A kit for visual detection of pasteurella multocida based on CRISPR-Cas12a and application

By combining CRISPR-Cas12a and RPA, specific crRNA and ssDNA fluorescent probes were designed, solving the problems of rapid, sensitive, and specific detection of Pasteurella multocida. This enabled on-site naked-eye visualization detection, making it suitable for rapid detection under grassroots conditions.

CN115029459BActive Publication Date: 2026-03-24SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210778136.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-28
Publication Date
2026-03-24
Estimated Expiration
2042-06-28

AI Technical Summary

Technical Problem

Existing technologies for detecting Pasteurella multocida are characterized by long detection cycles, cumbersome procedures, and high time and labor costs. They also require complex instruments and skilled personnel, making it difficult to meet the needs for rapid on-site testing.

Method used

By employing CRISPR-Cas12a technology combined with recombinase polymerase isothermal amplification (RPA), a specific crRNA guide sequence and ssDNA fluorescent probe were designed. After amplification, the target DNA was cut in the CRISPR-Cas12a system and detected by color development, achieving naked-eye visualization detection.

Benefits of technology

It enables rapid, sensitive, and specific detection of Pasteurella multocida, with a sensitivity of up to 2 copies/μL. It can be observed with the naked eye at 37°C, eliminating the need for large laboratory instruments and making it suitable for rapid on-site detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115029459B_ABST
    Figure CN115029459B_ABST
Patent Text Reader

Abstract

The application discloses a kit and method for visual detection of Pasteurella multocida based on CRISPR-Cas12a, wherein the kit is used for amplifying a sample to be detected, then under the mediation of a crRNA guide sequence, a CRISPR-Cas12a system is guided to recognize, combine and cut target double-strand DNA to activate a non-specific nuclease function, then an ssDNA fluorescent probe in the arbitrary cutting system is cut to obtain a cutting product and color development detection is performed to determine. The kit can detect nucleic acid of Pasteurella multocida with a sensitivity of 2 copies per muL, and can select RPA for amplification, and the whole process is performed in a 37 DEG C environment, naked eyes can directly observe, and the dependence on laboratory large instruments is broken, and the purpose of on-site rapid visual detection of target nucleic acid is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bacterial molecular diagnostic technology, specifically to a reagent kit and its application for the visual detection of Pasteurella multocida based on CRISPR-Cas12a. Background Technology

[0002] Pasteurella mutocida (Pm) is an important zoonotic pathogen that can cause serious illness in various animals and humans. Once infected with Pm, individuals often develop acute, hemorrhagic, or septicemic symptoms, such as swine pneumonia, hemorrhagic septicemia in cattle, sheep, and rabbits, and fowl cholera—a series of serious infectious diseases. Traditionally, Pm is classified into five serotypes—A, B, D, E, and F—based on its capsular antigen typing (10.1007 / 82_2012_216). Each serotype has different host tropisms and pathogenic characteristics. It has been confirmed that humans can be infected with Pm through cat and dog scratches and bites (10.1056 / NEJM199901143400202). In addition, Pm can also cause other diseases and infections in humans, such as urinary tract infections, meningitis, septicemia, and even death. The occurrence and spread of this disease directly threaten the healthy development of the livestock industry and public health security. Currently, clinical detection of Pasteurella multocida mainly involves pathogen isolation and culture, biochemical identification, smear staining, and microscopic examination. These methods are time-consuming, labor-intensive, and subjective, prone to missed or false positives, making them unsuitable for rapid clinical testing. In recent years, PCR and quantitative real-time PCR have been widely used in the diagnosis of Pasteurella multocida, but both require skilled operators, complex instruments, and a high-temperature testing environment, and are time-consuming. In situations with poor conditions and a shortage of technical personnel at the grassroots level, they are insufficient for rapid on-site testing.

[0003] CRISPR-Cas technology is a popular gene-editing technology that has brought about significant changes in bioengineering, medicine, and nucleic acid detection. Recent research indicates that CRISPR-related (Cas) endonucleases, such as Cas12a, Cas13a, and Cas14a, possess characteristics suitable for nucleic acid detection, including human papillomavirus (HPV), Zika virus (ZIKV), and dengue virus (DENV) (10.1126 / science.aam9321). CRISPR-Cas12a technology is frequently used as an ideal method for identifying and cleaving DNA fragments. When Cas12a recognizes target DNA, the Cas12a / crRNA / DNA ternary complex is activated, allowing Cas12a to specifically cleave the target sequence while also non-specifically cleaving any single-stranded DNA (ssDNA) in the system (10.1126 / science.aar6245). Currently, this method primarily relies on detecting fluorescence signals to determine the presence of the target gene in the sample, and detection still requires specialized instruments and equipment. Therefore, there is an urgent need to develop a rapid, highly sensitive, highly specific, visually perceptible method suitable for rapid on-site detection of Pasteurella multocida.

[0004] Recombinase polymerase isothermal amplification (RPA) is a novel in vitro nucleic acid isothermal amplification technology developed by TwistDx Inc. in the UK in 2006. It can detect not only DNA but also RNA. The entire reaction mainly relies on three enzymes: polymerase, recombinase, and single-stranded binding protein. Compared with other isothermal amplification technologies (doi.org / 10.1371 / journal.pone.0103091), this technology is relatively simple, rapid, and has low requirements for reaction equipment. Summary of the Invention

[0005] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a kit for visual detection of Pasteurella multocida based on CRISPR-Cas12a.

[0006] The first object of the present invention is to provide a composition.

[0007] A second object of the present invention is to provide the use of the above composition in the preparation of a kit for detecting Pasteurella multocida.

[0008] A third objective of this invention is to provide a kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a.

[0009] To achieve the above objectives, the present invention is implemented through the following solution:

[0010] A composition comprising a crRNA guide sequence and an ssDNA fluorescent probe; the nucleotide sequence of the crRNA guide sequence is shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0011] Specifically, the nucleotide sequence information of the crRNA guide sequence is as follows:

[0012] crRNA-KMT1 (SEQ ID NO: 1):

[0013] 5'- AAUUUCUACUAAGUGUAGAU CCCAGUGGGGCGGUGCGAAU-3';

[0014] crRNA-KMT2 (SEQ ID NO: 2):

[0015] 5'- AAUUUCUACUAAGUGUAGAU CAUGUUGAGUUACGUUUCUU-3';

[0016] crRNA-KMT3 (SEQ ID NO: 3):

[0017] 5'- AAUUUCUACUAAGUGUAGAU UGGCUCGUUGUGAGUGGGCU-3';

[0018] The underlined sequences in the crRNA-KMT1, crRNA-KMT2, and crRNA-KMT3 sequence information are stem-loop sequences homologous to LbCas12a (see 10.3784 / jbjc.202108090442).

