified by size exclusion chromatography on a HiLoad Superdex 7516 / 600 pg column (GE Healthcare) in 2x DPBS, 2 mM DTT, and 1 μM ZnCl2. Fractions were analyzed by SDS-PAGE, and fractions containing the protease were combined. The degree of biotinylation was confirmed by whole-cell mass spectrometry on a Xevo G2-CS MS (Waters Biotech). The biotinylated protein was aliquoted, flash-frozen in liquid nitrogen, and stored at -70°C.
[0508] To generate the NS3 / 4A S139A protease with His and Avitag tags and to introduce additional mutations to reduce affinity for cimetidine, a pET-28a-derived plasmid encoding the protease was used as a template for site-directed mutagenesis using the Quikchange Lightning site-directed mutagenesis kit. The mutant form of the protease construct was validated by Sanger sequencing of the entire coding sequence prior to expression. The mutant protein was transformed into a BL21(DE3) *E. coli* derivative carrying a plasmid for IPTG-induced overexpression of BirA biotinylate ligase to achieve biotinylation during bacterial expression. Overnight cultures were inoculated at a 1:20 dilution with 50 ml of 2xTY + 50 μg / ml kanamycin. Cultures were grown at 37°C until an OD600 of 0.6 was reached, then supplemented with 50 μM biotin and induced with 1 mM IPTG. The induced cultures were transferred to 25°C and incubated for 20 hours for expression. Cells were harvested by centrifugation and the pellet was stored at -20°C. For purification, each precipitate was resuspended in 20 mL of lysis buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, cOmplete, and an EDTA-free protease inhibitor) and lysed at 40,000 kpsi using a cell disruptor (Constant Systems). Proteins were purified in an automated two-step procedure on an IMAC column followed by buffer exchange with a desalting column. Once loaded onto the IMAC resin, samples were washed with lysis buffer supplemented with 20 mM imidazole and eluted with a buffer containing 400 mM imidazole. The eluent was automatically captured and loaded onto a desalting column equilibrated at 50 mM HEPES, 300 mM NaCl, 0.5 mM TCEP, and pH 7.5. The final protein samples were aliquoted, flash-frozen in liquid nitrogen, and stored at -70°C.
[0509] HCVNS3 / 4A PR protease activity assay
[0510] To assess enzyme activity, the cleavage of the FRET substrate of the fluorescent HCV protease with the EDANS-DABCYL donor-quencher pair was measured using purified HCVNS3 / 4A PR and S139A mutants (RET S1, AnaSpec). When closely approximating (10⁻¹⁰) [the enzyme activity was measured], the cleavage was [measured]. As with intact peptides, EDANS is excited at 340 nm, and the energy emitted by EDANS (at 490 nm) is quenched by DABCYL. The cleavage of the peptide by HCV NS3 / 4A PR separates DABCYL from EDANS, thus allowing the detection of fluorescence at 490 nm.
[0511] HCVNS3 / 4A PR and the active site mutant S139A were incubated with the fluorescent substrate in serially diluted assay buffer (HEPES pH 7.8, 5 mM DTT, 100 mM NaCl, 10% glycerol, 0.01% CHAPS) at room temperature. Fluorescence was measured using a PerkinElmer Envision plate reader (excitation 340 nm, emission 490 nm) after 3 hours.
[0512] Isothermal calorimetry
[0513] Isothermal calorimetry (ITC) was performed using an Auto-ITC 200 (Malvern). A 0.4 μl pre-injection was followed by 19 injections of 2 μl each at 120-second intervals. The solution was rotated at 750 rpm and the temperature was set to 37 °C. Cimetvir (125 μM) was titrated into HCV NS3 / 4A PR (WT 8 μM and S139A mutant 8.2 μM) or protein buffer (control); the protein buffer was enriched with 2.5% DMSO in an amount equal to that present in the cimetvir solution. WT was run once; S139A mutant was run twice. Data were analyzed using a unit point binding model and point-by-point reference subtraction using ITC-PEAQ software (Malvern).
[0514] Phage display screening
[0515] The scFv and Tn3 sequences were isolated from phage display screening using the following three phage display libraries: (i) library 1, a Tn3 library developed based on the third such module in human tendinin C as an alternative scaffold for FnIII (Leahy et al. 1992, Oganesyan et al. 2013, Gilbreth et al. 2014), (ii) library 2, a restricted-frame scFv library, and (iii) library 3, a primordial scFv library.
[0516] All phage screenings were performed according to previously established protocols (Vaughan et al., 1996; Swers et al., 2013). Phage display screening was performed using biotinylated HCVNS3 / 4A PR (S139A) captured on streptavidin-coated magnetic beads (Promega). A total of four rounds of phage display screening were performed on each phage library using decreasing concentrations of biotinylated HCVNS3 / 4A PR and cimetidine. Figure 4A and Figure 4B ).
[0517] Before screening began, biotinylated HCVNS3 / 4A PR (S139A) antigen was pre-incubated with a 50-fold molar excess of cimetidine to ensure protease saturation. Prior to each screening, phage pools were individually incubated with streptavidin beads to deplete any binding agent library of the streptavidin beads. For rounds 1 and 2 of phage display screening, no de-screening step was performed on biotinylated HCVNS3 / 4A PR (S139A) in the absence of cimetidine. However, for rounds 3 and 4, screening was conducted in parallel, with one group without a de-screening step on biotinylated HCVNS3 / 4A PR (S139A) and the other group with a de-screening step in which phage particles were pre-incubated with 250 nM biotinylated HCV NS3 / 4A PR (S139A) at room temperature for 15 minutes, followed by protease removal using streptavidin-coated beads. Subsequently, in the presence of cimetidine, the resulting phage was added to biotinylated HCVNS3 / 4A PR (S139A) coated on streptavidin beads for a screening protocol.
[0518] Phage display screening was performed in each round using the following concentrations of biotinylated HCV NS3 / 4A PR (S139A):
[0519] Round 1: 250 nM biotinylated HCVNS3 / 4A PR (S139A) + 12.5 μM cimetvir
[0520] Round 2: 100 nM biotinylated HCV NS3 / 4A PR (S139A) + 5 μM cimetvir
[0521] Round 3: 25 nM biotinylated HCVNS3 / 4A PR (S139A) + 1.25 μM cimetvir
[0522] Round 4: 25 nM biotinylated HCVNS3 / 4A PR (S139A) + 1.25 μM cimetvir
[0523] After incubation with biotinylated HCVNS3 / 4A PR (S139A) in the presence of cimetidine, the phages bound to the complex were washed three times with D-PBS (Sigma) and then eluted with trypsin. The eluted phages were used to infect log-medium phase phage cultures of *E. coli* TG1 cells and inoculated onto agar plates containing 100 μg / ml ampicillin and 2% (w / v) glucose.
[0524] Single phage clones from rounds 3 and 4 were selected for DNA sequencing and antigen binding screening by phage ELISA. DNA sequence information is shown in Table 1.
[0525] bacteriophage rescue
[0526] The specific binding to HCV NS3 / 4A PR (S139A) was assessed by phage ELISA using a single phage clone of scFv or Tn3 induced as described (Osbourn et al. 1996). Briefly, phage clones encoding individual TG1 colonies from rounds 3 and 4 of selection, along with negative control clones, were grown to logarithmic phase in 96-well plates at 37°C with shaking at 280 rpm in medium containing 100 μg / ml ampicillin and 2% (w / v) glucose. Helper phages were then added to each well, and the plates were incubated at 37°C with shaking at 150 rpm for 1 hour. The plates were then centrifuged at 4500 rpm for 10 minutes at room temperature, the medium was removed, and replaced with medium containing 100 μg / ml ampicillin and 50 μg / ml kanamycin. The plates were then incubated overnight at 25°C with shaking at 280 rpm. The next day, the phage preparation was blocked by adding an equal volume of 2x PBS containing 6% (w / v) skim milk powder (Malvin Company) to each well of the plate.
[0527] bacteriophage ELISA
[0528] In the presence and absence of a 3-fold excess of cimetidine (5.6 μM), 96-well streptavidin-coated plates were coated with biotinylated HCV NS3 / 4A PR (S139A) at 5 μg / ml (1.875 μM). The coated plates were washed with PBS and blocked for one hour with PBS containing 3% (w / v) skim milk powder (Malvin Laboratories). Following this blocking step, the wells were washed three times with PBS before adding the blocked phage preparation (produced as described in the phage rescue section). The phage preparation was incubated with the antigen at room temperature for one hour before washing three times with PBS / Tween 20 (0.1% v / v). Phages specifically binding to the antigen-coated plates were detected by using an anti-M13 phage-HRP-labeled antibody (General Health Medical Group) followed by detection with 3,3',5,5'-tetramethylbenzidine (TMB; Sigma). The detection reaction was terminated using 0.5 M H₂SO₄, and the plate was read at 450 nm using a fluorescence plate reader. Fluorescence readings of each clone binding to biotinylated HCVNS3 / 4A PR (S139A) in the presence of cimetidine were compared with those in the absence of cimetidine by dividing the signal observed in the presence of cimetidine by the signal observed in the absence of cimetidine. These data are plotted on a graph. Figure 4B From these data, a group of scFv and Tn3 clones named PRSIM_xx (where xx refers to the clone number) were selected for further study. The selected clones had unique DNA sequences and were confirmed by phage ELISA not to bind to HCV NS3 / 4A PR(S139A) in the absence of cimetidine (except for controls PRSIM 51, PRSIM 54, PRSIM 55, and PRSIM 85, which showed binding to HCV NS3 / 4A PR(S139A) in both the presence and absence of cimetidine).
[0529] Expression of scFv and Tn3 PRSIM binding molecules
[0530] The scFv and Tn3 PRSIM-binding molecules were purified from *E. coli* using a previously described method (Vaughan et al., 1996) with nickel chelation chromatography followed by size exclusion chromatography. To enhance the expression levels of the most promising Tn3 PRSIM-binding molecules, the DNA sequences encoding them were subcloned into the pET16b vector using the oligonucleotides Tn3_pETFwd2 (5'-CGATCATATGGACTACAAGGACGACGATGACAAGGGCAGCCGT CTGGATGCACCGAGCCAG-3' (SEQ ID NO:183)) and Tn3_pETRev2 (5'-ATCGGGATCCCTACAGACCGGTTTTAAAGGTAATTTTTGCCGG-3' (SEQ ID NO:184)) and expressed in the cytoplasm of BL21(DE3) *E. coli* (New England Biolabs). Following lysis in BugBuster plus Benzonase (EMD Millipore), Tn3-based PRSIM-binding molecules were purified to homogeneity using nickel chelation chromatography, followed by size exclusion chromatography to provide the monomeric protein in PBS (pH 6.5).
[0531] Homogeneous time-resolved fluorescence (HTRF) combined with screening
[0532] The scFv and Tn3 PRSIM binding molecules selectively to HCV NS3 / 4A PR(S139A) exhibit homogeneous time-resolved fluorescence in parallel operation. Identification was performed during the assay to measure binding in the presence and absence of cimetidine. Serial dilutions of HCV NS3 / 4A PR (S139A) and purified PRSIM-binding molecules were prepared in assay buffer (PBS containing 0.4 M potassium fluoride and 0.1% BSA). Streptavidin cryptanalytes (Cisbio) were premixed in assay buffer with either anti-FLAG XL665 (for detecting Tn3 molecules) or anti-c-myc XL665 (for detecting scFv molecules). For each assay, 2.5 μl of sample titrant was added to 2.5 μl of HCV NS3 / 4A PR (S139A) and 2.5 μl of premixed assay reagent. 2.5 μl of cimetidine or 2.5 μl of DMSO blank was also added to each well. The background was defined using wells with zero sample addition. Before using the PerkinElmer Envision plate reader to read the time-resolved fluorescence at emission wavelengths of 620 nm and 665 nm, the assay plates were incubated overnight at 4 °C. Data were analyzed by calculating the %ΔF value for each sample. ΔF was determined according to Equation 1.
[0533] Equation 1:
[0534] %ΔF = ((sample 665nm / 620nm ratio) - (background 665nm / 620nm ratio) / (background 665nm / 620nm ratio)) × 100
[0535] Selective binding molecules are defined as those scFv and Tn3PRSIM binding molecules that bind to HCV NS3 / 4A PR(S139A) complexed with cimetidine but not to HCV NS3 / 4A PR(S139A).
[0536] Combined with dynamic analysis
[0537] The affinity of scFv and Tn3 PRSIM binding molecules was measured using a Biacore 8K (General Health Medical Group) at 25°C. The scFv and Tn3 PRSIM binding molecules were covalently immobilized onto the CM5 chip surface at a concentration of 1 μg / ml in 10 mM sodium acetate at pH 4.5 using standard amine coupling technology.
[0538] HCVNS3 / 4A PR (S139A) or BSA control was diluted 1:4 (1.25-20 nM) with ±10 nM cimepvir in 10 mM Hepes pH 7.4, 150 mM NaCl, 0.05% surfactant P20, and 0.01% DMSO, ensuring constant cimepvir and DMSO concentrations. Using single-cycle kinetics, the sample flowed through the chip at 50 μl / min, with an association time of 120 s and a dissociation time of 600 s. The chip surface was regenerated with two 20-second pulses of 10 mM glycine-HCl pH 3.0. The final sensor map was analyzed using Biacore 8K evaluation software, and the affinity constant K was determined using a 1:1 binding model. D The same method was used to measure the affinity of the HCVNS3 / 4A PR mutant for PRSIM_23, but with a slight bias. The mutant was diluted 1:4 (2.5–40 nM) ± cimepvir in 10 mM Hepes pH 7.4, 150 mM NaCl, 0.05% surfactant P20, and 0.08% DMSO, ensuring constant cimepvir and DMSO concentrations. Single-cycle kinetics were used, with the sample flowing through the chip at 50 μl / min, an association time of 180 seconds, and a dissociation time of 600 seconds.
[0539] The effect of cimetidine concentration on the formation of the HCV NS3 / 4A PR(S139A) / PRSIM binding molecular complex was also measured using a Biacore 8K. PRSIM_57 and PRSIM_23 were covalently immobilized on the CM5 chip surface as before. Cimetidine was diluted 1:2 (0.0152–300 nM) in 10 mM hpeps pH 7.4, 150 mM NaCl, 0.05% surfactant P20, and 0.3% DMSO, with the HCV NS3 / 4A PR(S139A) concentration kept constant at 40 nM. Using multi-cycle kinetics, the sample was flowed through the chip at 50 μl / min, with an association time of 240 s and a dissociation time of 600 s. Regeneration conditions were as described above. Titration curves for cimetidine-induced HCV NS3 / 4A PR(S139A) / PRSIM dimerization were generated. The response at 225 seconds (15 seconds before the end of association) was normalized to the percentage of response to 300 nM cimetidine at 225 seconds, and plotted against cimetidine concentration. Each data point represents the mean ± sem of three independent experiments. The reported EC was calculated using a nonlinear regression curve fit. 50 The same method was used to mutate the HCV NS3 / 4A protease, except that cimetvir was diluted 1:2 (0.0457-900 or 0.412-8, 100 nM) in 10 mM Hepes pH 7.4, 150 mM NaCl, 0.05% surfactant P20, and 0.82% DMSO, with the HCV NS3 / 4A PR (S139A) concentration kept constant at 40 nM and the response to each cimetvir concentration normalized to the highest cimetvir concentration.
[0540] Cimetidine affinity was measured using an Octet RED384 (ForteBio) at 25°C. Biotinylated HCVNS3 / 4A PR (S139A), HCVNS3 / 4A K136D PR, HCV NS3 / 4A K136N PR, and HCV NS3 / 4A D168EPr were loaded onto a high-precision streptavidin (SAX) biosensor at a concentration of 2 μg / mL in 10 mM Hepes pH 7.4, 150 mM NaCl, 0.05% surfactant P20, and 0.3% DMSO. Cimetidine was diluted 1:1 (46.88–3,000 nM) in the same buffer, and the loaded biosensor was immersed in the cimetidine sample for 180 seconds to measure association. For dissociation, the biosensor was immersed in the buffer for 600 seconds. The traces were analyzed using ForteBio data analysis software, and a 1:1 combined model was used for global fitting.
[0541] Split NanoLuc Reconstruction Analysis
[0542] The ability of PRSIM-binding molecules to promote the dimerization of two proteins to which they fuse was evaluated using the NanoBiT system (Promega). This system measures the reconstruction of dissociative nanoluciferase (NanoLuc) and the luminescence produced upon provision of a live-cell imaging Nano-Glo NanoLuc substrate. Figure 8 In the NanoBiT system, one interacting partner fuses via a flexible linker to an 18 kDa NanoLuc fragment called LgBiT (representing the “bulk”) (SEQ ID NO:16), and the other fuses via an equivalent linker to a 1.3 kDa peptide SmBiT (the “small”) (SEQ ID NO:17). LgBiT and SmBiT have low affinity for each other (190 μM) in the absence of the interacting partner and do not reconstitute to form an active luciferase. Once fused with the interacting protein of CID and provided with an inducer, they reconstitute and luminescence can be measured. The NanoBiT system provides two sets of control proteins for fusion with LgBiT and SmBiT: a constitutive interacting protein PRKAR2A:PRKACA; and an FRB: the rapamycin-induced dimerization pair of FKBP12.
