A cell line that slows endothelial-mesenchymal transition and expresses low levels of siRNA and GTF2H4

By designing specific siRNA sequences and constructing a microvascular endothelial cell line with low GTF2H4 expression using a recombinant lentiviral vector, the therapeutic challenge of endothelial-mesenchymal transdifferentiation in cardiovascular diseases has been solved, enabling effective inhibition and in-depth research on endothelial-mesenchymal transformation.

CN115572723BActive Publication Date: 2025-10-28ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210435390.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-04-24
Publication Date
2025-10-28
Estimated Expiration
2042-04-24

AI Technical Summary

Technical Problem

Current technologies lack effective therapeutic targets to reverse endothelial-mesenchymal transdifferentiation (EndMT), a process that plays a crucial role in cardiovascular disease, but whose mechanisms remain unclear.

Method used

We constructed a microvascular endothelial cell line with low GTF2H4 expression using siRNA and recombinant lentiviral vectors. By inhibiting GTF2H4 expression, we suppressed endothelial-mesenchymal transdifferentiation, including designing specific siRNA sequences and using lentiviral vectors for gene interference.

Benefits of technology

Significantly inhibiting endothelial mesenchymal transformation under hypoxic conditions provides a new approach to the treatment of cardiovascular diseases and lays the foundation for in-depth research on the molecular mechanisms of endothelial mesenchymal transformation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115572723B_ABST
    Figure CN115572723B_ABST
Patent Text Reader

Abstract

This invention discloses an siRNA that slows down endothelial-mesenchymal transition (EMT) and a cell line with low GTF2H4 expression. The invention provides three siRNAs that knock down GTF2H4 expression using RNAi, with sequences shown in SEQ ID NO: 1-6. It also provides shRNAs with sequences shown in SEQ ID NO: 13-14, and constructs a microvascular endothelial cell line with low GTF2H4 expression based on these sequences. This cell line significantly inhibits hypoxia-induced EMT, suppresses cell migration, and promotes cell tube formation. This provides new hope for clinical intervention in EMT to improve cardiovascular disease and facilitates further research to explore the potential molecular mechanisms between GTF2H4 and EMT, offering useful clues for treating cardiovascular diseases caused by EMT and possessing significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a cell line that slows down endothelial mesenchymal lesions by expressing siRNA and GTF2H4, and belongs to the fields of medical molecular biology and genetic engineering technology. Background Technology

[0002] Endothelial-mesenchymal transition (EndMT) refers to the mesenchymal transformation of endothelial cells, characterized by the loss of endothelial markers such as VE-Cadherin and CD31, and the acquisition of mesenchymal markers such as α-SMA and FSP-1. During this process, cells change from a compact, cobblestone-like structure to a spindle-shaped structure, their anti-platelet-forming ability is impaired, while mesenchymal cell characteristics such as invasion and migration are enhanced. EndMT was first discovered during the formation of septa and valves in embryonic development. Subsequent studies have shown that EndMT is involved in the pathophysiological processes of cardiovascular diseases such as myocardial infarction, cavernous hemangioma, pulmonary hypertension, and atherosclerosis. Currently, the mechanisms of EndMT development and progression are not fully understood, and there is a lack of clinically specific therapeutic targets for EndMT. Therefore, it is crucial to investigate the molecular mechanisms of EndMT development and progression, identify the key signaling pathways and molecular networks involved, and seek effective targets to reverse EndMT, aiming to provide new insights for the treatment of cardiovascular diseases.

[0003] TFIIH (transcription factor IIH), a universal transcription factor, is a multi-protein complex composed of 10 subunits: XPB / Ssl2, XPD / Rad3, p62 / Tfb1, p52 / Tfb2, p8 / Tfb5, p44 / Ssl1, p34 / Tfb4, CDK7 / Kin28, Cyclin H / Ccl1, and MAT1 / Tfb3. It primarily functions in nucleic acid splicing repair and transcription initiation. The first seven subunits form the core TFIIH subcomplex, while CDK7 / Kin28, Cyclin H / Ccl1, and MAT1 / Tfb3 form a cyclin-dependent kinase (CDK) active kinase (CAK) subcomplex. TFIIH subunit 4 (GTF2H4) is an important member of the Tfb2 family of transcription factors discovered in recent years, playing a crucial regulatory role in cell growth, development, and metabolism. Existing research has confirmed that the main functions of GTF2H4 are nucleotide excision repair, RNA transcription, cell cycle regulation, and participation in immune regulation. This makes GTF2H4 extremely important in the replication, transmission, and expression of intact genetic information in organisms, as well as in error correction and repair after damage.

