Adenine deaminase, adenine base editor comprising same, and use thereof

Abstract

The application discloses an adenine deaminase, an adenine base editor comprising the same and application thereof. The adenine deaminase has one or more amino acid mutations at positions 29, 84, 108 and 145 of an amino acid sequence as shown in SEQ ID NO: 1. The adenine base editor of the application comprises a nuclease and the adenine deaminase, can effectively destroy the non-specific binding of the adenine deaminase to a substrate base, narrow the editing window to 1-2 bases, maintain a high editing activity, change the structure pocket caused by the mutation, make the adenine deaminase unable to recognize cytosine as a substrate, finally completely eliminate the independent cytosine editing event existing in the ABE, keep a low indel, improve the safety, promote the application in precision medicine, animal disease model preparation, crop genetic breeding and the like, and have great application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of gene editing, and particularly relates to an adenine deaminase, an adenine base editor comprising the same, and application thereof. BACKGROUND

[0002] The essence of human genetic disease is due to gene mutation, about 60% of genetic diseases are caused by single base mutation, and traditional homologous recombination mediated by genome editing technology to correct such genetic diseases is very inefficient (0.1%-5%). The single base editor (Base editor) derived from the CRISPR system is a new efficient base editing technology in recent years, which has shown great application prospects in basic research and clinical disease treatment due to its advantages of no DNA double-strand break, no need for recombination template, and high-efficiency editing.

[0003] The classic base editor is mainly divided into cytosine base editor and adenine base editor, the former is composed of a Cas9 protein spCas9n derived from Streptococcus pyogenes with impaired activity, a cytosine deaminase rAPOBEC1 derived from rats, and a uracil glycosylase inhibitor, wherein the Cas9 protein recognizes and specifically binds to DNA with NGG as PAM, and then under the action of deaminase and DNA repair, finally realizes the replacement of C / G-T / A in the 20bp range of the target sequence upstream of NGG (21-23), and the editing window is mainly located at 4-8; the latter is a fusion of a bacterial-derived TadA (adenine deaminase) and spCas9, which is assisted by directional evolution and protein engineering technology, and after 7 rounds of evolution, an adenine base editor ABE7.10 capable of acting on single-stranded DNA is finally obtained, and the active editing region is mainly located at 4-7. The average editing efficiency of this system in human cells is about 53% for A / T-G / C, which is much higher than the efficiency of base mutation mediated by homologous recombination, and the product purity is as high as 99.9% and the indel (insertion-deletion) occurrence is very low. More importantly, about 47% of human pathogenic point mutations are formed by C·G to T·A, and the adenine base editor is expected to correct nearly half of the pathogenic point mutations, showing its great potential in mutation base modification and genetic disease treatment. At present, ABE has been widely used in animal model preparation and gene therapy.

[0004] To solve the problems of low editing efficiency and narrow editing window of ABE7.10, various optimization and modification work have been carried out in different laboratories. By using the strategy of replacing nuclear localization signal and codon optimization, ABEmax was obtained, which improved the editing efficiency of A to G by 7.1 times compared with ABE7.10. The fusion CP-Cas9 variant constructed CP-ABEmax series expanded the editing window from 4-7 to 4-12, but the editing activity was still similar to ABEmax. In addition, to further expand the targeting range of ABE, ABE with different PAM selectivity was also developed, such as VQR-ABE (PAM: NGA), VRQR-ABE (PAM: NGA), SaCas9-ABE (PAM: NNGRRT), SaKKH-ABE (PAM: NNNRRT), VRER-ABE (PAM: NGCG), xABEmax (PAM: NGN), NG-ABEmax (PAM: NG). With the help of molecular evolution technology, the latest reported ABE8e (Richter MF, et al. Phage-assisted evolution of an adenine base editor with improved cas domain compatibility and activity. Nat Biotechnol, 2020, 38: 883-891) and ABE8s (Gaudelli NM, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol, 2020, 38: 892-900) significantly improved the base editing efficiency again. The activity of ABE8e was 590 times higher than that of ABE7.10, and the editing range was further expanded, which could cover 3-14 sites. This inevitably produced serious "bystander effect", that is, all adenines in the window will be edited. ABE8e and ABE8s cannot distinguish target A and non-target A when performing editing function, so high-precision and high-activity adenine base editor is still lacking for clinical application of precision medicine. At the same time, several groups reported that ABE has harmful cytosine editing (Li S, et al. Docking sites inside cas9 for adenine base editing diversification and rna off-target elimination. Nat Commun, 2020, 11: 5827; Kurt IC, et al.Crispr c-to-g base editors for inducing targeted DNAtransversions in human cells. Nat Biotechnol, 2021, 39: 41-46; Kim HS, et al. Adenine base editors catalyze cytosine conversions in human cells. Nat Biotechnol, 2019, 37: 1145-1148; Kim HS, et al. Adenine base editors catalyze cytosine conversions in human cells. Nat Biotechnol, 2019, 37: 1145-1148; Grunewald J, et al. Crispr DNA base editors with reduced rna off-target and self-editing activities. Nat Biotechnol, 2019, 37: 1041-1048), which inevitably arouses the concern about the safety of ABE application.