[0019] Preferably, the nucleotide sequence of the crRNA guide sequence is as shown in SEQ ID NO: 2.

[0020] Preferably, the composition further comprises an amplification primer pair.

[0021] More preferably, the amplification primer pair is an RPA primer pair or a PCR primer pair.

[0022] More preferably, the nucleotide sequence of the upstream primer Pm-RPA2-F of the RPA primer pair is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer Pm-RPA2-R is shown in SEQ ID NO: 5.

[0023] More preferably, the nucleotide sequence of the upstream primer PCR-Kmt1-PM-F of the PCR primer pair is shown in SEQ ID NO: 6, and the nucleotide sequence of the downstream primer PCR-Kmt1-PM-R is shown in SEQ ID NO: 7.

[0024] Specifically, the nucleotide sequence information of the RPA primer pair and the PCR primer pair is as follows:

[0025] RPA upstream primer Pm-RPA2-F (SEQ ID NO: 4):

[0026] 5'-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3';

[0027] RPA downstream primer Pm-RPA2-R (SEQ ID NO: 5):

[0028] 5'-ACTCGCTACTTTTTGTTTCATTTGGACT-3';

[0029] PCR upstream primer PCR-Kmt1-PM-F (SEQ ID NO: 6):

[0030] 5'-ATCCGCTATTTACCCAGTGG-3';

[0031] PCR downstream primer PCR-Kmt1-PM-R (SEQ ID NO: 7):

[0032] 5'-GCTGTAAACGAACTCGCCAC-3';

[0033] Preferably, the composition further comprises the Cas12a enzyme.

[0034] Preferably, the nucleotide sequence of the ssDNA fluorescent probe is shown in SEQ ID NO: 8.

[0035] Specifically, the nucleotide sequence information of the ssDNA fluorescent probe is as follows:

[0036] ssDNA fluorescent probe (SEQ ID NO: 8): 5'-(ROX)-GTATCCAGTGCA-(BHQ2)-3'.

[0037] More preferably, the ssDNA fluorescent probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

[0038] More preferably, the fluorescent group is ROX and the quenching group is BHQ2.

[0039] The present invention also claims the use of the above composition in the preparation of a kit for detecting Pasteurella multocida.

[0040] A kit for detecting Pasteurella multocida, the kit comprising the above-described composition.

[0041] Preferably, the kit further comprises amplification reaction reagents and CRISPR-Cas12a cleavage detection reagents.

[0042] More preferably, the amplification reaction system is an RPA amplification reaction system or a PCR amplification reaction system.

[0043] This invention targets the conserved Kmt1 sequence region in the genome of Pasteurella multocida, designing specific amplification primers and a crRNA guide sequence. The sample to be tested is first amplified, and then, guided by the crRNA guide sequence, the CRISPR-Cas12a system is guided to recognize and bind to the amplification product, cleaving the target double-stranded DNA to activate non-specific nuclease function. The cleavage product is then obtained by arbitrarily cleaving the ssDNA fluorescent probe in the system, and finally, the cleavage product is detected by colorimetric analysis.

[0044] A non-diagnostic visual detection method for Pasteurella multocida, the method comprising the following steps:

[0045] S1. Extract genomic DNA from the sample to be tested;

[0046] S2. Using the genomic DNA from step S1 as a template, an isothermal amplification reaction is performed using the RPA primers (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)) to obtain the RPA amplification product;

[0047] S3. Using the above-mentioned crRNA-KMT2 (SEQ ID NO: 2), prepare the Cas12a-crRNA complex, then add the ssDNA probe (SEQ ID NO: 8) and the RPA amplification product obtained in step S2, and perform a cleavage reaction in the CRISPR-Cas12a system to obtain the cleavage product;

[0048] S4. The cutting product obtained in step S3 is subjected to color development or naked-eye observation under blue light, ultraviolet light and / or a gel imaging system. If the cutting product appears blue under visible light, blue light and ultraviolet light or has no fluorescence under a gel imaging system, it indicates that the sample to be tested is not infected with Pasteurella multocida. If the cutting product appears pink under visible light, bright orange under blue light, bright pink under ultraviolet light or has fluorescence under a gel imaging system, it indicates that the sample to be tested is infected with Pasteurella multocida.

[0049] Preferably, the isothermal amplification reaction system in step S2 is as follows: 1 μL of 10 μM Pm-RPA2-F (SEQ ID NO: 4), 1 μL of 10 μM Pm-RPA2-R (SEQ ID NO: 5), 29.5 μL of RPA reaction buffer, 2.5 μL of 280 mM MgOAc, sterile water to 48 μL, and 2 μL of sample DNA. After mixing thoroughly, the mixture is reacted at 37°C for 15 min.

[0050] Preferably, the cleavage reaction system in step S3 is: 9 μL sterile water, 2 μL NEbuffer 2.1, 1 μM Cas12a protein 1 μL, 1 μM crRNA-KMT2 (SEQ ID NO: 2) μL, RPA amplification product 3 μL, and 20 μM ssDNA fluorescent probe (SEQ ID NO: 8) 4 μL.