[0004] Small interfering RNA (siRNA), also known as silent RNA or short interfering RNA, is a double-stranded RNA molecule of 20-25 base pairs in length. It inhibits the expression of target genes by recognizing complementary target gene mRNAs and inducing their degradation. For siRNA to be applied clinically and achieve therapeutic goals, the primary prerequisite is effective delivery to target tissues or cells. Currently, there are two main delivery methods: one is direct delivery of naked siRNA or chemically modified siRNA, including delivery via engineered nanoparticles, chemical group modification, and protein or peptide coating; the other is delivery using genetically engineered viral vectors, i.e., using lentiviruses, adenoviruses, or adeno-associated viruses encoding short hairpin RNA (shRNA) genes to infect cells and generate siRNA intracellularly. The biggest advantage of using viral vectors is that a long-term RNA interference effect can be obtained after a single dose. Based on the advantages of siRNA's specificity, modifiability, and high interference efficiency in targeting known complementary sequences of target genes, siRNA has gradually become an important tool for studying gene function and drug targets. Summary of the Invention

[0005] The present invention aims to use a siRNA to achieve low expression of GTF2H4, thereby inhibiting the endothelial-mesenchymal transdifferentiation of endothelial cells, and to construct a microvascular endothelial cell line with low GTF2H4 expression.

[0006] To achieve the above objective, the present invention provides a substance capable of inhibiting GTF2H4 expression, which is any one of the following A1) to A4):

[0007] A1): siRNA1, whose forward and reverse nucleotide sequences are shown in SEQ ID NO: 1-2;

[0008] A2): siRNA2, whose forward and reverse nucleotide sequences are shown in SEQ ID NO: 3-4;

[0009] A3): siRNA3, whose forward and reverse nucleotide sequences are shown in SEQ ID NO: 5-6;

[0010] A4): shRNA, the forward and reverse sequences of its double-stranded template DNA are shown in SEQ ID NO: 13-14.

[0011] The present invention also provides an expression vector comprising the target sequence as shown in SEQ ID NO: 1-2 or SEQ ID NO: 13-14.

[0012] Preferably, the expression vector is selected from viral, fungal, or bacterial expression vectors.

[0013] The present invention also provides a cell for the above-mentioned expression vector, wherein the cell is human microvascular endothelial cell HMEC-1.

[0014] This invention also provides a method for preparing a recombinant lentiviral expression vector, comprising the following steps:

[0015] Step 1: Anneal the single-stranded DNA molecules shown in SEQ ID NO: 13 and SEQ ID NO: 14 to form a double-stranded DNA fragment with sticky ends;

[0016] Step 2: The lentiviral vector pHBLV-U6-MCS-PGK-PURO was digested with restriction endonuclease 1 and restriction endonuclease 2. The DNA double-stranded fragment obtained in Step 1 was ligated into the vector using T4 ligase to obtain the recombinant lentiviral vector.

[0017] This invention also provides a method for constructing a microvascular endothelial cell line with low GTF2H4 expression, comprising the following steps:

[0018] Step 1: The recombinant lentiviral vector, together with the viral packaging helper plasmids pSPAX2 and pMD2G, constitutes a three-plasmid lentiviral system for viral packaging, which is then transfected into 293T cells to obtain viral fluid; the recombinant lentiviral vector is the recombinant lentiviral vector prepared by the above preparation method.

[0019] Step 2: Infect microvascular endothelial cell lines with the viral fluid obtained in Step 1, and screen to obtain microvascular endothelial cell lines with low GTF2H4 expression, i.e., microvascular endothelial cell lines with low GTF2H4 expression.

[0020] This invention also provides the use of siRNAs with forward and reverse nucleotide sequences as shown in SEQ ID NO: 1-2 in any of the following B1)-B10):

[0021] B1): Preparation of reagents for inhibiting GTF2H4 expression;

[0022] B2): Prepare products for inhibiting endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0023] B3): Prepare products for inhibiting the migration ability of microvascular endothelial cells under hypoxic conditions;

[0024] B4): Prepare products for promoting the tube-forming ability of microvascular endothelial cells under hypoxic conditions;

[0025] B5): Prepare products for constructing expression vectors, cell models, or animal models with low GTF2H4 expression;

[0026] B6): In vitro inhibition of GTF2H4 expression;

[0027] B7): In vitro inhibition of endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0028] B8): In vitro inhibition of microvascular endothelial cell migration ability under hypoxic conditions;

[0029] B9): Promotes the ability of microvascular endothelial cells to form tubes under hypoxic conditions in vitro;

[0030] B10): Construct expression vectors or cell models with low GTF2H4 expression.

[0031] This invention also provides the above-described expression vector, and the recombinant lentiviral expression vector prepared by the above-described method is used in any one of the following C1) C10):

[0032] C1): Preparation of reagents for inhibiting GTF2H4 expression;

[0033] C2): Prepare products for inhibiting endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0034] C3): Prepare products for inhibiting the migration ability of microvascular endothelial cells under hypoxic conditions;

[0035] C4): Prepare products for promoting the tube-forming ability of microvascular endothelial cells under hypoxic conditions;

[0036] C5): Prepare products for constructing cell or animal models with low GTF2H4 expression;

[0037] C6): In vitro inhibition of GTF2H4 expression;

[0038] C7): In vitro inhibition of endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0039] C8): In vitro inhibition of microvascular endothelial cell migration ability under hypoxic conditions;

[0040] C9): Promotes the ability of microvascular endothelial cells to form tubes under hypoxic conditions in vitro;

[0041] C10): Construct a cell model with low GTF2H4 expression.