[0005] At present, there is no report on narrowing the editing window of ABE to 1-2 bases, and there is still a lack of effective base editors for precise adenine editing. Meanwhile, the harmful cytosine editing produced by ABE has not been completely eliminated, and the safety problem of ABE needs to be solved urgently. SUMMARY

[0006] The technical problem to be solved by the present application is to overcome the lack of adenine deaminase capable of significantly reducing bystander adenine and cytosine editing in the prior art, and to provide a precise and efficient adenine deaminase, an adenine base editor comprising the same, and an application thereof. The adenine base editor of the present application can greatly reduce bystander adenine and almost completely remove bystander cytosine editing, and even narrow the editing window to 1-2 bases, which has extremely high safety.

[0007] The inventors predicted several key catalytic sites in TadA-8e through structural biology, and on this basis, obtained single-point mutants based on TadA-8e through amino acid substitution, and unexpectedly found that part of the single-point mutants greatly destroyed the non-specific binding of adenine deaminase to the substrate adenine, while maintaining a high editing activity; on the basis of the single-point mutants, further double-point mutants were obtained through amino acid substitution, and it was found that the double-point mutants could narrow the editing window to 1-2 bases, while maintaining a high editing activity, and the structural pocket changes caused by the mutation also made the adenine deaminase unable to recognize cytosine as a substrate, ultimately completely eliminating the independent cytosine editing events existing in ABE, and in addition, still maintaining a low indel.

[0008] The present application solves the above technical problems through the following technical solutions.

[0009] The first aspect of the present application provides an adenine deaminase, wherein one or more amino acid mutations occur at positions 29, 84, 108 and 145 of an amino acid sequence as shown in SEQ ID NO: 1.

[0010] Preferably, the one or more amino acid mutations comprise:

[0011] the amino acid residue N at position 108 is mutated to Q; or,

[0012] the amino acid residue L at position 145 is mutated to T; or,

[0013] the amino acid residue L at position 145 is mutated to Q; or,

[0014] the amino acid residue F at position 84 is mutated to T; or,

[0015] the amino acid residue F at position 84 is mutated to T, and the amino acid residue N at position 108 is mutated to Q; or,

[0016] the amino acid residue N at position 108 is mutated to Q, and the amino acid residue L at position 145 is mutated to T; or,

[0017] the amino acid residue N at position 108 is mutated to Q, and the amino acid residue P at position 29 is mutated to M; or,

[0018] the amino acid residue N at position 108 is mutated to Q, and the amino acid residue P at position 29 is mutated to W.

[0019] In the present application, the nucleotide sequence of the adenine deaminase with the amino acid sequence as shown in SEQ ID NO: 1 is as shown in SEQ ID NO: 2.

[0020] In the present application, the adenine deaminase further comprises one or more amino acid mutations at other sites as shown in SEQ ID NO: 1, and the mutant formed has the same or similar function or biological activity as the adenine deaminase of the first aspect.

[0021] In some embodiments of the present application, the adenine deaminase further comprises a nuclear localization signal sequence; the nuclear localization signal sequence can be conventional in the art, for example, the nuclear localization signal sequence as shown in SEQ ID NO: 3.

[0022] The second aspect of the present application provides an adenine base editor, which comprises a nuclease and the adenine deaminase of the first aspect.

[0023] In some embodiments of the present application, the nuclease is a Cas protein and a variant thereof;

[0024] In some preferred embodiments of the present application, the Cas protein is spCas9 derived from Saccharomyces cerevisiae, SaCas9 derived from Staphylococcus aureus, LbCas12a derived from Lachnospiraceae bacteria, or enAsCas12a derived from Acidaminococcus bacteria; and the Cas protein variant is VQR-spCas9, VRER-spCas9, spRY, spNG, SaCas9-KKH, or SaCas9-NG.

[0025] In some embodiments of the present application, the adenine base editor significantly reduces bystander adenine editing and bystander cytosine editing.

[0026] In some embodiments of the present application, the adenine base editor can greatly narrow the editing range, precisely edit 1-2 bases, and at the same time maintain a low indel event occurrence.

[0027] The third aspect of the present application provides a fusion protein comprising the adenine deaminase of the first aspect.

[0028] In some embodiments of the present application, the fusion protein further comprises a nuclease, and the nuclease is defined as in the second aspect.

[0029] In the present application, the sequence composition encoding the fusion protein can be promoter-adenine deaminase-nuclease-polyA, as long as it can provide an editing efficiency of A>G not lower than that of ABE8e; wherein the promoter and the polyA can be conventional in the art.

[0030] The promoter can be CMV, or other types of promoters such as CAG, PGK, EF1a, muscle-specific promoter Ctsk, liver-specific promoter Lp1, etc.

[0031] The polyA can be bovine growth hormone polyadenylation signal BGH polyA, or other biological sources of polyadenylation signal.

[0032] The sequence composition is, for example, CMV-adenine deaminase-Cas9n-BGH polyA.

