New Mutant Protein for Increasing Malic Acid Production
By performing amino acid mutations at specific sites on pyruvate carboxylase and malic transporter, an efficient malic acid synthesis pathway was constructed, which solved the problems of low malic acid synthesis efficiency and low purity in the prior art, and achieved the biosynthesis of high-purity L-malic acid.
Patent Information
- Application Number
- CN202211222788.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2018-10-19
- Filing Date
- 2019-10-18
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2039-10-18
AI Technical Summary
It is difficult to efficiently synthesize pure L-malic acid in the prior art, and the mixture of D and L-malic acid synthesized by chemical methods is difficult to separate. Microbial synthesis methods have problems such as low conversion efficiency and high burden on cells.
By performing amino acid mutations at specific sites on pyruvate carboxylase and malic transporter, an efficient malic acid synthesis pathway is constructed to improve malic acid yield and purity.
The yield of malic acid has been significantly improved, the synthesis of high-purity L-malic acid has been achieved, and the efficiency and yield of biosynthesis has been improved.
Smart Images

Figure BDA0003878592600000111 
Figure BDA0003878592600000112 
Figure BDA0003878592600000231
Abstract
Description
[0001] This application is a divisional application of the invention patent application with the application date of October 18, 2019, application number 201980068740.X, and invention title "New Mutant Proteins for Increasing Malic Acid Production". Technical Field
[0002] The present invention belongs to the field of biotechnology. Specifically, the present invention relates to novel mutant proteins of pyruvate carboxylase and malic acid transporter in the malic acid synthesis pathway and their applications. Background Art
[0003] Malic acid (2-hydroxy-1,4-butanedioic acid) is an important platform compound and is widely used in the pharmaceutical, cosmetic, food, and beverage industries. Previous syntheses mainly used chemical methods. However, the process mainly produces a mixture of D- and L-malic acid, which is difficult to separate.
[0004] There are currently five main reported pathways for malic acid synthesis, namely the TCA cycle, reductive TCA (or reverse TCA) rTCA, cyclic glyoxylate cycle, non-cyclic glyoxylate cycle, and the direct synthesis of malic acid from pyruvate by the reverse catalysis of malic enzyme. Among them, the rTCA cycle and the malic enzyme pathway are the most efficient, and the theoretical conversion rate of glucose to malic acid is 2. However, malic enzyme mainly catalyzes the decomposition of malic acid into pyruvate. Therefore, the currently most commonly used method is the rTCA pathway to synthesize malic acid.
[0005] Starting from glucose, it is converted into pyruvate through glycolysis. Pyruvate is converted into oxaloacetate through pyruvate carboxylase, oxaloacetate is converted into malic acid through malate dehydrogenase, and malic acid is transported out of the cell through a transporter. The conversion efficiency of each step in this process, side reaction diversion, coenzymes and reducing power catalyzing each step of the reaction, and the cell energy state will all affect malic acid synthesis.
[0006] There are three key indicators in malic acid synthesis, namely yield, production capacity, and conversion rate. To construct highly efficient malic acid-producing strains, malic acid synthesis pathways have been constructed in multiple species, such as Saccharomyces cerevisiae, Pichia pastoris, Escherichia coli, Aspergillus spp., Torulopsis glabrata, Ustilago trichophora, Bacillus subtilis, and Thermobifida fusca, etc. (Dai et al., Current advance in biological production of malic acid using wild type and metabolic engineered strains. Bioresour Technol. 2018, 258:345-353. Liu et al., Biological production of L-malate: recent advances and future prospects. World J Microbiol Biotechnol. 2017, 34(1):6.). However, these works mainly focused on attempting to construct malic acid synthesis pathways and perform partial optimizations in different species. For example, promoters with different strengths were selected to express key enzymes in malic acid synthesis to improve malic acid synthesis ability. However, this requires a multi-round combination process, and overexpression of key synthesis enzymes will also impose an additional burden on cells.
[0007] Therefore, there is an urgent need in the art to develop a method that can directly and efficiently obtain pure malic acid. Summary of the Invention
[0008] The present invention provides novel mutant proteins of pyruvate carboxylase and malic acid transporter in the malic acid synthesis pathway and their applications.
[0009] In the first aspect of the present invention, a mutant protein of pyruvate carboxylase is provided. The mutant protein of pyruvate carboxylase is based on the sequence shown in SEQ ID NO:1 (wild type) and has core amino acid mutations at one or more sites selected from the following:
[0010] A762D, A762P, A762V or A762T; and / or
[0011] P826E, P826Q, P826Y, P826T, P826D or P826I;
[0012] and the pyruvate carboxylase mutant protein has the activity of carboxylating pyruvate to synthesize oxaloacetate, the precursor of malic acid.
[0013] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation at one or more of the following sites:
[0014] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T; and / or
[0015] P1031E, 1031S, P1031N or P1031G.
[0016] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation at one or more of the following sites:
[0017] G837D, or G837H;
[0018] A254K, A254E, A254R, or A254F;
[0019] H51N, or H51G; and
[0020] F453E, or F453P.
[0021] In another preferred embodiment, the pyruvate carboxylase mutant protein is derived from wild-type pyruvate carboxylase.
[0022] In another preferred embodiment, the wild-type pyruvate carboxylase is derived from Corynebacterium glutamicum
[0023] In another preferred embodiment, the pyruvate carboxylase mutant protein further includes its active fragment, variant form or derivative protein, and the active fragment, variant form or derivative protein of the pyruvate carboxylase mutant protein has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the pyruvate carboxylase mutant protein, and has the activity of carboxylating pyruvate to synthesize oxaloacetate, the precursor of malic acid.
[0024] In another preferred embodiment, except for one or more of the core amino acid mutations, the remaining sequences of the derivative protein of the pyruvate carboxylase mutant protein are the same as or substantially the same as the sequence shown in SEQ ID NO:1.
[0025] In another preferred example, compared with SEQ ID NO:1 (wild type), the sequence of the pyruvate carboxylase mutant protein has core amino acid mutations at the following sites:
[0026] A762D and P826E;
[0027] A762D and P824V;
[0028] P824V and P826E
[0029] P824V and P1031E; or
[0030] A762D, P826E and P1031E.
[0031] In another preferred example, the pyruvate carboxylase mutant protein is as shown in SEQ ID NO:2-20, 175.
[0032] In the second aspect of the present invention, there is provided a malate transporter mutant protein, which, based on the sequence shown in SEQ ID NO:22, has core amino acid mutations at one or more sites selected from the following:
[0033] I80K, I80W, or I80C; and
[0034] R272A, or R272F;
[0035] And the malate transporter mutant protein has the activity of transporting malate from inside the cell to the cell.
[0036] In another preferred example, the mutant protein further has core amino acid mutations at one or more sites selected from the following:
[0037] E8Q, E8Y, E8R, or E8P; and / or
[0038] V142I, V142S or V142C.
[0039] In another preferred example, the mutant protein further has core amino acid mutations at one or more sites selected from the following group:
[0040] F97V, or F97R;
[0041] F101Y, or F101W;
[0042] Y115E;
[0043] S123K, S123H, S123R, or S123D;
[0044] I301W, I301F, I301H, I301K, or I301Y;
[0045] L140N, L140H, or L140K;
[0046] P163I, P163V, P163F, P163L, P163Q, or P163Y;
[0047] A191R, or A191K;
[0048] F201Q, F201G, F201N or F201K;
[0049] A214V, A214G or A214D;
[0050] E222S, or E222H;
[0051] H227F, or H227W; and / or
[0052] M251E, or M251G.
[0053] In another preferred embodiment, compared with SEQ ID NO:22 (wild type), the sequence of the malate transporter mutant protein has core amino acid mutations at the following sites:
[0054] I80K and R272A; or
[0055] I80K, E8Q and R272A.
[0056] In another preferred embodiment, the sequence of the malate transporter mutant protein is as shown in SEQ ID NO:23 - 42, 176.
[0057] In another preferred embodiment, the malate transporter mutant protein further includes its active fragments, variant forms or derivative proteins, and the active fragments, variant forms or derivative proteins of the malate transporter mutant protein have at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the malate transporter mutant protein, and have the activity of transporting malate from inside the cell to outside the cell.
[0058] In the third aspect of the present invention, there is provided an isolated polynucleotide or a combination thereof, which encodes the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention.
[0059] In another preferred embodiment, the isolated polynucleotides encode the pyruvate carboxylase mutant protein described in the first aspect of the present invention or the malate transporter mutant protein described in the second aspect of the present invention, respectively.
[0060] In another preferred embodiment, the combination of the isolated polynucleotides simultaneously contains polynucleotides encoding the pyruvate carboxylase mutant protein described in the first aspect of the present invention and the malate transporter mutant protein described in the second aspect of the present invention.
[0061] In the fourth aspect of the present invention, there is provided a vector which contains the isolated polynucleotide described in the third aspect of the present invention.
[0062] In another preferred embodiment, the expression vector contains polynucleotides encoding the pyruvate carboxylase mutant protein described in the first aspect of the present invention and the malate transporter mutant protein described in the second aspect of the present invention.
[0063] In the fifth aspect of the present invention, there is provided a host cell which contains the vector described in the fourth aspect of the present invention, or the nucleic acid of the host cell integrates the isolated polynucleotide described in the third aspect of the present invention.
[0064] In another preferred embodiment, the host cell includes cells derived from the following microorganisms:
[0065] Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Schizosaccharomyces pombe, Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipites, Candida shehatae, Candida tropicalis, Escherichia coli, Bacillus subtilis, Torulopsis glabrata, Aspergillus oryzae, Rhizopus oryzae, Ustilago trichophora, Thermobifida fusca, Myceliophthora thermophila, Myceliophthora heterothallica.
[0066] In another preferred example, the host cell includes Saccharomyces cerevisiae, Pichia pastoris or Myceliophthora thermophila.
[0067] In another preferred example, the host cell only expresses the pyruvate carboxylase mutant protein.
[0068] In another preferred example, the host cell only expresses the malate transporter mutant protein.
[0069] In another preferred example, the host cell simultaneously expresses the pyruvate carboxylase mutant protein and the malate transporter mutant protein.
[0070] In the sixth aspect of the present invention, a method for preparing the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention is provided, including the steps:
[0071] Under suitable expression conditions, culture the host cell described in the fifth aspect of the present invention to express the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention; and
[0072] Isolate the expression product to obtain the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention.