[0543] To determine the optimal orientation of the HCVNS3 / 4A PR (S139A) and PRSIM components, constructs were created in which HCV NS3 / 4A PR (S139A) was fused to the N-terminus or C-terminus of SmBiT (SEQ ID NO: 18 and 19, respectively) and a set of parallel constructs (SEQ ID NO: 20-30 and 31-41, respectively) were fused to the N-terminus or C-terminus of each PRSIM binding module of LgBiT. A set of vectors capable of generating these constructs were provided by the NanoBiT kit (Promega). DNA strings encoding the HCVNS3 / 4A PR (S139A) and PRSIM molecules were purchased from GeneArt and cloned by PCR amplification with primers (primer extensions containing restriction sites compatible with NanoBiT vectors) and Gibson assembly. All constructs were validated by Sanger sequencing of the entire coding sequence.
[0544] All NanoBiT selections were performed in adherent HEK293 cells cultured in 96-well plates. Cells digested from tissue culture flasks were counted and divided into groups of 2 x 10⁻⁶. 4Cells / well were seeded in 96-well plates (Costar 3917) with a white opaque bottom. The plates were incubated overnight at 37°C with 5% CO2 to allow cell adhesion. On day 2, the plasmids were co-transfected with Lipofectamine LTX (Thermo Fisher Scientific) at a final concentration of 100 ng / well (50 ng / plasmid, one encoding the SmBiT fusion and the other encoding the LgBiT fusion). On day 3, the wells were treated with 100 nM of an appropriate small molecule inducer (rapamycin (FRB: FKBP12) or cimetvir (HCV NS3 / 4A PR: PRSIM)) or a mediator control, and luminescence was quantified immediately after the addition of Nano-Glo live cell substrate (Promega) using an Envision plate reader.
[0545] Transcriptional regulation assay
[0546] The iDimerize regulatory transcription system (Takara Bio Inc.) is used to test the ability of PRSIM-based CIDs to regulate gene expression. It is based on the reconstruction of a split transcription factor in which the DNA-binding domain (DBD) and activation domain (AD) are separate, thus preventing transcription. The DBD and AD are fused to two protein components of the CID, respectively, so that the AD only approaches the DBD in the presence of a small molecule inducer, recruiting the transcriptional apparatus to the promoter containing the DBD recognition site. The iDimerize regulatory transcription system (Takara Bio Inc.) is available in two vectors, pHet-Act1-2 and pZFHD1-luciferase. The pHet-Act1-2 vector encodes two fusion proteins, representing positive controls: one is a fusion between FRB (T82L mutant; DmrC) and the activation domain (AD) from human p65 (SEQ ID NO:42); the other is a fusion protein consisting of a DNA-binding domain (ZFHD1) (SEQ ID NO:43) fused to three tandem copies of FKBP12 (DmrA). These sequences are preceded by a CMV promoter and separated by an internal ribosome entry site (IRES). The ZFHD1 vector encodes luciferase, preceded by an inducible promoter consisting of 12 copies of the ZFHD1 DBD recognition sequence upstream of the minimal IL-2 promoter. The binding of the DBD to its recognition sequence and the recruitment of the transcriptional apparatus by AD initiate the transcription of the luciferase reporter gene. The DNA sequence encoding HCVNS3 / 4A PR (S139A) was purchased as a DNA string from GeneArt and cloned into the pHet-Act1-2 vector as an N-terminal fusion partner with the activation domain (replacing FRB) (SEQ ID NO:44) or as a C-terminal fusion partner with the DNA-binding domain (replacing FKBP12) (SEQ ID NO:45), wherein flexible linkers (TGGGGSGGGGS (SEQ ID NO:185) and SA, respectively) are present between the fusion partners. Subsequently, a sequence encoding one copy of a set of 12 PRSIM molecules (Table 2) was purchased as a DNA string from GeneArt and cloned using Gibson assembly into the aforementioned pHetAct1-2 construct containing HCVNS3 / 4A PR (S139A), serving as fusion partners with DBD (SEQ ID NO: 46-56) or AD (SEQ ID NO: 57-67), respectively. Equivalent constructs were generated by replacing three copies of FKBP12 in pHet-Act1-2 with a single copy of FKBP12. The sequence of the construct encoding the fusion protein of the activation domain and DNA-binding domain was confirmed by Sanger sequencing of the entire coding region.
[0547] The DNA sequence encoding NanoLuc-PEST (Promega) (SEQ ID NO:68) was purchased as a DNA string from GeneArt and cloned downstream of the ZFHD1 inducible promoter in the pZFHD1-2 vector (Takara Bio Inc.) using Gibson assembly cloning. The nucleotide sequence of the final construct was confirmed by sequencing.
[0548] The DNA sequence encoding MEDI8852 (SEQ ID NO:237 and SEQ ID NO:238, separated by the internal ribosome entry site (IRES) sequence) was purchased as a DNA string from GeneArt and cloned downstream of the ZFHD1 inducible promoter in the pZFHD1-2 vector (Takara Bio Inc.) using Gibson assembly cloning. The nucleotide sequence of the final construct was confirmed by sequencing.
[0549] The sequences encoding three HCVNS3 / 4A PR(S139A) mutants (Table 6) were purchased as DNA strings from GeneArt and cloned as fusion couples with AD (SEQ ID NO:211-216) into the pHetAct1-2 HCVNS3 / 4A PR(S139A)-PRSIM_23 (3 tandem copies) construct described above using Gibson assembly.
[0550] All transcriptional regulation assays were performed in adherent HEK293 cells cultured in 384-well plates. Cells digested from tissue culture flasks were counted and compared at 7.5 x 10⁻⁶. 3 Cells were seeded per well in 384-well plates. The plates were incubated overnight at 37°C with 5% CO2 to allow cell adhesion. On day 2, cells were co-transfected with pHet-Act1-2 plasmid (containing FRB:FKBP12 control fusion protein (Clontech)) or HCVNS3 / 4A PR(S139A):PRSIM fusion protein) and pZFHD1 plasmid (encoding luciferase (Clontech) or NanoLuc-PEST (as described above)) using Lipofectamine LTX (Thermo Fisher Scientific). On day 3, wells were treated with different concentrations of A / C heterodimer (for FRB:FKBP12 control), cimetvir, or mordant control. After 24 hours, luminescence was quantified immediately using an Envision plate reader after adding SteadyGlo luciferase substrate (Promega) or Nano-Glo Vivazine luciferase substrate (Promega). Alternatively, reverse staining is performed on day 1, dimer is added on day 2, and luminescence is quantified on day 3 24 hours later.
[0551] The luminescence readings are converted into a multiple change by dividing the signal with or without cimetidine.
[0552] To quantify antibody expression (MEDI8852) using a transcriptional regulation assay, cells were co-transfected with the pHet-Act1-2 plasmid (containing HCV NS3 / 4A PR(S139A):PRSIM_23) and the pZFHD1 plasmid (encoding MEDI8852). Twenty-four hours later, wells were treated with different concentrations of cimetvir. Forty-eight hours after cimetvir addition, antibody concentrations in the supernatant were measured using an MSD kit (Singleplex Human / NHP IgG Isotyping Kit) (Mesoscale).
[0553] Split-type chimeric antigen receptor activation assay
[0554] Chimeric antigen receptors (CARs) are genetically engineered synthetic versions of T-cell receptors that can guide immune cell activation in response to user-defined targets via target-specific recognition domains (e.g., single-chain variable antibody fragments (scFv)). These multi-domain synthetic proteins are typically constructed by fusing a target recognition domain with a transmembrane domain, a T-cell receptor co-stimulatory domain, and a C-terminal CD3ζ cytoplasmic activation domain. Decoupled CARs can be generated by expressing the target recognition / transmembrane / co-stimulatory domain and the CD3ζ activation domain as two separate proteins. Adding an appropriate heterodimerization switch component to the corresponding protein then allows activation of the CAR via chemically induced heterodimerization in the presence of the target protein.
[0555] Two constructs encoding split CARs were generated using the FRB:FKBP12 or HCVNS3 / 4APR(S139A):PRSIM_23 heterodimerization component. For both split CARs, tricistronic constructs were produced. The three encoded fusion proteins are: 1) a signal peptide sequence from N-terminus to C-terminus, an scFv fragment recognizing the target antigen, a hinge domain from human IgG4, a transmembrane domain from CD28, an intracellular domain of the costimulatory protein 4-1BB activation domain, and FKBP12 or HCV NS3 / 4APR(S139A); 2) a signal peptide sequence from N-terminus to C-terminus, a hinge domain from human IgG4, a transmembrane domain from CD28, an intracellular domain of the costimulatory protein 4-1BB activation domain, FRB or PRSIM_23, followed by a CD3ζ domain; and 3) green fluorescent protein (GFP) used as a marker for transfected cells. Figure 15AFusion proteins 1 and 2 are linked via a P2A self-cleaving peptide, and proteins 2 and 3 are linked via another T2A self-cleaving peptide. Tricistronic DNA sequences encoding the fragmented CARs based on FRB:FKBP12 and HCV NS3 / 4A PR(S129A):PRSIM_23 were purchased from GeneArt (Life Technologies) and cloned into a pCDH expression lentiviral vector (Systems Bioscience), with the sequences validated by Sanger sequencing. The tricistronic DNA sequence of the FRB:FKBP12 fragmented CAR (without the scFV fragment recognizing the target antigen) is provided as SEQ ID NO:132, and the tricistronic DNA sequence of HCVNS3 / 4A PR(S139A):PRSIM_23 (also without the scFV fragment recognizing the target antigen) is provided as SEQ ID NO:133. The DNA sequence encoding the scFv fragment that recognizes the target antigen is inserted between nucleotide positions 66 and 67 of SEQ ID No: 132 and 133, respectively.
[0556] Following the manufacturer's protocol, lentiviral particles encoding each detachable CAR were generated using the pPACKH1 HIV Lentiviral Packaging Kit (Systems Biosciences). Jurkat cells were transduced with the lentiviral particles for 24 hours in the presence of 8 μg / ml polybrene, and then the cells were replaced with fresh growth medium (RPMI-1640 + 10% fetal bovine serum) and allowed to grow for 5 days. Jurkat cell pools transduced with detachable CARs were FACS-sorted based on GFP fluorescence to achieve equivalent expression levels of FKBP12:FRB and HCV NS3 / 4A PR(S139A):PRSIM_23CAR prior to functional assays. Activation of Jurkat cells expressing detachable CARs could be measured by the amount of interleukin-2 (IL-2) produced after CAR stimulation (Smith-Garvin, Koretzky, and Jordan 2009). Co-culture assays were used to promote CAR activation, in which CAR-expressing Jurkat cells were mixed with HepG2 (antigen-positive) or A375 (antigen-negative) cells at a 1:1 ratio. Different concentrations of cimetvir or mediator control (DMSO) were added to the cell mixture and incubated for 24 hours. After incubation, the cells were pelleted by centrifugation, and IL-2 expression in the supernatant was measured using a commercially available IL-2 ELISA (R&D Systems) according to the manufacturer's protocol.
[0557] AAV transduction assay
[0558] AAV expression vectors are generated by subcloning specific promoters and transgenic elements into an intermediate vector derived from pAAV-CMV (Takara Bio Inc.), in which the CMV promoter downstream of the 5'ITR is removed and the WPRE element and SV40 polyA sequence are inserted upstream of the 3'ITR.
[0559] To generate an AAV encoding an inducible luciferase transgene, the ZHFD1-luciferase cassette was amplified by PCR from the pZFHD1-luciferase provided by the iDimerize regulatory transcription system (Takara Bio Inc.) and subcloned into an intermediate AAV vector. To generate an AAV encoding constitutively expressed huIL-2, the gene encoding human IL-2 (SEQ ID NO: 210) was subcloned downstream of the CAG promoter in the intermediate AAV vector. Figure 18A To generate an AAV encoding PRSIM_23CID in the context of a dissociative transcription factor, a cassette encoding two fusion proteins (ZFHD1 DNA-binding domain fused to three copies of PRSIM_23 and HCV NS3 / 4A PR (S139A) fused to AD) separated by a P2A self-cleaving peptide (SEQ ID NO:208) was subcloned downstream of the heterozygous EF1α-HTLV-1 promoter in the intermediate AAV vector. To generate an AAV encoding an inducible IL-2 transgene in addition to the PRSIM_23CID dissociative transcription factor, human IL-2 was subcloned to replace the luciferase transgene in the pZFHD1-luciferase vector, and the ZFHD1-huIL-2 cassette was amplified by PCR and inserted downstream of the 5' ITR in the AAV vector immediately following the PRSIM_23CID dissociative transcription factor construct. Figure 18C All constructs were validated using Sanger sequencing.
[0560] Recombinant AAV (rAAV) was produced by using a standard helper-free method on 40 T-175cm cells of HEK293 T-17 cells with 80% confluence. 2The flasks were produced through three transfections. In short, each flask was transfected with 15 μg of helper plasmid (containing adenovirus E2A and E4 plasmids), 7.5 μg of plasmid carrying AAV ITR and encoding the transgene, and 7.5 μg of AAV capsid plasmid (containing the AAV8 capsid and the corresponding Rep gene) using 90 μg of 40 kDa linear polyethyleneimine (PEI). Five days post-transfection, the culture medium was collected from all flasks, treated with 2000 units of Benzonase nuclease, and incubated at 37°C for 1 hour. The medium was then filtered through a 0.22 μm filter and concentrated to a volume of 80 ml using tangential flow filtration (TFF). Before loading onto a stepwise iodixanol gradient (15% / 25% / 40% / 60%) and centrifuging for 1.5 hours at 18°C and 69,000 rpm in a Ti70 rotor, the volume was further concentrated using an Amicon-15ml-100kDa filter and buffer-exchanged with PBS. Fractions were extracted from the ultraclear centrifuge tubes by puncturing the tube with a 19-gauge syringe at the 60% layer below the zona pellucida representing the virus. The purity of each fraction was assessed by SDS-PAGE and subsequent Sypro Ruby analysis. The pure fractions were combined, buffer-exchanged with PBS in an Amicon-15ml-100kDa filter, concentrated to a final volume of 150 μl, and aliquoted and stored at -80°C to avoid any repeated freezing / thawing. The virus was titrated using digital droplet PCR and a TaqMan probe targeting the ITR. Typical titer ranges were 1–3 x 10⁻⁶. 13 One genome copy (GC) / ml.
[0561] All rAAV transduction assays were performed in adherent HEK293 cells cultured in 96-well plates. Cells digested from tissue culture flasks were counted and analyzed at 2.5 x 10⁻⁶. 4 10 cells / well were seeded in a 96-well plate. The plate was incubated overnight at 37°C with 5% CO2 to allow cell adhesion. On day 2, cells were seeded with 2.5–5 x 10⁻⁵ rAAV. 9 GC / ml (corresponding to 1-2 x 10⁻⁶) 5Cells were transduced with a multiplicity of infection (MOI). After incubation for 48–72 hours, cells were treated with different concentrations of cimetidine or a control and incubated for another 24 hours. For luminescence assays, SteadyGlo luciferase substrate (Promega) was added and luminescence was quantified using an Envision plate reader. The luminescence readings were converted to fold changes by dividing the signal in the presence of cimetidine by the signal in the absence of cimetidine. For IL-2 assays, the supernatant was collected according to the manufacturer's protocol and IL-2 was quantified using the V-PLEX Human IL-2 Kit (Meso Scale Discovery).
[0562] Endogenous gene regulation assay
[0563] To demonstrate endogenous gene regulation using PRSIM-based CID, an activating CRISPR (CRISPRa) approach was employed. CRISPRa relies on the use of a dead Cas9 enzyme (dCas9) lacking endonuclease activity to bind to a target site within the promoter region of an endogenous gene via a single guide RNA. Transcription of the endogenous gene begins after the transcriptional activator is recruited.
[0564] In this method, dCas9 and the VPR activation domain (AD) are separate, thus preventing transcription. dCas9 and AD are fused to two protein components of CID, respectively, so that AD only approaches dCas9 closely in the presence of a small molecule inducer, allowing the transcriptional apparatus to be recruited to the promoter region of the endogenous gene via a single guide RNA (sgRNA). In this example, an activation plasmid consisting of two functional units was generated: AD fused to HCV NS3 / 4A PR (S139A) (SEQ ID 226) and dCas9 fused to three tandem copies of PRSIM-23 (SEQ ID 228). These sequences are preceded by a CMV promoter and separated by an internal ribosome entry site (IRES). The gRNA plasmid was generated using BsaI via golden assembly. The gRNA plasmid encodes the human U6 promoter, the interleukin-2 (IL-2) target sequence (GTTACATTAGCCCACACTT; SEQ ID NO:229), and a scaffold RNA sequence to allow Cas9 binding ( Figure 19A ).