[0033] The fourth aspect of the present application provides an adenine base editor system, comprising: sgRNA and the adenine base editor as described in the second aspect.

[0034] In some embodiments of the present application, the target sequence of the sgRNA is as shown in the nucleotide sequence of SEQ ID NO: 4-15.

[0035] The fifth aspect of the present application provides a pharmaceutical composition, comprising the adenine deaminase as described in the first aspect, the adenine base editor as described in the second aspect, the fusion protein as described in the third aspect, or the adenine base editor system as described in the fourth aspect.

[0036] The sixth aspect of the present application provides a base editing method for non-therapeutic purposes, comprising:

[0037] Expressing the adenine deaminase as described in the first aspect, the adenine base editor as described in the second aspect, the fusion protein as described in the third aspect, or the adenine base editor system as described in the fourth aspect in a target cell, so that the target cell is subjected to base editing, preferably further comprising adding sgRNA, the target sequence of which is as shown in the nucleotide sequence of SEQ ID NO: 4-15.

[0038] In some embodiments of the present application, the source of the target cell is an isolated cell line.

[0039] In some preferred embodiments of the present application, the isolated cell line is 293T cell, HELA cell, U2OS cell, NIH3T3 cell or N2A cell.

[0040] In the present application, the non-therapeutic purposes are, for example, evaluating the adenine deaminase, the adenine base editor, the fusion protein or the adenine base editor system described in the present application in the laboratory by detecting the editing of the target cell. Conversely, the function of the target cell can also be studied by base editing.

[0041] In the present application, the base editing method can also be for therapeutic purposes. In the present application, the treatment refers to treating diseases of a subject, such as a human, including inhibiting the occurrence or development of the disease, relieving the symptoms of the disease, or curing the disease.

[0042] In the present application, the target cell can be a eukaryotic cell, a prokaryotic cell, or a paleobiological cell different from the prokaryotic cell.

[0043] Preferably, the target cell can express the fusion protein as described in the third aspect.

[0044] More preferably, the target cell can be a plant cell, a human cell, or an animal cell.

[0045] The seventh aspect of the present application provides use of the adenine deaminase as described in the first aspect, the adenine base editor as described in the second aspect, the fusion protein as described in the third aspect, or the adenine base editing system as described in the fourth aspect in the preparation of a base editing drug or a gene therapy drug.

[0046] The eighth aspect of the present application provides use of the adenine deaminase as described in the first aspect, the adenine base editor as described in the second aspect, the fusion protein as described in the third aspect, or the adenine base editing system as described in the fourth aspect in the construction of an animal model and crop breeding.

[0047] The ninth aspect of the present application provides use of the adenine deaminase as described in the first aspect, the adenine base editor as described in the second aspect, the fusion protein as described in the third aspect, or the adenine base editing system as described in the fourth aspect in the preparation of a base editing tool.

[0048] On the basis of common general knowledge in the art, the above-mentioned preferred conditions can be combined in any manner, thereby obtaining various preferred examples of the present application.

[0049] The reagents and raw materials used in the present application are commercially available.

[0050] The positive progress effect of the present application is that:

[0051] The adenine base editor of the present application can effectively destroy the non-specific binding of adenine deaminase to the substrate base, narrow the editing window to 1-2 bases, while maintaining high editing activity; the structural pocket change caused by mutation also makes the adenine deaminase unable to recognize cytosine as a substrate, ultimately completely eliminating the independent cytosine editing event existing in ABE; and maintains a low indel, improves safety, and can promote its application in precision medicine, animal disease model making, crop genetic breeding, etc., and has great application value. BRIEF DESCRIPTION OF DRAWINGS

[0052] Figure 1 Crystal structure of ABE8e binding to substrate DNA (PDB: 6VPC).

[0053] Figure 2 Schematic diagram of comparison results of A>G base editing achieved by 21 ABE8e mutants at FANCF site1 site on 293T.

[0054] Figure 3 Schematic diagram of comparison results of A4 and C6 base editing achieved by 21 ABE8e mutants at FANCF site1 site on 293T.

[0055] Figure 4 Schematic diagram of comparison results of A>G, C>G, C>T, C>A base editing generated by ABE8e and ABE8e-N108Q at 4 target sites on 293T.

[0056] Figure 5 Schematic diagram of comparison results of A>G base editing achieved by 19 ABE8e combination mutants at ABE-site3 and ABE-site10 sites on 293T.

[0057] Figure 6 Schematic diagram of comparison results of A and C base editing efficiency achieved by ABE9s and ABE9.1s at ABE-site10, HEK-site7 sites on 293T.

[0058] Figure 7 Schematic diagram of comparison results of A>G editing efficiency achieved by ABE9s, ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s at ABE-site16, ABE-site17, ABE-site13 and ABE-site8 endogenous target sites on 293T.

[0059] Figure 8 Schematic diagram of comparison results of indel generated by ABE9s, ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s at ABE-site16, ABE-site17, ABE-site13 and ABE-site8 endogenous target sites on 293T. DETAILED DESCRIPTION

[0060] The present application will be further described by way of examples, but the present application is not limited to the examples. The experimental methods in the following examples, for which specific conditions are not indicated, are selected according to conventional methods and conditions, or according to the instructions of the commercial products.