[0073] The seventh aspect of the present invention provides a method for increasing the production of malic acid, comprising the steps of:
[0074] i) Introduce the polynucleotide or its combination described in the third aspect of the present invention into a suitable host cell;
[0075] ii) Culture the host cell in the presence of a carbon source to increase the production of malic acid.
[0076] In another preferred embodiment, the carbon source includes glucose, sucrose, galactose, xylose, glycerol, or methanol.
[0077] In another preferred embodiment, the suitable host cell includes cells derived from the following microorganisms: Pichia pastoris, Saccharomyces cerevisiae, and / or Myceliophthora thermophila, Myriococcum thermophilum.
[0078] The eighth aspect of the present invention provides a mutant protein combination, which contains the pyruvate carboxylase mutant protein described in the first aspect of the present invention and the malate transporter mutant protein described in the second aspect of the present invention.
[0079] The ninth aspect of the present invention provides the application of the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention, the isolated polynucleotide or its combination described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, the host cell described in the fifth aspect of the present invention, or the mutant protein combination described in the eighth aspect of the present invention, for increasing the production of malic acid and / or for preparing malic acid.
[0080] In another preferred embodiment, the increase in the production of malic acid includes that the production of malic acid is increased by at least 10%, preferably at least 20%, 30%, 40%, 50% compared with the wild-type strain producing malic acid.
[0081] It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be repeated one by one here. Brief Description of the Drawings
[0082] Figure 1Shows the pyc expression plasmid map.
[0083] Figure 2 Shows the mdh expression plasmid map.
[0084] Figure 3 Shows the tandem expression plasmid map of mdh and pyc.
[0085] Figure 4 Shows the comparative expression and directed evolution plasmid map of dicarboxylic acid transporter.
[0086] Figure 5 Shows the Aomae expression plasmid map.
[0087] Figure 6 Shows the pyc directed evolution and modification plasmid map.
[0088] Figure 7 Shows the effect of overexpressing pyc and mdh on malic acid production and the effect of overexpressing different transporters on malic acid production.
[0089] Figure 8 Shows the primary screening of transporter screening and modification by hydrolysis zone on spotting plate.
[0090] Figure 9 Shows the effect of Aomae I80 saturation mutation on malic acid production. Among them, I80K, I80W, and I80C increase the malic acid production by 14.3%, 11.3%, and 11.5% respectively.
[0091] Figure 10 Shows the effect of Aomae V142 saturation mutation on malic acid production. Among them, V142I, V142S, and V142C increase the malic acid production by 21.1%, 16.2%, and 14.1% respectively.
[0092] Figure 11 Shows the effect of Aomae R272 saturation mutation on malic acid production. Among them, R272A and R272F increase the malic acid production by 21% and 22.1% respectively.
[0093] Figure 12 Shows the effect of Aomae E8 saturation mutation on malic acid production. Among them, E8Q, E8Y, E8R, and E8P increase the malic acid production by 15.5%, 10.3%, 9.3%, and 10.7% respectively.
[0094] Figure 13 Shows the effect of Aomae I109 saturation mutation on malic acid production. Among them, I109M and I109P increase the malic acid production by 12% and 10.2% respectively.
[0095] Figure 14Shows the effect of Aomae S123 saturation mutation on malic acid production. S123, S123H, S123R, and S123D increased malic acid production by 27.4%, 28.2%, 23.4%, and 23.6% respectively.
[0096] Figure 15 Shows the effect of Aomae I301 saturation mutation on malic acid production. I301W, I301F, I301H, I301K, and I301Y increased malic acid production by 25.2%, 18.6%, 18.3%, 17.6%, and 17.6% respectively.
[0097] Figure 16 Shows the effect of Aomae P163 saturation mutation on malic acid production. Among them, P163I, P163V, P163F, P163L, P163Q, and P163Y increased malic acid production by 27.4%, 25.2%, 20.6%, 18.1%, 16.5%, and 15.3% respectively.
[0098] Figure 17 Shows the effect of Aomae F101 saturation mutation on malic acid production. Among them, F101Y and F101W increased malic acid production by 25% and 21% respectively.
[0099] Figure 18 Shows the effect of Aomae L140 saturation mutation on malic acid production. Among them, L140N, L140K, and L140H increased malic acid production by 22%, 10%, and 20% respectively.
[0100] Figure 19 Shows the effect of Aomae F97 saturation mutation on malic acid production. Among them, F97V and F97R increased malic acid production by 25% and 22.7% respectively.
[0101] Figure 20 Shows the effect of Aomae A191 saturation mutation on malic acid production. Among them, A191R and A191K increased malic acid production by 29.2% and 22.6% respectively.
[0102] Figure 21 Shows the effect of Aomae Y115 saturation mutation on malic acid production. Among them, Y115E and Y115L increased malic acid production by 28% and 16% respectively.
[0103] Figure 22 Shows the effect of Aomae A214 saturation mutation on malic acid production. Among them, A214V, A214G, and A214D increased malic acid production by 25%, 22.1%, and 21.3% respectively.
[0104] Figure 23 It shows the effect of Aomae F201 saturation mutation on malic acid production. Among them, F201Q, F201G, F201K, and F201N increase malic acid production by 32%, 22%, 18%, and 19% respectively.
[0105] Figure 24 It shows the effect of Aomae H227 saturation mutation on malic acid production. Among them, H227F and H227W increase malic acid production by 22% and 18% respectively.
[0106] Figure 25 It shows the effect of Aomae E222 saturation mutation on malic acid production. Among them, E222S and E222G increase malic acid production by 22% and 22% respectively.
[0107] Figure 26 It shows the effect of Aomae M251 saturation mutation on malic acid production. Among them, M251E and M251G increase malic acid production by 28% and 23% respectively.
[0108] Figure 27 It shows the effect of Aomae combined mutation on malic acid production. Among them, I80K / R272A can increase malic acid production by more than 30%.
[0109] Figure 28 It shows the effect of pyc from different sources on malic acid production. Among them, when comparing Corynebacterium glutamicum, the highest malic acid production reaches 53.2 g / L.
[0110] Figure 29 It shows the primary screening of PYC by spotting on a plate based on the hydrolysis zone
[0111] Figure 30 It shows the effect of CgPyc H51 saturation mutation on malic acid production. Among them, H51N and H51G increase malic acid production by 19% and 18% respectively.
[0112] Figure 31 It shows the effect of CgPyc F453 saturation mutation on malic acid production. Among them, F453E and F453P increase malic acid production by 17% and 17% respectively.
[0113] Figure 32 It shows the effect of CgPyc A254 saturation mutation on malic acid production. Among them, A254K, A254E, A254R, and A254F increase malic acid production by 19%, 17%, 16%, and 15% respectively.
[0114] Figure 33Shows the effect of CgPyc G837 saturation mutation on malic acid production. Among them, G837D and G837H increased malic acid production by 24% and 17% respectively.
[0115] Figure 34 Shows the effect of CgPyc P824 saturation mutation on malic acid production. Among them, P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, and P824T increased malic acid production by 29.4%, 28.2%, 25.9%, 22.4%, 23.5%, 23.5%, 23.6%, 23.2%, and 20% respectively.
[0116] Figure 35 Shows the effect of CgPyc A762 saturation mutation on malic acid production. Among them, A762D, A762P, A762V, and A762T increased malic acid production by 33.5%, 30.6%, 29.6%, and 22.4% respectively.
[0117] Figure 36 Shows the effect of CgPyc P826 saturation mutation on malic acid production. Among them, P826E, P826Q, P826Y, P826T, P826D, and P826I increased malic acid production by 28.3%, 20.9%, 24.1%, 22.9%, 20.9%, and 21.6% respectively.
[0118] Figure 37 Shows the effect of CgPyc P1031 saturation mutation on malic acid production. Among them, P1031E, P1031N, P1031S, and P1031G increased malic acid production by 34.2%, 30.8%, 128.2%, and 122.2% respectively.
[0119] Figure 38 Shows the effect of CgPyc combined mutation on malic acid production. Among them, A762D / P826E, A762D / P824V, P824V / P826E, P824V / P1031E, and A762D / P826E / P1031E increased malic acid production by 41.4%, 38.6%, 36.7%, 37.1%, and 42.3% respectively.
[0120] Figure 39 Shows that Saccharomyces cerevisiae expressing PYC, AoMae, and MDH produces malic acid. Among them, the strain co-expressing the three genes can produce 22 g / L of malic acid.
[0121] Figure 40 Malic acid production of the strain overexpressing the modified malic acid transporter. Among them, overexpressing the mutation Aomae I80K / R272A increased malic acid production by 9.5%.
[0122] Figure 41 Malic acid production of the pyruvate carboxylase strain after overexpression modification. Among them, after overexpressing the mutant CgPYCA762D / P826E / P1031E, the malic acid production increased by 16%. Detailed implementation manners
[0123] Through extensive and in-depth research, the present inventors unexpectedly discovered for the first time that by modifying the catalytic machinery and transporter proteins for malic acid synthesis, that is, by mutating the core amino acids at specific sites of pyruvate carboxylase and malic acid transporter proteins, the ability of microbial strains to produce malic acid was significantly improved, so that more pyruvate precursors could flow towards the target product malic acid, thereby effectively increasing the malic acid production. Specifically, the present inventors first constructed a high-throughput screening scheme for coupling malic acid synthesis in Pichia pastoris, compared pyruvate carboxylase and malic acid transporter proteins from different sources, found the target proteins to be modified, constructed random mutation libraries for the two target proteins respectively, and obtained pyruvate carboxylase and malic acid transporter protein mutants with increased malic acid production after multiple screenings. Then, single amino acid saturation mutations and combinatorial mutations were carried out to obtain pyruvate carboxylase mutants with improved catalytic activity and malic acid transporter protein mutants with enhanced malic acid transport ability, and a series of engineering strains for efficient malic acid synthesis were constructed. On this basis, the present invention was completed.
[0124] Malic acid and its synthesis
[0125] Malic acid (2-hydroxy-1,4-butanedioic acid) is an important platform compound and is widely used in the pharmaceutical, cosmetic, food and beverage industries.