[0565] Transcriptional regulation assays were performed on adherent HEK293 cells cultured in 96-well plates. Cells digested from tissue culture flasks were counted and analyzed at 2.5 x 10⁻⁶. 4Seed cells / well. Incubate plates overnight at 37°C with 5% CO2 to allow cell adhesion. On day 2, co-transfect cells with the activation plasmid and gRNA plasmid using Lipofectamine 3000 (Thermo Fisher Scientific) at a gRNA:activating plasmid DNA ratio of 2:1. On day 3, incubate wells with 300 nM cimetvir or a mediator control. 72 hours post-treatment (day 6), collect cell supernatant according to the manufacturer's protocol and quantify IL-2 using the V-PLEX Human IL-2 Kit (Mythos Gell Discovery).
[0566] Molecular simulations were used to identify mutations predicted to reduce the affinity of cimetidine for the NS3 / 4A protease against hepatitis C virus (HCV).
[0567] The co-crystal structure of the HCV-cimeprovir complex was first prepared using a protein preparation wizard (Sastry et al., 2013) to add hydrogen atoms, fill missing side chains, and assign appropriate ionization states to both the amino acids and cimeprovir at physiological pH. Then, a Schrödinger method with an OPLS3e force field was used. The FEP+ (module) from version 2019-2 (Moraca et al., 2019) was used to predict the relative binding free energy following mutations of residues H57, K136, S139, and R155 in HCVNS3 / 4A PR. Mutations expected to reduce the affinity of the HCV protease for cimetidine are listed in Table 4.
[0568] A stable cell line expressing GFP-PEST under the control of split transcription factors was generated.
[0569] According to the manufacturer's instructions, a CRISPR-mediated knock-in system is used to integrate the transgene at the AAVS1 locus (ORIGENE) to generate a monoclonal cell line. Figure 26BInitially, HEK293 cells expressing GFP-PEST (SEQ ID NO: 232, 233) under the control of an inducible promoter (minimum IL-2 promoter) were obtained by transient transfection with the previously linearized pHet-ZFHD1-GFP-PEST plasmid. Transfected cells were screened by adding 800 μg / ml genimycin to growth medium (DMEM + 10% fetal bovine serum + 1% non-essential amino acids). Subsequently, polyclonal cells were transfected with the pHet-Act1-2-HCVNS3 / 4A PR(S139A)-PRSIM23 (3 tandem copies) plasmid, and single-cell clones were isolated by FACS sorting based on the GFP fluorescence intensity in response to cimetvir treatment. The resulting single-cell lines served as the basis for further generation of HEK293 cells expressing GFP-PEST under the control of the split transcription factor PRSIM_23HCV NS3 / 4PR WT and mutants.
[0570] The AAVS1 safe harbor CRISPR-mediated knock-in system employs two plasmids: a CRISPR all-in-one vector, the pCAS-guide-AAVS1 vector, and a donor vector with an AAVS1 homologous arm (pAAVS1-DNR-purinemycin) (SEQ ID NO: 234, 235). The AAVS1 targeting sequence (SEQ ID NO: 236) was previously cloned into the pCAS-guide plasmid. The donor vector was designed by adding SbfI and HpaI restriction enzyme sites via Gibson assembly to enable further subcloning of HCVNS3 / 4A PR (S139A) and the mutant: PRSIM_23 heterodimer component. Subsequently, the pHet-Act1-2-HCVNS3 / 4A PR(S139A)-PRISM23 (3 tandem copies) plasmid was digested with SbfI and HpaI restriction enzymes (New England Biolabs) to obtain HCVNS3 / 4A PR(S139)-PRISM23 DNA, which was then further subcloned into the donor vector via Gibson assembly. HCV NS3 / 4APR variants (including HCV NS3 / 4PR(K136D)(SEQ ID NO:211), HCV NS3 / 4PR(D168E)(SEQ ID NO:213), and HCV NS3 / 4PR(K136N)(SEQ ID NO:215)) were subcloned from pHet-Act1-2-HCV NS3 / 4PR(K136D / D168E or K136N)-PRISM23 into the pAAVS1-HCV NS3 / 4A PR(S139A)-PRISM23-puromycin plasmid using SbfI and AfeI restriction enzyme sites via Gibson assembly. The nucleotide sequences were confirmed by Sanger sequencing.
[0571] Stable cells expressing GFP-PEST under the control of a single inducible promoter were co-transfected with pAAVS1-HCVNS3 / 4A PR(S139A; K136D; D168E; K136N)-PRISM23-puromycin donor vector and pCAS-guide-AAVS1 to enable targeted integration into the AAVS1 locus. Transfected cells were selected by adding 1 μg / ml puromycin to the growth medium (DMEM + 10% fetal bovine serum + 1% non-essential amino acids + 800 μg / ml genimycin) 48 hours after transfection. After a 14-day selection period, polyclonal cell lines were induced with 500 nM cimetidine and single-cell clones were isolated by FACS sorting based on GFP fluorescence intensity. The final single-cell cell lines ( Figure 26C FACS characterization was performed based on GFP signals that responded to 500 nM cimetidine treatment.
[0572] Flow cytometry determined the kinetics of GFP-PEST expression derived from a cimetidine-induced switch.
[0573] Monoclonal cell lines expressing GFP-PEST, under the control of a dissociative transcription factor system, were enzymatically removed from tissue culture flasks and seeded into 96-well collagen-coated plates. The next day, cells were treated with 100 nM cimetidine. Twenty-four hours after treatment, cells were washed twice in cimetidine-free growth medium and maintained in cimetidine-free medium. GFP fluorescence of cells at different time points after cimetidine removal was measured using a Fortessa flow cytometer (BD Biosciences). For analysis, the GFP fluorescence of untreated cells (relative fluorescence unit = RFU) was subtracted from all experimental values. RFU values were further normalized to the time point "0 h", obtained at the time of cimetidine removal.
[0574] The structure of HCVNS3 / 4A PR(S139A) was determined: PRSIM57 complex.
[0575] A single-chain HCV protease construct—derived from an 11-residue peptide fused to the N-terminus of an NS3 protease with an S139A mutation—was redesigned to have an N-terminal six-histidine (6His) cleavage site, followed by a tobacco etch virus (TEV) protease cleavage site (enabling affinity purification and tag removal, respectively) (SEQ ID NO:218). A second construct was designed to express PRSIM_57scFv (SEQ ID NO:221) with an N-terminal pelB leader sequence guiding periplasmic secretion and a C-terminal TEV site and 6His tag. Both sequences were purchased as linear DNA strings (GeneArt) and cloned into the pET-28a vector (for bacterial expression) using Gibson assembly. The final construct sequences were validated by Sanger sequencing of the entire coding sequence.
[0576] For expression, the pET-28a plasmid was transformed into BL21(DE3) *E. coli* cells and screened on plates containing kanamycin (50 μg / ml). For each expression, a single colony was inoculated with 5 ml of 2xTY + 50 μg / ml kanamycin culture, which was grown overnight at 37°C. This culture was then inoculated with 500 ml of 1:500 diluted TB self-induction medium (Formedium, supplemented with 10 ml / L glycerol and 100 μg / ml kanamycin). Cultures were grown at 37°C until an OD600 of 1.3–1.5 was reached, and then transferred to 25°C (HCV NS3 / 4A PR(S139A)) or 30°C (PRSIM_57) for 20 hours to induce expression. Cells were harvested by centrifugation and the pellet was stored at -80°C.
[0577] For the purification of HCV NS3 / 4A PR (S139A) protein, each bacterial pellet from a 500 ml culture was thawed and resuspended in 50 ml of lysis buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, pH 8.0). Cells were lysed via a cell disruptor at 30,000 kpsi, and the lysate was clarified by centrifugation at 50,000 g for 30 min at 4 °C. The clarified supernatant was loaded onto a 5 ml HisTrap HP column (GE Healthcare) at a flow rate of 5 ml / min. The column was washed sequentially with wash buffer (50 mM HEPES, 500 mM NaCl, 1 mM TCEP, 20 mM imidazole, pH 8.0 and 50 mM HEPES, 500 mM NaCl, 1 mM TCEP, 40 mM imidazole, pH 8.0) and eluted with an imidazole gradient of 40–400 mM imidazole for more than 5 column volumes. Fractions were analyzed by SDS-PAGE, and fractions rich in the correct protein were pooled and buffer-exchanged using a HiPrep26 / 10 desalting column (General Health Medical Group) to 50 mM HEPES, 200 mM NaCl, 0.3 mM TCEP, 10 μM ZnCl2, pH 7.5 (storage buffer). The desalted protein fractions were treated overnight at 4°C with a His-tagged TEV protease at a 1:100 w / w ratio. The TEV protease was removed by passing the sample through a HisTrap HP column, and the resulting flow material was purified by loading it onto a Superdex 7526 / 600 column (which was equilibrated in storage buffer).
[0578] PRSIM-57His-labeled scFv samples were released from the periplasm via osmotic shock of cell pellet: cells were first resuspended in 300 mL of 50 mM Tris, 1 mM EDTA, 20% sucrose, pH 8.0, then precipitated and resuspended in water to apply osmotic shock and release the periplasmic contents. Samples were purified by loading onto a HisTrap excel column and washing and eluting with the same buffers used for the HCVNS3 / 4A PR (S139A) construct. Eluted proteins were buffer-exchanged on a HiPrep 26 / 10 desalting column in 50 mM HEPES, 200 mM NaCl, pH 7.5 and treated overnight at 4°C with TEV protease at a 1:50 w / w ratio. TEV-digested material was further purified using IMAC and size exclusion steps (regarding the protease) and stored in 50 mM HEPES, 200 mM NaCl, pH 7.5.
[0579] To form a ternary complex of HCVNS3 / 4A PR (S139A), PRSIM_57, and cimetvir, 50 μM of HCVNS3 / 4A PR (S139A) was mixed with a 1.1-fold excess of PRSIM_57, followed by the addition of cimetvir to a final concentration of 100 μM and 3% DMSO. The sample was incubated at room temperature for 60 min to reach equilibration, and then loaded onto a Superdex 7516 / 600 column at 0.75 mL / min in 20 mM HEPES, 200 mM NaCl, pH 7.5. Fractions containing the complex were combined, concentrated to 12 mg / mL, aliquoted, and rapidly frozen in liquid nitrogen, then stored at -70 °C. Before crystallization, one aliquot of the complex was thawed and run on an HP-SEC column to verify the integrity and monodispersity of the complex.
[0580] The ternary complex was crystallized using a drop vapor diffusion method. Several proprietary crystallization screens were set at 277 K and 293 K. Hit rates from these screens were optimized using drop and pendant drop vapor diffusion experiments as needed. Final crystals were obtained at 293 K from a storage solution consisting of 20–25% (w / v) PEG 8000, 100–300 mM magnesium chloride, and HEPES buffer (pH 7.0–8.0). The crystals were exposed to a cryoprotectant solution replenished with 20% (v / v) ethylene glycol in the storage container and then frozen directly in liquid nitrogen.
[0581] Data was collected at a diamond light source, beamline i04, and at low temperature. The CCP4 and autoBUSTER software packages were used for structure resolution and optimization, while the Coot program was used for manual model building. The structure was resolved by molecular substitution using the HCVNS3 / 4A (S139A) model from a protein database.
[0582] Computer simulation prediction of HCVNS3 / 4A PR(S193A) mutant stability
[0583] The Schrödinger Residue Scanning tool (Schrödinger version 2020-2: SiteMap, Schrödinger Inc.) was used. (LLC), New York, NY 2020) calculated changes in HCV protein stability after mutation.
[0584] The Prime MM / GBSA energy function with implicit solvent terms was used for calculation (Li et al., 2011). The cutoff value is used for protein refinement around the mutation. Negative values for stability changes are associated with increased mutation stability.
[0585] PRISM-based kill switch cloning
[0586] The sequence (SEQ ID NO: 223) encoding a kill switch fusion protein of PRSIM23, HCVNS3 / 4A PR, and ΔCARD caspase 9 (with a short GGGSG between the three fragments) was purchased from Geneart (Life Sciences, Inc.) as a cloned gene in the vector pcDNA3.1. The fusion protein was subcloned into the EcoRI / NotI-digested lentiviral vector pCDH-EF1α-MCS-(PGK-GFP-T2A-Puro) (Systems Biosciences, Inc.) using Gibson assembly cloning. To generate the caspase 9S196A mutant, a DNA fragment synthesized by Geneart that modifies the kill switch construct's equivalent Ser371 to Ala was cloned into a ClaI / NotI-cleaved kill switch vector (SEQ ID NO: 230). The gene sequence was confirmed by DNA sequencing.
[0587] Generation of Kill Switch Cell Lines Based on PRISM
[0588] Following the manufacturer's instructions, lentiviral particles encoding either a kill switch fusion protein (SEQ ID NO: 223) or a kill switch S196A mutant fusion protein (SEQ ID NO: 230) were generated using the pPACKH1 HIV Lentiviral Packaging Kit (Systems Biosciences). HEK293 cells were transduced for 24 hours in the presence of 8 μg / ml polybrene, and then the cells were replaced with fresh growth medium (DMEM + 10% fetal bovine serum + 1% non-essential amino acids). After 24 hours, transduced cells were screened by adding 2 μg / ml puromycin for 5 days. Prior to functional testing, the transduced cell pools were sorted by FACS based on GFP fluorescence to separate pools of highly expressed cell lines and single-cell clones.
[0589] HCT116 and HT29 transduced cells were generated using the same protocol, the difference being that McCoy's 5A medium with 10% fetal bovine serum was used as the growth medium, supplemented with 2 μg / ml puromycin for screening transduced cells.
[0590] hESC line Sa121 (Takara Bio Europe) was also transduced using lentiviral particles encoding the aforementioned PRSIM-based killer switch fusion protein (SEQ ID 223). Cells (passage 19) were cultured at 3.5 x 10⁻⁶ cells / year. 5 cells / cm 2 Cells were seeded in a DEF-CS culture system and transduced 30 hours later. 24 hours after transduction, puromycin selection was initiated and continued until a stable cell pool was reached.
[0591] Generation of stable iPS cell lines expressing PRSIM-based kill switch
[0592] A stable induced pluripotent stem cell (iPSC) line expressing cimetidine-induced killing switch (a monoclonal fibroblast (B-3 / 1F1) derived from healthy human donors in the AstraZeneca Research Specimen Collection Program) was generated as follows: using CRISPR / Cas9 technology, AAV-encoded DNA was used as a template to target and integrate into the β2 microglobulin (B2M) locus.
[0593] The donor construct encoding a PRSIM-based kill switch (SEQ ID 223) was synthesized and purchased from GenScript, Inc., and subcloned into an AAV shuttle plasmid backbone. The donor construct was packaged into an adeno-associated virus (AAV) particle; briefly, the donor plasmid was co-transfected with two helper plasmids, pAd5Helper and pR2C6 (encoding adenoviral components essential for AAV replication and AAV2 replication (rep) / AAV6 capsid (cap) proteins, respectively). Cells were collected after 72 hours and lysed via freeze-thaw cycles. Cell lysates were digested with Benzonase (100 U / ml) at 37°C for 1 hour and then centrifuged. The supernatant containing the vector was collected and applied to an iodixanol gradient, followed by ultracentrifugation. After ultracentrifugation, the solution containing the vector was collected and washed three times with 20 mL PBS in a centrifuge concentrate tube. Finally, the solution was concentrated to 1 mL. The vector genome copies contained in the solution were titrated by qPCR.
[0594] iPSC cells with a confluence of 50%–70% (approximately 1.2 x 10⁻⁶ cells) will be seeded into 6-well plates coated with quinone. 6 Cells were used for transfection / transduction. Cells were maintained in 2 mL of fresh StemFlex medium containing 1x RevitaCell (Lifetech Corporation). For each well, 200 μL of Opti-MEM (Lifetech Corporation) medium containing 220 nM CRISPR-ribonucleoprotein and 12 μL RNAiMAX (Lifetech Corporation) was applied. Simultaneously, the AAV vector was applied at a multiplicity of infection (MOI) of 50,000. After 24 hours of incubation, the medium containing RNP / AAV was replaced with fresh StemFlex medium.
[0595] Forty-eight hours after transfection, the culture medium was replaced with fresh StemFlex medium containing 5 μg / mL cyprodinil S HCl (Lifetech Corporation). For the next three to four days, the medium was replaced daily with fresh StemFlex medium containing cyprodinil. The cells were then maintained back in standard StemFlex medium.
[0596] FACS was performed to identify B2M-negative cells that encode a PRSIM-based killer switch. Cells were isolated from the plate using TrypLE Express (Life Technologies) and spaced at 1 x 10⁻⁶ cells / cells. 7 Cells were resuspended at a density of 10 cells / mL in FACS buffer (containing 1% PBS and 1x RevitaCell HBBS) containing 5% APC-labeled anti-human B2M antibody (BioLegend, Inc.). After incubation for 10 minutes, the cells were washed twice with 10 volumes of FACS buffer and then incubated with 2x 10⁻⁶ cells / mL. 7 B2M negative cells were resuspended in FACS buffer at a density of 10 cells / mL. B2M negative cells were collected via FACS (FACSAria; BD Biosciences) and cultured for further experiments.