[0061] In the mutants used in the examples, the codons encoding the mutation sites are shown in Table 1.

[0062] Table 1 TadA single point mutation sequence

[0063]

[0064]

[0065] The target points and their sequences used in the examples are shown in Table 2.

[0066] Table 2 Target points and sequences used

[0067] Target name Sequence (5'-3') SEQ ID NO FANCF site1 GGAATCCCTTCTGCAGCACC 4 EGFR-library-sg4 AAGATCAAAGTGCTGGGCTC 5 HBG-sg1 CTTGTCAAGGCTATTGGTCA 6 EMX1-sg2p GACATCGATGTCCTCCCCAT 7 HBG-sg8 CAGGACAAGGGAGGGAAGGA 8 ABE-site3 GTCAAGAAAGCAGAGACTGC 9 ABE-site10 GAACATAAAGAATAGAATGA 10 HEK-site7 GGAACACAAAGCATAGACTG 11 ABE-site16 GGGAATAAATCATAGAATCC 12 ABE-site17 GACAAAGAGGAAGAGAGACG 13 ABE-site13 GAAGATAGAGAATAGACTGC 14 ABE-site8 GTAAACAAAGCATAGACTGA 15

[0068] The identification primers of the target points used in the examples are shown in Table 3.

[0069] Table 3 Identification primers of target points used

[0070]

[0071]

[0072] Wherein: F is a forward primer, and R is a reverse primer.

[0073] The seamless cloning kit used in the examples is Vazyme ClonExpress MultiS One Step Cloning Kit, C113-01.

[0074] The HEK293T cells used in the examples are ATCC CRL-3216 cell lines.

[0075] The nucleotide sequence of the plasmid U6-sgRNA-EF1α-GFP used in the examples is shown in SEQ ID NO: 40, wherein the coding sequence of the sgRNA targeting the target sequence is represented by consecutive Ns.

[0076] The service provider for sequencing in the examples is Suzhou Jinyu Zhi Biological Technology Co., Ltd.

[0077] Example 1

[0078] 1.1 Plasmid design and construction

[0079] 1.1.1 As shown in Table 1, 21 single point mutants of ABE8e were designed according to the crystal structure of ABE8e binding to substrate DNA captured by cryo-EM, and 1 endogenous test target FANCF site1 from human (as shown in Table 2) was designed for screening evaluation. Figure 1

[0080] ​1.1.2 Synthesize 21 ABE8e single point mutants according to the sequences in Table 1, using ABE8e as the carrier, and then perform seamless cloning assembly, i.e. synthesize two oligos according to Table 2, add CACC to the positive strand and AAAC to the reverse strand, and ligate to U6-sgRNA-EF1a-GFP which has been digested with Bbsl enzyme.

[0081] 1.1.3 Perform sanger sequencing on the plasmids constructed in 1.1.1 and 1.1.2 to ensure that the sequences are completely correct.

[0082] 1.2 Cell transfection

[0083] Day 1: Seed 24-well plates with 293T cells

[0084] (1) Digest HEK293T cells and inoculate 96-well plates at 2 x 10 5 cells / well.

[0085] Note: After cell recovery, generally need to be passaged twice before being used for transfection experiments.

[0086] Day 2: Transfection

[0087] (2) Observe the state of cells in each well.

[0088] Note: The cell density before transfection should be 70% to 90%, and the state should be normal.

[0089] (3) The amount of plasmid transfection is as follows (using ABE8e as a control):

[0090] ABE8e single point mutant: U6-sgRNA-EF1a-GFP = 750 ng: 250 ng

[0091] Set n = 3 wells / group.

[0092] 1.3 Genomic extraction and preparation of amplicon library

[0093] Genomic DNA was extracted 72h post-transfection using the TIANamp Genomic DNA Kit (DP304). The corresponding primers were designed (as shown in Table 3) according to the protocol of the Hi-Tom Gene Editing Detection Kit (Novogene), i.e. a bridged sequence 5'-ggagtgagtacggtgtgc-3' (SEQ ID NO:41) was added to the 5' end of the forward primer and a bridged sequence 5'-gagttggatgctggatgg-3' (SEQ ID NO:42) was added to the 5' end of the reverse primer, to obtain a first-round PCR product. The first-round PCR product was then used as a template for a second-round PCR to obtain a second-round PCR product, which was then mixed together, purified by gel recovery, and sent to the company for sequencing.

[0094] 1.4 Analysis and statistics of deep sequencing results

[0095] The deep sequencing results were analyzed using the BE-analyzer website (http: / / www.rgenome.net / be-analyzer / #!) to calculate the ratios of A>G, C>T, C>G, C>A, and Indel, and the results were plotted using Graphpad Prism 9.1.0, as shown in Table 4 and Figures 2-4

[0096] 1.5 Analysis of results

[0097] As shown in Table 4 and Figure 2 According to the Sanger results, among the 21 single-point mutants of ABE8e, ABE8e-L145T, ABE8e-L145Q, ABE8e-N108Q, and ABE8e-F84T all significantly reduced the editing of bystander A3 while maintaining the editing efficiency of the targeted base A4.