[0051] Compared with the prior art, the present invention has the following beneficial effects:

[0052] This invention provides a CRISPR-Cas12a-based visual detection kit for Pasteurella multocida. The kit involves first amplifying the sample, then, guided by a crRNA guide sequence, directing the CRISPR-Cas12a system to recognize and bind to the amplified product, cleaving the target double-stranded DNA and activating non-specific nuclease function. The ssDNA fluorescent probe in the system is then randomly cleaved to obtain the cleavage product, which is finally detected by colorimetric analysis. The kit described in this invention achieves a detection sensitivity of up to 2 copies / μL for Pasteurella multocida nucleic acid, and can utilize RPA for amplification. The entire process is performed at 37°C and can be observed directly with the naked eye, achieving rapid, on-site visual detection of target nucleic acids without the need for large laboratory instruments. Attached Figure Description

[0053] Figure 1 This is a flowchart of the experimental process of the present invention;

[0054] Figure 2 Fluorescence chromatograms for detecting Pasteurella multocida with different crRNA guide sequences;

[0055] Figure 3 Fluorescence signal intensity diagrams for detecting Pasteurella multocida with different crRNA guide sequences;

[0056] Figure 4 Fluorescence chromatograms of Pasteurella multocida detected by different concentrations of ssDNA fluorescent probes;

[0057] Figure 5Agarose gel electrophoresis images of PCR amplification products of different concentrations of PUC19-PM plasmid;

[0058] Figure 6 Fluorescence staining patterns of different concentrations of PUC19-PM plasmid PCR combined with CRISPR-Cas12a for the detection of Pasteurella multocida;

[0059] Figure 7 Fluorescence signal intensity diagrams of Pasteurella multocida at different concentrations of PUC19-PM plasmid;

[0060] Figure 8 Agarose gel electrophoresis diagrams identifying PCR amplification products of different plasmids;

[0061] Figure 9 Fluorescence staining patterns for detecting Pasteurella multocida with different plasmids;

[0062] Figure 10 Agarose gel electrophoresis images of RPA amplification products of different concentrations of PUC19-PM plasmid;

[0063] Figure 11 Fluorescence staining of Pasteurella multocida with different concentrations of PUC19-PM plasmid RPA bound to CRISPR-Cas12a;

[0064] Figure 12 A specific fluorescence colorimetric pattern for the one-step RPA combined with CRISPR-Cas12 visualization detection of Pasteurella multocida;

[0065] Figure 13 Fluorescence colorimetric patterns for detecting Pasteurella multocida in different experimental components;

[0066] Figure 14 Electrophoretic identification images of 16 pig lung tissue samples;

[0067] Figure 15 Fluorescence staining images of 16 pig lung samples;

[0068] Figure 16 Fluorescence signal intensity maps of 16 pig lung samples. Detailed Implementation

[0069] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0070] The experimental flowchart of this invention is as follows: Figure 1 As shown.

[0071] Example 1: Screening for conserved and highly active crRNA guide sequences

[0072] 1. Experimental Methods

[0073] (1) Design and screening of crRNA sequences and design of amplification primer pairs

[0074] 295 *Pasteurella multocida* genome sequences were downloaded from NCBI (National Center for Biotechnology Information). Analysis was conducted to identify species-conserved and species-specific gene fragments within *Pasteurella multocida*. After comparison and evaluation with NCBI, gene fragments with greater than 99% similarity to *Pasteurella multocida* were selected as target DNA, specifically the Kmt1 gene. Universal and specific PCR primer pairs, specific RPA primer pairs, and crRNA guide sequences for *Pasteurella multocida* were designed on conserved regions. The primer pairs and crRNA were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0075] Three crRNA guide sequences were designed and named: crRNA-KMT1 (SEQ ID NO: 1), crRNA-KMT2 (SEQ ID NO: 2), and crRNA-KMT3 (SEQ ID NO: 3).

[0076] crRNA-KMT1 (SEQ ID NO: 1):

[0077] 5'- AAUUUCUACUAAGUGUAGAU CCCAGUGGGGCGGUGCGAAU-3';

[0078] crRNA-KMT2 (SEQ ID NO: 2):

[0079] 5'- AAUUUCUACUAAGUGUAGAU CAUGUUGAGUUACGUUUCUU-3';

[0080] crRNA-KMT3 (SEQ ID NO: 3):

[0081] 5'- AAUUUCUACUAAGUGUAGAU The underlined sequences in the sequence information of UGGCUCGUUGUGAGUGGGCU-3', crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 are stem-loop sequences homologous to LbCas12a (see 10.3784 / jbjc.202108090442).

[0082] PCR primer pairs:

[0083] PCR upstream primer PCR-Kmt1-PM-F (SEQ ID NO: 6):

[0084] 5'-ATCCGCTATTTACCCAGTGG-3';

[0085] PCR downstream primer PCR-Kmt1-PM-R (SEQ ID NO: 7):

[0086] 5'-GCTGTAAACGAACTCGCCAC-3'.

[0087] RPA primer pairs:

[0088] RPA upstream primer Pm-RPA2-F (SEQ ID NO: 4):

[0089] 5'-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3';

[0090] RPA downstream primer Pm-RPA2-R (SEQ ID NO: 5):

[0091] 5'-ACTCGCTACTTTTTGTTTCATTTGGACT-3'.

[0092] (2) PCR amplification

[0093] The Kmt1 gene (AE004439.1) was inserted into the pUC19 vector using an Xbal single restriction enzyme site to construct an expression plasmid, named pUC19-PM. The plasmid concentration was determined using a spectrophotometer, and the concentration of pUC19-PM was adjusted to 100 ng / μL. The copy number of the expression plasmid was calculated to be 2.03 × 10⁻⁶. 10 Copies / μL, for later use.

[0094] The prepared pUC19-PM was serially diluted to 2.03 × 10⁻⁶. 8 Using copier / μL as a template, and PCR-Kmt1-PM-F and PCR-Kmt1-PM-R designed in step (1) as PCR primers, amplification was performed to obtain the amplification product. Simultaneously, pUC19-PM (2.03×10⁻⁶ μL) was added. 8 The copier (μL) was replaced with an equal amount of sterile ddH2O and set as a negative control to obtain the negative control amplification product.

[0095] The PCR reaction program was as follows: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, PCR amplification for a total of 30 cycles, 72℃ extension for 10 min again, and then hold at 16℃.

[0096] 3 μL of the amplification product and 3 μL of the negative control amplification product were respectively subjected to electrophoresis on a 1.5% agarose gel for identification.

[0097] (3) Take 3 μL of the amplification product obtained in step (2) and 3 μL of the negative control amplification product and add them to two centrifuge tubes respectively. Add 1 μL of crRNA-KMT1 (SEQ ID NO: 1) (1 μM), 1 μL of Cas12a (1 μM), 4 μL of ssDNA fluorescent probe (20 μM), 2 μL of NEbuffer 2.1 and 9 μL of sterile ddH2O to each centrifuge tube respectively. React at 37℃ for 15 min. After the reaction is completed, immediately place on ice for 5 min to stop the reaction.