[0042] The present invention also provides the use of the above-described cells in any one of the following D1) D7):

[0043] D1): Prepare a product for inhibiting endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0044] D2): Prepare products for inhibiting the migration ability of microvascular endothelial cells under hypoxic conditions;

[0045] D3): Prepare products to promote the tube-forming ability of microvascular endothelial cells under hypoxic conditions;

[0046] D4): Products for constructing animal models with low GTF2H4 expression;

[0047] D5): In vitro inhibition of endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0048] D6): In vitro inhibition of microvascular endothelial cell migration ability under hypoxic conditions;

[0049] D7): Promotes the ability of microvascular endothelial cells to form tubes under hypoxic conditions in vitro.

[0050] This invention also provides the application of the microvascular endothelial cell line with low GTF2H4 expression constructed by the above-described method in any one of the following E1) E7):

[0051] E1): Prepare products for inhibiting endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0052] E2): Prepare products for inhibiting the migration ability of microvascular endothelial cells under hypoxic conditions;

[0053] E3): Prepare products to promote the tube-forming ability of microvascular endothelial cells under hypoxic conditions;

[0054] E4): Products for constructing animal models with low GTF2H4 expression;

[0055] E5): In vitro inhibition of endothelial-mesenchymal transdifferentiation of microvascular endothelial cells under hypoxic conditions;

[0056] E6): In vitro inhibition of microvascular endothelial cell migration ability under hypoxic conditions;

[0057] E7): Promotes the ability of microvascular endothelial cells to form tubes under hypoxic conditions in vitro.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] This invention utilizes RNAi technology to knock down GTF2H4, discovering that it can significantly inhibit hypoxia-induced endothelial-mesenchymal lesions (EMLs), bringing new hope for clinical intervention in EMLs to improve cardiovascular diseases. Furthermore, this invention utilizes a stable GTF2H4 knockdown cell line constructed using a recombinant lentiviral vector, which facilitates further research to explore the potential molecular mechanisms between GTF2H4 and EMLs, providing useful clues for the treatment of cardiovascular diseases caused by EMLs. Therefore, this invention has significant application value. Attached Figure Description

[0060] Figure 1 To identify the interference effects of GTF2H4 siRNA1, GTF2H4 siRNA2, and GTF2H4 siRNA3 on the GTF2H4 gene using RT qPCR;

[0061] Figure 2 To identify the interference effects of GTF2H4 shRNA1 and GTF2H4 shRNA2 on the GTF2H4 gene using RT qPCR;

[0062] Figure 3 To identify the inhibitory effects of GTF2H4 shRNA1 and GTF2H4 shRNA2 on GTF2H4 protein using Western blot;

[0063] Figure 4To identify changes in endothelial and mesenchymal biomarkers in human microvascular endothelial cells HMEC-1 with GTF2H4 shRNA interference during hypoxia-induced endothelial-mesenchymal transdifferentiation using Western blot.

[0064] Figure 5 The effect of GTF2H4 knockdown on Transwell migration of human microvascular endothelial cells HMEC-1 under hypoxic conditions and statistical analysis;

[0065] Figure 6 The effect of GTF2H4 knockdown on tubule formation in human microvascular endothelial cells HMEC-1 under hypoxic conditions and statistical analysis. Detailed Implementation

[0066] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0067] Example 1: Design and synthesis of siRNA targeting GTF2H4 gene mRNA (hereinafter referred to as GTF2H4 siRNA)

[0068] By searching the human GTF2H4 sequence in the NCBI GenBank database (www.ncbi.nlm.nih.gov / gene), siRNA targeting the GTF2H4 gene was designed. The design principles are as follows: (1) The interference target region designed on the GTF2H4 cDNA sequence should be located 50-100 nt downstream of the start codon (AUG), while avoiding intron sequences; (2) Starting from the start codon (AUG) of the human GTF2H4 transcript, search for AA(N 19 )TT or NA(N 21 ) or NAR(N 17 (2) YNN, where N represents any nucleotide, R represents purine (A or G), and Y represents pyrimidine (C or U); (3) Avoid the 5'UTR and 3'UTR, i.e., the non-coding regions of the transcript; (4) Avoid the region within 50-100bp of the start codon and stop codon; (5) Avoid extensions of 4 or more identical bases; (6) Avoid regions with G or C base content <30% or >60%; (7) Avoid single nucleotide polymorphism sites; (8) Use NCBI BLAST (www.ncbi.nlm.nih.gov / BLAST / ) to perform homology comparison on the gene bank data to avoid off-target effects.

[0069] Based on the above principles, the sense and antisense strands of GTF2H4 siRNA were designed, and three GTF2H4 siRNAs were synthesized by Shanghai Qingke Biotechnology Co., Ltd., named GTF2H4 siRNA1, GTF2H4siRNA2, and GTF2H4siRNA3, respectively. All three GTF2H4 siRNAs are double-stranded siRNAs. siRNA NC was provided as a negative control by Shanghai Qingke Biotechnology Co., Ltd.

[0070] The purity of GTF2H4 siRNA1, GTF2H4 siRNA2, GTF2H4 siRNA3, and siRNA NC is all greater than 99%, 2 OD / tube. They can be directly used for cell transfection after dissolution in nuclease-free water. The nucleotide sequences of the sense and antisense strands of the three GTF2H4 siRNAs and siRNA NC are shown in Table 1.