[0098] Table 4 Editing efficiency results of target FANCF site 1 (unit, %)

[0099]

[0100]

[0101]

[0102] As Figure 3 ​As shown, deep sequencing evaluation of bystander C6 editing, ABE8e produced bystander cytosine editing of 45.2% (C>G+C>T+C>A), while the above four single-point mutants produced editing efficiencies of only 5.07%, 3.67%, 2.44%, 2.93%, respectively, among which ABE8e-N108Q reduced the harmful cytosine editing by 94.6% the highest.

[0103] As shown in Figure 4 ABE8e-N108Q was selected for further verification at another four endogenous target sites (EGFR-library-sg4, HBG1-sg1, EMX1-sg2p, HBG-sg8), and the results showed that: compared with ABE8e, for the EGFR-library-sg4 target site, ABE8e-N108Q reduced bystander cytosine editing from 13.7% to 3.13%, for the HBG-sg1 target site, bystander cytosine editing was reduced from 16.4% to 5.17%, for the EMX1-sg2P target site, bystander cytosine editing was reduced from 14.5% to 1.9%, and for the HBG-sg8 target site, bystander cytosine editing was reduced from 9.33% to 1.2%.

[0104] In summary, ABE8e-L145T, ABE8e-L145Q, ABE8e-N108Q and ABE8e-F84T all significantly reduced bystander adenine editing and bystander cytosine editing.

[0105] Example 2

[0106] To completely eliminate bystander cytosine editing and achieve precise editing of a single A>G, this embodiment was designed.

[0107] 2.1 Plasmid design and construction

[0108] 2.1.1 Based on the screening results of single-point mutations in Example 1, the amino acid sites that potentially affect the substrate structure were combined and mutated according to the crystal structure of ABE8e, and were synthesized for seamless cloning assembly. At the same time, two endogenous test targets ABE site10 and ABE site3 rich in poly A were designed for testing (as shown in Table 2), and the construction method was the same as 1.1.2.

[0109] 2.1.2 The plasmids constructed in 2.1.1 were sequenced by sanger to ensure complete correctness.

[0110] 2.2 Cell transfection

[0111] Day 1: 293T cells were seeded in a 24-well plate

[0112] (1) Digest HEK293T cells, according to 2x10 5Cell / well seeded 96-well plate.

[0113] Note: After cell recovery, generally need to pass 2 times to be used for transfection experiment.

[0114] Day 2: Transfection

[0115] (2) Observe the state of cells in each well.

[0116] Note: The cell density before transfection should be 70%-90%, and the state is normal.

[0117] (3) The amount of plasmid transfection is as follows (ABE8e as control)

[0118] 2.1 Newly constructed plasmid: U6-sgRNA-EF1a-GFP = 750 ng:250 ng

[0119] Set n = 3 wells / group.

[0120] 2.3 Genome extraction and preparation of amplicon library

[0121] 72h after transfection, use Tian Gen cell genomic extraction kit (DP304) to extract cell genomic DNA. Then use the operation process of Hitom kit, design the corresponding identification primer (as shown in Table 3), that is, add the bridging sequence as shown in SEQ ID NO: 38 at the 5' end of the forward primer, and add the bridging sequence as shown in SEQ ID NO: 39 at the 5' end of the reverse primer, to obtain a round of PCR product, then use the first round of PCR product as a template to perform a second round of PCR to obtain a second round of PCR product, then mix together for gel recovery and purification and then send to the company for sequencing.

[0122] 2.4 Analysis and statistics of deep sequencing results

[0123] Use BE-analyzer website (http: / / www.rgenome.net / be-analyzer / #!) to analyze the deep sequencing results, that is, to calculate the ratio of A>G, C>T, C>G, C>A, Indel, and use Graphpad Prism 9.1.0 for statistical mapping.

[0124] 2.5 Results analysis

[0125] As Figure 5As shown, according to Sanger's results, among the 19 combined mutations, N108Q-L145T, N108Q-P29M, N108Q-P29W, and N108Q-F84T exhibited extremely narrow editing windows, targeting a range of approximately 1–2 bases. For the ABEsite3 target, ABE8e's editing range is ~5 bases, while the previously reported F148A mutation, which possesses the potential to narrow the window, also has an editing range of ~4 bases. ABE8e-N108Q's editing window is ~3 bases, while the four combined mutations edit only 1 base, and efficiently and precisely edit A5. Similarly, for the ABE site10 target, ABE8e covers ~7 bases, and the ABE8e-F148A target region covers ~4 bases. For the single-point mutation ABE8e-N108Q, the editing range remains ~3 bases, while N108Q-L145T and N108Q-P29M edit ~2 bases, also efficiently catalyzing the A>G at the fifth position. N108Q-P29W and N108Q-F84T precisely edit one base A5, with only a partial decrease in editing activity. For ease of description, ABE8e-N108Q is named ABE9s, and N108Q-L145T, N108Q-P29M, N108Q-P29W, and N108Q-F84T are named ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s, respectively. The editing windows of ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s are approximately 1–2 bases, with the selectivity of adenine editing becoming progressively stricter.