[0098] The same experimental procedures were performed by replacing crRNA-KMT1 with crRNA-KMT2 (SEQ ID NO: 2) and crRNA-KMT3 (SEQ ID NO: 3), respectively.

[0099] Specifically, the nucleotide sequence information of crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 is shown in Table 1. The underlined sequences in the sequence information of crRNA-KMT1, crRNA-KMT2 and crRNA-KMT3 are stem-loop sequences homologous to LbCas12a (refer to 10.3784 / jbjc.202108090442).

[0100] Table 1. Specific nucleotide sequence information

[0101] sequence name Nucleotide sequence (5'-3') crRNA-KMT1 (SEQ ID NO: 1) <![CDATA[ AAUUUCUACUAAGUGUAGAU CCCAGUGGGCGGUGCGAAU]]> crRNA-KMT2 (SEQ ID NO: 2) <![CDATA[ AAUUUCUACUAAGUGUAGAU CAUGUUGAGUUACGUUUCUU]]> crRNA-KMT3 (SEQ ID NO: 3) <![CDATA[ AAUUUCUACUAAGUGUAGAU UGGCUCGUUGUGAGUGGGCU]]>

[0102] (4) Centrifuge tubes containing the reaction solution were placed in visible light, blue light, ultraviolet light and gel imaging instruments for visual detection.

[0103] 2. Experimental Results

[0104] Fluorescence chromatograms of different crRNA guide sequences for detecting Pasteurella multocida are shown below. Figure 2 As shown, the fluorescence signal intensity diagram is as follows: Figure 3 As shown, the experimental results indicate that with 2.03 × 10 8Using copier / μL PUC19-PM as a template, centrifuge tubes for detecting Pasteurella multocida with crRNA-KMT2 showed pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, and bright white under gel imaging, demonstrating fluorescence signals. These signals could be observed with the naked eye under visible light. In contrast, centrifuge tubes for detecting Pasteurella multocida with crRNA-KMT1 and crRNA-KMT3 showed no obvious fluorescence.

[0105] This indicates that the crRNA-KMT2 guide sequence is significantly superior to the crRNA-KMT1 and crRNA-KMT3 guide sequences, suggesting that crRNA-KMT2 has the highest detection activity.

[0106] Example 2: Screening for the optimal visual concentration of ssDNA fluorescent probes

[0107] 1. Experimental Methods

[0108] (1) PCR amplification of target gene fragments

[0109] A 25 μL reaction system was used for PCR amplification as a positive control. The PCR reaction system is shown in Table 2.

[0110] Table 2 PCR reaction system

[0111]

[0112]

[0113] The specific nucleotide information for PCR-Kmt1-PM-F and PCR-Kmt1-PM-R is shown in Table 3.

[0114] Table 3 Nucleotide Information

[0115] sequence name Nucleotide sequence (5'-3') PCR-Kmt1-PM-F (SEQ ID NO: 6) ATCCGCTATTTACCCAGTGG PCR-Kmt1-PM-R (SEQ ID NO: 7) GCTGTAAACGAACTCGCCAC

[0116] The amplification reaction program for the Kmt1 gene is as follows: pre-denaturation at 94℃ for 10 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, PCR amplification for a total of 30 cycles, extension at 72℃ for 10 min again, and then holding at 16℃ to obtain the positive control PCR amplification product.

[0117] The difference between the negative and positive controls lies in the amount of pUC19-PM (2.03 × 10⁻⁶). 8 The template (copies / μL) was replaced with an equal amount of sterile ddH2O to obtain the negative control amplification product.

[0118] (2) Cas12a enzyme digestion reaction

[0119] The Kmt1 gene was detected using ssDNA fluorescent probes with a modification type of 5'-ROX-N12-BHQ2-3' (N represents any base selected from A, T, C, G) at concentrations of 500 nM, 1 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, and 35 μM, respectively.

[0120] The specific nucleotide sequence of the ssDNA fluorescent probe is as follows:

[0121] ssDNA fluorescent probe (SEQ ID NO: 8): 5'-(ROX)-GTATCCAGTGCA-(BHQ2)-3'.

[0122] Add 20 μL of the CRISPR-Cas12a cleavage detection system to a centrifuge tube: 1 μL of crRNA-KMT2 (1 μM) (SEQ ID NO: 2), 1 μL of Cas12a (1 μM), 3 μL of the positive control PCR amplification product obtained in step (1), 4 μL of ssDNA fluorescent probe (SEQ ID NO: 8), 2 μL of NEbuffer 2.1, and 9 μL of sterile water. Incubate at 37 °C for 15 min, and immediately place on ice for 5 min after the reaction to terminate the reaction, obtaining the positive control cleavage product.

[0123] The negative control amplification products obtained in step (1) were treated in the same way.

[0124] (3) Centrifuge tubes containing cleavage products corresponding to different concentrations of ssDNA fluorescent probes were placed in visible light, blue light, ultraviolet light and gel imaging instruments for visualization detection.

[0125] 2. Experimental Results

[0126] Test results as follows Figure 4 As shown, if the centrifuge tube appears blue under visible light, blue light, and ultraviolet light, or has no fluorescence under a gel imaging device, it indicates that the sample is not infected with Pasteurella multocida; if the centrifuge tube appears pink under visible light, bright orange under blue light, bright pink under ultraviolet light, or has fluorescence under a gel imaging device, it indicates that the sample is infected with Pasteurella multocida.

[0127] Experimental results showed that naked-eye detection yielded better color development and easier differentiation when the concentration of the ssDNA fluorescent probe was ≥10 μM. However, for fluorescence intensity under blue light, ultraviolet light, and gel imaging, the minimum concentration of ssDNA that could clearly develop color was 500 nM. Taking all factors into consideration, a 20 μM ssDNA fluorescent probe was selected for subsequent experiments.

[0128] Example 3: Sensitivity test of two-step PCR-CRISPR-Cas12a amplification visualization method for detecting Pasteurella multocida.

[0129] 1. Experimental Methods

[0130] The 2.03×10 prepared in Example 1 10 pUC19-PM with a concentration of copier / μL was serially diluted to 2.03×10⁻⁶ μL. 8 copier / μL, 2.03×10 7 copier / μL, 2.03×10 6 copier / μL, 2.03×10 5 copier / μL, 2.03×10 4 copier / μL, 2.03×10 3 copier / μL, 2.03×10 2 copier / μL, 2.03×10 1 copier / μL and 2.03×10 0 copier / μL.