[0126] At present, there are mainly five reported pathways for malic acid synthesis, namely the TCA cycle, the reductive TCA (or reverse TCA) rTCA, the cyclic glyoxylate cycle and the non-cyclic glyoxylate cycle, and the direct synthesis of malic acid from pyruvate by the reverse catalysis of malic enzyme. Among them, the rTCA cycle and the malic enzyme pathway are the most effective, and the theoretical conversion rate of glucose to malic acid is 2. However, malic enzyme mainly catalyzes the decomposition of malic acid into pyruvate. Therefore, the currently most commonly used method is the rTCA pathway to synthesize malic acid.
[0127] Starting from glucose, it is converted into pyruvate through glycolysis. Pyruvate is converted into oxaloacetate through pyruvate carboxylase, oxaloacetate is converted into malic acid through malate dehydrogenase, and malic acid is transported out of the cell through a transporter protein. The conversion efficiency of each step in this process, the diversion of side reactions, the coenzymes and reducing power for catalyzing each step of the reaction, and the cell energy state will all affect malic acid synthesis.
[0128] Previous syntheses mainly used chemical methods. However, the process mainly produces a mixture of D- and L-malic acids, which are difficult to separate. In contrast, the method of the present invention using microorganisms can synthesize high-purity L-malic acid.
[0129] Pyruvate carboxylase
[0130] Pyruvate carboxylase (PYC) is one of the key enzymes involved in the central metabolic pathway in organisms. It participates in the TCA cycle by carboxylating pyruvate to form oxaloacetate. At the same time, this reaction is also the first step in the gluconeogenesis pathway. Most pyruvate carboxylases are composed of four identical subunits, with a molecular weight of 120 - 130 kDa for a single subunit, and the functional tetramer has a molecular weight of approximately 520 kDa. Since pyruvate carboxylase needs to be tetramerized to function, and the tetramerized protein is as large as 520 kDa, it is difficult to secrete it outside the cell. Although pyruvate carboxylase can be screened by measuring enzyme activity, it can only reside inside the cell, and cell disruption is required to measure enzyme activity. It is very difficult to perform cell wall breaking on all mutants in a mutant library, making it very difficult to modify this protein. Currently, for the modification of such complex-forming proteins, there are only a very few site-directed mutations at specific sites based on crystal structures, and the number of mutants involved is very small. No protein engineering modification has been carried out on CgPYC without a crystal structure.
[0131] The pyruvate carboxylase of the present invention is derived from Corynebacterium glutamicum, and its wild type (named CgPYC) has the sequence number WP_011013816.1, and the sequence is shown in SEQ ID NO:1, and its encoding nucleic acid is shown in SEQ ID NO:21. It is the first to be used in strains for malic acid synthesis. By constructing random mutations, site-directed mutations, and combinatorial mutations, multiple single mutations that can significantly increase the malic acid synthesis in Pichia pastoris by more than 30%, and 2 double mutations and triple mutations that can increase malic acid by more than 40% are obtained. At the same time, the mutant protein can also increase malic acid by 16% in Myceliophthora thermophila.
[0132] Malic acid transporter
[0133] Malate transporters play an important role in the process of malate synthesis. The transporters used in the present invention for malate production mainly include those derived from Aspergillus oryzae (AO090023000318(C4T318)), and the protein sequence of the wild type (named AoMae) is shown in SEQ ID NO:22, and its encoding nucleic acid is shown in SEQ ID NO:43; those derived from Schizosaccharomyces pombe (NM_001020205.2) and DCT (AQW79505.1) derived from Aspergillus carbonarius. Among them, the key AoMae protein has a theoretical molecular weight of 42.2 kDa.
[0134] The malate transporter Aomae belongs to a membrane protein. The usual evaluation criterion for membrane proteins is to measure the substrate transport ability. The protein needs to be purified and constructed into liposomes or into a multi-gene knockout strain without similar functional transporters, and then measured with isotopically labeled substrates; in addition, transport is divided into efflux type and influx type, and coupled with the generally low protein identity of membrane proteins, these factors have caused very great difficulties in modifying membrane proteins.
[0135] Through random mutation, site-directed mutation and combinatorial mutation, the present invention has obtained a series of mutation sites that can significantly improve the level of malate synthesis. Among them, I80K / E8Q / R272A and I80K / R272A can increase the malate synthesis in Pichia pastoris by more than 30%, and can also increase malate by 10.5% in Myceliophthora thermophila.
[0136] Mutant proteins and their derivatives
[0137] Those skilled in the art know that if a certain enzyme is to be mutated in order to obtain a mutant with improved activity, the key lies in finding the sites that can improve the activity after mutation. In the present invention, specific-site mutations are made to the enzymes with amino acid sequences shown in SEQ ID NO:1 and 22, and corresponding mutants with significantly improved activity are obtained. As used herein, the terms "mutant protein" and "mutant" can be used interchangeably, referring to mutant proteins of pyruvate carboxylase and / or malate transporters, and their correspondence with pyruvate carboxylase mutant proteins or malate transporter mutant proteins can be obtained from the context of the context. Specifically, the pyruvate carboxylase mutant proteins of the present invention generally refer to the sequences shown in SEQ ID NO:1 and / or 22 (wild type), and have core amino acid mutations at one or more sites selected from the following:
[0138] ① When mutating according to the sequence shown in SEQ ID NO:22, it can have core amino acid mutations at one or more sites selected from the following:
[0139] A762D, A762P, A762V, or A762T;
[0140] P826E, P826Q, P826Y, P826T, P826D, or P826I;
[0141] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T;
[0142] P1031E, 1031S, P1031N, or P1031G;
[0143] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T;
[0144] P1031E, 1031S, P1031N, or P1031G;
[0145] G837D, or G837H;
[0146] A254K, A254E, A254R, or A254F;
[0147] H51N, or H51G; and / or
[0148] F453E, or F453P.
[0149] and the pyruvate carboxylase mutant protein has the activity of carboxylating pyruvate to synthesize oxaloacetate, the precursor of malic acid;
[0150] A preferred pyruvate carboxylase mutant protein, based on the sequence shown in SEQ ID NO:1, has core amino acid mutations at one or more of the following sites:
[0151] A762D and P826E;
[0152] A762D and P824V;
[0153] P824V and P826E
[0154] P824V and P1031E; or
[0155] A762D, P826E, and P1031E.
[0156] The sequence of a preferred pyruvate carboxylase mutant protein is shown in any one of SEQ ID NO:2 - 20, 175.
[0157] ②When mutating according to the sequence shown in SEQ ID NO:22, it may have core amino acid mutations at one or more sites selected from the following:
[0158] I80K, I80W, or I80C;
[0159] R272A, or R272F;
[0160] E8Q, E8Y, E8R, or E8P;
[0161] V142I, V142S or V142C;
[0162] F97V, or F97R;
[0163] F101Y, or F101W;
[0164] Y115E;
[0165] S123K, S123H, S123R, or S123D;
[0166] I301W, I301F, I301H, I301K, or I301Y;
[0167] L140N, L140H, or L140K;
[0168] P163I, P163V, P163F, P163L, P163Q, or P163Y;
[0169] A191R, or A191K;
[0170] F201Q, F201G, F201N or F201K;
[0171] E222S, or E222G;
[0172] H227F, or H227W; and / or
[0173] M251E, or M251G.
[0174] And the malate transporter mutant protein has the activity of transporting malate from inside the cell to outside the cell.
[0175] A preferred malate transporter mutant protein, based on the sequence shown in SEQ ID NO:22, has core amino acid mutations at one or more sites selected from the following:
[0176] I80K and R272A; or
[0177] I80K, E8Q and R272A.
[0178] The sequence of a preferred malic acid transporter mutant protein is shown in any one of SEQ ID NOs: 23-42 and 176.
[0179] SEQ ID No.: 1
[0180]
[0181] SEQ ID No.: 22
[0182]
[0183] In view of the teachings of the present invention and the prior art, those skilled in the art should understand that the mutant proteins of the present invention should also include active fragments, modified or unmodified variant forms, or derivative proteins of the mutant proteins.
[0184] Specifically, the active fragments, variant forms, or derivative proteins of the pyruvate carboxylase mutant protein include those based on the sequences shown in SEQ ID NOs: 2-20, with one or several (e.g., usually 1-30, preferably 1-10, more preferably 1-6, still more preferably 1-3, most preferably 1) amino acid residue deletions, insertions, and / or substitutions, and still having the activity (cA1) of carboxylating pyruvate to synthesize oxaloacetate, the precursor of malic acid, which is significantly higher than the corresponding activity (cA0) of the wild-type pyruvate carboxylase shown in SEQ ID NO: 1. The significant increase is any value in (cA1 - cA0) / cA0 ≥ 10% - 500%, such as ≥ 15%, 20%, 25%, 30%, 40%, 50%, or 100%.
[0185] The active fragments, variant forms, or derivative proteins of the malic acid transporter mutant protein include those based on the sequences shown in SEQ ID NOs: 23-42, with one or several (e.g., usually 1-30, preferably 1-10, more preferably 1-6, still more preferably 1-3, most preferably 1) amino acid residue deletions, insertions, and / or substitutions, and still having the activity (aA1) of transporting malic acid from inside the cell to outside the cell, which is significantly higher than the corresponding activity (aA0) of the wild-type malic acid transporter shown in SEQ ID NO: 22. The significant increase is any value in (cA1 - cA0) / cA0 ≥ 10% - 500%, such as ≥ 15%, 20%, 25%, 30%, 40%, 50%, or 100%.
[0186] Those skilled in the art can generate mutants with conservative variations by performing conservative amino acid substitutions, for example, as shown in the following table.
[0187] Initial residue Representative substituted residue Preferred substituted residue Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu (L) Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Leu; Val; Ile; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala Leu
[0188] As used herein, modified forms of proteins (which generally do not change the primary structure) include: chemically derivatized forms of proteins in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation. Modified forms also include sequences having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to enhance their proteolytic resistance or optimize their solubility properties. All of these techniques are known to those skilled in the art.
[0189] In addition, derivative proteins of the mutant proteins of the present invention also include fusion proteins or conjugates formed by the mutant proteins of the present invention or their active fragments with other proteins or markers.
[0190] Preferably, the active fragments, variant forms or derivative proteins of the mutant proteins of the present invention have at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with SEQ ID NO: 1 or 22, respectively.
[0191] The mutant proteins of the present invention can be in combination form, so as to further improve the yield of malic acid.