[0126] like Figure 6 As shown, taking ABE9.1s as an example, and using ABE site10 and the newly designed endogenous target HEK site7 as evaluation targets, the bystander cytosine editing characteristics of the combined mutation were evaluated again. The results showed that, compared with ABE9s, ABE9.1s completely eliminated harmful cytosine editing, narrowed the window to 1-2 bases, and preferentially edited A5 / A6 bases.

[0127] In summary, the combined mutations of ABE8e, N108Q-L145T, N108Q-P29M, N108Q-P29W, and N108Q-F84T, can precisely edit 1 to 2 bases while completely eliminating harmful cytosine editing.

[0128] Example 3

[0129] This embodiment was designed to compare the operating characteristics of ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s.

[0130] 3.1 Plasmid Design and Construction

[0131] 3.1.1. Design 4 additional target sites ABE-site 16, ABE-site 17, ABE-site 13 and ABE-site 8 (as shown in Table 2) for evaluation, with ABE8e and ABE9s as controls.

[0132] 3.1.2. Sanger sequencing of the plasmids constructed in 3.1.1 to ensure complete correctness.

[0133] 3.2 Cell transfection

[0134] Day 1: Seed 24-well plate with 293T cells

[0135] (1) Digest HEK293T cells, seed 96-well plate at 2 x 10 5 cells / well.

[0136] Note: After cell recovery, generally need to be subcultured twice before being used for transfection experiments.

[0137] Day 2: Transfection

[0138] (2) Observe the state of cells in each well.

[0139] Note: The cell density should be 70% to 90% before transfection, and the state should be normal.

[0140] (3) The amount of plasmid transfection is as follows (with ABE8e as control):

[0141] 3.1. New plasmid constructed in: U6-sgRNA-EF1a-GFP = 750 ng: 250 ng

[0142] Set n = 3 wells / group.

[0143] 3.3 Genome extraction and preparation of amplicon library

[0144] 72 h after transfection, extract cell genomic DNA using the Tian Gen cell genomic extraction kit (DP304). Then use the Hitom kit operation process, design the corresponding identification primers (as shown in Table 3), i.e. add a bridging sequence as shown in SEQ ID NO: 38 to the 5' end of the forward primer, and a bridging sequence as shown in SEQ ID NO: 39 to the 5' end of the reverse primer, to obtain a round of PCR product. Then use the first round of PCR product as a template to perform a second round of PCR to obtain a second round of PCR product. Then mix together, purify by gel recovery, and then send to the company for sequencing.

[0145] 3.4 Analysis and statistics of deep sequencing results

[0146] The deep sequencing results were analyzed using the BE-analyzer website (http: / / www.rgenome.net / be-analyzer / #!) to count the ratios of A>G, C>T, C>G, C>A, and Indel, and statistical mapping was performed using Graphpad Prism 9.1.0.

[0147] 3.5 Result analysis

[0148] As shown in Figure 7 , at the ABE site16 site, the corresponding ABE8e editing window is ~5 bases, ABE9s can cover ~4 bases, and ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s only edit 1-2 bases; at the ABE site13 and ABE site13 sites, the editing range of ABE8e is ~5 bases, the coverage range of ABE9s is 3-4 bases, and among ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s, except for ABE9.1s with slight A7 or A4 editing, the remaining three variants only edit one base. For the ABE site17 site, the editing range of ABE8e is ~6 bases, the editing range of ABE9s is ~3 bases, ABE9.1s and ABE9.2s mainly edit 2 bases (A5 / A6), and ABE9.3s and ABE9.4s still accurately edit a single base.