[0131] (1) PCR amplification

[0132] Using different concentrations of pUC19-PM as templates, and PCR-Kmt1-PM-F (SEQ ID NO: 6) and PCR-Kmt1-PM-R (SEQ ID NO: 7) obtained in Example 2 as PCR primers, amplification products corresponding to different concentrations of pUC19-PM were obtained. Simultaneously, pUC19-PM was replaced with an equal amount of sterile ddH2O as a negative control, yielding negative control amplification products.

[0133] The PCR reaction program was as follows: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, PCR amplification for a total of 30 cycles, 72℃ extension for 10 min again, and then hold at 16℃.

[0134] 3 μL of the amplification product and 3 μL of the negative control amplification product were respectively subjected to electrophoresis on a 1.5% agarose gel for identification.

[0135] (2) Take 3 μL of the negative control amplification product obtained in step (1) and 3 μL of the amplification product and add them to two centrifuge tubes respectively. Add 1 μL of crRNA-KMT2 (SEQ ID NO: 2) (1 μM), 1 μL of Cas12a (1 μM), 4 μL of ssDNA fluorescent probe (SEQ ID NO: 8) (20 μM), 2 μL of NEbuffer 2.1 and 9 μL of sterile ddH2O to each centrifuge tube respectively. React at 37℃ for 15 min. After the reaction is completed, immediately place on ice for 5 min to stop the reaction.

[0136] The amplification products obtained at each concentration were treated in the same manner.

[0137] (3) Centrifuge tubes containing the reaction solution were placed in visible light, blue light, ultraviolet light and gel imaging instruments for visual detection. The changes in fluorescence visual detection signal intensity after amplification with different copy number templates were compared, and the fluorescence intensity value was quantified using ImageJ to determine the detection sensitivity.

[0138] 2. Experimental Results

[0139] The agarose gel electrophoresis results of PCR amplification products of different concentrations of pUC19-PM plasmid are as follows: Figure 5 As shown, the results indicate that the lowest sensitivity for detecting the Kmt1 gene of Pasteurella multocida by PCR amplification combined with gel electrophoresis is 2.03 × 10⁻⁶. 7 copier / μL; PCR products of different concentrations were digested with Cas12, and their fluorescence was developed under visible light, ultraviolet light, blue light, and a gel imaging system as shown in the figure. Figure 6 As shown, the results indicate that its minimum sensitivity is 2.03 × 10⁻⁶. 6 copier / μL; fluorescence signal intensity of different concentrations of pUC19-PM plasmid as shown in Figure 1. Figure 7 As shown, the results indicate that the sensitivity of the PCR-CRISPR-Cas12a detection method is 10 to 100 times that of the conventional PCR amplification method.

[0140] Example 4: Specificity test for the visual detection of Pasteurella multocida using a two-step PCR-CRISPR-Cas12a amplification method.

[0141] 1. Experimental Methods

[0142] (1) Using the Xbal single enzyme digestion site, 821 bp of the conserved region of Haemophilus parasuis (M75065.1) was inserted into the pUC19 vector to construct an expression plasmid, which was named pUC19-HPS; using the Xbal single enzyme digestion site, 363 bp of the conserved region of Actinobacillus pleuropneumoniae (HM021153.1) was inserted into the pUC19 vector to construct an expression plasmid, which was named pUC19-APP.

[0143] (2) PCR amplification

[0144] pUC19-PM (2.03 × 10⁻⁶) prepared in Example 1 8 Using copier / μL) as a template, PCR amplification was performed using PCR-Kmt1-PM-F (SEQ ID NO: 6) and PCR-Kmt1-PM-R (SEQ ID NO: 7) as primers to obtain amplification product 1;

[0145] The pUC19-HPS (2.03×10⁻⁶) obtained in step (1) 8 Using copier / μL) as a template, PCR amplification reaction was performed using PCR-Kmt1-HPS-F (SEQ ID NO: 9) and PCR-Kmt1-HPS-R (SEQ ID NO: 10) as primers to obtain amplification product 2;

[0146] The pUC19-APP (2.03×10) obtained in step (1) 8 Using copier / μL) as a template, PCR amplification reaction was performed using PCR-Kmt1-APP-F (SEQ ID NO: 11) and PCR-Kmt1-APP-R (SEQ ID NO: 12) as primers to obtain amplification product 3;

[0147] pUC19-PM (2.03×10) 8 copier / μL), pUC19-HPS (2.03×10 8 copier / μL) and pUC19-APP (2.03×10) 8 The copier (μL) was mixed at a volume ratio of 1:1:1 and used as a template for PCR amplification to obtain amplification product 4;

[0148] PCR amplification was performed using sterile water as a template to obtain amplification product 5.

[0149] Specifically, the nucleotide sequence information of the PCR primers is shown in Table 4.

[0150] Table 4 PCR primer nucleotide sequences

[0151]

[0152]

[0153] The PCR reaction program was as follows: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, PCR amplification for a total of 30 cycles, 72℃ extension for 10 min again, and then hold at 16℃.

[0154] 3 μL of each amplification product 1–5 was electrophoresed on a 1.5% agarose gel for identification.

[0155] (3) Take the amplification products 1-5 obtained in step (2) and add them to different centrifuge tubes. Add 1 μL of crRNA-KMT2 (SEQ ID NO: 2) (1 μM), 1 μL of Cas12a (1 μM), 4 μL of ssDNA fluorescent probe (SEQ ID NO: 8) (20 μM), 2 μL of NEbuffer 2.1, and 9 μL of sterile ddH2O to each centrifuge tube. React at 37℃ for 15 min. After the reaction is completed, immediately place the tube on ice for 5 min to terminate the reaction.

[0156] (4) Centrifuge tubes containing the reaction solution were placed in visible light, blue light, ultraviolet light and gel imaging instruments for visual detection, and the changes in fluorescence visual detection signal intensity after amplification using templates with different copy numbers were compared.