[0597] Single-cell clones were then isolated using single-cell printing. Cells were isolated from the plate using TrypLE Express (Life Technologies) and printed at 1.6 x 10⁻⁶ cells per cell. 6 Resuspend cells at a density of 1 cell / ml in SCP buffer (HBBS containing 1x RevitaCell). Load the cell suspension into a column of a Cytena CloneSelectSingle-Cell Printer (Cytena). Seed cells at 1 cell per well in a 96-well plate coated with either Matrigel or vitrinine and containing 200 μL of fresh mTeSR (STEMCELL Technologies) or StemFlex medium containing 1x RevitaCell (Life Technologies). Replace the medium with fresh StemFlex medium on the second day after SCP.
[0598] Five single-cell clones were recovered, expanded from 96-well plates to quinone-coated 24-well plates, and further expanded and maintained in quinone-coated 6-well plates. For each single-cell clone, approximately 5 x 10⁻⁶ cells were collected. 5Cells. Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen). The target region of the human B2M gene was amplified using the following primers and SuperFi DNA polymerase (LifeScience). PCR products were loaded onto 1.2% agarose gels for electrophoresis. Gel visualization was performed to identify the gene knock-in status of single-cell clones by amplicon size. Clones 1B7, 1D12, 1G8, and 2D8 were shown as biallelic genes at the B2M locus and used for functional analysis of killer switch activity.
[0599] B2M_LHA_PF2 GGGAGGAACTTCTTGGCACA(SEQ ID NO.:246) B2M_RHA_PR2 AGGAGAGACTCACGCTGGAT(SEQ ID NO.:247)
[0600] Killer switch cell viability and caspase 3 function assay
[0601] HEK293, HCT116, or HT29 cells stably expressing the PRSIM-based killer switch fusion protein (SEQ ID NO: 223) or HEK293 cells stably expressing the PRSIM killer switch S196A mutant fusion protein (SEQ ID NO: 230) were seeded into collagen-coated 96-well plates and treated with 100 nM cimetidine 24 hours later. Phase-contrast images were acquired at different time points using 10x or 20x objectives on an Incucyte Zoom (Essen Bioscience).
[0602] Functional caspase 9 activates caspase 3, and this proteolytic activity can be determined by cleaving the non-fluorescent substrate DEVD-AMC into cleavage products DEVD and fluorescent AMC, where the AMC fluorescence signal at 430 nm is proportional to the caspase 3 activity. For the caspase 3 assay, cells were seeded in duplicate into 6-well tissue culture plates. After 24 hours, one of the replicate wells was treated with 10 nM cimetidine for 3 hours. Cell lysates were analyzed in triplicate using the caspase 3 assay from BD Biosciences, modified to normalize the total protein input to 50 μg using the BCA assay (Lifetech). Fluorescence was measured on an Envision plate reader (PerkinElmer), Ex: 380 nm, Em: 430 nm. For quantification, the RFU (raw fluorescence value) of wells containing only the assay substrate was subtracted from the RFU of all samples from the assay. Results were standardized to untransduced, cimetidine-treated cells. Analysis was performed using one-way ANOVA in Prism (GraphPad), followed by multiple comparisons.
[0603] PRSIM-based kill switch activity in ESC cells
[0604] To test the induction of the killer switch in Sa121 ES cells, cells were sputtered at 3.5 x 10⁻⁶ cells / year. 5 / cm 2 Two days after inoculation, cytokine-switching activity was induced by treatment with cimetidine at concentrations ranging from 10 nm to 1 μM. Cells were imaged at 10–20 minute intervals using an Incucyte S3 (Essen Biosciences); cytokine-switching efficiency was quantified by image analysis of confluence. Real-time cell analysis (RTCA) was used to detect cimetidine-induced cytokine-switching activity in iPS cells.
[0605] Cells from each of the above single-cell clones were seeded at a density of 40,000 cells per well in 96-well electronic microtiter plates coated with vitrin (E-). 96, ACEA Biosciences Inc. The plate was connected to the xCelligence module and incubated at 37°C in a humidified incubator with 5% CO2 to monitor the cell proliferation index without interrupting normal cell growth. The cell proliferation index was measured and recorded every 15 minutes over 24 hours. Then, different concentrations of cimetidine were added, and the cell proliferation index was measured every 5 minutes over 8 hours, followed by measurements every 15 minutes over another 40 hours. All experiments were performed in triplicate for each clone and each condition. The mean cell index was quantified using xCELLigence RTCA Software Pro (ACEA Biosciences Inc.). Example 2 - Identification as Cimetidine and HCVNS3 / 4A PR based on the dimerization chemical inducer (CID) module
[0606] To generate de novo dimerization chemical inducer modules, we employed a method where the small molecule inducer is a clinically approved small molecule, and one protein component is the target protein of that small molecule. The second protein component (binding member) is derived from a binding molecule library (Tn3 or scFv), and the target protein bound to the small molecule exhibits excellent selectivity compared to the unbound target protein. Figure 1 By focusing on approved small molecules, we inferred that the path to regulatory approval would be smoother, given that small molecules are considered safe for human use at appropriate doses. Instead of using small molecules targeting human proteins, we decided to focus on small molecules that bind to non-human proteins, such as antiviral compounds. We inferred that the advantage of this approach is that small molecules do not cause any potentially harmful on-target pharmacology, and since the target protein is absent in (uninfected) patients, there is no competition for binding to the small molecule that could affect its pharmacokinetics. To determine the preferred small molecule / target protein pair, we considered the following criteria:
[0607] Ideal small molecule standard:
[0608] • Approved for long-term administration (daily dosing for >6 months)
[0609] • Permeable cells
[0610] • Oral administration
[0611] • Not used as first-line treatment with antiviral drugs
[0612] Ideal target protein standards:
[0613] ·monomer
[0614] Small (≤30kDa)
[0615] • Overexpression of the target protein (or its domains) is non-toxic, or the target protein can be inactivated but retain SM binding.
[0616] • Small molecules that can be expressed in the cytoplasm (i.e., not bound to the membrane or DNA): target protein complex standard:
[0617] There is reason to believe that the bound target protein will have different epitopes than the unbound target protein.
[0618] Extensive analysis identified one of the preferred small molecule / target protein pairs as cimetvir and its target, the NS3 / 4A protease of hepatitis C virus (HCV NS3 / 4A PR). It is an orally administered small molecule with cell permeability and a pharmacokinetic (PK) profile supporting once-daily dosing. It has been used in combination with ribavirin and pegylated interferon for a long period (up to 39 months) to treat HCV infection and is included in the WHO Essential Medicines List, indicating it is a well-tolerated and widely used drug. HCVNS3 / 4A PR is a monomer, relatively small in size (21 kDa), capable of being expressed in the cytoplasm, and not found to be associated with DNA. Furthermore, three-dimensional X-ray crystallography of the complex (PDB code: 3KEE) showed that cimetvir binds in a shallow substrate-binding groove of HCVNS3 / 4A PR, with an exposed surface area of [missing information]. ( Figure 2 We infer that this relatively large exposure area is significantly different from the unbound HCV NS3 / 4A PR, and can identify the complex-specifically binding molecules. Example 3 - Mutant HCV NS3 / 4A PR (S139A) retains the properties of cimetidine. Despite the significant reduction in activity, the binding...
[0619] HCVNS3 / 4A PR is an enzyme that cleaves at four junctions of the HCV polyprotein precursor and is known to cleave a limited number of endogenous human targets (Li, Sun et al., 2005; Li, Foy et al., 2005). To limit this activity in human cells, we deduced the need to identify a mutant form of HCV NS3 / 4A PR that is enzymatically inactivated but retains binding to cimetidine. The active site mutant of HCVNS3 / 4A PR (S139A) has previously been shown to have significantly lower activity than its wild-type counterpart (Sabariegos et al., 2009). To confirm this and to investigate whether the mutant HCV NS3 / 4A PR would retain binding to cimetidine, the recombinant protein was expressed in E. coli and purified to homogenate. HCV NS3 / 4A PR (both WT (SEQ ID NO:3) and S139A mutant (SEQ ID NO:4)) with N-terminal hexahistine residues and AviTag were expressed separately in 1 L of BL21(DE3) culture induced by autoinduction. Cultures were harvested and the proteins were purified using a combination of immobilized metal affinity chromatography and size exclusion chromatography. The final pooled samples were evaluated by SDS-PAGE, indicating a purity level >99% (…). Figure 3A The purified protein aliquots were site-specifically biotinylated at AviTag using BirA enzyme and then repurified by size exclusion chromatography. Mass spectrometry confirmed that both WT and S139A HCVNS3 / 4A PR had 100% biotinylation incorporation.
[0620] The enzymatic activities of these recombinant HCV NS3 / 4A PR WT and S139A proteins were tested using a fluorescent peptide cleavage assay, which confirmed that the HCV NS3 / 4A PR S139A mutant exhibited significantly reduced activity. Enzymatic activity was undetectable at most test concentrations, with minimal activity observed only at high nM to μM concentrations. Figure 3B ).
[0621] Isothermal calorimetry was used to evaluate the binding affinity of cimetidine to WT and S139A HCV NS3 / 4A PR proteins. Both proteins yielded very similar results, obtaining the same stoichiometry (approximately 0.6 Sim / NS3 binding site) and ΔH value (approximately 22 kcal / mol). Figure 3C The calculated dissociation constant was very low (approximately 1 pM), but the associated error was very high (10 nM), indicating that the affinity was too high for accurate measurement using this technique without the use of competing ligands. However, since the stoichiometry and ΔH value are the same, the binding affinity between the WT and S139A HCV NS3 / 4A PR proteins is likely not significantly different.
[0622] Based on these data, we chose to continue screening for HCV NS3 / 4A PR:cimepvir complex-specific binding (PRSIM) molecules based on the S139A mutant protein.
[0623] Example 4 - HCV NS3 / 4A PR(S139A): Screening for Cimetvir Complex-Specific Binding (PRSIM) Molecules
[0624] Four rounds of phage display screening were performed on biotinylated HCVNS3 / 4A PR (S139A) in the presence of cimetidine. Phage ELISA was performed on biotinylated HCVNS3 / 4A PR (S139A) from the outputs of rounds 3 and 4, with and without cimetidine, and binding was determined by measuring the fluorescence signal. Figure 4A and Figure 4B Phage ELISA binding data were compared with DNA sequence data from the same clones, and a group of 34 scFv and 28 Tn3 clones (with unique sequences showing selective binding to biotinylated HCV N3 / 4A PR (S139A) in the presence of cimetidine) were selected for expression for further biochemical studies (Tables 1A and 1B). In addition, one scFv clone (PRSIM_51) and three Tn3 clones (PRSIM_54, PRSIM_55, and PRSIM_85) showing binding to biotinylated HCV N3 / 4A protease (S139A) in both the presence and absence of cimetidine were selected for further biochemical studies.
[0625] Table 1A
[0626]
[0627]
[0628] Table 1B
[0629]
[0630]
[0631]
[0632] *Except for the data in parentheses, which were determined in the absence of cimetidine, all data are reported in the presence of cimetidine.
[0633] Example 5 - A group of PRSIM molecules exhibit specificity for the HCVNS3 / 4A PR(S139A):cimetvir complex.
[0634] PRSIM-binding proteins identified as complex-specific from phage display screening were expressed and purified on a large scale, providing sufficient material for further analysis. Homogeneous time-resolved fluorescence (HTRF) binding screening was performed on all HCV NS3 / 4A PR(S139A):cimipvir complex-specific PRSIM molecules. Figure 5 Furthermore, a group of 8 Tn3-based molecules and 14 scFv-based molecules were confirmed to be complex-specific and showed no detectable binding to the individual HCV NS3 / 4A PR (S139A) protein (Table 1 (bold)). Figure 6 ).
[0635] To further characterize the PRSIM-binding molecules, five scFv molecules (PRSIM_4, PRSIM_57, PRSIM_67, PRSIM_72, and PRSIM_75) and five Tn3 molecules (PRSIM_23, PRSIM_32, PRSIM_33, PRSIM_36, and PRSIM_47) were selected, and the kinetics of HCV NS3 / 4A PR(S139A) protease binding in the presence or absence of cimetidine were determined using Biacore 8K (Table 2). All tested PRSIM-binding molecules showed selectivity for cimetidine-bound HCV NS3 / 4A PR(S139A), with only three showing slight nonspecific binding to HCV NS3 / 4A PR(S139A) alone. PRSIM_57 was selected... Figure 7A ) and PRSIM_23 Figure 7B Further characterization was performed. HCV NS3 / 4A PR(S139A) showed an affinity of 15.0 nM for PRSIM_57 (scFv) and 6.3 nM for PRSIM_23 (Tn3). The effect of cimetvir concentration on the formation of the HCV NS3 / 4A PR(S139A) / PRSIM_57 / 23 complex was also evaluated. Figure 7C ). Cimetvir for ECMO of PRSIM_57 and PRSIM_23 in combination with HCV NS3 / 4A PR(S139A). 50 They are almost equal; 4.57 and 4.03 nM respectively.
[0636] Table 2: Binding and kinetic constants measured for the binding of HCV NS3 / 4A PR(S139A) to PRSIM-binding molecules in the presence or absence of cimetidine. BSA in the presence of cimetidine was used as a control.
[0637]
[0638] ND = indicates that the value cannot be determined due to the lack of detectable binding.
[0639] # = No binding
[0640] * = Minimal nonspecific binding
[0641] Italicized data indicate high association rates and / or lower than expected R. max
[0642] $=BSA control was measured only in the presence of 10 nM cimetidine. Example 6 - PRSIM-based CID can be adjusted for splitting Reconstruction of protein
[0643] After isolating the PRSIM-binding molecule that specifically binds to the cimetidine:HCVNS3 / 4A PR(S139A) complex, we inferred that this system could be used to regulate the reconstitution of dissociative proteins. By providing temporal and spatial regulation of intracellular protein dimerization, CID can be applied to the post-translational environment to control desired protein-protein interactions or activities. Numerous examples exist of dissociative proteins that acquire activity after reconstitution, one of which is the dissociative nanoluciferase (NAFLZ) provided in the NanoBiT system (Promega). Figure 8 We applied this system to PRSIM-based CIDs by fusing HCV NS3 / 4A PR (S139A) to SmBiT and PRSIM-binding members to LgBiT. Screening was performed to test five Tn3 and six scFv PRSIM-binding modules generated during phage screening, using N-terminal and C-terminal fusions with LgBiT and equivalent N-terminal and C-terminal fusions with HCV NS3 / 4A PR (S139A) fused to SmBiT. Cells were transfected with appropriate plasmids, incubated for 24 hours, and then treated with 100 nM cimetidine or a mediator control (or 100 nM rapamycin if the kit-provided FRB:FKBP12 control). Luminescence was measured, and the fold change in signal with and without cimetidine was calculated. Figure 9 A general trend was observed that significant fold changes in luminescence were typically only observed when LgBiT fused with the C-terminus of the PRSIM binding module. For the following PRSIM binding modules, significant signals above the background were observed in this context: PRSIM_23 (31-fold), PRSIM_33 (9-fold), PRSIM_01 (16-fold), PRSIM_06 (11-fold), PRSIM_57 (14-fold), and PRSIM_75 (51-fold). These results indicate that, in the presence of simipvir, many isolated PRSIM binding modules can specifically induce dimerization of split NanoLuc from the NanoBiT system.
[0644] Example 7 - PRSIM-based CID can regulate gene expression through the reconstruction of fragmented transcription factors.
[0645] Having demonstrated that PRSIM-based CIDs can reconstruct the activity of dissociative proteins by fusing HCV NS3 / 4A PR (S139A) and PRSIM molecules into different components of dissociative NanoLuc enzymes, we infer that the same CID can regulate transgene expression by fusing with two domains of dissociative transcription factors. To demonstrate this, we used the iDimerize-regulated transcription system (Takara Bio Inc.), which provides two separate vectors; one vector (pHet-Act1-2) encodes an FRB fused with the activation domain (AD) p65 and a DNA-binding domain (DBD) ZFHD1 fused with three copies of FKBP12, separated by an IRES sequence and preceded by the constitutive promoter CMV; the other vector (pZFHD1_luciferase) encodes a luciferase controlled by an inducible promoter containing 12 copies of the ZFHD1 recognition sequence upstream of the minimal IL-2 promoter. When the two plasmids were transfected into cells, they expressed FRB-AD and DBD-FKBP12 proteins. DBD recognizes its target site on the inducible promoter, but transcription initiation does not occur because AD is not as close to the promoter. Only when the rapalog inducer "A / C heterodimer" is added will AD be recruited to DBD, which then binds to the promoter upstream of the luciferase gene and begins expression.