[0149] In summary, ABE9s can slightly narrow the editing range, while ABE9.1s, ABE9.2s, ABE9.3s, and ABE9.4s accurately edit 1-2 bases, while maintaining a low incidence of indel events (as shown in Figure 8 ). SEQUENCE LISTING <110> East China Normal University Shanghai Bangyao Biotechnology Co., Ltd. <120> Adenine deaminase, adenine base editor comprising same, and application thereof <130> P21016504C <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 167 <212> PRT <213> Artificial Sequence <220> <223> TadA <400> 1 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala 35 40 45 Ile Gly Leu His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg Asn Ser Lys Arg Gly 100 105 110 Ala Ala Gly Ser Leu Met Asn Val Leu Asn Tyr Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Cys Asp Phe Tyr Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Ile Asn 165 <210> 2 <211> 501 <212> DNA <213> Artificial Sequence <220> <223> TadA <400> 2 atgtctgagg tggagttttc ccacgagtac tggatgagac atgccctgac cctggccaag 60 agggcacggg atgagaggga ggtgcctgtg ggagccgtgc tggtgctgaa caatagagtg 120 atcggcgagg gctggaacag agccatcggc ctgcacgacc caacagccca tgccgaaatt 180 atggccctga gacagggcgg cctggtcatg cagaactaca gactgattga cgccaccctg 240 tacgtgacat tcgagccttg cgtgatgtgc gccggcgcca tgatccactc taggatcggc 300 cgcgtggtgt ttggcgtgag gaactcaaaa agaggcgccg caggctccct gatgaacgtg 360 ctgaactacc ccggcatgaa tcaccgcgtc gaaattaccg agggaatcct ggcagatgaa 420 tgtgccgccc tgctgtgcga tttctatcgg atgcctagac aggtgttcaa tgctcagaag 480 aaggcccaga gctccatcaa c 501 <210> 3 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Nuclear localization signal sequence <400> 3 Lys Arg Thr Ala Asp Gly Ser Glu Phe Glu Ser Pro Lys Lys Lys Arg 1 5 10 15 Lys Val <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FANCF site1 <400> 4 ggaatccctt ctgcagcacc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EGFR-library-sg4 <400> 5 aagatcaaag tgctgggctc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg1 <400> 6 cttgtcaagg ctattggtca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EMX1-sg2p <400> 7 gacatcgatg tcctccccat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg8 <400> 8 caggacaagg gagggaagga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site3 <400> 9 gtcaagaaag cagagactgc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site10 <400> 10 gaacataaag aatagaatga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HEK-site7 <400> 11 ggaacacaaa gcatagactg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site 16 <400> 12 gggaataaat catagaatcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site 17 <400> 13 gacaaagagg aagagagacg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site 13 <400> 14 gaagatagag aatagactgc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABE-site 8 <400> 15 gtaaacaaag catagactga 20 <210> 16 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> FANCF site 1-F <400> 16 ggagtgagta cggtgtgcaa ggaacacgga taaagacgct ggg 43 <210> 17 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> FANCF site1-R <400> 17 gagttggatg ctggatggta ggtagtgctt gagaccgcca gaa 43 <210> 18 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> EGFR-library-sg4-F <400> 18 ggagtgagta cggtgtgcct tgtggagcct cttacaccca gtg 43 <210> 19 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> EGFR-library-sg4-R <400> 19 gagttggatg ctggatggct ccccaccaga ccatgagagg c 41 <210> 20 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg1-F <400> 20 ggagtgagta cggtgtgctg gaatgactga atcggaacaa ggc 43 <210> 21 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg1-R <400> 21 gagttggatg ctggatggct ggcctcactg gatactctaa gact 44 <210> 22 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> EMX1-sg2p-F <400> 22 ggagtgagta cggtgtgcgt ggttccagaa ccggaggaca aag 43 <210> 23 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> EMX1-sg2p-R <400> 23 gagttggatg ctggatgggt ttgtggttgc ccaccctagt cat 43 <210> 24 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg8-F <400> 24 ggagtgagta cggtgtgctg gggcaaggtg aatgtggaag atg 43 <210> 25 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> HBG-sg8-R <400> 25 gagttggatg ctggatggaa cctctgggtc catgggtaga caa 43 <210> 26 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ABE-site3-F <400> 26 ggagtgagta cggtgtgctg tcttcccttt cccttttcct cacc 44 <210> 27 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site3-R <400> 27 gagttggatg ctggatggaa ttgaggctca gaggagatgt gcc 43 <210> 28 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site10-F <400> 28 ggagtgagta cggtgtgcta cattaaccat ccccacatta tcc 43 <210> 29 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ABE-site10-R <400> 29 gagttggatg ctggatggag ggaactagat gttatgttta ggtga 45 <210> 30 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> HEK-site7-F <400> 30 ggagtgagta cggtgtgctg aatggattcc ttggaaacaa tgat 44 <210> 31 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> HEK-site7-R <400> 31 gagttggatg ctggatggtg tcaaactgtg cgtatgacat c 41 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site16-F <400> 32 ggagtgagta cggtgtgcta caattctgac cccatgcacc ctc 43 <210> 33 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site16-R <400> 33 gagttggatg ctggatggat gccagatacc agcaatccag caa 43 <210> 34 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site17-F <400> 34 ggagtgagta cggtgtgcct caagcctgat tccaaggaga ttg 43 <210> 35 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> ABE-site17-R <400> 35 gagttggatg ctggatggtc cctcctctgc gtgaatttg 39 <210> 36 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ABE-site13-F <400> 36 ggagtgagta cggtgtgcca tcaatcaact tctctttctc tccc 44 <210> 37 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ABE-site13-R <400> 37 gagttggatg ctggatggat atcacttcag cccaggagta taac 44 <210> 38 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site8-F <400> 38 ggagtgagta cggtgtgcct gctgccgtgg gagacaattc ata 43 <210> 39 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ABE-site8-R <400> 39 gagttggatg ctggatggag ctgttgcatg aggaaaggga cta 43 <210> 40 <211> 2340 <212> DNA <213> Artificial Sequence <220> <223> U6-sgRNA-EF1a-GFP <220> <221> misc_feature <222> (250)..(269) <223> n is a, c, g, or t <400> 40 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattagaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccn nnnnnnnnnn nnnnnnnnng ttttagagct agaaatagca agttaaaata 300 aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt ttaggcctga 360 attctgcaga tatccatcac actggcggct ccggtgcccg tcagtgggca gagcgcacat 420 cgcccacagt ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa 480 ggtggcgcgg ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg 540 gtgggggaga accgtatata agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt 600 ttgccgccag aacacaggta agtgccgtgt gtggttcccg cgggcctggc ctctttacgg 660 gttatggccc ttgcgtgcct tgaattactt ccactggctg cagtacgtga ttcttgatcc 720 cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag gagccccttc 780 gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 840 gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa atttttgatg 900 acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc aagatctgca 960 cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt cccagcgcac 1020 atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg ggtagtctca 1080 agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 1140 ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc ttcccggccc 1200 tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg gtgagtcacc 1260 cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact ccacggagta 1320 ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt cgtctttagg 1380 ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1440 taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg agtttggatc 1500 ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat ttcaggtgtc 1560 gtgaaatacg actcactata gggagaccca agctggctag ttaagcttgg taccgccacc 1620 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 1680 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 1740 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 1800 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 1860 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 1920 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 1980 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 2040 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 2100 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 2160 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 2220 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 2280 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 2340 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer end-tailing sequence <400> 41 ggagtgagta cggtgtgc 18 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer end-tailing sequence <400> 42 gagttggatg ctggatgg 18