[0157] 2. Experimental Results

[0158] The agarose gel electrophoresis results of amplification products 1-5 are as follows: Figure 8 As shown, only with pUC19-PM (2.03×10 8 In PCR amplification products using a mixed plasmid (pUC19-PM, pUC19-HPS, and pUC19-APP in a volume ratio of 1:1:1) as a template, specifically amplification products 1 and 4, the specific target band was detected. However, when using pUC19-HPS plasmid (2.03 × 10⁻⁶ μL) as a template, the band was not detected. 8 copier / μL) and pUC19-APP plasmid (2.03×10) 8 No electrophoretic bands were detected in the PCR amplification products using copier / μL as a template, indicating that the PCR-Kmt1-PM-F and PCR-Kmt1-PM-R selected in this invention have high specificity.

[0159] The fluorescence colorimetric results of different plasmids for detecting Pasteurella multocida are as follows: Figure 9 As shown. Fluorescence staining results indicated that only plasmids containing pUC19-PM (2.03 × 10⁻⁶) were detected. 8Centrifuge tubes with a density of 10 μL showed pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, and bright white under gel imaging, indicating a clear fluorescent signal. This means that a clear fluorescent signal could be observed in the Pasteurella multocida positive group.

[0160] The results show that the CRISPR-Cas12a-based detection method for Pasteurella multocida is highly specific and does not readily cross-react with Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0161] Example 5: Sensitivity test of RPA combined with CRISPR-Cas12 for visual detection of Pasteurella multocida.

[0162] 1. Experimental Methods

[0163] (1) RPA primer design: RPA primers (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (PAGE purification).

[0164] (2) RPA amplification of the target fragment

[0165] The 2.03×10 prepared in Example 1 10 pUC19-PM with a concentration of copier / μL was serially diluted to 2.03×10⁻⁶ μL. 8 copier / μL, 2.03×10 7 copier / μL, 2.03×10 6 copier / μL, 2.03×10 5 copier / μL, 2.03×10 4 copier / μL, 2.03×10 3 copier / μL, 2.03×10 2 copier / μL, 2.03×10 1 copier / μL and 2.03×10 0 copier / μL.

[0166] Using different concentrations of pUC19-PM as templates, and Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5) as RPA primers, isothermal RPA amplification reactions were performed to obtain RPA amplification products of corresponding concentrations. A negative control was also set up to obtain the corresponding negative control RPA amplification products.

[0167] Specifically, the nucleotide sequence information of the RPA primers is shown in Table 5.

[0168] Table 5. Specific nucleotide sequence information

[0169] sequence name Nucleotide sequence (5'-3') Pm-RPA2-F (SEQ ID NO: 4) AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA Pm-RPA2-R (SEQ ID NO: 5) ACTCGCTACTTTTTGTTTCATTTGGACT

[0170] The RPA isothermal amplification reaction system is shown in Table 6.

[0171] Table 6. RPA isothermal amplification reaction system

[0172] Components Dosage (μL) pUC19-PM plasmid template 2.0 RPA-Kmt1-F (SEQ ID NO: 4) (10 μM) 1.0 RPA-Kmt1-R (SEQ ID NO: 5) (10 μM) 1.0 RPA Rehydration Buffer 29.5 sterile water 14 MgOAc (280mM) 2.5 total 50

[0173] The RPA isothermal amplification reaction procedure is as follows: react at 37℃ for 15 min, immediately place on ice for 5 min, and then terminate the reaction.

[0174] 3 μL of RPA amplification product and negative control RPA amplification product were respectively subjected to electrophoresis on a 1.5% agarose gel for identification.

[0175] (2) The steps of the Cas12a enzyme digestion reaction are the same as those in step (3) of Example 3.

[0176] (3) Centrifuge tubes containing the reaction solution were placed in visible light, blue light, ultraviolet light and gel imaging instruments for visual detection. The changes in fluorescence visual detection signal intensity after amplification with different copy number templates were compared to determine the detection sensitivity.

[0177] 2. Experimental Results

[0178] Agarose gel electrophoresis identification results of RPA amplification products of different concentrations of pUC19-PM are as follows: Figure 10 As shown, the results indicate that the lowest sensitivity for detecting the Kmt1 gene of Pasteurella multocida using RPA amplification combined with gel electrophoresis is 2.03 × 10⁻⁶. 0 copier / μL; different concentrations of RPA products were cleaved with Cas12a, and their fluorescence was developed under visible light, ultraviolet light, blue light, and a gel imaging system as shown in the figure. Figure 11 As shown, the results indicate that its minimum sensitivity is 2.03 × 10⁻⁶. 0 copier / μL.

[0179] Compared to the results of Example 3, the sensitivity is greatly improved, and Pasteurella multocida can be identified and detected more accurately.

[0180] Example 6: A one-step RPA combined with CRISPR-Cas12a visual detection method for Pasteurella multocida and its specificity test.

[0181] 1. Experimental Methods

[0182] (1) Establishment of a one-step RPA combined with CRISPR-Cas12a visualization method for detecting Pasteurella multocida.

[0183] 1 μL of crRNA-KMT2 (SEQ ID NO: 2) (1 μM), 1 μL of Cas12a (1 μM), 4 μL of ssDNA fluorescent probe (SEQ ID NO: 8) (20 μM), and 2 μL of NEbuffer 2.1 were mixed to obtain the Cas12a mixture. 8 μL of the Cas12a mixture was pre-added to the centrifuge tubes provided with the RPA kit (Twist). Inside the round cap of the Basic Kit (TwistDX Inc., UK), 21 μL of the RPA reaction system (as shown in Table 7) was placed at the bottom of the centrifuge tube to establish an integrated RPA-CRISPR-Cas12a reaction.

[0184] Table 7 RPA Reaction System

[0185] Components Dosage (μL) <![CDATA[pUC19-PM plasmid template (2.03×10 8 copies / μL)]]> 2.0 RPA-Kmt1-F (10μM) 1.0 RPA-Kmt1-R(10μM) 1.0 RPA Rehydration Buffer 11.8 sterile water 4.2 MgOAc (280mM) 1.0

[0186] RPA amplification was performed at 37°C for 10 min, followed by instantaneous centrifugation. The Cas12a mixture inside the cap of the round tube was centrifuged into a centrifuge tube, mixed, and reacted at 37°C for 15 min. After the reaction was completed, the tube was immediately placed on ice for 5 min to terminate the reaction.

[0187] The centrifuge tubes after the reaction were placed under visible light, blue light, ultraviolet light, and a gel imaging instrument for visualization detection.