[0646] We swapped the FRB and FKBP12 coding sequences to encode a copy of HCV NS3 / 4A PR (S139A) and one of the following 11 PRSIM molecules, wherein the PRSIM molecule is fused to the N-terminus of the activation domain or the C-terminus of the DNA-binding domain. Figure 10 After transfecting cells with pHet-Act1-2 (PRSIM) and pZFHD1_luciferase constructs, we evaluated the ability of PRSIM-based CIDs to regulate luciferase gene expression at increasing concentrations of cimetvir. Different PRSIM-based CID constructs showed dose-dependent gene expression regulation ranging from 1.4 to 146-fold. Figure 11A and Figure 11B(Table 3) Among them, six Tn3-based and five scFv-based PRSIM molecules showed gene expression increases of more than 10-fold. The highest fold change achieved by the Tn3-based clone was 106-fold, based on PRSIM_23 fused with the activation domain. Interestingly, most PRSIM clones showed a preference for fusion with AD or DBD; PRSIM_23 is unique in that it provides strong gene expression regulation in both orientations (106-fold with AD fusion and 88-fold with DBD fusion). PRSIM_23 also showed the lowest EC50 (2 nM), meaning that activation of transcription requires a lower concentration of cimetidine. The clone showing the highest fold change after adding cimetidine was the scFv-based PRSIM_57 fused with DBD, achieving a 146-fold induction and a low EC50 value (3 nM).
[0647] Table 3: EC50 and fold change values of CID based on PRSIM in the split transcription factor assay.
[0648]
[0649]
[0650] When the ability of HCV NS3 / 4A PR(S139A)-AD and DBD-PRSIM_23 or DBD-PRSIM_57 constructs to regulate luciferase expression in the presence of cimetidine was directly compared with the FRB:FKBP12:rapalog positive control, the PRSIM-based construct (100-fold increase) was superior to the FRB:FKBP12-based construct (30-fold increase). Figure 12A ). Luminescence analysis in the absence of an inducer (i.e., cimetvir or rapalog) showed higher levels of CID based on FRB:FKBP12:rapalog, indicating improved leakage levels in PRSIM-based CID. Figure 12B )
[0651] Example 8 - Increasing tandem copies of PRSIM fused with DBD improves gene regulation
[0652] To assess the impact of target protein copy number fusion to the DNA-binding domain, we generated pHet-Act1-2-based constructs encoding FRB-AD or HCVNS3 / 4A PR(S139A)-AD and DBD-FKBP12 or DBD-PRSIM_23, wherein the protein fused to the DBD was included either as a single copy or as three tandem copies separated by a short peptide linker. Figure 13When comparing the ability of PRSIM_23-based CID to regulate NanoLuc-PEST protein expression in the presence of cimetidine with the FRB:FKBP12:rapalog positive control, we found that PRSIM_23-based CID outperformed FRB:FKBP12-based CID when using one copy (55-fold vs. 13-fold) or three copies (100-fold vs. 55-fold) of the DBD fusion partner. Figure 14A ).
[0653] Furthermore, when assessing the effects of one, two, or three tandem copies of PRSIM_23 fused to DBD using the same fractional transcription factor assay and measuring the induction of firefly luciferase expression, a graded response was observed; one copy of PRSIM_23 resulted in a maximum fold change of 364.5, while two tandem PRSIM_23 molecules resulted in a maximum fold change of 2436, and three tandem PRSIM_23 molecules further increased to 4862-fold (…). Figure 14B ).
[0654] This data suggests that the regulation of gene expression by inducible promoters can be improved by recruiting more copies of the activation domain, a phenomenon that is universal and independent of the CID used. Example 9 - PRSIM-based CID can be adjusted for splitting activity of chimeric antigen receptors (CARs)
[0655] Regulating CAR activity via chemically induced heterodimerization has previously been shown to be an effective method for modulating CAR function (Wu et al., 2015; Hill et al., 2018). We hypothesize that applying heterodimerized PRSIM components to CAR will promote CAR regulation in a similar manner. The previously described FKBP12:FRB system (Wu et al., 2015) has been used as a comparator for regulating CAR function. To test this, we engineered Jurkat T cells to express PRSIM and FKBP12:FRB-regulated CAR using a lentiviral expression system. Figure 15A In the presence of the rapamycin analog AP2196 (FKBP12:FRB dimer) or cimetvir (PRSIM dimer), activation of the CAR after antigen binding leads to dose-dependent secretion of IL-2. Figure 15B IL-2 expression can be rapidly quantified using an IL-2-specific ELISA (R&D Systems). These systems are designed to promote T cell activation only in the presence of appropriate dimers and upon antigen binding. In PRSIM and FKBP12:FRB-regulated CAR systems, the addition of cimetidine or AP2196, respectively, resulted in dose-dependent activation of CAR-expressing Jurkats cells in the presence of antigen-positive HepG2 cells, as measured by the production of IL-2. Figure 16 Importantly, no activation of any CAR was observed in the presence of antigen-negative A375 cells. Figure 16 While both the FKBP12:FRB and PRSIM systems exhibit dose-dependent activation, the PRSIM system demonstrates more stringent control over CAR activity, as evidenced by lower background IL-2 levels and a larger dynamic range of CAR activation. Figure 16 Both systems exhibited comparable maximum IL-2 expression levels. These data suggest that the PRSIM heterodimerization system can be used for the regulation / modulation of cimetidine-mediated CAR-initiated cell signaling pathways.
[0656] Example 10 - PRSIM-based CID can regulate the gene expression of antibody (MEDI8852).
[0657] In addition to demonstrating gene regulation of two recombinant intracellular proteins (luciferase (Example 7) and NanoLuc-PEST (Example 8)) using PRSIM-based CID, gene expression regulation of secreted antibodies (MEDI8852; SEQ ID NO:205 and SEQ ID NO:206) was also investigated. Constructs encoding HCV NS3 / 4A PR(S139A)-AD and DBD-PRSIM_23 (three tandem copies) based on pHet-Act1-2 and a construct encoding pZFHD1_MEDI8852 were generated. When cells were transfected with these two constructs, the expression was evaluated using the Singleplex Human / NHP IgG Isotyping Kit (Mysos Gell-Hill). Figure 17 The expression of MEDI8852, as measured, showed that it was dose-dependent on cimetidine.
[0658] Example 11 - PRSIM-based CID can regulate protein gene expression via adeno-associated virus.
[0659] Recombinant adeno-associated virus (rAAV) vectors are well-studied platforms for delivering DNA encoding a CID based on PRSIM_23 / HCV NS3 / 4A PR (S139A) into cells for controlled gene therapy. One such application is the regulation of exogenous transgenes delivered to cells together with the PRSIM_23 / HCV NS3 / 4A PR (S139A)-based fractionated transcription factor component described in Example 7, or in separate AAV particles. In the context of the systems described herein, the packaging capacity of AAV limits the size of transgenes that can be delivered in the same AAV vector to approximately 550 bp, or the size of transgenes that can be delivered in separate AAV particles to approximately 3.6 bp.
[0660] To demonstrate the delivery of CID-encoded DNA and the “trans” inducible transgene, two distinct AAV vectors were generated: one encoding a fragmented transcription factor component based on PRSIM_23 / HCV NS3 / 4A PR(S139A), whose expression is driven by a constitutive EF1 / HTLV heterozygous promoter; and a second encoding a firefly luciferase gene controlled by an inducible ZFHD1 promoter. Figure 18A AAV particles were generated from these vectors. After transducing HEK293 cells with two separate AAV8 preparations, we observed a dose-dependent regulation of cimetidine gene expression based on the CID of PRSIM_23 / HCVNS3 / 4A PR (S139A) with the addition of both AAV8 particle preparations, in which luciferase activity was induced 228-fold (…). Figure 18B ).
[0661] To demonstrate that CID and inducible transgenes can be delivered "cis-" , an AAV8 vector encoding a transcription factor component based on PRSIM_23 / HCVNS3 / 4A PR(S139A) and an inducible IL-2 transgene was generated. Figure 18C After transducing HEK293 cells with AAV8 particles generated using this AAV vector, we observed a dose-dependent regulation of cimetidine gene expression on IL-2 based on PRSIM_23 / HCV NS3 / 4A PR (S139A), with the highest observed level being approximately 3500 pg / ml IL-2. Figure 18D The highest concentration of cimetidine-induced IL-2 expression level (3506+ / -817 pg / ml) induced by the CID based on PRSIM_23 / HCV NS3 / 4A PR(S139A) was comparable to that achieved by the control AAV8 vector encoding IL-2 under constitutive CAG promoter control (2606+ / -189 pg / ml). Figure 18E ).
[0662] Therefore, the ability of PRSIM-based CID to control gene expression via AAV transduction was demonstrated using single or dual AAV-based systems.
[0663] Example 12 - PRSIM-based CID can regulate the transcription of endogenous genes.
[0664] It has been demonstrated that PRSIM-based CIDs can regulate transgene expression by fusing to two domains of a split transcription factor; we infer that PRSIM-based CIDs can also regulate endogenous gene expression. The use of chemically induced heterodimerization systems to modulate endogenous gene activity has previously proven to be an effective method for gene regulation (Foight et al., 2019). Therefore, we hypothesize that applying heterodimerized PRSIM components to an activated CRISPR (CRISPRa) system can promote endogenous gene regulation in a similar manner.
[0665] To demonstrate this, the inactive form of the Streptococcus pyogenes Cas9 enzyme (dCas9) and the activation domain (AD) consisting of a fusion of three transcriptional activators (VP64, p65, and Rta; VPR) were fused to two protein components of the CID (three copies of PRSIM_23 and HCVNS3 / 4A PR (S139A), respectively). This ensured that AD only came into close contact with dCas9 in the presence of a small molecule inducer. Co-transfection of the PRSIM-based CID and the guide RNA (gRNA) targeting the interleukin-2 (IL-2) promoter allowed dCas9 to bind to the target site on the IL-2 promoter. Following administration of the PRSIM dimer (cimipvir), AD and the associated transcriptional apparatus were subsequently recruited to the promoter region of the endogenous IL-2 gene, thereby initiating transcription. Figure 19A Therefore, system activation can be measured by IL-2 production and quantified by IL-2-specific cytokine assay (MSD).
[0666] In HEK293 cells transiently expressing PRSIM-regulated fragmented dCas9 / AD boxes and IL-2-targeting gRNA, cimetvir addition led to IL-2 secretion. Figure 19B Importantly, IL-2 was not detected in cells that expressed only a portion of the system (gRNA only or PRISM-dCas9 only) or gRNAs that did not target IL-2.
[0667] These data indicate that the PRSIM heterodimerization system can be used for cimetidine-mediated regulation of endogenous gene expression.
[0668] Example 13 - HCVNS3 / 4APR(S139A):PRSIM_23 and HCVNS3 / 4APR(S139A):PRSIM_57 complex Specific to simipvir
[0669] The formation of the active switch complex has been shown to be dependent on the presence of cimetidine, and we wanted to test the specificity of this interaction relative to alternative small molecule inhibitors of the HCV protease. Several small molecule inhibitors are known to bind to the HCV NS3 / 4A protease and have been approved for human use. A group of such small molecules were evaluated for their ability to induce the formation of a complex between HCV NS3 / 4A PR (S139A) and PRSIM_23 or PRSIM_57. These are gleprevir, popreprevir, telazorevir, asunaprevir, veluprevir, vaniriprevir, nalazorevir, goraprevir, and danoprevir.
[0670] Homogeneous time-resolved fluorescence (HTRF) binding assay was performed. Figure 20 This study aimed to determine the levels of the HCV NS3 / 4A PR(S139A):PRSIM_23 and HCV NS3 / 4A PR(S139A):PRSIM_57 complexes formed when cimetvir is replaced by an alternative HCV PR inhibitor small molecule. We found that the induction of complex formation was specific to cimetvir, as no HCV PR inhibitor can form a complex with either HCV NS3 / 4A PR(S139A) and PRSIM_23, or HCV NS3 / 4A PR(S139A):PRSIM_57.
[0671] This data indicates that the administration of other small molecule HCV NS3 / 4A PR inhibitors, such as in individuals infected with HCV, will not result in the formation of an active HCVNS3 / 4A PR(S139A):PRSIM_23 complex, and that the HCVNS3 / 4A PR(S139A):PRSIM_23 complex exhibits unique specificity for cimetvir.
[0672] The residues in Example 14-HCVNS3 / 4A PR are expected to reduce affinity for cimetidine.
[0673] Cimetvir has a very high affinity for HCV NS3 / 4A PR (Example 3); Figure 3B This could affect the rate at which the complex can dissociate once cimetvir administration is discontinued. Identification of HCV NS3 / 4A PR variants with reduced cimetvir affinity could provide some flexibility in regulating the half-life of the complex, allowing this PRSIM-based CID to be inactivated more rapidly if necessary, such as in the event of an adverse event and when rapid reversal of activity is required.
[0674] To identify mutations on the hepatitis C virus (HCV) protease protein that reduce cimetidine binding, the co-crystal structure of the HCV NS3 / NS4A complex with cimetidine (PDB: 3KEE, resolution: [resolution missing]) was obtained. The HCV NS3 / NS4A:cimepuvir interface was analyzed first. Analysis showed that the HCV NS3 / NS4A:cimepuvir interface consists of 25 HCV residues, of which 6 residues contribute to hydrogen bonding and salt bridge interactions, and 12 are surface-exposed. Figure 21 Residues were selected for detailed mutation analysis based on two criteria: first, residues exposed to solvents were omitted to avoid any negative impact of mutagenesis on the binding of the PRSIM molecule to the complex; second, those exhibiting a predicted free energy change >1 kcal / mol after mutation to alanine were included. Free energy perturbation calculations were then used to predict the relative binding free energies following mutations in the interacting side chains of these residues (H57, K136, S139, and R155). Mutations expected to reduce the affinity of the HCV protease for cimetidine are listed in Table 4. Although FEP+alanine scanning analysis only predicted a relatively small change in the predicted binding free energy of D168, we also experimentally evaluated three mutations (D168A, D168E, and D168Q) at this position due to its published role in anti-cimetidine activity.
[0675] Table 4: Predicted changes in the binding free energy of cimetidine by HCVNS3 / NS4A protease after mutation of key binding residues.
[0676]
[0677]
[0678] Example 15 - Mutations in HCVNS3 / 4A PR affect HCVNS3 / 4A PR (S139A): Cimetidine: PRSIM_23 Formation of the complex
[0679] After identifying a group of mutants expected to reduce the affinity of HCV NS3 / 4A PR for cimetidine, we inferred that if the mutations affected the affinity of HCV NS3 / 4A PR for cimetidine as predicted, this would affect the formation of the HCV NS3 / 4A PR(S139A):cimetidine:PRSIM_23 complex. To assess the effect of these mutations on the formation of the HCV NS3 / 4A PR(S139A):cimetidine:PRSIM_23 complex, we performed homogeneous time-resolved fluorescence (HTRF) binding assays. Figure 22 The amount of complex formed in the presence of increased concentrations of cimetidine was measured in the study.
[0680] We found that mutations at positions R155, H57, and S139 were intolerable and did not result in complex formation. A mutation at position K136 resulted in an HCV PR variant that could form a complex, with the degree of complex formation reaching the same maximum value observed with HCV PR "wt". A mutation at residue D168 was also tolerable, but resulted in a reduced amount of complex formation at equivalent HCV PR concentrations. The increased EC50 observed for cimetvir with respect to the K136N and K136D mutants, as well as all mutants at position D168, indicates varying affinities in the complex for these mutants.
[0681] Example 16 - Some HCVNS3 / 4A PR mutants showed reduced affinity for cimetidine.
[0682] After identifying HCV PR variants capable of forming complexes due to mutations at positions K136 and D168, three mutants (K136D, K136N, and D168E) were selected for further characterization. To assess the impact on cimetidine affinity, the binding kinetics of cimetidine with the HCV NS3 / 4A PR'WT' (S139A) protease and the three mutants were determined using Octet RED384 (Figure 23, Table 5). The K136D mutation had the greatest impact on cimetidine affinity, reducing affinity by approximately 3.5-fold compared to HCV NS3 / 4A PR'WT' (S139A). K136N and D168E resulted in approximately 2-fold reductions in affinity. The changes in affinity were primarily driven by the dissociation rate (kJ / kJ / kE). off The increase is driven by ).
[0683] Table 5: Binding and kinetic constants of cimetidine binding to HCV NS3 / NS4A protease mutants, measured using Octet RED384.
[0684]
[0685] The data is the mean ± sd.
[0686] Example 17 - Effects of cimetidine affinity changes caused by mutations in HCVNS3 / 4A PR (S139A) Formation of the HCVNS3 / 4APR(S139A):cimepvir:PRSIM_23 complex
[0687] To further characterize the three mutant proteases, the effect of cimetidine concentration on the formation of the mutant HCVNS3 / 4A PR(S139A) / PRSIM_23 complex was also evaluated using Biacore 8K. Figure 24A (Table 6). Consistent with the decreased affinity for cimetidine (Table 5), the EC50 of cimetidine in the HCVNS3 / 4A PR K136D / cimetidine / PRSIM_23 complex was reduced. 50It has increased to 131.5 nM, approximately 30 times higher than the wt complex. Compared to the “wt”, the K136N mutation also results in ECG reactivity against cimetidine. 50 Higher, although less effective than the K136D mutation. However, the D168E mutation has almost the same EC50 as the "wt" complex. 50 The values are 3.69 and 4.53 nM, respectively.