[0071] Table 1. GTF2H4 siRNA nucleotide sequence

[0072]

[0073] Example 2: Detection of the GTF2H4 interference effect of GTF2H4 siRNA in human microvascular endothelial cells HMEC-1

[0074] 1. Transfection

[0075] (1) Human microvascular endothelial cells HMEC-1 (ATCC Cell Bank, USA) were seeded in 6-well plates and cultured in MCDB131 medium containing 10% fetal bovine serum for 24 hours until the cells grew to 70-80% ready for use.

[0076] (2)Use Lipofectamine TM The 3000 transfection reagent (Invitrogen, USA) was used to transfect cells with four different siRNAs (GTF2H4 siRNA1, GTF2H4 siRNA2, GTF2H4 siRNA3, and siRNA NC). The specific steps are as follows: ① Take Lipofectamine TM 3000 Reagent 3.75μl, 125μl Opti-MEM TM ① Mix 5 μg siRNA and 250 μl Opti-MEM in a 1.5 ml EP tube; ② Take 5 μg siRNA and 250 μl Opti-MEM. TM ③ Mix the medium in another 1.5ml EP tube until homogeneous; ④ Combine the systems from steps ① and ② and incubate at room temperature for 10-15 minutes. ⑤ Add the mixed transfection system to each well for transfection.

[0077] (3) Place the cells in a 37°C, 5% CO2 incubator and continue transfection for 48-72 hours.

[0078] 2. Obtaining cDNA

[0079] Total RNA was extracted from siRNA-transfected human microvascular endothelial cells HMEC-1 using Trizol (Invitrogen, USA), and cDNA was obtained by reverse transcription. The specific steps of reverse transcription are as follows:

[0080] (1) Preparation of the reaction system for digesting DNA: 1 μg of total RNA from human microvascular endothelial cells HEMC-1 transfected with siRNA, 2 μl of 5×g DNA Eraser Buffer, and 1 μl of gDNA Eraser (Takara Bio Inc., Japan) were added to the PCR tube, and then nuclease-free water was added to bring the total to 10 μl.

[0081] (2) Invert and mix the prepared reaction system in step (1) and centrifuge. Incubate in a metal bath at 42°C for 2 min to achieve DNA digestion.

[0082] (3) Add 1 μl RNase Free dH2O, 4 μl PrimeScriptRTBuffer 2, 4 μl RT primer Mix and 1 μl PrimeScriptRT Enzyme Mix I (Takara Bio Inc., Japan) to each tube after step (2), mix by inversion and centrifugation, incubate at 37°C for 15 min, terminate the reaction at 85°C for 5 s to obtain cDNA of human microvascular endothelial cells HMEC-1 transfected with siRNA, and store at 4°C.

[0083] 3. RT qPCR was used to identify the interference effect of GTF2H4 siRNA on the GTF2H4 gene.

[0084] A 10 μl qRT PCR reaction system was prepared, consisting of 5 μl TB Green Premix Ex TaqII (Tli RNaseH Plus)2 (Thermo Fisher Scientific), 0.3 μl upstream primer, 0.3 μl downstream primer, 4 μl nuclease-free water, and 0.4 μl cDNA template obtained in step 2. The prepared reaction system was placed on a real-time PCR instrument for RT-qPCR amplification to detect the relative expression level of the GTF2H4 gene in siRNA-transfected human microvascular endothelial cells HMEC-1 (using β-actin as an internal reference gene). The mRNA expression level of GTF2H4 was calculated using the 2ΔΔCT method.

[0085] The upstream primer for amplifying the GTF2H4 gene was 5'GGTATTGGACCGATTGTATG 3' (SEQ ID NO: 9), and the downstream primer was 5'CTTTCCTCCTGAGCCTTG 3' (SEQ ID NO: 10).

[0086] The upstream primer for amplifying the β-actin gene was 5'GTTGTCGACGACGAGCG 3' (SEQ ID NO: 11), and the downstream primer was 5'GCACAGAGCCTCGCCTT 3' (SEQ ID NO: 12).

[0087] 4. Experimental Results

[0088] Test results such as Figure 1 As shown in the figure. The results showed that after transfection of human microvascular endothelial cells HMEC-1 with GTF2H4 siRNA1, GTF2H4 siRNA2 and GTF2H4 siRNA3, the expression level of GTF2H4 mRNA was significantly reduced, with GTF2H4 siRNA1 and GTF2H4 siRNA3 showing the most significant interference effect.

[0089] Example 3: Construction of a lentiviral vector targeting the GTF2H4 gene and identification of its interference effect on the GTF2H4 gene.

[0090] 1. Construction of GTF2H4 shRNA and shRNA NC recombinant lentiviral vectors

[0091] (1) Identify interference targets and design and synthesize primers

[0092] Given that GTF2H4 siRNA1 and GTF2H4 siRNA3 showed the best inhibitory effect on GTF2H4 in Example 2, short hairpin RNAs (shRNAs) were designed based on GTF2H4 siRNA1 and GTF2H4 siRNA3, respectively.