[0188] (2) Specificity test for one-step RPA combined with CRISPR-Cas12 visualization detection of Pasteurella multocida

[0189] The pUC19-PM constructed in Example 1 and the pUC19-HPS and pUC19-APP constructed in Example 4 were used to set up experimental groups according to the method of step (2) in Example 4. The difference from step (2) in Example 4 is that the amplification primers used were Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5).

[0190] The experimental groups were amplified separately, and the corresponding centrifuge tubes were placed in visible light, blue light, ultraviolet light, and gel imaging instruments for visual detection, and the changes in fluorescence visualization signal intensity were detected.

[0191] 2. Experimental Results

[0192] The results of one-step RPA combined with CRISPR-Cas12 visualization detection of specific fluorescence colorimetric effects on Pasteurella multocida are as follows: Figure 12As shown, the fluorescence colorimetric results indicate that only those containing pUC19-PM (2.03 × 10⁻⁶) are detected. 8 Centrifuge tubes with a density of 10 μL showed pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, and bright white under gel imaging, indicating a clear fluorescent signal. This means that a clear fluorescent signal could be observed in the Pasteurella multocida positive group.

[0193] This demonstrates that the one-step RPA combined with CRISPR-Cas12a visualization method for detecting Pasteurella multocida is highly specific and does not easily cross-react with Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0194] Example 7: Verification of CRISPR-Cas12a cleavage activity

[0195] 1. Experimental Methods

[0196] Six sets of variable experiments were set up to verify the CRISPR-Cas12a cleavage activity according to the method described in step (1) of Example 6.

[0197] Experimental group 1 follows the same steps as in Example 6 (1);

[0198] The difference between experimental group 2 and experimental group 1 is that experimental group 2 does not contain the pUC19-PM template (2.03×10⁻⁶). 8 copier / μL);

[0199] The difference between experimental group 3 and experimental group 1 is that it does not contain crRNA-KMT2 (SEQ ID NO: 2);

[0200] The difference between experimental group 4 and experimental group 1 is that it does not contain Cas12a;

[0201] The difference between experimental group 5 and experimental group 1 is that it does not contain Cas12a and crRNA-KMT2 (SEQ ID NO: 2);

[0202] The difference between experimental group 6 and experimental group 1 is that experimental group 6 does not contain the pUC19-PM template (2.03×10⁻⁶). 8 (copier / μL), Cas12a and crRNA-KMT2 (SEQ ID NO: 2).

[0203] Centrifuge tubes containing reaction solutions from experimental groups 1 to 6 were placed in visible light, blue light, ultraviolet light, and gel imaging instruments for visual detection.

[0204] 2. Experimental Results

[0205] Fluorescence colorimetric results of different experimental groups Figure 13As shown, the results indicate that only the full-component experimental group (experimental group 1) exhibits a fluorescent signal, showing pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, and bright white under gel imaging. This means that the DNA fragment to be tested, Cas12a, and crRNA-KMT2 form a ternary complex, which can directionally cleave the target DNA while simultaneously cleaving any single-stranded DNA (ssDNA) in the system, thus producing a significant fluorescent signal.

[0206] No signal was generated in experimental groups 2–6. The results indicate that Cas12a possesses non-specific ssDNA cleavage activity triggered by the specific recognition of target DNA.

[0207] Example 8: A kit for visual detection of Pasteurella multocida.

[0208] 1. Components of the reagent kit

[0209] A kit for visually detecting Pasteurella multocida includes crRNA-KMT2 (SEQ ID NO: 2), specific RPA primer pairs (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)), ssDNA fluorescent probe (SEQ ID NO: 8), RPA reaction buffer, MgOAc (280mM), NEbuffer 2.1, sterile water, and Cas12a enzyme (1μM).

[0210] The crRNA-KMT2 (SEQ ID NO: 2):

[0211] 5'- AAUUUCUACUAAGUGUAGAU CAUGUUGAGUUACGUUUCUU-3';

[0212] Specific RPA primer pairs:

[0213] Pm-RPA2-F (SEQ ID NO: 4): 5'-AGTTTTGTTGGGCGGAGTTTGGTGTGTTGA-3';

[0214] Pm-RPA2-R (SEQ ID NO: 5): 5'-ACTCGCTACTTTTTGTTTCATTTGGACT-3';

[0215] ssDNA fluorescent probe (SEQ ID NO: 8): 5'-(ROX)-GTATCCAGTGCA-(BHQ2)-3'.

[0216] 2. Instructions for using the reagent kit

[0217] Genomic DNA was extracted from the sample to be tested. The extracted genomic DNA was added to the kit and thoroughly mixed with RPA reaction buffer, MgOAc (280mM), and sterile water. Amplification was performed at 37°C for 15 minutes using specific RPA primer pairs (Pm-RPA2-F (SEQ ID NO: 4) and Pm-RPA2-R (SEQ ID NO: 5)). After amplification, the sample was thoroughly mixed with Cas12a enzyme (1μM), NEbuffer 2.1, and ssDNA fluorescent probe (SEQ ID NO: 8) in the kit and reacted at 37°C for 15 minutes for cleavage. The kit was then visualized under visible light, blue light, ultraviolet light, or a gel imaging system.

[0218] 3. Result Interpretation

[0219] If the kit appears pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, or bright white under a gel imaging system, it indicates the expression of a fluorescent signal, meaning the test result is positive and the sample is infected with Pasteurella multocida. Otherwise, the test result is negative, and the sample is not infected with Pasteurella multocida.

[0220] Example 9: A kit for visual detection of Pasteurella multocida.

[0221] 1. Components of the reagent kit

[0222] A kit for visually detecting Pasteurella multocida includes crRNA-KMT2 (SEQ ID NO: 2), specific PCR primer pairs (as shown in SEQ ID NO: 6 and SEQ ID NO: 7), ssDNA fluorescent probe (SEQ ID NO: 8), Nebuffer 2.1, sterile water, and Cas12a enzyme (1 μM).