[0688] HCV NS3 / 4A PR mutants also bound to PRSIM_23 in the presence or absence of cimetidine using Biacore 8K assays. Figure 24B -E). All protease mutants tested showed similar mild nonspecific binding to PRSIM_23 alone, as previously shown for HCV NS3 / 4A PR'WT'(S139A) (Table 2, Figure 7B Due to the varying affinities of cimetidine and the different effects of mutations on the formation of the HCV NS3 / 4A PR / cimetidine / PRSIM_23 complex ( Figure 24A Different fixed concentrations of cimetvir were used for each HCVNS3 / 4A PR to form a complex on a Biacore chip. The cimetvir concentration for each mutant was determined as the respective EC50 for cimetvir. 50 The affinity of HCV NS3 / 4A PR to PRSIM_23 was 5-6x (Table 6). Complexes containing the mutant HCV NS3 / 4A PR'WT' (S139A) showed lower affinity than the HCV NS3 / 4A PR'WT' (S139A) complex (Table 7). The affinity of HCV NS3 / 4A PR'WT' (S139A) for PRSIM_23 was 5.4 nM ( Figure 24B ), while HCVNS3 / 4A PRK136D ( Figure 24C ) and HCVNS3 / 4A PRK136N ( Figure 24D The affinity of HCVNS3 / 4A PR D168E for PRSIM_23 was reduced by approximately 6-7 times compared to 'wt' (Table 7). The affinity of HCVNS3 / 4A PR D168E for PRSIM_23 was 14.7 nM (…). Figure 24E It has an affinity that is about 3 times lower than that of 'wt' protease.
[0689] Table 6: Cimetidine-induced mutant HCVNS3 / 4A PR / PRSIM_23 binding heterodimerization of cimetidine EC 50 value.
[0690]
[0691] Table 7: Binding and kinetic constants measured for binding of mutant HCV NS3 / 4A PR to PRSIM_23 in the presence of cimetidine.
[0692]
[0693] The data are the mean ± sd, n = 3
[0694] Example 18 - Small molecule inhibitors of HCV PR can bind to HCV PR variants by competing with cimetidine instead of... HCVPR "wt" was used to disrupt the PRSIM_23 complex.
[0695] Having demonstrated the specificity of HCV NS3 / 4A PR(S139A):PRSIM_23 complex formation for cimetidine (Example 13), we further investigated whether our group of small-molecule HCV PR inhibitors could disrupt the HCV NS3 / 4A PR(S139A):cimetidine:PRSIM_23 complex by competitively binding to HCV PR with cimetidine. We found that a subset of these small-molecule inhibitors inhibited HCV NS3 / 4A PR(S139A):PRSIM_23 complex formation when added together with cimetidine in a homogeneous time-resolved fluorescence (HTRF) binding assay. However, no significant complex inhibition was observed when cimetidine was pre-incubated with HCV NS3 / 4A PR(S139A) prior to the addition of the small-molecule inhibitors. Figure 25A ).
[0696] To further characterize the mutation of HCV NS3 / 4A PR, we investigated whether small molecules could disrupt the pre-formed mutant HCV PR:cimipvir:PRSIM_23 complex. With the mutation at position 136, a subset of small molecule inhibitors (asunaprevir, veluprevir, vaniriprevir, goraprevir, danoprevir, and glimepiride) showed more significant inhibition of the mutant HCV PR:cimipvir:PRSIM_23 complex, but this was not observed with other small molecule inhibitors (nalarevir, poprevir, and telaraprevir). Figure 25B The degree of inhibition depends on the specific mutation produced. Although cimetidine has a similar EC80 to HCV PR “wt”, approximately 75% inhibition was observed with K136H. Almost complete inhibition was observed with K136N, and complete inhibition was observed with K136D. Complete inhibition of the HCVNS3 / 4A PR(S139A):cimetidine:PRSIM_23 complex was observed for all HCV PR variants with the mutation at position 168.
[0697] Other small molecule inhibitors (asunaprevir, veluprevir, vaniriprevir, goraprevir, danoprevir, and gliprevir) offer the opportunity to rapidly inactivate any PRSIM-based CID and shut down transgenic expression or therapeutic activity by competing with cimetidine for and disrupting the complex between PRSIM_23 and the HCV NS3 / 4A PR mutant version. Furthermore, the inability of other inhibitors (nalarevir, boprevir, and telaraprevir) to compete with cimetidine for HCV NS3 / 4A PR binding provides an opportunity to develop molecular switches based on orthogonal HCV NS3 / 4A PR induced by these small molecules.
[0698] Example 19 - The HCVNS3 / 4A PR mutant with incorporation of a split transcription factor system retains the regulatory gene expression ability
[0699] To assess the impact of HCV NS3 / 4A PR mutations on gene regulation, we generated a pHet-Act1-2-based construct encoding the HCV NS3 / 4A PR(S139A)-AD mutant and DBD-PRSIM_23 (three tandem copies). Gene expression was assessed after transfection of cells with either these pHet-Act1-2 (HCVNS3 / 4A PR(S139A)-AD mutant & DBD-PRSIM_23 (three tandem copies)) constructs or the “WT” construct (HCVNS3 / 4A PR(S139A)-AD & DBD-PRSIM_23 (three tandem copies)) and the reporter construct pZFHD1_luciferase. The ability to regulate luciferase gene expression in the presence of increased concentrations of cimetvir was determined. All PRSIM HCV NS3 / 4A PR(S139A)-AD mutants showed dose-dependent gene expression of luciferase, although the maximum fold change was slightly reduced and the EC50 was increased compared to “WT” HCV NS3 / 4A PR(S139A)-AD (Figure 26 and Table 8).
[0700] Combined data from Examples 14-19 suggest that, in cases where rapid reversal of CID-based activity is required by administration of a “competitive” small molecule HCV PR inhibitor, CIDs based on PRSIMs containing mutant HCV NS3 / 4A PRs can provide an alternative to CIDs based on HCV NS3 / 4A (S139A) “wt”.
[0701] Table 8: EC50 and fold change values for HCV NS3 / 4A PR variants in split transcription factor assays.
[0702]
[0703] To assess whether the decreased affinity / increased dissociation rate of HCV NS3 / 4A PR(S139A) mutants (K136D, D168E, K136N) affected the rate of gene expression shutdown after cimetidine removal, cell-based assays were performed using live-cell time-course assays. Monoclonal stable cell lines were generated in which the expression of short-lived green fluorescent protein (GFP-PEST, half-life approximately 2 hours) was controlled by a fragmented transcription factor consisting of HCV NS3 / 4A PR(S139A)-AD variants & DBD-PRSIM_23 (three tandem copies). GFP expression was induced by cimetidine treatment for 24 hours, followed by cimetidine removal, and GFP fluorescence was measured at the time points after removal. "WT" S139A maintained high GFP fluorescence after 24 hours. This indicates that once formed in a cimetidine-dependent manner, the transcription factor complex containing HCV NS3 / 4A PR(S139A) remains stable for a long period to drive sustained GFP-PEST expression, without requiring a persistent excess of cimetidine in the culture medium. However, over the same time period, all three mutants (K136D, K136N, D168E) reverted to a native non-expression state within 15–24 hours after cimetidine removal, suggesting that the transcription factor complex formed using the HCV NS3 / 4A PR(S139A)-AD mutant & DBD-PRSIM_23 (three tandem copies) is less stable than that formed using HCV NS3 / 4A PR(S139A)-AD'WT' & DBD-PRSIM_23 (three tandem copies).
[0704] These data suggest that by reducing the affinity of cimetidine for the HCV NS3 / 4A PR mutant, it is possible to alter the kinetics of gene expression, enabling gene expression to be stopped more quickly in a fragmented transcriptional manner compared to using CID based on “wt” HCV NS3 / 4A PR.
[0705] Example 20 - The crystal structure of the cimetidine:PRSIM_57 complex reveals the small molecule Triggered dimerization mechanism
[0706] Cimetvir induces the formation of heterodimers of HCV NS3 / 4A PR(S139A) and the scFv molecule PRSIM_57 by binding to a pocket on the surface of the protease and generating a novel epitope specifically recognized by PRSIM_57. To understand the molecular mechanism behind this heterodimerization event, the crystal structure of the complex between the protease, scFv, and cimetvir was determined. To deduce the structure, both the protease form and the PRSIM_57scFv with a His-cleavable tag from tobacco etch virus (TEV) were expressed separately in BL21(DE3) E. coli. The protein was purified to homogenization using a combination of immobilized metal affinity chromatography and size exclusion chromatography, and the tag was removed by TEV protease treatment. To form the ternary complex, the protease was incubated with excess PRSIM_57 and cimetvir, and the resulting complex was purified from the non-composite material using size exclusion chromatography. Fractions containing the pure complex were combined and concentrated to 12 mg / mL for crystallization assays. The complex was crystallized via droplet vapor diffusion, and X-ray diffraction data were collected from the crystal using a synchrotron X-ray source. The structure was resolved using molecular substitution in the apo form of HCV NS3 / 4A PR (S139A) as a search model.
[0707] All three components of the ternary complex are clearly visible in terms of electron density. Figure 27A Cimetvir binds to HCV NS3 / 4A PR (S139A) in the same posture and via the same previously observed interaction (PDB id 3KEE). This structure suggests that most of the interaction generated by PRSIM_57scFv targets residues directly in the protease, with limited contact with cimetvir. The scFv forms a predominantly hydrophobic pocket around cimetvir (including the side chains of Phe77, Ile74, Ile125, and Trp249), clamping it to either side and binding to the protease. Binding is dominated by the scFv complementarity-determining region (CDR) loops HCDR2, HCDR3, and LCDR3.
[0708] The following interactions can be identified between PRSIM_57 and HCVNS3 / 4A PR(S139A). Figure 27BThe interactions between the side-chain carboxyl groups of Asp94 (HCVNS3 / 4A PR) and the main-chain nitrogen atoms of Ile125 and Thr126 (PRSIM_57), as well as the side-chain hydroxyl groups of Thr126, are as follows: 1) The side-chain carboxyl groups of Tyr71 (HCV NS3 / 4A PR) interact with the side chains of His251 and Trp249 (PRSIM_57). 3) Hydrophobic interactions occur between the side chains of Val93 (HCVNS3 / 4A PR) and Trp249 (PRSIM_57). 4) Water-mediated interactions occur between Glu254 (PRSIM_57) and the main-chain nitrogen atoms of Gly75 and Thr76 (HCV NS3 / 4A PR). The primary interaction between PRSIM_57 and cimetvir is the interaction between the quinoline moiety of cimetvir and the side chain of Phe77 in HCDR2 (PRSIM_57).
[0709] Example 21 - PRSIM-based CID can modulate the activity of apoptosis proteins to control cell death.
[0710] Once therapeutic cells are administered, the ability to "remotely control" them provides a safety net in case of uncontrolled proliferation or adverse events. One way to control these cells is to endow them with so-called "kill switches," so that they can be removed at will once they have completed their function or posed a safety risk. Therefore, a PRSIM-based, cimetidine-responsive cysteine 9-based kill switch was generated and tested in vitro. The homodimerized CARD domain of cysteine 9 was replaced by PRSIM23 and HCV NS3 / 4A PR(S139A) domains separated by short linkers. Thus, the active cysteine 9 homodimer could only be reconstituted by adding cimetidine (Figure 28). Addition of cimetidine to HEK293, HCT116, and HT29 cells stably transduced with the PRSIM-based kill switch construct resulted in rapid cell death upon microscopic examination of the cells after the addition of 100 nM cimetidine. Figure 29A (B) Active caspase 9 activates downstream caspase 3 via proteolytic cleavage. Caspase 3 activity is detected by cleavage with the fluorescent substrate Ac-DEVD-AMC. Figure 29C ). Caspase 3 activity in cimipvir-treated HEK293 cells transduced with a kill switch ( Figure 29D ) or kill switch transduced human tumor cell lines HCT116 and HT29 ( Figure 29E The expression was significantly upregulated (p<0.0001) in the study.
[0711] To demonstrate that the PRSIM-based kill switch can eliminate treatment-relevant cells, stable cell lines were prepared in embryonic stem (ES) cells and induced pluripotent stem cells (iPSCs). In ES cells, a dose-response to cimetidine was observed, with high doses of cimetidine (1 μM) rapidly and effectively eliminating up to 95% of cells within 4 hours, as measured by cell confluence, where this effect began at approximately 15 minutes. Figure 30 Lower doses delayed the initiation of cell killing; 100 nM cimetvir induced approximately 90% cell killing within 4 hours, while at 10 nM, maximum cell killing was not reached within 4 hours in the experiment. In contrast, wt Sa121 cells did not respond to cimetvir treatment.
[0712] To demonstrate the effectiveness of the PRSIM-based killer switch in iPSC cells, four separate iPSC clones were generated, each representing a biallelic expression of the PRSIM-based killer switch at the B2M locus. These cells were incubated with parental iPSC cells along with 1 nM cimetidine, and cell proliferation index was measured over time using xCELLigence RTCA Software Pro (ACEA Biosciences). All cell clones encoding the PRSIM-based killer switch showed a significant decrease in cell proliferation index after 5 hours, which remained constant throughout the experiment (approximately 60 hours after cimetidine addition), while the parental cells continued to proliferate.
[0713] These data demonstrate that PRSIM-based kill switches can effectively eliminate a wide range of cell types in vitro and provide a means for the rapid removal of therapeutic cells from patients.
[0714] Caspase 9 can be inactivated by Akt kinase-mediated phosphorylation of Ser196. This introduces the risk of "escaping" caspase 9-mediated apoptosis in cells that have already undergone Ser196 phosphorylation on the caspase 9 fusion protein. To mitigate this risk, a stable HEK cell line was generated that encodes a PRSIM-based killer switch fusion protein containing a Ser196-to-Ala substitution. Addition of 100 nM cimetidine to the killer switch S196A cells showed rapid cell killing within a timeframe comparable to that of the wt killer switch. Figure 32A Compared with untransduced cells, the activity of downstream caspase 3 was significantly upregulated in both wt and S196A mutant killer switch cells (p<0.0005); no significant difference was detected between wt and S196A killer switch cells in the same assay. Figure 32BThis indicates that the S196A version of the PRSIM-based kill switch fusion protein is as active as the kill switch based on wild-type caspase 9 and can be used as a mechanism to prevent Akt-mediated cell escape mechanisms.
[0715] References
[0716] The foregoing has cited numerous publications to provide a more comprehensive description of this disclosure and the state of the prior art to which it relates. Full citations of these references are provided below. Each of these references is incorporated herein by reference in its entirety.
[0717] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. 'Basic local alignment search tool'. J. Mol. Biol. 215(3), 403-10.
[0718] Banaszynski, LA, CWLiu, and TJWandless. 2005. 'Characterization of the FKBP.rapamycin.FRB ternary complex', J Am Chem Soc, 127: 4715-21.
[0719] Bartenschlager R,Ahlborn-Laake L,Mous J,Jacobsen H.1993'Nonstructuralprotein 3of the hepatitis C virus encodes a serine-type proteinase required for cleavage at the NS3 / 4and NS4 / 5junctions'.J Virol.; 67(7):3835-3844
[0720] Belshaw,PJ,SN Ho,GR Crabtree,and SL Schreiber.1996.'Controllingprotein association and subcellular localization with a synthetic ligand thatinduces heterodimerization ofproteins',Proceedings ofthe NationalAcademyofSciences,93:4604-07.
[0721] Belshaw, PJ, DMSpencer, GRCrabtree, and SLSchreiber.1996.'Controlling programmed cell death with a cyclophilin-cyclosporine-basedchemical inducer of dimerization',Chem Biol,3:731-8.