[0192] Coding nucleic acids and their combinations
[0193] Based on the pyruvate carboxylase mutant protein or malate transporter mutant protein of the present invention, the present invention also provides an isolated polynucleotide encoding the pyruvate carboxylase mutant protein or malate transporter mutant protein or its degenerate variant. The polynucleotides of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or synthetic DNA. The DNA can be single-stranded or double-stranded. The DNA can be the coding strand or the non-coding strand. The coding region sequence encoding the mature polypeptide can be the same as or a degenerate variant of the nucleotide sequence encoding the pyruvate carboxylase mutant protein and / or malate transporter mutant protein in the examples of the present invention. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes the pyruvate carboxylase mutant protein and / or malate transporter mutant protein in the claims of the present invention, but is different from the coding nucleotide sequence of the pyruvate carboxylase mutant protein or malate transporter mutant protein in the examples of the present invention.
[0194] Vectors, host cells
[0195] The coding polynucleotide sequence can be inserted into a recombinant expression vector or the genome. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host. An important feature of an expression vector is usually that it contains an origin of replication, a promoter, a marker gene and translation control elements.
[0196] Those skilled in the art can use well-known methods to construct an expression vector containing the DNA sequence encoding "pyruvate carboxylase mutant protein and / or malate transporter mutant protein" and appropriate transcriptional / translational control signals, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, etc. The said DNA sequence can be effectively ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.
[0197] The host cells described herein include host cells containing the above-mentioned expression vector or having the coding sequence of the mutant protein of the present invention integrated into the genome. The host cells include host cells derived from ascomycetes, having a very high evolutionary relationship, and having a high similarity in the sequences and functions of pyruvate carboxylase and malate transporter. Preferred microbial cells are as follows:
[0198] Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Saccharomyces pombe, Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipites, Candida shehatae, Candida tropicalis, Escherichia coli, Bacillus subtilis, Torulopsis glabrata, Aspergillus oryzae, Rhizopus oryzae, Ustilago trichophora, Thermobifida fusca, Myceliophthora thermophila, Myceliophthora heterothallica.
[0199] The mutant protein of the present invention can be obtained by conventional recombinant transformation methods in the art, and the mutant protein can be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, sonication, high-pressure homogenization, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. The host cells of the present invention can express the pyruvate carboxylase mutant protein and the malate transporter mutant protein separately and / or simultaneously.
[0200] Preparation of mutant protein
[0201] The present invention also provides a method for preparing the pyruvate carboxylase mutant protein and the malate transporter mutant protein, comprising culturing the host cells of the present invention under suitable expression conditions to express the pyruvate carboxylase mutant protein and / or the malate transporter mutant protein; and
[0202] isolating the pyruvate carboxylase mutant protein and / or the malate transporter mutant protein.
[0203] The obtained mutant protein can also be optionally purified to obtain a more pure mutant protein product.
[0204] Preferably, the suitable expression conditions include conventional techniques in the art, and the purification techniques include nickel column purification, ion exchange chromatography, etc.
[0205] Carbon source
[0206] The carbon source that can be used in the present invention is not particularly limited and is a type of nutrient for the growth of microorganisms (such as the host cells of the present invention), which is a carbon-containing compound. Preferably, the carbon sources that can be used in the present invention include glucose, sucrose, cellobiose, lactose, galactose, xylose, glycerol, or methanol.
[0207] Application
[0208] The mutant proteins of the present invention can be used separately or simultaneously to increase the yield of malic acid. After single mutation at specific sites, the synthesis of malic acid by the pyruvate carboxylase mutant protein of the present invention is increased by at least more than 10%, and the mutation in the preferred strain can reach more than 30%. After double mutation and triple mutation, the yield of malic acid can be increased by 40%. For the malic acid transporter mutant protein, after mutation at specific sites, the yield of malic acid is increased by at least 10%, and the mutation in the preferred strain can reach more than 30%. After the two proteins of the present invention are modified and combined, the yield of malic acid is synergistically increased.
[0209] Advantages of the present invention
[0210] In the present invention, a malic acid synthesis pathway is constructed in Pichia pastoris, and the synthesis abilities of pyruvate carboxylase and malic acid transporter in the malic acid synthesis pathway are coupled with the malic acid yield, and thus the size of the CaCO3 hydrolysis circle. For the first time, the directed evolution and modification of two proteins are realized, and the malic acid synthesis level is significantly improved. After single mutation at specific sites, the synthesis of malic acid by the pyruvate carboxylase mutant protein of the present invention is increased by at least more than 10%, and the mutation in the preferred strain can reach more than 30%. After double mutation and triple mutation, the yield of malic acid can be increased by 40%. For the malic acid transporter mutant protein, after mutation at specific sites, the yield of malic acid is increased by at least 10%, and the mutation in the preferred strain can reach more than 30%. After the two proteins of the present invention are modified and combined, the yield of malic acid is synergistically increased.
[0211] The following specific examples are used to further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions described in the following examples are usually carried out under conventional conditions such as those described by Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 2001), or according to the conditions recommended by the manufacturer.
[0212] All primers used were synthesized by Genewiz Biotechnology Co., Ltd., and the genes to be synthesized were also synthesized by Genewiz. The sequences involved in the present invention are shown in the sequence listing.
[0213] The acquisition routes of various biological materials described in the examples are only provided as an experimental acquisition route to achieve the specific disclosure purpose, and should not be a limitation on the source of biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the prompts in the examples.
[0214] In the present invention, malic acid and succinic acid were purchased from sigma reagent company.
[0215] Example 1 Construction of a Screening Platform for Dicarboxylic Acid Transporters in Pichia pastoris
[0216] I. Construction of Vectors for Overexpressing Pyruvate Carboxylase and Malate Dehydrogenase in Pichia pastoris
[0217] Using primers AvrII-F (SEQ ID NO:44): (CCACCGCCCGTTACCGTCCGAAGGAAATTTTACTCTGCTGGAG) and AvrII-R (SEQ ID NO:45): (CTCCAGCAGAGTAAAATTTCCTTCGGACGGTAACGGGCGGTGG), with pGAPzA as the template, perform PCR. The PCR reaction system is as follows: 5×phusion HF buffer 10 μl, 10 mM dNTPs 1 μl, AvrII-F 1 μl, AvrII-R 1 μl, pGAPzA 1 μl, Phusion DNA polymerase 0.5 μl, water 35.5 μl. The PCR reaction conditions are: first at 98°C for 30 s; then at 98°C for 10 s, 60°C for 30 s, 72°C for 3 min, for 30 cycles; finally at 72°C for 10 min, 4°C for 10 min. After the PCR reaction, purify the product through a purification column. Add 1 μg of plasmid with 1 μl of restriction endonuclease DpnI to digest and remove the template, then heat inactivate at 85°C for 5 min. Take 5 μl of the product to transform Escherichia coli competent cell DH5α, coat it on a low-salt LB medium plate with 25 μg / ml Zeocin to screen for positive clones, and perform sequencing. The sequencing results show that the AvrII cleavage site on pGAPzA has been successfully removed, and it is named pGAPzAm. Using primers PYC-F (SEQ ID NO:46): (GGGTTCGAAACGATGGCCGAAGAAGACTACTCCC) / PYC-R (SEQ ID NO:47): (GGGGCGGCCGCTTACTCAGCCTTGACGATTTTGGCGATC), MDH-F (SEQ ID NO:48): (GGGTTCGAAACGATGGTTAAAGTCACAGTTTGCGGAG) / MDH-R (SEQ ID NO:49): (GGGGCGGCCGCTTAGTTGCCAGCAATGAAGGCAGTTCC), amplify the pyruvate carboxylase PYC and malate dehydrogenase MDH genes by PCR using the Pichia pastoris GS115 genome as the template. The PCR reaction conditions are: first at 98°C for 30 s; then at 98°C for 10 s, 60°C for 30 s, 72°C for 3 min (for PYC) or 1 min (for MDH), for 30 cycles; finally at 72°C for 10 min, 4°C for 10 min.After the PCR products were purified by passing through a purification column, double digestion was performed using BstBI and NotI. The plasmids pGAPzA and pGAPzAm were also double-digested with the same enzymes. Then, PYC was ligated to pGAPzA, and MDH was ligated to pGAPzAm at 22 °C for 1 h using T4 DNA ligase. 10 μl of the ligation product was taken to transform Escherichia coli competent cells DH5α, and the cells were spread on a low-salt LB medium plate containing 25 μg / ml Zeocin to screen for positive clones, followed by sequencing. The sequencing results showed that pGAPzA-PYC( was successfully constructed. Figure 1 ) and pGAPzAm-MDH( Figure 2 ) plasmids. Further, pGAPzAm-MDH was double-digested using BglII and BamHI to obtain the MDH expression cassette, which was then ligated to the plasmid pGAPzA-PYC digested with BamH1. The ligation product was used to transform Escherichia coli competent cells DH5α, and the cells were spread on a low-salt LB medium plate containing 25 μg / ml Zeocin to screen for positive clones, followed by sequencing, resulting in the construction of the pGAPzA-PYC-pGAPzAm-MDH expression plasmid. The schematic diagram of the plasmid is shown as Figure 3 shown.
[0218] II. Construction of Pichia pastoris strains overexpressing pyruvate carboxylase and malate dehydrogenase:
[0219] 1. Streak the Pichia pastoris GS115 strain stored at -80 °C on a YPD (1% yeast extract, 2% peptone, 2% glucose, 2% agar) plate and culture at 30 °C until single colonies grow.
[0220] 2. Pick a single colony and inoculate it into 30 ml of liquid YPD medium in a 250 ml flask. Culture at 200 rpm and 30 °C for 2 days for activation.
[0221] 3. Re-transfer the activated Pichia pastoris GS115 strain into a medium containing 30 ml of liquid YPD, with the inoculation amount controlled at one-thousandth. Culture at 200 rpm and 30 °C for about 16 h - 20 h until the OD 600 reaches 1.0.
[0222] 4. Centrifuge at 3000 rpm and 4 °C to collect the cells, and wash them twice with pre-cooled sterile water.
[0223] 5. Then wash once with pre-cooled 1 M sorbitol and centrifuge to collect the precipitate.
[0224] 6. Resuspend the cells in about 400 μl of 1 M sorbitol, and then aliquot 80 μl into each pre-cooled 1.5 ml centrifuge tube to prepare Pichia pastoris GS115 competent cells, which are stored at -80 °C for later use.