Claims

1. An adenine deaminase, characterized in that, The adenine deaminase undergoes the following amino acid mutations at positions 29, 84, 108, and 145 of the amino acid sequence shown in SEQ ID NO: 1: The 108th amino acid residue N is mutated to Q; or, The 145th amino acid residue L is mutated to T; or, The 145th amino acid residue L is mutated to Q; or, The 84th amino acid residue F is mutated to T; or, The 84th amino acid residue F is mutated to T, and the 108th amino acid residue N is mutated to Q; or, The amino acid residue N at position 108 is mutated to Q, and the amino acid residue L at position 145 is mutated to T; or, The 108th amino acid residue N is mutated to Q, and the 29th amino acid residue P is mutated to M; or, The amino acid residue N at position 108 is mutated to Q, and the amino acid residue P at position 29 is mutated to W.

2. An adenine base editor, characterized in that, The adenine base editor includes a nuclease and the adenine deaminase as described in claim 1.

3. The adenine base editor as described in claim 2, characterized in that, The nuclease is a Cas protein or its variants.

4. The adenine base editor as described in claim 3, characterized in that, The Cas protein is spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Trichophytonceae bacteria, or enAsCas12a from Acidococcus spp. bacteria; the Cas protein variant is VQR-spCas9, VRER-spCas9, spRY, spNG, SaCas9-KKH, or SaCas9-NG.

5. A fusion protein, characterized in that, The fusion protein comprises the adenine deaminase as described in claim 1.

6. The fusion protein as described in claim 5, characterized in that, The fusion protein further comprises a nuclease, wherein the nuclease is the nuclease in the adenine base editor as described in any one of claims 2 to 4.

7. The fusion protein as described in claim 5 or 6, characterized in that, The adenine deaminase also includes a nuclear localization signal sequence.

8. The fusion protein as described in claim 7, characterized in that, The nuclear positioning signal sequence is shown in SEQ ID NO:

3.

9. An adenine base editing system, characterized in that, It includes: sgRNA and the adenine base editor as described in any one of claims 2 to 4.

10. The adenine base editing system as described in claim 9, characterized in that, The target sequence of the sgRNA is shown in the nucleotide sequences of SEQ ID NO: 4~15.

11. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the adenine deaminase as described in claim 1, the adenine base editor as described in any one of claims 2 to 4, the fusion protein as described in any one of claims 5 to 8, or the adenine base editing system as described in claim 9 or 10.

12. A base editing method for non-therapeutic purposes, characterized in that, The base editing method includes: The target cells are expressed with the adenine deaminase as described in claim 1, the adenine base editor as described in any one of claims 2 to 4, the fusion protein as described in any one of claims 5 to 8, or the adenine base editing system as described in claim 9 or 10, thereby causing base editing in the target cells.

13. The non-therapeutic base editing method as described in claim 12, characterized in that, The target cells are derived from isolated cell lines.

14. The non-therapeutic base editing method as described in claim 13, characterized in that, The isolated cell lines are 293T cells, HELA cells, U2OS cells, NIH3T3 cells, or N2A cells.

15. The use of the adenine deaminase of claim 1, the adenine base editor of any one of claims 2 to 4, the fusion protein of any one of claims 5 to 8, or the adenine base editing system of claim 9 or 10 in the preparation of base-editing drugs or gene therapy drugs.

16. The application of the adenine deaminase as described in claim 1, the adenine base editor as described in claims 2-4, the fusion protein as described in claims 5-8, or the adenine base editing system as described in claim 9 or 10 in the construction of animal models and crop breeding.

17. The use of the adenine deaminase as described in claim 1, the adenine base editor as described in claims 2-4, the fusion protein as described in claims 5-8, or the adenine base editing system as described in claim 9 or 10 in the preparation of base editing tools.

Images