[0722] Chavez A,Scheiman J,Vora S,Pruitt BW,Tuttle M,PR Iyer E,Lin S,KianiS,Guzman CD,Wiegand DJ,Ter-Ovanesyan D,Braff JL,Davidsohn N,Housden BE,Perrimon N,Weiss R,Aach J,Collins JJ,Church G.Nat.Mathods.,12(4):326-8
[0723] Chelur DS,Chalfie M.2007.'Targeted cell killing by reconstitutedcaspases.'Proc.Natl.Acad.Sci.USA,104(7):2283-8
[0724] Colella P,Ronzitti G,Mingozzi F.2017.'Emerging Issues in AAV-MediatedIn Vivo Gene Therapy.'Mol Ther Methods Clin Dev.,8:87-104
[0725] De Clercq E.2014.‘Current race in the development of DAAs(direct-acting antivirals)against HCV.’Biochem.Pharmacol.,89(4):441-52
[0726] Dixon AS,Schwinn MK,Hall MP,Zimmerman K,Otto P,Lubben TH,Butler BL,Binkowski BF,Machleidt T,Kirkland TA,Wood MG,Eggers CT,Encell LP,WoodKV.2016.‘NanoLuc Complementation Reporter Optimized for Accurate Measurementof Protein Interactions in Cells.’ACS Chem.Biol.,11(2):400-8
[0727] Eckart,M.R.M.Selby,F.Masiarz,C.Lee,K.Berger,K.Crawford,C.Kuo,G.Kuo,M.Houghton,Q.L.Choo.1993‘The Hepatitis C Virus Encodes a Serine ProteaseInvolved in Processing of the Putative Nonstructural Proteins from the ViralPolyprotein Precursor’,Biochemical and Biophysical Research Communications,Volume 192,Issue 2,1993,Pages 399-406
[0728] Foight GW,Wang Z,Wei CT,et al.Multi-input chemical control of proteindimerization for programming graded cellular responses.Nat Biotechnol.2019;37(10):1209-1216.doi:10.1038 / s41587-019-0242-8
[0729] Gargett T,Brown MP.2014.‘The inducible caspase-9 suicide gene systemas a“safety switch”to limit on-target,off-tumor toxicities of chimericantigen receptor T cells.’FrontPharmacol.,5:235.
[0730] Gilbreth,R.N.,B.M.Chacko,L.Grinberg,J.S.Swers,and M.Baca.2014.‘Stabilization of the third fibronectin type III domain of human tenascin-Cthrough minimal mutation and rational design’,Protein Eng Des Sel,27:411-8.
[0731] Grakoui A,McCourt DW,Wychowski C,Feinstone SM,Rice CM.1993‘Characterization ofthe hepatitis C virus-encoded serine proteinase:determination ofproteinase-dependentpolyprotein cleavage sites.’J Virol.,67(5):2832-2843)
[0732] Hijikata M,Mizushima H,Akagi T,et al.1993‘Two distinct proteinaseactivities required for the processing ofa putative nonstructural precursorprotein ofhepatitis C virus.’J Virol.;67(8):4665-4675.
[0733] Hill,Z.B.,A.J.Martinko,D.P.Nguyen,and J.A.Wells.2018.‘Human antibody-based chemically induced dimerizers for cell therapeutic applications’,NatChem Biol,14:112-17.
[0734] Kotterman MA&Schaffer DV.2014.‘Engineering adeno-associated virusesfor clinical gene therapy.’Nat.Rev.Genet.15(7):445-51.
[0735] Leahy,D.J.,W.A.Hendrickson,I.Aukhil,and H.P.Erickson.1992.‘Structureofa fibronectin type III domain from tenascin phased by MAD analysis oftheselenomethionyl protein’,Science,258:987-91.
[0736] Li J,Abel R,Zhu K,Cao Y,Zhao S,Friesner RA.The VSGB 2.0model:a nextgeneration energy model for high resolution protein structuremodeling.Proteins.2011;79(10):2794-2812.
[0737] Li,Kui,Eileen Foy,Josephine C.Ferreon,Mitsuyasu Nakamura,AllanC.M.Ferreon,Masanori Ikeda,Stuart C.Ray,Michael Gale,and StanleyM.Lemon.2005.‘Immune evasion by hepatitis C virus NS3 / 4A protease-mediatedcleavage of the Toll-like receptor 3 adaptor protein TRIF’,Proceedings of theNational Academy ofSciences of the United States ofAmerica,102:2992-97.
[0738] Li,Xiao-Dong,Lijun Sun,Rashu B.Seth,Gabriel Pineda,and ZhijianJ.Chen.2005.‘Hepatitis C virus protease NS3 / 4A cleaves mitochondrialantiviral signaling protein off the mitochondria to evade innate immunity’,Proceedings ofthe NationalAcademy ofSciences ofthe UnitedStates ofAmerica,102:17717-22.
[0739] Lv Z,Chu Y,Wang Y.2015.‘HIV protease inhibitors:a review of molecularselectivity and toxicity.’HIVAIDS(Auckl).,7:95-104
[0740] Moraca,F.,Negri,A.,de Oliveira,C.&Abel,R.Application ofFree EnergyPerturbation(FEP+)to Understanding Ligand Selectivity:A Case Study to AssessSelectivity Between Pairs ofPhosphodiesterases(PDE's).J Chem InfModel 59,2729-2740(2019).
[0741] Naso MF,Tomkowicz B,Perry WL 3rd,Strohl WR.2017‘Adeno-AssociatedVirus(AAV)as a Vector for Gene Therapy.’BioDrugs,31(4):317-334
[0742] Oganesyan,V.,A.Ferguson,L.Grinberg,L.Wang,S.Phipps,B.Chacko,S.Drabic,T.Thisted,and M.Baca.2013.‘Fibronectin type III domains engineered to bindCD40L:cloning,expression,purification,crystallization and preliminary X-raydiffraction analysis of two complexes’,Acta Crystallogr Sect F Struct BiolCryst Commun,69:1045-8.
[0743] Osbourn,J.K.,A.Field,J.Wilton,E.Derbyshire,J.C.Earnshaw,P.T.Jones,D.Allen,and J.McCafferty.1996.‘Generation of a panel of related human scFvantibodies with high affinities for human CEA’,Immunotechnology,2:181-96.
[0744] Patick AK,Potts KE.1998.‘Protease inhibitors as antiviral agents.’Clin.Microbiol.Rev.,11(4):614-27
[0745] Pomerantz JL,Sharp PA,Pabo CO.1995.‘Structure-based design oftranscription factors.’Science.267(5194):93-6
[0746] Sabariegos,Rosario,Fernando Picazo,Beatriz Domingo,Sandra Franco,Miguel-Angel Martinez,and Juan Llopis.2009.‘Fluorescence Resonance EnergyTransfer-Based Assay for Characterization ofHepatitis C Virus NS3-4A ProteaseActivity in Live Cells’,Antimicrobial Agents and Chemotherapy,53:728-34.
[0747] Sabers,C.J.,M.M.Martin,G.J.Brunn,J.M.Williams,F.J.Dumont,G.Wiederrecht,and R.T.Abraham.1995.‘Isolation ofa protein target of theFKBP12-rapamycin complex in mammalian cells’,J Biol Chem,270:815-22.
[0748] Sadelain M,Brentjens R,Rivière I.2013‘The basic principles ofchimeric antigen receptor design.’CancerDiscov.,3(4):388-98
[0749] Sastry,G.M.,Adzhigirey,M.,Day,T.,Annabhimoju,R.&Sherman,W.Protein andligand preparation:parameters,protocols,and influence on virtual screeningenrichments.J Comput Aided Mol Des 27,221-234(2013).
[0750] Smith-Garvin,J.E.,G.A.Koretzky,and M.S.Jordan.2009.‘T cellactivation’,Annu RevImmunol,27:591-619.
[0751] Srivastava A.2016.‘In vivo tissue-tropism ofadeno-associated viralvectors.’Curr.Opin.Virol.21:75-80
[0752] Stanton,B.Z.,E.J.Chory,and G.R.Crabtree.2018.‘Chemically inducedproximity in biology and medicine’,Science,359.
[0753] Stempniak M,Hostomska Z,Nodes BR,Hostomsky Z.1997‘The NS3 proteinasedomain ofhepatitis C virus is a zinc-containing enzyme.’J Virol.,71(4):2881-2886.
[0754] Swers, J.S., L. Grinberg, L. Wang, H. Feng, K. Lekstrom, R. Carrasco, Z. Xiao, I. Inigo, C.C. Leow, H. Wu, D.A. Tice, and M. Baca. 2013. ‘Multivalent scaffold proteins as superagonists of TRAIL receptor 2-induced apoptosis’, Mol Cancer Ther, 12:1235-44.
[0755] Vaughan, T.J., A.J. Williams, K. Pritchard, J.K. Osbourn, A.R. Pope, J.C. Earnshaw, J. McCafferty, R.A. Hodits, J. Wilton, and K.S. Johnson. 1996. ‘Human antibodies with sub-nanomolar affinities isolated from a large non-immunized phage display library’, Nat Biotechnol, 14:309-14.
[0756] Wu, C.Y., K.T. Roybal, E.M. Puchner, J. Onuffer, and W.A. Lim. 2015. ‘Remote control of therapeutic T cells through a small molecule-gated chimeric receptor’, Science, 350:aab4077.
[0757] For standard molecular biology techniques, see Sambrook, J., Russel, D.W. Molecular Cloning, A Laboratory Manual, 3 ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press sequence
[0758]
[0759]
[0760]
[0761]
[0762]
[0763]
[0764]
[0765]
[0766]
[0767]
[0768]
[0769]
[0770]
[0771]
[0772]
[0773]
[0774]
[0775]
[0776]
[0777]
[0778]
[0779]
[0780]
[0781]
[0782]
[0783]
[0784]
[0785]
[0786]
[0787]
[0788]
[0789]
[0790]
[0791]
[0792]
[0793]
[0794]
[0795]
[0796]
[0797]
[0798]
[0799]
[0800]
[0801]
[0802]
[0803]
[0804]
[0805]
[0806]
[0807]
Claims
1. One or more expression vectors comprising: i) a first expression cassette encoding a target protein, wherein the target protein is capable of binding a small molecule to form a complex between the target protein and the small molecule (T-SM complex); and ii) a second expression cassette encoding a binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone and the small molecule alone, wherein the target protein is derived from a non-human protein and the small molecule is an inhibitor of the non-human protein, wherein the target protein is derived from a viral protease and the small molecule inhibitor is a viral protease inhibitor; wherein the viral protease is HCV NS3 / 4A protease; wherein the small molecule is simeprevir; and wherein the binding member is a Tn3 protein or a single chain variable fragment (scFv).
2. The one or more expression vectors of claim 1, wherein the target protein consists of the amino acid sequence of SEQ ID NO:
1.
3. The one or more expression vectors of claim 1, wherein the target protein has attenuated protease activity compared to the protein from which it is derived.
4. The one or more expression vectors of claim 3, wherein the target protein comprises one or more amino acid mutations compared to the protein from which it is derived, wherein the one or more amino acid mutations attenuate the protease activity of the target protein.
5. The one or more expression vectors of claim 4, wherein the target protein comprises an amino acid mutation at one or more amino acids selected from position 72, 96, 112, 114, 154, 160, and 164 compared to SEQ ID NO: 1, wherein amino acid numbering corresponds to SEQ ID NO:
1.
6. The one or more expression vectors of claim 5, wherein the target protein comprises an amino acid mutation at position 154.
7. The one or more expression vectors of claim 6, wherein the amino acid mutation at position 154 is a mutation to alanine.
8. The one or more expression vectors of claim 1 or 2, wherein the target protein consists of the amino acid sequence set forth in SEQ ID NO:
2.
9. The one or more expression vectors of claim 1 or 2, wherein the target protein comprises an affinity-reducing amino acid mutation at one or more amino acids selected from position 151 and 183 compared to SEQ ID NO: 1, wherein amino acid numbering corresponds to SEQ ID NO:
1.
10. The one or more expression vectors of claim 9, wherein the amino acid mutation at position 151 is a mutation to aspartic acid, asparagine, or histidine and the amino acid mutation at position 183 is a mutation to glutamic acid, glutamine, or alanine.
11. The one or more expression vectors of claim 1 or 2, wherein the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone and / or the small molecule alone: i) at least 10-fold; ii) at least 50-fold; iii) at least 100-fold; or iv) at least 1000-fold. iii) at least 100-fold; or iv) at least 1000-fold.
12. One or more expression vectors as claimed in claim 1 or 2, wherein the binding member has the following K D The affinity of the K value binds to the target protein or the small molecule. D Value higher than i) 500 nM; ii) 1 mM; iii) 10 mM; iv) 100 mM; or v) 1 mM.
13. The one or more expression vectors of claim 12, wherein affinity is measured using surface plasmon resonance.
14. The one or more expression vectors of claim 1 or 2, wherein the binding member does not exhibit significant binding to the target protein alone and / or to the small molecule alone, or wherein the binding member does not exhibit binding or does not exhibit detectable binding to the target protein alone and / or to the small molecule alone.
15. The one or more expression vectors of claim 1 or 2, wherein the binding member specifically binds the T-SM complex at an epitope that is only present on the T-SM complex and is not present on the target protein alone or the small molecule alone.
16. The one or more expression vectors of claim 1 or 2, wherein formation of the T-SM complex induces a conformational change in the target protein resulting in formation of an epitope that is specifically bound by the binding member.
17. One or more expression vectors as claimed in claim 1 or 2, wherein the binding member has the following K D The affinity of the K-SM complex binds to the K-SM complex. D Value lower than i) 50 nM; ii) 25 nM; iii) 20 nM; iv) 15 nM; or v) 10 nM.
18. The one or more expression vectors of claim 17, wherein affinity is measured using surface plasmon resonance.
19. The one or more expression vectors of claim 1 or 2, wherein the binding member is a Tn3 protein.
20. The one or more expression vectors of claim 19, wherein the Tn3 protein comprises BC, DE, and FG loops of: i) PRSIM_23, set forth in SEQ ID NOs: 136, 137, and 138, respectively; ii) PRSIM_32, set forth in SEQ ID NOs: 139, 140, and 141, respectively; iii) PRSIM_33, set forth in SEQ ID NOs: 142, 143, and 144, respectively; iv) PRSIM_36, set forth in SEQ ID NOs: 145, 146, and 147, respectively; or v) PRSIM_47, set forth in SEQ ID NOs: 148, 149, and 150, respectively.
21. The one or more expression vectors of claim 20, wherein the Tn3 comprises an amino acid sequence of: i) PRSIM_23 set forth in SEQ ID NO: 5; ii) PRSIM_32 set forth in SEQ ID NO: 6; iii) PRSIM_33 set forth in SEQ ID NO: 7; iv) PRSIM_36 set forth in SEQ ID NO: 8; or v) PRSIM_47 set forth in SEQ ID NO:
9.
22. The one or more expression vectors of claim 21, wherein the Tn3 consists of the amino acid sequence of PRSIM_23 set forth in SEQ ID NO:
5.
23. The one or more expression vectors of claim 1 or 2, wherein the binding member is a single-chain variable fragment (scFv).
24. One or more expression vectors as claimed in claim 23, wherein the scFv comprises heavy chain complementarity-determining regions (HCDRs) 1 to 3 and light chain complementarity-determining regions (LCDRs) 1 to 3 of the following: i)PRSIM_57, as shown in SEQ ID NO:151, 152, 153, 154, 155 and 156 respectively; ii) PRSIM_01, as shown in SEQ ID NO:151, 152, 198, 154, 155 and 156 respectively; iii) PRSIM_04, as shown in SEQ ID NO:151, 152, 163, 154, 155 and 164 respectively; iv)PRSIM_67, as shown in SEQ ID NO:165, 166, 167, 168, 169 and 170 respectively; v)PRSIM_72, as shown in SEQ ID NO:171, 172, 173, 174, 175 and 176 respectively; or vi) PRSIM_75, as shown in SEQ ID NO:177, 178, 179, 180, 181 and 182 respectively. These CDR sequences are defined according to the Kabat numbering scheme.
25. One or more expression vectors as claimed in claim 24, wherein the scFv comprises the following amino acid sequence: i) PRSIM_57 as shown in SEQ ID NO:12; ii) PRSIM_01 as shown in SEQ ID NO:10; iii) PRSIM_04 as shown in SEQ ID NO:11; iv) PRSIM_67 as shown in SEQ ID NO:13; v) PRSIM_72 as shown in SEQ ID NO:14; or vi) PRSIM_75 as shown in SEQ ID NO:
15.
26. One or more expression vectors as claimed in claim 24, wherein the scFv consists of the amino acid sequence of PRSIM_57 as shown in SEQ ID NO:
12.
27. One or more expression vectors as described in claim 1 or 2, wherein The target protein fuses with the first component polypeptide; and The binding member fuses with the second component polypeptide.
28. One or more expression vectors as claimed in claim 27, wherein the one or more expression vectors encode dimerization-inducible proteins.
29. One or more expression vectors as described in claim 28, wherein (1) The first component polypeptide contains a DNA-binding domain and fuses with the target protein to form a DBD-T fusion protein; and The second component polypeptide contains a transcriptional regulatory domain and fuses with this binding member to form a TRD-BM fusion protein, or (2) The first component polypeptide contains a transcriptional regulatory domain and fuses with the target protein to form a TRD-T fusion protein; and The second component polypeptide contains a DNA-binding domain and fuses with this binding member to form the DBD-BM fusion protein. The first and second component polypeptides form transcription factors after dimerization.
30. The one or more expression vectors of claim 29, wherein the transcriptional regulatory domain is a transcriptional activation domain, or wherein the transcriptional regulatory domain is a transcriptional inhibition domain.
31. The one or more expression vectors of claim 29, further comprising a third expression cassette, wherein the third expression cassette encodes a desired expression product, wherein the DNA binding domain binds to a target sequence in the third expression cassette, enabling the transcription factor to regulate expression of the desired expression product.