[0093] ① Based on the GTF2H4 siRNA1 sequence, a short hairpin RNA (GTF2H4 shRNA1) sequence was designed and primers were synthesized. The upstream primer is:

[0094] 5'GATCCGTAGCTCTGTGGGTAAAGATTCAAGAGATCTTTACCCACAGAGCTACTTTTTTG 3' (SEQ ID NO: 13),

[0095] The downstream primer is:

[0096] 5'AATTCAAAAAAGTAGCTCTGTGGGTAAAGATCTCTTGAATCTTTACCCACAGAGCTACG 3' (SEQ ID NO: 14);

[0097] ②A short hairpin RNA (GTF2H4 shRNA2) sequence was designed and synthesized based on the GTF2H4 siRNA3 sequence, and primers were synthesized. The upstream primer is:

[0098] 5'GATCCGCCACATGTCTGGCTGTCTTTTCAAGAGAAAGACAGCCAGACATGTGGTTTTTTG 3' (SEQ ID NO: 15),

[0099] The downstream primer is:

[0100] 5'AATTCAAAAAACCACATGTCTGGCTGTCTTTCTCTTGAAAAGACAGCCAGACATGTGGCG 3' (SEQ ID NO: 16).

[0101] ③ Based on the siRNA NC sequence, a short hairpin RNA (shRNA NC) sequence was designed and synthesized, and primers were synthesized. The upstream primer is:

[0102] 5'GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC 3' (SEQ ID NO: 17),

[0103] The downstream primer is:

[0104] 5'AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG 3' (SEQ ID NO: 18).

[0105] (2) Primer annealing forms double-stranded fragments with sticky ends.

[0106] The three pairs of upstream and downstream primers synthesized in (1) were annealed to form double-stranded fragments with sticky ends according to the reaction system of 2 μl 10*oligo Buffer, 1 μl upstream primer, 1 μl downstream primer and 16 μl ddH2O, and the annealing procedure was 95℃ for 10 min, 75℃ for 10 min, 55℃ for 10 min, 35℃ for 10 min and 15℃ for 10 min.

[0107] (3) Vector digestion and fragment ligation

[0108] The reaction mixture of 1 μl vector DNA (1 μg / μl), 4 μl 10* buffer, 32 μl ddH2O, 1.5 μl restriction endonuclease 1, and 1.5 μl restriction endonuclease 2 was incubated in a 37°C water bath for 1–2 h. The DNA was then digested with pHBLV-U6-MCS-PGK-PURO enzymes. After digestion, agarose gel electrophoresis was performed, and the target fragments were recovered from the gel. Using T4 ligase, the double-stranded DNA fragments corresponding to GTF2H4 shRNA1, GTF2H4 shRNA2, and shRNA NC were ligated into the digested pHBLV-U6-MCS-PGK-PURO vector overnight at 16°C to obtain the recombinant lentiviral vectors GTF2H4 shRNA1, GTF2H4 shRNA2, and shRNA NC.

[0109] 2. Preparation of virus concentrate

[0110] (1) 293T cells (ATCC cell bank, USA) were seeded into 6-well plates and cultured in DMEM high glucose medium containing 10% fetal bovine serum. The cells were placed in an incubator at 37°C and 5% CO2. Transfection was performed after the cell density reached 70-80% confluence.

[0111] (2) Using LipofeCtamine 3000 transfection reagent (Shanghai Hanheng Biotechnology Co., Ltd.), 10 μg of GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC recombinant lentiviral vector, 10 μg of viral packaging helper plasmid pSPAX2, and 5 μg of pMD2G (Shanghai Hanheng Biotechnology Co., Ltd.) were co-transfected into the 293T cells of step (1). 16 h after transfection, the medium was replaced with fresh complete medium containing 10% fetal bovine serum.

[0112] (3) Viral supernatant was collected twice, at 48h and 72h after transfection. The viral supernatant in 50mL centrifuge tubes was centrifuged at 2000g for 10min at 4℃ to remove cell debris. Then, the viral stock solution supernatant was collected and placed in an ultracentrifuge tube. It was centrifuged at 82700g for 120min at 4℃. The viral pellet was resuspended in complete culture medium. Finally, the ultracentrifugation resuspended solution was aliquoted into sterilized viral tubes to obtain GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC viral concentrate, which was stored at -80℃.

[0113] 3. Cell infection

[0114] Human microvascular endothelial cells HMEC-1 (ATCC Cell Bank, USA) were infected with the concentrated GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC virus solution prepared in step 2. The specific steps are as follows;

[0115] (1) HMEC-1 cells (ATCC cell bank, USA) were seeded into 6-well plates and cultured in MCDB131 microvascular endothelial cell culture medium containing 10% fetal bovine serum. The cells were placed in an incubator at 37°C and 5% CO2. Infection was carried out after the cell density reached 70-80% confluence.

[0116] (2) Discard half of the culture medium in each well of the 6-well plate in (1) using the 1 / 2 volume infection method, and add 20 μl of GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC virus concentrate; replace with fresh complete culture medium after 6 h; after 48 h, use puromycin for positive screening and amplification culture to obtain the human microvascular endothelial cell line HMEC-1 after virus infection screening.