[0223] The crRNA-KMT2 (SEQ ID NO: 2):

[0224] 5'- AAUUUCUACUAAGUGUAGAU CAUGUUGAGUUACGUUUCUU-3';

[0225] Specific PCR primer pairs:

[0226] PCR-Kmt1-F (SEQ ID NO: 6): 5'-ATCCGCTATTTACCCAGTGG-3';

[0227] PCR-Kmt1-R (SEQ ID NO: 7): 5'-GCTGTAACGAACTCGCCAC-3';

[0228] ssDNA fluorescent probe (SEQ ID NO: 8): 5'-(ROX)-GTATCCAGTGCA-(BHQ2)-3'.

[0229] 2. Instructions for using the reagent kit

[0230] Genomic DNA was extracted from the sample to be tested. The extracted genomic DNA was added to the kit and mixed thoroughly with sterile water. PCR amplification was performed using specific PCR primer pairs (PCR-Kmt1-F (SEQ ID NO: 6) and PCR-Kmt1-R (SEQ ID NO: 7)). The PCR reaction program was as follows: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles of PCR amplification, followed by a second extension at 72℃ for 10 min, and then holding at 16℃.

[0231] After the PCR reaction, the sample was thoroughly mixed with Cas12a enzyme (1 μM), NEbuffer 2.1, and ssDNA fluorescent probe (SEQ ID NO: 8) in the kit and reacted at 37°C for 15 min to perform the cleavage reaction. The kit was then placed under visible light, blue light, ultraviolet light, or a gel imaging system for visualization detection.

[0232] 3. Result Interpretation

[0233] If the kit appears pink under visible light, bright yellow under blue light, bright pink under ultraviolet light, or bright white under a gel imaging system, it indicates the expression of a fluorescent signal, meaning the test result is positive and the sample is infected with Pasteurella multocida. Otherwise, the test result is negative, and the sample is not infected with Pasteurella multocida.

[0234] Example 10: Clinical application of one-step RPA combined with CRISPR-Cas12 visualization for the detection of Pasteurella multocida.

[0235] 1. Experimental Methods

[0236] (1) Genomic extraction was performed on pig lung tissue samples from the vegetable market using a blood and tissue sample genomic extraction kit (DP304-03). A total of 16 pig lung tissue samples were collected and numbered 1 to 16.

[0237] Sixteen pig lung tissue samples were first subjected to the operation shown in step (2) of Example 3, and then identified by electrophoresis.

[0238] Sixteen pig lung tissue samples were tested using the kit described in Example 8.

[0239] The same procedure was performed on each pig lung tissue sample to obtain corresponding centrifuge tubes containing the reaction solution.

[0240] (2) The detection kit corresponding to each pig lung tissue sample was placed in a visible light, blue light, ultraviolet light and gel imaging instrument for visual detection. The fluorescence visualization detection signal intensity changes were observed, and ImageJ was used to quantify the fluorescence intensity value to determine the detection sensitivity.

[0241] 2. Experimental Results

[0242] Electrophoretic identification confirms the results as follows Figure 14 As shown, the results indicated that bands appeared in the electrophoresis results of porcine lung tissue samples numbered 5, 6, 12, and 14, all of which were positive for Pasteurella multocida; the fluorescence colorimetric results of RPA combined with CRISPR-Cas12a technology are as follows. Figure 15 As shown, the fluorescence signal intensity is as follows Figure 16 As shown, the results indicate that pig lung tissue samples numbered 5, 6, 12, and 14 showed fluorescence signals under visible light (pink), blue light (bright yellow), ultraviolet light (bright pink), and gel imaging (bright white), all indicating positive results. The remaining samples did not show fluorescence signals, and the results were not negative.

[0243] This indicates that the detection results of RPA combined with CRISPR-Cas12a technology are consistent with the electrophoretic identification results, and this technology can be used to accurately detect clinical Pasteurella multocida.

[0244] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention. sequence list <110> South China Agricultural University <120> A CRISPR-Cas12a-based visual detection kit for Pasteurella multocida and its application. <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> RNA <213> crRNA-KMT1 <400> 1 aauuucuacu aaguguagau cccagugggg cggugcgaau 40 <210> 2 <211> 40 <212> RNA <213> crRNA-KMT2 <400> 2 aauuucuacu aaguguagau cauguugagu uacguuucuu 40 <210> 3 <211> 40 <212> RNA <213> crRNA-KMT3 <400> 3 aauuucuacu aaguguagau uggcucguug ugagugggcu 40 <210> 4 <211> 30 <212> DNA <213> RPA upstream primer Pm-RPA2-F <400> 4 agttttgttg ggcggagttt ggtgtgttga 30 <210> 5 <211> 28 <212> DNA <213> RPA downstream primer Pm-RPA2-R <400> 5 actcgctactttttgtttca tttggact 28 <210> 6 <211> 20 <212> DNA <213> PCR upstream primer PCR-Kmt1-PM-F <400> 6 atccgctatt tacccagtgg 20 <210> 7 <211> 20 <212> DNA <213> PCR downstream primer PCR-Kmt1-PM-R <400> 7 gctgtaaacg aactcgccac 20 <210> 8 <211> 12 <212> DNA <213> ssDNA fluorescent probe <400> 8 gtatccagtg ca 12 <210> 9 <211> 20 <212> DNA <213> PCR-Kmt1-HPS-F <400> 9 atccgctatt tacccagtgg 20 <210> 10 <211> 20 <212> DNA <213> PCR-Kmt1-HPS-R <400> 10 gctgtaaacg aactcgccac 20 <​​​​​​​​​​​​​​​​​​​​​​

Claims

1. A composition, characterized in that, The composition comprises a crRNA guide sequence, an ssDNA fluorescent probe, and an amplification primer pair; the nucleotide sequence of the crRNA guide sequence is as shown in SEQ ID NO: 2; The amplification primer pair is an RPA primer pair. The nucleotide sequence of the upstream primer Pm-RPA2-F is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer Pm-RPA2-R is shown in SEQ ID NO:

5.

2. The composition according to claim 1, characterized in that, The nucleotide sequence of the ssDNA fluorescent probe is shown in SEQ ID NO:

8.

3. The composition according to claim 2, characterized in that, The ssDNA fluorescent probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

4. The composition according to claim 3, characterized in that, The fluorescent group is ROX, and the quenching group is BHQ2.

5. A kit for detecting Pasteurella multocida, characterized in that, The kit comprises the composition according to any one of claims 1 to 4.

Citation Information

Patent Citations

  • Primer, probe and kit for rapidly detecting pasteurella mutocida on site

    CN106811541A