32. The one or more expression vectors of claim 31, wherein the target sequence is in a promoter operably linked to a coding sequence of the desired expression product.
33. The one or more expression vectors of claim 32, wherein the desired expression product is a therapeutic protein.
34. The one or more expression vectors of claim 33, wherein the therapeutic protein is a therapeutic antibody.
35. The one or more expression vectors of claim 29, wherein the DBD-T fusion protein comprises a DNA binding domain fused to two or more target proteins; or the DBD-BM fusion protein comprises a DNA binding domain fused to two or more binding members.
36. The one or more expression vectors of claim 28, wherein (1) the first component polypeptide comprises a first costimulatory domain and is fused to the target protein; and the second component polypeptide comprises an intracellular signaling domain and is fused to the binding member, or (2) the first component polypeptide comprises an intracellular signaling domain and is fused to the target protein; and the second component polypeptide comprises a first costimulatory domain and is fused to the binding member.
37. The one or more expression vectors of claim 36, wherein in (1), the first component polypeptide further comprises an antigen-specific recognition domain and a transmembrane domain; and the second component polypeptide further comprises a transmembrane domain and a second costimulatory domain, wherein the first and second component polypeptides form a chimeric antigen receptor (CAR) upon dimerization.
38. The one or more expression vectors of claim 37, wherein the target protein is fused to the C-terminus of the first costimulatory domain; and / or the binding member is fused to the C-terminus of the second costimulatory domain.
39. The one or more expression vectors of claim 36, wherein in (2), the first component polypeptide further comprises a transmembrane domain and a second costimulatory domain; and the second component polypeptide further comprises an antigen-specific recognition domain and a transmembrane domain, wherein the first and second component polypeptides form a chimeric antigen receptor (CAR) upon dimerization.
40. The one or more expression vectors of claim 39, wherein the binding member is fused to the C-terminus of the first costimulatory domain; and / or the target protein is fused to the C-terminus of the second costimulatory domain.
41. The one or more expression vectors of claim 37, wherein the first component polypeptide fused to the target protein consists of the amino acid sequence set forth in SEQ ID NO: 70; and 42. The one or more expression vectors of claim 39, wherein the second component polypeptide fused to the binding member consists of the amino acid sequence set forth in SEQ ID NO:
71. The second component polypeptide fused to the binding member consists of the amino acid sequence set forth in SEQ ID NO:
200.
42. The one or more expression vectors of claim 41, wherein the antigen-specific recognition domain is located at the N-terminus of the amino acid sequence set forth in SEQ ID NO:
70.
43. The one or more expression vectors of claim 28, wherein the first component polypeptide comprises a first caspase component; and the second component polypeptide comprises a second caspase component, and wherein the first and second component polypeptides form a caspase upon dimerization.
44. The one or more expression vectors of claim 43, wherein the first and second caspase components comprise a caspase 9 activation domain.
45. The one or more expression vectors of claim 43, wherein the first and second caspase components are identical.
46. The one or more expression vectors of claim 31, wherein (1) the first and second expression cassettes are located on the same expression vector; or (2) the first expression cassette is located on a first expression vector and the second expression cassette is located on a second expression vector.
47. The one or more expression vectors of claim 46, wherein in (1), the third expression cassette is located on the same expression vector or on separate expression vectors.
48. The one or more expression vectors of claim 46, wherein in (2), the third expression cassette is located on the first expression vector or the second expression vector or on a third expression vector.
49. The one or more expression vectors of claim 1 or 2, wherein each of the one or more expression vectors is a DNA plasmid.
50. The one or more expression vectors of claim 1 or 2, wherein each of the one or more expression vectors is a viral vector.
51. The one or more expression vectors of claim 50, wherein the viral vector is selected from the list consisting of: an adeno-associated virus (AAV) vector, an adenovirus vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, an alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease virus vector, a poxvirus vector, and a picornavirus vector.
52. The one or more expression vectors of claim 51, wherein the viral vector is an AAV vector.
53. A method of producing viral particles in vitro, the method comprising: transfecting host cells with one or more viral vectors of any one of claims 50-52 and expressing in the host cells viral proteins necessary for viral particle formation; and culturing the transfected cells in a culture medium such that the cells produce viral particles.
54. The method of claim 53, further comprising isolating the viral particles from the culture medium.
55. The method of claim 54, further comprising concentrating the viral particles.
56. A dimerization-inducible protein, comprising: a first component polypeptide fused to a target protein; and a second component polypeptide fused to a binding member, wherein the target protein is capable of binding a small molecule to form a complex between the target protein and the small molecule (T-SM complex), wherein the binding member specifically binds to the T-SM complex such that the binding member binds to the T-SM complex with a higher affinity than the binding member binds to the target protein alone and / or the small molecule alone, and wherein the target protein is derived from a non-human protein and the small molecule is an inhibitor of the non-human protein, wherein the non-human protein is a viral protease and the small molecule is a viral protease inhibitor, wherein the viral protease is HCV NS3 / 4A protease, wherein the small molecule is simeprevir; and wherein the binding member is a Tn3 protein or a single chain variable fragment (scFv).
57. The dimerization-inducible protein of claim 56, wherein the viral protease consists of the amino acid sequence of SEQ ID NO:
2.
58. The dimerization-inducible protein of claim 56, wherein the target protein consists of the amino acid sequence set forth in SEQ ID NO: 1, or wherein the target protein comprises an amino acid mutation at one or more amino acids selected from positions 151 and 183 as compared to SEQ ID NO: 1, wherein amino acid numbering corresponds to SEQ ID NO:
1.
59. The dimerization-inducible protein of any one of claims 56-58, wherein the (1) the first component polypeptide comprises a DNA binding domain and is fused to the target protein to form a DBD-T fusion protein; and the second component polypeptide comprises a transcriptional regulatory domain and is fused to the binding member to form a TRD-BM fusion protein, or (2) the first component polypeptide comprises a transcriptional regulatory domain and is fused to the target protein to form a TRD-T fusion protein; and the second component polypeptide comprises a DNA binding domain and is fused to the binding member to form a DBD-BM fusion protein, wherein the first component polypeptide and second component polypeptide form a transcription factor upon dimerization.
60. The dimerization-inducible protein of claim 59, wherein the DBD-T fusion protein comprises a DNA binding domain fused to two or more target proteins; or the DBD-BM fusion protein comprises a DNA binding domain fused to two or more binding members.
61. The dimerization-inducible protein of claim 59, wherein the DBD-T fusion protein consists of the amino acid sequence set forth in SEQ ID NO: 45; the TRD-BM fusion protein consists of the amino acid sequence set forth in any one of SEQ ID NOs: 57-67; the DBD-BM fusion protein consists of the amino acid sequence set forth in any one of SEQ ID NOs: 46-56; and / or the TRD-T fusion protein consists of the amino acid sequence set forth in any one of SEQ ID NO:
44.
62. The dimerization-inducible protein of any one of claims 56-58, wherein (1) the first component polypeptide comprises a first costimulatory domain and is fused to the target protein; and the second component polypeptide comprises a second costimulatory domain and is fused to the binding member. the second component polypeptide comprises an intracellular signaling domain and is fused to the binding member, or (2) the first component polypeptide comprises an intracellular signaling domain and is fused to the target protein; and the second component polypeptide comprises a first costimulatory domain and is fused to the binding member.
63. The dimerization-inducible protein of claim 62, wherein in (1), the first component polypeptide further comprises an antigen-specific recognition domain and a transmembrane domain; and the second component polypeptide further comprises a transmembrane domain and a second costimulatory domain, and wherein the first and second component polypeptides form a chimeric antigen receptor (CAR) upon dimerization.
64. The dimerization-inducible protein of claim 63, wherein the target protein is fused to the C-terminus of the first costimulatory domain; and / or the binding member is fused to the C-terminus of the second costimulatory domain.
65. The dimerization-inducible protein of claim 62, wherein in (2), the first component polypeptide further comprises a transmembrane domain and a second costimulatory domain; and the second component polypeptide further comprises an antigen-specific recognition domain and a transmembrane domain, and wherein the first and second component polypeptides form a chimeric antigen receptor (CAR) upon dimerization.
66. The dimerization-inducible protein of claim 65, wherein the binding member is fused to the C-terminus of the first costimulatory domain; and / or the target protein is fused to the C-terminus of the second costimulatory domain.
67. The dimerization-inducible protein of claim 63, wherein the first component polypeptide fused to the target protein consists of the amino acid sequence set forth in SEQ ID NO: 70; and the second component polypeptide fused to the binding member consists of the amino acid sequence set forth in SEQ ID NO:
200.
68. The dimerization-inducible protein of claim 67, wherein the antigen-specific recognition domain is at the N-terminus of the amino acid sequence set forth in SEQ ID NO:
70.
69. The dimerization-inducible protein of any one of claims 56-58, wherein the first component polypeptide comprises a first caspase component; and the second component polypeptide comprises a second caspase component, and wherein the first component polypeptide and second component polypeptide form a caspase upon dimerization.
70. The dimerization-inducible protein of claim 69, wherein the first and second caspase components comprise a caspase 9 activation domain.
71. The dimerization-inducible protein of claim 69, wherein the first and second caspase components are identical.
72. A cell expressing the dimerization-inducible protein of any one of claims 56-71, wherein the cell is not an embryonic stem cell.
73. The cell of claim 72, wherein the cell is a stem cell or an immune cell.
74. A method of genetically modifying a cell to produce the cell of claim 72 or 73, the method comprising administering to the cell one or more expression vectors of any one of claims 27-45, wherein the method is in vitro or ex vivo.
75. One or more viral particles comprising: i) a first expression cassette encoding a target protein, wherein the target protein is capable of binding a small molecule to form a complex between the target protein and the small molecule (T-SM complex); and ii) a second expression cassette encoding a binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone and / or the small molecule alone, wherein the target protein is derived from a non-human protein and the small molecule is an inhibitor of the non-human protein, wherein the non-human protein is derived from a viral protease and the small molecule is a viral protease inhibitor, wherein the viral protease is an HCV NS3 / 4A protease; wherein the small molecule is simeprevir; wherein the binding member is a Tn3 protein or a single-chain variable fragment (scFv) and wherein the first and second expression cassettes form part of a viral genome in the one or more viral particles.
76. The one or more viral particles of claim 75, wherein the viral particle is an AAV particle.
77. The one or more viral particles of claim 75, wherein the first and second expression cassettes form part of the same viral genome, or wherein the first expression cassette forms part of a first viral genome in a first viral particle and the second expression cassette forms part of a second viral genome in a second viral particle.
78. The one or more viral particles of any one of claims 75-77, wherein the viral protease consists of the amino acid sequence of SEQ ID NO: 1, and wherein the target protein consists of the amino acid sequence set forth in SEQ ID NO:
2.
79. The one or more viral particles of any one of claims 75-77, wherein the target protein is fused to a first component polypeptide; and the binding member is fused to a second component polypeptide, and wherein the one or more expression vectors encode dimerization-induced proteins.
80. The one or more viral particles of claim 79, wherein (1) the first component polypeptide comprises a DNA-binding domain and is fused to the target protein to form a DBD-T fusion protein; and the second component polypeptide comprises a transcriptional regulatory domain and is fused to the binding member to form a TRD-BM fusion protein, or (2) the first component polypeptide comprises a transcriptional regulatory domain and is fused to the target protein to form a TRD-T fusion protein; and the second component polypeptide comprises a DNA-binding domain and is fused to the binding member to form a DBD-BM fusion protein, wherein the first and second component polypeptides form a transcription factor upon dimerization.
81. The one or more viral particles of claim 80, further comprising a third expression cassette, wherein the third expression cassette encodes a desired expression product, wherein the DNA binding domain binds to a target sequence in the third expression cassette, enabling the transcription factor to modulate expression of the desired expression product.
82. The one or more viral particles of claim 81, wherein the third expression cassette forms part of the same viral genome as the first and / or second expression cassette, or wherein the third expression cassette forms part of a third viral genome in a third viral particle.
83. The one or more viral particles of claim 79, wherein (1) the first component polypeptide comprises a first costimulatory domain, an antigen-specific recognition domain, and a transmembrane domain, and the first component polypeptide is fused to the target protein; and the second component polypeptide comprises an intracellular signaling domain, a transmembrane domain, and a second costimulatory domain, and the second component polypeptide is fused to the binding member, or (2) the first component polypeptide comprises an intracellular signaling domain, a transmembrane domain, and a second costimulatory domain, and the first component polypeptide is fused to the target protein; and the second component polypeptide comprises a first costimulatory domain, an antigen-specific recognition domain, and a transmembrane domain, and the second component polypeptide is fused to the binding member, wherein the first and second component polypeptides form a chimeric antigen receptor (CAR) upon dimerization.
84. One or more nucleic acids encoding the dimerization-inducible protein of any one of claims 56-71.
85. One or more nucleic acids encoding the target protein of the dimerization-inducible protein of any one of claims 56-71 and the first component polypeptide fused to the target protein and the binding member of the dimerization-inducible protein of any one of claims 56-71 and the second component polypeptide fused to the binding member.
86. Use of one or more expression vectors of any one of claims 1-52 for the manufacture of a medicament for treatment of the human or animal body.
87. Use of one or more viral particles of any one of claims 75-83 for the manufacture of a medicament for treatment of the human or animal body.
88. Use of the dimerization-inducible protein of any one of claims 59-61 for the manufacture of a medicament for use in a method of modulating expression of a desired expression product in a cell of a human or animal subject, wherein the first and second component polypeptides form a transcription factor upon dimerization, the method comprising: i) expressing the dimerization-inducible protein of any one of claims 59-61 in the cell, wherein the DNA binding domain binds to a target sequence in the cell, enabling the transcription factor to modulate expression of the desired expression product; and ii) administering cemiplimab to the cell to modulate expression of the desired expression product.
89. The use of claim 88, wherein the method comprises administering a third expression cassette to the cell, wherein the third expression cassette encodes the desired expression product, and wherein the third expression cassette comprises the target sequence.
90. The use of claim 88, wherein the target sequence is located in a promoter that is operably linked to a coding sequence of the desired expression product.
91. Use of the cell of claim 72 or 73 in the manufacture of a medicament for a method of treatment comprising: i) administering the cell to the individual; and ii) administering cimpieneve to the individual.
92. Use of the cell of claim 72 or 73 in the manufacture of a medicament for treatment of the human or animal body comprising: i) administering the cell to the individual; and ii) administering cimpieneve to the individual.
93. The use of claim 91 or 92, wherein the cell is an immune cell.
94. The use of claim 93, wherein the immune cell is a T cell.
95. The use of claim 94, wherein the first and second component polypeptides form a CAR upon dimerization.
96. A kit comprising one or more expression vectors of any one of claims 1-52 and a small molecule.
97. A kit comprising the cell of claim 72 or 73 and a small molecule.
98. A kit comprising one or more viral particles of any one of claims 75-83 and a small molecule.
99. A kit comprising one or more nucleic acids of claim 84 or 85 and a small molecule.
100. A system comprising: i) a target protein, wherein the target protein is capable of binding a small molecule to form a complex between the target protein and the small molecule (T-SM complex); and ii) a binding member, wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone and the small molecule alone, wherein the target protein is a non-human protein and the small molecule is an inhibitor of the non-human protein, wherein the non-human protein is derived from a viral protease and the small molecule is a viral protease inhibitor, wherein the viral protease is HCV NS3 / 4A protease; wherein the small molecule is cimpieneve; and wherein the binding member is a Tn3 protein or a single-chain variable fragment (scFv).
101. An expression vector encoding an inducible caspase 9 (iCasp9) protein, the expression vector comprising an expression cassette encoding a target protein, a binding member, and a caspase 9 activation domain, wherein the target protein and the binding member are each fused to the caspase 9 activation domain, wherein the target protein is capable of binding a small molecule to form a complex between the target protein and the small molecule (T-SM complex); wherein the target protein is a non-human protein and the small molecule is an inhibitor of the non-human protein, wherein the non-human protein is derived from a viral protease and the small molecule is a viral protease inhibitor, wherein the viral protease is HCV NS3 / 4A protease; wherein the small molecule is cimpieneve; and wherein the binding member is a Tn3 protein or a single-chain variable fragment (scFv). wherein the binding member specifically binds to the T-SM complex such that the affinity of the binding member for the T-SM complex is higher than the affinity of the binding member for the target protein alone and the small molecule alone, wherein the target protein is derived from a viral protease and the small molecule is an inhibitor of the viral protease, wherein the viral protease is HCV NS3 / 4A protease; wherein the small molecule is simeprevir; and wherein the binding member is a Tn3 protein or a single chain variable fragment (scFv).
Citation Information
Patent Citations
Mouse-human chimaeric immunoglobulin heavy chain, and chimaeric DNA encoding it
EP0184187A2
Recombinant antibodies and methods for their production
EP0239400A2
Chimeric antibodies
GB2188638A
Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6453242B1
Modified forms of hepatitis C NS3 protease for facilitating inhibitor screening and structural studies of protease:inhibitor complexes
US6800456B2