[0225] 7. The plasmid pGAPzA-PYC-pGAPzAm-MDH was extracted, linearized with AvrII, and then transformed into competent Pichia pastoris GS115 cells by electroporation. After that, 1 ml of pre-cooled 1 M sorbitol was added, and the cells were left standing at 30 °C for 2 h. Then, they were spread on YPD plates containing 50 or 75 μg / ml and used for malic acid production after colonies grew. This strain was named P0.
[0226] III. Determination of malic acid synthesis ability
[0227] The malic acid-synthesizing strain was first activated in YPD medium for 48 h, and then inoculated into the malic acid-producing medium (100 g / L glucose, 1.24 g / L KNO3, 0.64 g / L KH2PO4, 0.04 g / L ZnSO4·7H2O, 0.25 g / L MgSO4·7H2O, 0.0005 g / L FeSO4·7H2O, 4 g / L peptone, 0.1 g / L CaCl2, 75 g / L CaCO3, 0.1 g / L histidine) at an initial OD 600 = 1.0. The liquid volume in a 250-ml Erlenmeyer flask was 30 ml, and the cells were cultured at 200 rpm and 30 °C. Every 24 h, 1 ml of the sample was taken, 1 ml of 20% (V / V) H2SO4 was added, and the mixture was acidified at 80 °C for 30 min. A certain amount of water was added for dilution, and then the mixture was centrifuged. The supernatant was taken to measure the malic acid content using an HPLC Aminex 87H chromatographic column. The HPLC parameter conditions were as follows: column temperature 35 °C, detector temperature 40 °C, mobile phase 5 mM H2SO4, flow rate 0.5 ml / min, and quantification was performed using a malic acid standard. The results were as Figure 7 shown. Compared with the GS115 strain, the P0 strain could produce 3.0 g / l of malic acid, while the GS115 strain produced 1.0 g / L of malic acid.
[0228] Example 2 Construction and screening of a binary carboxylic acid transporter mutant library.
[0229] I. Construction of a binary carboxylic acid transporter expression vector:
[0230] The primers were:
[0231] Hph-BamH1 SEQ ID NO:50 GGGGGATCCTGTACAGCTTGCCTCGTCCCC
[0232] Hph-R SEQ ID NO:51 GTCGACACTGGATGGCGGCGTTAG
[0233] Using the pAG34 plasmid as a template, the hygromycin gene was amplified by PCR. The PCR reaction conditions were as follows: first, 98°C for 30 s; then 98°C for 10 s, 60°C for 30 s, 72°C for 2 min, for 30 cycles; finally, 72°C for 10 min and 4°C for 10 min. After the PCR reaction was completed, the product was purified using a purification column, digested with BamH1, and ligated to the pGAPzA plasmid digested with BamH1 and EcoRV. The ligation product was transformed into Escherichia coli competent cells DH5α, and the monoclonal sequencing was correct, obtaining pGAP-hph.
[0234] The primers were:
[0235] his-BglII SEQ ID NO:52 GGGAGATCTGTTGTAACACTGGCAGAGCATTACG
[0236] his-BamH1 SEQ ID NO:53 GGGGGATCCGTCCCAGTTTCTCCATACGAACC)
[0237] Using the pPIC9K plasmid as a template, the his gene was amplified by PCR. The PCR fragment was digested with BglII and BamH1 and ligated to pGAP-hph digested with BglII, obtaining pGAP-hph-his.
[0238] The primers were:
[0239] SpMae-ClaI SEQ ID NO:54 GGGATCGATATGGGTGAACTCAAGGAAATCTTG
[0240] SpMae-NotI SEQ ID NO:55 GGGGCGGCCGCTTAAACGCTTTCATGTTCACTACTAGG
[0241] Using the Schizosaccharomyces pombe genomic DNA as a template, the SpMae gene was amplified by PCR.
[0242] The primers were:
[0243] AoMae-BstBI SEQ ID NO:56 GGGTTCGAAATGCTGACACCTCCCAAGTTTG
[0244] AoMae-NotI SEQ ID NO:57 GGGCGGCCGCCTAATCAGATACATCCTCATCTTTAC
[0245] Using the cDNA of Aspergillus oryzae DSM1863 (DSMZ, purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) as a template, the AoMae gene was amplified by PCR;
[0246] The primers were:
[0247] Kljen2-EcoRI SEQ ID NO:58 GGGGAATTCATGGCTGCAGAATCAATAGTGTCTC
[0248] Kljen2-NotI SEQ ID NO:59 GGGGCGGCCGCTTATGTTGAATTTCTTGCTTGAAATTTAGAT
[0249] C
[0250] Using the genomic DNA of Kluyveromyces lactis as a template, Kljen2 was amplified by PCR. The PCR products of SpMae, AoMae and Kljen2 were digested with ClaI / NotI, BstBI / NotI, and EcoRI / NotI respectively, purified, and then ligated to the vector pGAP-hph-his (digested with the corresponding enzymes, ClaI and BstBI are isocaudamers). The ligation products were transformed into Escherichia coli competent cells DH5α, and the monoclonal sequencing was correct, obtaining pGAP-hph-his-SpMae, pGAP-hph-his-AoMae and pGAP-hph-his-Kljen2 ( Figure 4 )
[0251] II. Comparison of the malic acid-producing ability of candidate proteins of dicarboxylic acid transporters: After the vectors pGAP-hph-his-SpMae, pGAP-hph-his-AoMae and pGAP-hph-his-Kljen2 were linearized with AvrII respectively, they were electrotransformed into the P0 strain and spread on MD (YNB 13.4 g / L, biotin 4×10 -4 g / L, agar 2.0 g / L, glucose 2.0 g / L). After colonies grew out, they were cultured in a shaking flask with an acid-producing medium. The results are as Figure 7 shown. Among them, AoMae derived from A. oryzae is more conducive to the synthesis of organic acids such as malic acid. Using 100 g / L glucose as a substrate, 55 g / L malic acid can be synthesized. The obtained strain was named P1, and protein engineering modification was carried out using this as the starting protein.
[0252] III. Construction of a high-throughput screening method based on the hydrolysis zone: Due to the solubility of calcium malate at 20 - 30 g / L (discovered in the early stage of this study), we established a high-throughput screening method for the hydrolysis zone. The specific method is as follows: When the transport protein expression plasmid is transferred into P0 competent cells, after colonies grow, pick the colonies with a sterile toothpick and then stab them into the solid medium for malic acid production (2.0 g / L agar is added to the liquid, and the concentration of CaCO3 is 3 g / L). Check the size of the hydrolysis zone every day, and use the ratio of the diameter of the hydrolysis zone to the diameter of the colony as the screening criterion. The larger the value, the higher the malic acid production.
[0253] IV. Construction of the Aomae mutant library and screening of malic acid-producing mutants: Protein engineering modification was carried out on AoMae derived from A. oryzae. Using AoMae-BstBI and AoMae-NotI as primers, random mutagenesis amplification of AoMae was performed using the random mutagenesis kit GeneMorph II Random Mutagenesis (Agilent). After digesting the PCR product with BstBI and NotI, it was ligated with pGAP-hph-his. The ligation product was transformed into Escherichia coli competent cells DH5α, and spread on an LB solid plate medium containing 125 μg / ml hygromycin, and cultured overnight at 37°C. Randomly pick 20 monoclonal colonies for sequencing and analyze the mutation rate. The results show that the mutation rate is about 1%. The mutant library was eluted with an LB liquid medium containing 125 μg / ml hygromycin, then resuscitated at 37°C for 2 h, and then the mixed plasmid was extracted. After linearization with AvrII, it was transformed into P0 competent cells, spread on an MD plate. After single colonies grew, stab them into the solid medium for malic acid production. Using the wild-type strain P1 of AoMae as a control, the strains in the mutant library with a larger hydrolysis zone than P1 ( Figure 8 ), were subjected to rescreening by shake flask and determination of malic acid content by HPLC.
[0254] V. Determination of the copy number of the AoMae gene in malic acid-producing mutants
[0255] Extract the genomic DNA of the malic acid-producing mutants.
[0256] The primers are:
[0257] Actin-RT1-F SEQ ID NO:60 CTGCGATTCTTATTCTTCCGATTG
[0258] Actin-RT1-R SEQ ID NO:61 CAACCGAGGACAACCAACAG
[0259] Amplify the Actin gene as an internal reference
[0260] The primers are:
[0261] Aomae-RT1-F SEQ ID NO:62 CATCATCTGCGGCTTGTC
[0262] Aomae-RT1-R SEQ ID NO:63 TGAGAAGACGAACGAGTATTG Amplify the AoMae gene, and the results show that all the obtained AoMae transformants are single-copy.
[0263] VI. Mutation site identification: For the mutant strains with increased malic acid production, extract their genomic DNA, and then perform PCR amplification using AoMae-BstB1 and AoMae-NotI as primers. After the amplified product is recovered by a purification column, it is ligated to the pJET1.2 blunt vector, transformed into Escherichia coli competent cells DH5α, and spread on LB medium containing 100 μg / ml ampicillin. Sequencing of the monoclonal colonies yields the mutation sites I80F, V142D, R272P, E8G, I109V, S123R, I301K, P163Q, F101H, L140N, F97G, A191C, Y115I, A214G, F201K, H227F, M251Y, and E222H.
[0264] VII. Site-directed saturation mutagenesis and combinatorial mutagenesis of AoMae to enhance malic acid synthesis: Perform saturation mutagenesis on the sites obtained by random mutagenesis and the key amino acid sites obtained based on structural alignment. The method is as follows: Introduce the mutation sites in the middle of the primers, and then perform PCR circular amplification of pGAP-hph-his-AoMae. The PCR product is digested with DpnI to remove the template plasmid, and then 5 μl is taken to transform Escherichia coli competent cells DH5α. Spread on LB medium containing 125 μg / ml hygromycin, sequence the monoclonal colonies to obtain the mutation sites. After linearizing the obtained AoMae mutant expression plasmid with AvrII, transform the P0 strain, and then perform shake flask culture in a liquid malic acid production medium and HPLC analysis.