[0117] 4. Obtaining cDNA and identifying the interference effect of GTF2H4 shRNA on the GTF2H4 gene using RT qPCR

[0118] (1) Total RNA was extracted from human microvascular endothelial cells HMEC-1 infected with concentrated GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC virus using Trizol (Invitrogen, USA), and cDNA was obtained by reverse transcription. The specific steps of reverse transcription are as follows:

[0119] ① Prepare the DNA digestion reaction system: Add 1 μg of total RNA from virus-infected human microvascular endothelial cells (HEMC-1), 2 μl of 5×g DNA Eraser Buffer, and 1 μl of gDNA Eraser (Takara Bio Inc., Japan) to a PCR tube, then add nuclease-free water to a final volume of 10 μl; ② Invert and centrifuge the prepared reaction system from step ①, and incubate at 42°C for 2 min to achieve DNA digestion. ③ Add 1 μl of RNase-free dH2O, 4 μl of PrimeScriptRT Buffer 2, 4 μl of RT primer Mix, and 1 μl of PrimeScriptRT Enzyme Mix I (Takara Bio Inc., Japan) to each tube after step ②, invert and centrifuge, incubate at 37°C for 15 min, and terminate the reaction at 85°C for 5 s to obtain cDNA from virus-transfected human microvascular endothelial cells (HMEC-1), and store at 4°C.

[0120] (2) RT qPCR was used to identify the interference effect of GTF2H4 shRNA on the GTF2H4 gene.

[0121] A 10 μl RT-qPCR reaction system was prepared, consisting of 5 μl TB Green Premix Ex TaqII (Tli RNaseH Plus)2 (Thermo Fisher Scientific), 0.3 μl upstream primer, 0.3 μl downstream primer, 4 μl nuclease-free water, and 0.4 μl cDNA template obtained in step 2. The prepared reaction system was placed on a real-time PCR instrument for RT-qPCR amplification to detect the relative expression level of the GTF2H4 gene in human microvascular endothelial cells HMEC-1 (using β-actin as an internal reference gene). The mRNA expression level of GTF2H4 was calculated using the 2ΔΔCT method.

[0122] The upstream primer for amplifying the GTF2H4 gene was 5'GGTATTGGACCGATTGTATG 3' (SEQ ID NO: 9), and the downstream primer was 5'CTTTCCTCCTGAGCCTTG 3' (SEQ ID NO: 10).

[0123] The upstream primer for amplifying the β-actin gene was 5'GTTGTCGACGACGAGCG 3' (SEQ ID NO: 11), and the downstream primer was 5'GCACAGAGCCTCGCCTT 3' (SEQ ID NO: 12).

[0124] (3) Experimental Results

[0125] Test results such as Figure 2 As shown in the figure. The results indicate that after human microvascular endothelial cells HMEC-1 were infected with concentrated GTF2H4 shRNA1 and GTF2H4 shRNA2 viral solutions, the expression of GTF2H4 mRNA decreased only in cells infected with GTF2H4 shRNA1, indicating that the interference effect of GTF2H4 shRNA1 was significant, while the interference effect of GTF2H4 shRNA2 was not ideal.

[0126] 5. Western blot analysis of the inhibitory effect of GTF2H4 shRNA on GTF2H4 protein.

[0127] (1) Protein extraction and gel electrophoresis

[0128] Total cellular protein was extracted from human microvascular endothelial cells HMEC-1 infected with concentrated GTF2H4 shRNA1 / GTF2H4 shRNA2 / shRNA NC virus using neutral lysis buffer (RIPA:PMSF = 100:1). After denaturation, SDS-PAGE electrophoresis was performed under constant voltage of 200V for 40 min.

[0129] (2) Transfer membrane

[0130] The protein was transferred onto a PVDF membrane under constant current conditions of 300 mA for 100 min.

[0131] (3) Closed

[0132] Transfer the PVDF membrane to an incubation box containing a rapid sealing solution and seal it on a shaker at room temperature for 30 min to 1 h.

[0133] (4) Primary antibody incubation

[0134] The GTF2H4 mouse primary antibody diluted 2000:1 (Santa Cruz, USA) and the GAPDH rabbit primary antibody diluted 1000:1 (Cell Signaling Technology, USA) were added to the blocked PVDF membrane and incubated overnight at 4°C.

[0135] (5) Secondary antibody incubation

[0136] The primary antibody was recovered, and the membrane was washed three times on a shaker for 10 min each time with 1×TBST solution (each L TBST contains 2.42 g Tris, 8.77 g NaCl, 201 ml Tween, pH 7.6). The mouse or rabbit secondary antibody (CellSignaling Technology, USA) diluted 5000:1 was added and the membrane was incubated on a shaker at room temperature for 1 h.

[0137] (6) Development

[0138] After washing the membrane three times on a shaker for 10 minutes each time with 1×TBST solution, prepare the developing solution and develop it using the Bio-Rad chemiluminescence imaging system.