[0265] For the I80F mutation, use primer I80F (SEQ ID NO:64):
[0266] CCATGGCTATAAGGTTCTTCCTGCACGGCAACCTTCTG and I80-rev (SEQ ID NO:65): GAACCTTATAGCCATGGTAGAG. For other I80X mutations (X represents 18 other amino acids except F), use primers I80X (SEQ ID NO:66):
[0267] CCATGGCTATAAGGTTCXXXCTGCACGGCAACCTTCTG (XXX are codons corresponding to different amino acids) and I80-rev (SEQ ID NO:65) were introduced.
[0268] The V142D mutation was introduced using primers V142D (SEQ ID NO:67): GCGTCTGCACCTTACTCGACGCAATCATCCAATACTCG and V142-rev (SEQ ID NO:68): GAGTAAGGTGCAGACGCAGTAG. For V142X mutations at other sites (X represents 18 amino acids other than F), primers V142X (SEQ ID NO:69): GCGTCTGCACCTTACTCXXXGCAATCATCCAATACTCG (XXX are codons corresponding to different amino acids) and V142-rev (SEQ ID NO:68) were used respectively.
[0269] The R272P mutation was introduced using primers R272P (SEQ ID NO:69): CACGCCCTGGAAGATGGCCCAATCATCGAGCTGCTGGC and R272-rev (SEQ ID NO:70): GCCATCTTCCAGGGCGTG. For R272X mutations at other sites (X represents 18 amino acids other than F), primers R272X (SEQ ID NO:71): CACGCCCTGGAAGATGGCXXXATCATCGAGCTGCTGGC (XXX are codons corresponding to different amino acids) and R272-rev (SEQ ID NO:70) were used respectively.
[0270] The E8G mutation was introduced using primers E8G (SEQ ID NO:72): CTGACACCTCCCAAGTTTGGTGATGAGAAGCAGCTGGG and E8-rev (SEQ ID NO:73): AAACTTGGGAGGTGTCAGC. For E8X mutations at other sites (X represents 18 amino acids other than F), primers E8X (SEQ ID NO:74): CTGACACCTCCCAAGTTTXXXGATGAGAAGCAGCTGGG (XXX are codons corresponding to different amino acids) and E8-rev (SEQ ID NO:73) were used respectively.
[0271] The I109V mutation was introduced using primers I109V (SEQ ID NO:75): TCTCCGTCGCAACCATCGTCTGCGGCTTGTCTCGCTAC and I109-rev (SEQ ID NO:76): GATGGTTGCGACGGAGAG. For the I109X mutations at other sites (where X represents any of the 18 amino acids other than F), primers I109X (SEQ ID NO:77): TCTCCGTCGCAACCATCXXXTGCGGCTTGTCTCGCTAC (XXX is the codon corresponding to the different amino acid) and I109-rev (SEQ ID NO:76) were used respectively.
[0272] The S123R mutation was introduced using primers S123R (SEQ ID NO:78): GTGAAGAATCGAATGAGAGATTCCAACTAGCCCTCGAAG and S123-rev (SEQ ID NO:79): CTCATTCGATTCTTCACCG. For the S123X mutations at other sites (where X represents any of the 18 amino acids other than F), primers S123X (SEQ ID NO:80): GTGAAGAATCGAATGAGXXXTTCCAACTAGCCCTCGAAG (XXX is the codon corresponding to the different amino acid) and S123-rev (SEQ ID NO:79) were used respectively.
[0273] The I301K mutation was introduced using primers I301K (SEQ ID NO:81): CGCCATTGTCGCCGTCAAGCGCTCGCCCCCCGAGGCC and I301-rev (SEQ ID NO:82): GACGGCGACAATGGCGATG. For the S123X mutations at other sites (where X represents any of the 18 amino acids other than F), primers S123X (SEQ ID NO:83): CGCCATTGTCGCCGTCXXXCGCTCGCCCCCCGAGGCC (XXX is the codon corresponding to the different amino acid) and I301-rev (SEQ ID NO:82) were used respectively.
[0274] The P163Q mutation was introduced using primers P163Q (SEQ ID NO:84): GCCTTCAAACCATGATGCAATCATGGATCCTTCCAGCC and P163Q-rev (SEQ ID NO:85): CATCATGGTTTGAAGGCC. The P163X mutations at other sites (where X represents any of the 18 amino acids other than F) were introduced using primers P163X (SEQ ID NO:86): GCCTTCAAACCATGATGXXXTCATGGATCCTTCCAGCC (where XXX is the codon corresponding to the different amino acid) and P163-rev (SEQ ID NO:85).
[0275] The F101H mutation was introduced using primers F101H (SEQ ID NO:87): GGTCTCTTCTTCCCGACCCACTGGCTCTCCGTCGCAACC and F101-rev (SEQ ID NO:88): GGTCGGGAAGAAGAGACCC. The F101X mutations at other sites (where X represents any of the 18 amino acids other than F) were introduced using primers F101X (SEQ ID NO:89): GGTCTCTTCTTCCCGACCXXXTGGCTCTCCGTCGCAACC (where XXX is the codon corresponding to the different amino acid) and F101-rev (SEQ ID NO:88).
[0276] The L140N mutation was introduced using primers L140N (SEQ ID NO:90): TCTACTGCGTCTGCACCAACCTCGTCGCAATCATCC and L140-rev (SEQ ID NO:91): GGTGCAGACGCAGTAGATC. The L140X mutations at other sites (where X represents any of the 18 amino acids other than F) were introduced using primers L140X (SEQ ID NO:92): TCTACTGCGTCTGCACCXXXCTCGTCGCAATCATCC (where XXX is the codon corresponding to the different amino acid) and L140-rev (SEQ ID NO:91).
[0277] The F97G mutation was introduced using primers F97G (SEQ ID NO: 93): CATGACCGCGAGGGTCTCGGGTTCCCGACCTTCTGGCTC and F97-rev (SEQ ID NO: 94): GAGACCCTCGCGGTCATG. For the F97X mutations at other sites (where X represents any of the 18 amino acids other than F), primers F97X (SEQ ID NO: 95): CATGACCGCGAGGGTCTCXXXTTCCCGACCTTCTGGCTC (where XXX is the codon corresponding to the different amino acid) and F97-rev (SEQ ID NO: 94) were used respectively.
[0278] The A191C mutation was introduced using primers A191C (SEQ ID NO: 96): CAACAACCCGCTCGCGCATGTCTCCCCATCATCGGCGC and A191-rev (SEQ ID NO: 97): TGCGCGAGCGGGTTGTTG. For the A191X mutations at other sites (where X represents any of the 18 amino acids other than F), primers F97X (SEQ ID NO: 98): CAACAACCCGCTCGCGCATGTCTCCCCATCATCGGCGC (where XXX is the codon corresponding to the different amino acid) and A191-rev (SEQ ID NO: 97) were used respectively.
[0279] The Y115I mutation was introduced using primers Y115I (SEQ ID NO: 99): TCTGCGGCTTGTCTCGCATCTTCGGTGAAGAATCGAATG and Y115-rev (SEQ ID NO: 100): GCGAGACAAGCCGCAGATG. For the Y115X mutations at other sites (where X represents any of the 18 amino acids other than F), primers F97X (SEQ ID NO: 101): TCTGCGGCTTGTCTCGCXXXTTCGGTGAAGAATCGAATG (where XXX is the codon corresponding to the different amino acid) and Y115-rev (SEQ ID NO: 100) were used respectively.
[0280] The A214G mutation was introduced using primers A214G (SEQ ID NO:102): TCAGCTTCATGATGTACGGGCACTACATCGGCCGACTG and A214-rev (SEQ ID NO:103): GTACATCATGAAGCTGATG. For other site A214X mutations (where X represents 18 amino acids other than F), primers A214X (SEQ ID NO:104): TCAGCTTCATGATGTACXXXCACTACATCGGCCGACTG (XXX is the codon corresponding to different amino acids) and A214X-rev (SEQ ID NO:103) were used respectively.
[0281] The F201K mutation was introduced using primers F201K (SEQ ID NO:105): CGGCGCCGGCGTCACCAAGCAGGGCCTCGGCTTCTCC and F201-rev (SEQ ID NO:106): GGTGACGCCGGCGCCGATG. For other site F201X mutations (where X represents 18 amino acids other than F), primers A214X (SEQ ID NO:107): CGGCGCCGGCGTCACCXXXCAGGGCCTCGGCTTCTCC (XXX is the codon corresponding to different amino acids) and F201-rev (SEQ ID NO:106) were used respectively.
[0282] The H227F mutation was introduced using primers H227F (SEQ ID NO:108): ATGGAGTCCGGCCTCCCCTTCAGCGACCACAGACCAGGC and H227-rev (SEQ ID NO:109): GGGGGAGGCCGGACTCCATC. For other site H227X mutations (where X represents 18 amino acids other than F), primers A214X (SEQ ID NO:110): ATGGAGTCCGGCCTCCCCXXXAGCGACCACAGACCAGGC (XXX is the codon corresponding to different amino acids) and H227-rev (SEQ ID NO:109) were used respectively.
[0283] The M251Y mutation was introduced using primers M251Y (SEQ ID NO: 111): CCCTCGCCCTCGTCGGCTACAGCAAAGGCCTCCCCGAAG and M251-rev (SEQ ID NO: 112): GCCGACGAGGGCGAGGGC. For other site M251X mutations (X represents 18 amino acids other than F), primers M251X (SEQ ID NO: 113): CCCTCGCCCTCGTCGGCXXXAGCAAAGGCCTCCCCGAAG (XXX is the codon corresponding to different amino acids) and M251-rev (SEQ ID NO: 112) were used respectively.
[0284] The E222H mutation was introduced using primers E222Y (SEQ ID NO: 114): TACATCGGCCGACTGATGCACTCCGGCCTCCCCCAC and E222-rev (SEQ ID NO: 115): CATCAGTCGGCCGATGTAG. For other site E222X mutations (X represents 18 amino acids other than F), primers M251X (SEQ ID NO: 116): TACATCGGCCGACTGATGXXXTCCGGCCTCCCCCAC (XXX is the codon corresponding to different amino acids) and E222-rev (SEQ ID NO: 115) were used respectively.
[0285] The results of screening for malic acid after transforming each mutant into the P0 strain are as Figures 9 - 26 shown:
[0286] Four optimal points E8Q, I80K, V142I, and R272A were selected for combinatorial mutagenesis (which can improve the malic acid synthesis ability by 15%, 14%, 21%, and 21% respectively). Using the same method as for saturation mutagenesis, the P0 strain was also transformed with the combinatorial mutagenesis. The results of malic acid production are as Figure 27 shown. Among them, the I80K / R272A (corresponding to plasmid pGAP-hph-his-AoMaeKA) mutation had the best ability to synthesize malic acid, which was 30% higher than that of the starting strain, reaching 71.5 g / L.
[0287] Example 3 Construction of the Screening Platform Strain for Pyruvate Carboxylase
[0288] I. Construction of the expression vector for the dicarboxylic acid transporter, primers are as follows:
[0289] Hph-BamH1 SEQ ID NO: 117 GGGGGATCCTGTACAGCTTGCCTCGTCCCC
[0290] Hph-R SEQ ID NO:118 GTCGACACTGGATGGCGGCGTTAG
[0291] Using the pAG34 plasmid as a template, the hygromycin gene was amplified by PCR. The PCR reaction conditions were as follows: first, at 98°C for 30 s; then, at 98°C for 10 s, 60°C for 30 s, 72°C for 2 min, for 30 cycles; finally, at 72°C for 10 min and 4°C for 10 min. After the PCR reaction ended, the product was purified using a purification column, digested with BamH1, and ligated to the pGAPzA plasmid digested with BamH1 and EcoRV. The ligation product was transformed into Escherichia coli competent cells DH5α, and the monoclonal sequencing was correct, obtaining pGAP-hph. AoMae from Aspergillus oryzae was directly amplified by PCR from genomic DNA; after digestion with BstBI and NotI, AoMae was ligated to the vector pGAP-hph. The ligation product was transformed into Escherichia coli competent cells DH5α, and the monoclonal sequencing was correct, obtaining pGAP-hph-AoMae( Figure 5 ).
[0292] II. Construction of Pichia pastoris strains overexpressing dicarboxylic acid transporters
[0293] 1. Streak the Pichia pastoris GS115 strain stored at -80°C on a YPD (1% yeast extract, 2% peptone, 2% glucose, 2% agar) plate and culture it at 30°C until single colonies grow.
[0294] 2. Pick a single colony and inoculate it into a 250-ml liquid YPD medium with a volume of 30 ml, culture it at 200 rpm and 30°C for 2 days for activation.
[0295] 3. Re-transfer the activated Pichia pastoris GS115 strain into a medium containing 30 ml of liquid YPD, control the inoculation amount at one-thousandth, culture it at 200 rpm and 30°C for about 16 h - 20 h until the OD 600 grows to 1.0.
[0296] 4. Centrifuge at 3000 rpm and 4°C to collect the cells, and wash them twice with pre-cooled sterile water
[0297] 5. Then wash them once with pre-cooled 1 M sorbitol and centrifuge to collect the precipitate
[0298] 6. Add about 400 μl of 1 M sorbitol to resuspend the cells, and then aliquot 80 μl into each pre-cooled 1.5-ml centrifuge tube to prepare Pichia pastoris GS115 competent cells, which are stored at -80°C for later use.
[0299] 7. Extract the pGAP-hph-AoMae plasmid, linearize the plasmid with AvrII, and then transform it into Pichia pastoris GS115 competent cells by electroporation. After that, add 1 ml of pre-cooled 1 M sorbitol, let it stand at 30 °C for 2 h, and then coat it on a YPD plate containing 300 μg / ml. After the colonies grow, it is used for malic acid production, and this strain is named P2.
[0300] III. Determination of malic acid synthesis ability
[0301] The malic acid-synthesizing strain is first activated in YPD medium for 48 h, and then with an initial OD 600 = 1.0, inoculate it into the malic acid-producing medium (100 g / L glucose, 1.24 g / L KNO3, 0.64 g / L KH2PO4, 0.04 g / L ZnSO4·7H2O, 0.25 g / L MgSO4·7H2O, 0.0005 g / L FeSO4·7H2O, 4 g / L peptone, 0.1 g / L CaCl2, 75 g / L CaCO3, 0.1 g / L histidine, biotin 4×10 -4 g / L). The liquid volume in a 250 ml Erlenmeyer flask is 30 ml, culture it at 200 rpm and 30 °C. Every 24 h, take 1 ml of the sample, add 1 ml of 20% (V / V) H2SO4, acidify it at 80 °C for 30 min, add a certain amount of water for dilution, then centrifuge, and take the supernatant to measure the malic acid content using an HPLC Aminex 87H chromatographic column. The HPLC parameter conditions are as follows: the column temperature is 35 °C, the detector temperature is 40 °C, the mobile phase is 5 mM H2SO4, the flow rate is 0.5 ml / min, and quantify it with a malic acid standard. The results show that the P2 strain can produce 5.0 g / L of malic acid, and GS115 produces 1.0 g / L of malic acid.
[0302] Example 4 Construction and screening of pyruvate carboxylase mutant library
[0303] I. Construction of pyruvate carboxylase expression vector, primers are as follows:
[0304] his-BglII SEQ ID NO:119 GGGAGATCTGTTGTAACACTGGCAGAGCATTACG
[0305] his-BamH1 SEQ ID NO:120 GGGGGATCCGTCCCAGTTTCTCCATACGAACC
[0306] Using the pPIC9K plasmid as a template, the his gene was amplified by PCR. The PCR fragment was digested with BglII and BamH1 and ligated to pGAPzA digested with BglII to obtain pGAPzA-his. The pyruvate carboxylases from Penicillium and Rhizobium were synthesized by GenScript, and the primers were as follows:
[0307]
[0308]
[0309] Then, after digestion with BstBI and NotI, it was ligated to pGAPzA-his digested with the same enzymes, and Escherichia coli DH5α was transformed. The transformants were sequenced correctly and named pGAPzA-his-PvPyc and pGAPzA-his-RePyc( Figure 6 ). For the pyruvate carboxylases from Aspergillus, Rhizopus oryzae, Corynebacterium glutamicum and Pichia pastoris, the primers were as follows:
[0310]
[0311] Using their respective genomic DNAs as templates, PCR amplification was carried out. The PCR reaction system was: 5×phusion HF buffer 10 μl, 10 mM dNTPs 1 μl, AvrII-F 1 μl, AvrII-R 1 μl, pGAPzA 1 μl, Phusion DNA polymerase 0.5 μl, water 35.5 μl. The PCR reaction conditions were: first at 98°C for 30 s; then at 98°C for 10 s, 60°C for 30 s, 72°C for 3 min, for 30 cycles; finally at 72°C for 10 min and 4°C for 10 min. After the PCR products were purified by a purification column, they were digested with BstBI and NotI (the restriction sites within the gene were eliminated by mutation), ligated to the vector pGAPzA-his, and Escherichia coli DH5α was transformed. The transformants were sequenced correctly and named pGAPzA-his-AoPyc, pGAPzA-his-RoPyc, pGAPzA-his-CgPyc and pGAPzA-his-PpPyc( Figure 6 ).
[0312] II. Comparison of pyruvate carboxylase candidate genes
[0313] After the 6 expression vectors of pyruvate carboxylases from different sources constructed above were digested with AvrII, they were electrotransformed into the Pichia pastoris P2 strain containing the dicarboxylic acid transporter AoMae, spread on an MD plate. After colonies grew out, single colonies were picked, activated in YPD liquid medium for 48 h, and cultured in a shake flask with an acid-producing medium. The results were as Figure 28As shown, the pyruvate carboxylase CgPyc derived from Corynebacterium glutamicum is more conducive to the synthesis of organic acids such as malic acid. Using 100 g / L glucose as the substrate, 53.2 g / L malic acid can be synthesized. Based on this starting protein, protein engineering modification is carried out.
[0314] III. Construction of a high-throughput screening method based on the hydrolysis zone: Due to the soluble property of calcium malate at 20 - 30 g / L (discovered in the early stage of this research), we established a high-throughput screening method for the hydrolysis zone. The specific method is as follows: Transform P2 competent cells with pyruvate carboxylase. After colonies grow, pick the colonies with a sterile toothpick and then puncture them into a solid medium for malic acid production (2.0 g / L agar is added to the liquid, and the concentration of CaCO3 is 3 g / L). Check the size of the hydrolysis zone every day, and use the ratio of the diameter of the hydrolysis zone to the diameter of the colony as the screening criterion. The larger the value, the higher the malic acid production ( Figure 29 ).
[0315] IV. Construction of the PYC mutant library and screening of malic acid-producing mutant strains: Protein engineering modification is carried out on the pyruvate carboxylase CgPyc derived from Corynebacterium glutamicum. First, mutate BstBI and NotI contained in CgPyc. The primers used are as follows:
[0316]
[0317] The same site-directed mutagenesis method as in Example 2 is used to obtain the plasmid pGAPZA-his-CgPyc (BstBI NotImut) as a template for random mutagenesis and site-directed mutagenesis of CgPyc. The primers are as follows:
[0318] CgPyc-ep-F SEQ ID NO:137 GGGTTCGAAATGTCGACTCACACATCTTC
[0319] CgPyc-ep-R SEQ ID NO:138 GGGGCGGCCGCTTAGGAAACGACGACGATCAAG
[0320] Random mutagenesis amplification of CgPyc was carried out using the random mutagenesis kit GeneMorph II Random Mutagenesis (Agilent). The PCR product was digested with BstB1 and NotI and then ligated with pGAPzA-his. The ligation product was transformed into Escherichia coli competent cells DH5α and spread on an LB solid plate medium containing 25 μg / ml Zeocin. After overnight culture at 37 °C, 20 monoclonal colonies were randomly selected for sequencing to analyze the mutation rate. The results showed that the mutation rate was about 1%. The mutant library was eluted with an LB liquid medium containing 25 μg / ml Zeocin, then resuscitated at 37 °C for 2 h, and then the mixed plasmid was extracted. After linearization with AvrII, it was transformed into P2 competent cells and spread on an MD plate. After single colonies grew, they were stabbed into a solid medium for malic acid production. Using the wild-type strain of CgPyc as a control, the strains in the mutant library with a larger hydrolysis zone than the wild-type CgPyc were rescreened by shake flasks and the malic acid content was determined by HPLC.
[0321] V. Identification of mutation sites: For the mutant strains with increased malic acid production, their genomic DNA was extracted, and then PCR amplification was carried out using CgPyc-F and CgPyc-R as primers. After the amplification product was recovered by a purification column, it was ligated into the pJET1.2 blunt vector, transformed into Escherichia coli competent cells DH5α, and spread on an LB medium containing 100 μg / ml ampicillin. The monoclonal colonies were sequenced to obtain the mutation sites H51E, F453Q, A254N, G837M, A762T, P824L, P826T, P1031S.