[0139] (7) Experimental Results

[0140] Test results such as Figure 3 As shown in the figure. The results showed that after human microvascular endothelial cells HMEC-1 were infected with concentrated GTF2H4 shRNA1 and GTF2H4 shRNA2 viral solutions, the protein expression of GTF2H4 decreased to varying degrees, with GTF2H4 shRNA1 showing the most significant inhibitory effect.

[0141] Example 4: Effect of GTF2H4 knockdown on hypoxia-induced endothelial-mesenchymal transdifferentiation in human microvascular endothelial cells HMEC-1

[0142] 1. Hypoxia modeling of human microvascular endothelial cells HMEC-1

[0143] The human microvascular endothelial stable cell line with GTF2H4 knockdown constructed in Example 3 and the control cell line were subjected to hypoxia treatment for 3 days under 5% CO2, 95% N2, and serum-free culture conditions.

[0144] 2. Western blot analysis of changes in endothelial and mesenchymal biomarkers in human microvascular endothelial cells (HMEC-1) with GTF2H4 shRNA interference during hypoxia-induced endothelial-mesenchymal transdifferentiation.

[0145] (1) Protein extraction and gel electrophoresis

[0146] Total protein was extracted from cells using neutral lysis buffer (RIPA:PMSF = 100:1), denatured, and then subjected to SDS-PAGE electrophoresis under constant voltage of 200V for 40 min.

[0147] (2) Transfer membrane

[0148] The protein was transferred onto a PVDF membrane under constant current conditions of 300 mA for 100 min.

[0149] (3) Closed

[0150] Transfer the PVDF membrane to an incubation box containing a rapid sealing solution and seal it on a shaker at room temperature for 30 min to 1 h.

[0151] (4) Primary antibody incubation

[0152] The following primary antibodies were added to the blocked PVDF membrane: GTF2H4 mouse primary antibody (Santa Cruz, USA) diluted 2000:1, GAPDH rabbit primary antibody (Cell Signaling Technology, USA) diluted 1000:1, CD31 mouse primary antibody (Cell Signaling Technology, USA) diluted 1000:1, Ve-Cadherin rabbit primary antibody (Cell Signaling Technology, USA) diluted 1000:1, α-SMA rabbit primary antibody (Cell Signaling Technology, USA) diluted 1000:1, Fibronectin rabbit primary antibody (Cell Signaling Technology, USA) diluted 1000:1, and FSP-1 rabbit primary antibody (Cell Signaling Technology, USA) diluted 1000:1. The membrane was then incubated overnight at 4°C.

[0153] (5) Secondary antibody incubation

[0154] The primary antibody was recovered, and the membrane was washed three times on a shaker for 10 min each time with 1×TBST solution (each L TBST contains 2.42 g Tris, 8.77 g NaCl, 201 ml Tween, pH 7.6). The mouse or rabbit secondary antibody (CellSignaling Technology, USA) diluted 5000:1 was added and the membrane was incubated on a shaker at room temperature for 1 h.

[0155] (6) Development

[0156] After washing the membrane three times on a shaker for 10 minutes each time with 1×TBST solution, prepare the developing solution and develop it using the Bio-Rad chemiluminescence imaging system.

[0157] 3. Experimental results

[0158] The expression of endothelial and stromal biomarkers can be found in the table below. Figure 4 (shGTF2H4 is a stable human microvascular endothelial cell line with GTF2H4 knockdown, and shGTF2H4 NC is the control cell line). The results showed that, compared with shGTF2H4NC, shGTF2H4 significantly increased the expression of endothelial markers Ve-Cadherin and CD31, and significantly inhibited the expression of mesenchymal markers Fibronectin, α-SMA, and FSP-1, meaning that shGTF2H4 could significantly inhibit hypoxia-induced endothelial-mesenchymal transdifferentiation of human microvascular endothelial cells.

[0159] Example 5: Effect of GTF2H4 knockdown on the migration of human microvascular endothelial cells HMEC-1 under hypoxic conditions

[0160] 1. Hypoxia modeling of human microvascular endothelial cells HMEC-1

[0161] The human microvascular endothelial stable cell line with GTF2H4 knockdown constructed in Example 4 and the control cell line were subjected to hypoxia treatment for 3 days under 5% CO2, 95% N2, and serum-free culture conditions.

[0162] 2. Transwell experiment

[0163] (1) Digest the hypoxic cells with 0.25% trypsin, centrifuge at 1000 rpm for 5 min after terminating with complete culture medium, and resuspend in serum-free MCDB131 basal medium.

[0164] (2) 2×10 per hole 4 Cell number: 200 μl of suspension was seeded into the upper chamber of a Transwell chamber (Beijing Lanjieke Technology Co., Ltd.), while 500 μl of MCDB131 medium containing 10% fetal bovine serum was added to the lower chamber of the Transwell chamber.

[0165] (3) The Transwell chamber was placed in an incubator at 37°C and 5% CO2 for 24 h. After the culture, it was fixed with 4% PFA at room temperature for 30 min, washed twice with PBS, stained with 0.1% crystal violet at room temperature for 10 min, and then washed twice with PBS.

[0166] (4) Image acquisition and statistical analysis: Taking pictures under an inverted microscope and performing statistical analysis.

[0167] 3. Experimental results

[0168] Transwell migration and statistical analysis can be found in [link to data]. Figure 5 (shGTF2H4 is a stable human microvascular endothelial cell line with GTF2H4 knockdown, and shGTF2H4 NC is the control cell line). The results showed that, compared with shGTF2H4 NC, shGTF2H4 significantly inhibited the migration of human microvascular endothelial cells HMEC-1 under hypoxic conditions.

[0169] Example 6: Effect of GTF2H4 knockdown on tube formation in human microvascular endothelial cells HMEC-1 under hypoxic conditions

[0170] 1. Hypoxia modeling of human microvascular endothelial cells HMEC-1

[0171] The human microvascular endothelial stable cell line with GTF2H4 knockdown constructed in Example 4 and the control cell line were subjected to hypoxia treatment for 3 days under 5% CO2, 95% N2, and serum-free culture conditions.

[0172] 2. Tube forming experiment

[0173] (1) Spread the matrix gel (Corning Corporation, USA) in 50 μl per well into the 96-well plate and place it in an incubator at 37°C and 5% CO2 for 30 min to allow the matrix gel to solidify.

[0174] (2) Digest the hypoxic cells with 0.25% trypsin, centrifuge at 1000 rpm for 5 min after terminating with complete culture medium, and resuspend in fresh complete culture medium.

[0175] (3) 3×10 per hole 4 Cell count: 50 μl of suspension was seeded into 96-well plates coated with matrix gel.

[0176] (4) Place the 96-well plate in an incubator at 37°C and 5% CO2 for 6 hours.

[0177] (5) Image acquisition and statistical analysis: take pictures under an inverted microscope and perform statistical analysis using Image J.

[0178] 3. Experimental results

[0179] The formation and statistical analysis of tubules can be found in [see...]. Figure 6 (shGTF2H4 is a stable human microvascular endothelial cell line with GTF2H4 knockdown, and shGTF2H4 NC is the control cell line). The results showed that, compared with shGTF2H4 NC, shGTF2H4 significantly promoted tube formation in human microvascular endothelial cells under hypoxic conditions.

[0180] The human microvascular endothelial stable cell line with GTF2H4 knockdown constructed in this invention is a GTF2H4 low-expression cell line, laying the foundation for in-depth research on the molecular mechanism of endothelial mesenchymal transformation.

[0181] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make several improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. sequence list <110> Zhongshan Hospital Affiliated to Fudan University <120> A cell line that slows endothelial-mesenchymal transition and expresses low levels of siRNA and GTF2H4 <141> 2022-04-24 <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 1 guagcucugu ggguaaagat t 21 <210> 2 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 2 ucuuuaccca cagagcuact t 21 <210> 3 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 3 cucccauccu uggcuaagat t 21 <210> 4 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 4 ucuuagccaa ggaugggagt t 21 <210> 5 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 5 ccacaugucu ggcugucuut t 21 <210> 6 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 6 aagacagcca gacauguggt t 21 <210> 7 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 7 uucuccgaac gugucacgut t 21 <210> 8 <211> 21 <212> DNA / RNA <213> Artificial Sequence <400> 8 acgugacacg uucggagaat t 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 ggtattggac cgattgtatg 20 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 ctttcctcct gagccttg 18 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <400> 11 gttgtcgacg acgagcg 17 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <400> 12 gcacagagcc tcgcctt 17 <210> 13 <211> 59 <212> DNA <213> Artificial Sequence <400> 13 gatccgtagc tctgtgggta aagattcaag agatctttac ccacagagct acttttttg 59 <210> 14 <211> 59 <212> DNA <213> Artificial Sequence <400> 14 aattcaaaaa agtagctctg tgggtaaaga tctcttgaat ctttacccac agagctacg 59 <210> 15 <211> 60 <212> DNA <213> Artificial Sequence <400> 15 gatccgccac atgtctggct gtcttttcaa gagaaagaca gccagacatg tggttttttg 60 <210> 16 <211> 60 <212> DNA <213> Artificial Sequence <400> 16 aattcaaaaa accacatgtc tggctgtctt tctcttgaaa agacagccag acatgtggcg 60 <210> 17 <211> 64 <212> DNA <213> Artificial Sequence <400> 17 gatccgttct ccgaacgtgt cacgtaattc aagagattac gtgacacgtt cggagaattt 60 tttc 64 <210> 18 <211> 64 <212> DNA <213> Artificial Sequence <400> 18 aattgaaaaa attctccgaa cgtgtcacgt aatctcttga attacgtgac acgttcggag 60 aacg 64

Claims

1. A substance capable of inhibiting GTF2H4 expression, characterized in that, It is either A1) or A2) below: A1): siRNA1, whose forward and reverse nucleotide sequences are shown in SEQ ID NO: 1-2; A2): siRNA3, whose forward and reverse nucleotide sequences are shown in SEQ ID NO: 5-6.

2. Application of siRNAs with forward and reverse nucleotide sequences as shown in SEQ ID NO: 1-2 in the preparation of products for constructing expression vectors, cell models or animal models with low expression of GTF2H4.