[0322] VI. Site-directed saturation mutagenesis and combinatorial mutagenesis of CgPyc to enhance malic acid synthesis: The sites obtained by random mutagenesis were subjected to saturation mutagenesis. The method was as follows: The mutation sites were introduced in the middle of the primers, and then pGAPzA-his-CgPyc was amplified by PCR in a circular form. The PCR product was digested with DpnI to remove the template plasmid. Then, 5 μl was taken and transformed into Escherichia coli competent cells DH5α, and spread on an LB medium containing 25 μg / ml Zeocin. The monoclonal colonies were sequenced to obtain the mutation sites. After linearization of the obtained CgPyc mutant expression plasmid with AvrII, it was transformed into strain P2, and then cultured in a shake flask with a liquid malic acid production medium and analyzed by HPLC. The mutations introduced were as follows:
[0323] The H51E mutation was introduced using primers H51E (SEQ ID NO: 139): GAAGATCGGGGATCATTCGAGCGCTCTTTTGCTTCTG and H51-rev (SEQ ID NO: 140): GAATGATCCCCGATCTTC. For other-site H51X mutations (where X represents any of the 18 amino acids other than F), the mutations were introduced using primers H51X (SEQ ID NO: 141): GAAGATCGGGGATCATTCXXXCGCTCTTTTGCTTCTG (where XXX is the codon corresponding to the different amino acid) and H51-rev (SEQ ID NO: 140).
[0324] The F453Q mutation was introduced using primers F453Q (SEQ ID NO: 142): AGCGCATCGCCACCGGACAAATTGCCGATCACCCGCAC and F453-rev (SEQ ID NO: 143): TCCGGTGGCGATGCGCTTG. For other-site F453X mutations (where X represents any of the 18 amino acids other than F), the mutations were introduced using primers F453X (SEQ ID NO: 144): AGCGCATCGCCACCGGAXXXATTGCCGATCACCCGCAC (where XXX is the codon corresponding to the different amino acid) and F453-rev (SEQ ID NO: 143).
[0325] The A254N mutation was introduced using primers A254N (SEQ ID NO: 145): AGTTGTCGAAATTGCGCCAAACCAGCATTTGGATCCAG and A254-rev (SEQ ID NO: 146): TGGCGCAATTTCGACAAC. For other-site A254X mutations (where X represents any of the 18 amino acids other than F), the mutations were introduced using primers A254X (SEQ ID NO: 147): AGTTGTCGAAATTGCGCCAAACCAGCATTTGGATCCAG (where XXX is the codon corresponding to the different amino acid) and A254X-rev (SEQ ID NO: 146).
[0326] The G837M mutation was introduced using primers G837M (SEQ ID NO:148): TACCGCCACGAAATCCCAATGGGACAGTTGTCCAACCTG and G837-rev (SEQ ID NO:149): TGGGATTTCGTGGCGGTAG. For other site G837X mutations (where X represents any of the 18 amino acids other than F), primers G837X (SEQ ID NO:150): TACCGCCACGAAATCCCAXXXGGACAGTTGTCCAACCTG (XXX is the codon corresponding to the different amino acid) and G837-rev (SEQ ID NO:149) were used respectively.
[0327] The A762T mutation was introduced using primers A762T (SEQ ID NO:151): GCTCAAGCTGGTACCGATGCTGTTGACGGTGCTTC and A762-rev (SEQ ID NO:152): ACCAGCTTGAGCTGCAGC. For other site A762X mutations (where X represents any of the 18 amino acids other than F), primers A762X (SEQ ID NO:153): GCTCAAGCTGGTXXXGATGCTGTTGACGGTGCTTC (XXX is the codon corresponding to the different amino acid) and A762-rev (SEQ ID NO:152) were used respectively.
[0328] The P824L mutation was introduced using primers P824L (SEQ ID NO:154): TTGAGTCTGGAACCTTGGGCCCAACCGGTCGC and P824-rev (SEQ ID NO:155): GGTTCCAGACTCAAATGGCAGG. For other site P824X mutations (where X represents any of the 18 amino acids other than F), primers P824X (SEQ ID NO:156): TTGAGTCTGGAACCXXXGGCCCAACCGGTCGC (XXX is the codon corresponding to the different amino acid) and P824-rev (SEQ ID NO:155) were used respectively.
[0329] The P826T mutation was introduced using primers P826T (SEQ ID NO: 157): CTGGAACCCCAGGCACCACCGGTCGCGTCTAC and P826-rev (SEQ ID NO: 158): GCCTGGGGTTCCAGACTC. For other site P826X mutations (where X represents 18 amino acids other than F), primers G837X (SEQ ID NO: 159): CTGGAACCCCAGGCXXXACCGGTCGCGTCTAC (where XXX is the codon corresponding to different amino acids) and P826-rev (SEQ ID NO: 158) were used respectively.
[0330] The P1031S mutation was introduced using primers P1031S (SEQ ID NO: 160): TGCGATCTCTGAGTCCGACGATAAGGGTATGC and P1031-rev (SEQ ID NO: 161): CTCAGAGATCGCATCCAGGC. For other site P1031X mutations (where X represents 18 amino acids other than F), primers P1031X (SEQ ID NO: 162): TGCGATCTCTGAGXXXGACGATAAGGGTATGC (where XXX is the codon corresponding to different amino acids) and P1031-rev (SEQ ID NO: 161) were used respectively.
[0331] All mutants were transformed into P2 competent cells, and the results of screening for malic acid are as Figures 30 - 37 shown: For the mutation sites with better positive mutation effects among them, A762D, P824V, P826E, and P1031E were selected for combinatorial mutation (these four points can increase malic acid by 35.7%, 29.4%, 28.3%, and 34.2% respectively). Using the same method as for saturation mutation, the combinatorial mutants were also transformed into strain P2, and the results of malic acid production Figure 38 , where A726D / P826E and A762D / P824E / P1031E can increase malic acid by 41.4% and 42.3% respectively, and the final malic acid synthesis ability reaches 75.2 g / L and 75.5 g / L.
[0332] Example 5 Application of Aomae in the synthesis of malic acid by Saccharomyces cerevisiae
[0333] I. Construction of co-expression plasmid vectors for pyc, mdh, and AoMae, primers are as follows:
[0334]
[0335] Using the DNA of Saccharomyces cerevisiae CEN PK.2-1C and Aspergillus oryzae cDNA as templates, ScPYC2, AoMae, and MDH3 (with the mitochondrial targeting sequence SKL removed) were amplified by PCR respectively. The three gene fragments were ligated to the EcoRI and HindIII of the Prs426-pgk-CYCtt vector by the Gibson method. The three genes formed a single cistron through the 2A peptide (raegrgslltcgdveenpg), and the expression plasmid Prs426-PGK-ScPYC2-Aomae-MDH3ΔSKL was obtained.
[0336] II. Construction of malic acid-producing Saccharomyces cerevisiae
[0337] The plasmid Prs426-PGK-ScPYC2-Aomae-MDH3ΔSKL was transformed into Saccharomyces cerevisiae CEN.PK2-1C by the LiAc / SS Carrier DNA method (Methods Mol Biol. 2014;1205:1-12.). The same medium as that for Pichia pastoris to produce malic acid was used for malic acid synthesis. The results are as Figure 39 shown. The results showed that 22 g / l of malic acid could be produced from 100 g / l of glucose.
[0338] Example 6 Modifying the C4-dicarboxylate transporter-encoding gene mae to improve the malic acid synthesis ability of Myceliophthora thermophila
[0339] I. Construction of the mae overexpression vector
[0340] The C4-dicarboxylate transporter-encoding gene mae (XM_001820829.2, SEQ ID NO:1) and its mutated gene maeKA were amplified from the cDNA of Aspergillus oryzae DSM1863 (DSMZ, purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) and the plasmid pGAP-hph-his-AoMaeKA respectively. After digestion with BglII, they were ligated into the linearized vector pAN52-hph digested with BglII and EcoRV. The ligation products were identified by restriction enzyme digestion to obtain the overexpression vectors, named pAN52-Wtmae and pAN52-maeKA. The primers are as follows:
[0341] mae-F SEQ ID NO:169 GGAAGATCTTAATTAACTCGAGCGGCCGCGTTTAAA
[0342] CACTAGTATGCTGACACCTCCCAAGTTTG
[0343] mae-R SEQ ID NO:170 ATCCTAATCAGATACAT CCTCATCTTTA
[0344] Using the gene of the starting strain Myceliophthora thermophila ATCC42464 (purchased from the American Type Culture Collection, American type culture collection) as a template, a promoter 1.4 kb upstream of the coding reading frame of the translation elongation factor (MYCTH_2298136) (named the Ptef promoter) was amplified by PCR. The primers are as follows:
[0345] tef-F SEQ ID NO:171 CCTTAATTAACATGTACCTTGACGTCCTCCGAG
[0346] tef-R SEQ ID NO:172 GGACTAGTTCTGAAGAACGAAACTGGC GACT
[0347] After the PCR reaction, it was digested with PacI and SpeI, and ligated into the linearized vector pAN52-hph-mae digested with the same enzymes. The ligation product was digested and identified with restriction endonucleases to obtain the mae gene expression vectors under the regulation of the promoter tef, named pAN52-Ptef-Wtmae and pAN52-Ptef-maeKA.
[0348] II. Introduction of the expression vector into Myceliophthora thermophila
[0349] A. Culture Myceliophthora thermophila ATCC42464 on an MM slant medium [50×Vogel's salts 20 ml, sucrose 20 g, agar 15 g, histidine (50 mg / ml) 20 ml, volume made up to 1 l, autoclaved. 50×Vogel's salts (1 l): trisodium citrate (1 / 2H2O) 150 g, anhydrous KH2PO4 250 g, anhydrous NH4NO3 100 g, MgSO4·7H2O 10 g, CaCl2·2H2O 5 g, trace element salt solution 5 mL, biotin (0.1 mg / ml) 2.5 mL, volume made up to 1 l.
[0350] B. Protoplast transformation of Myceliophthora thermophila
[0351] 1) Mycelium preparation
[0352] Collect mature spores of Myceliophthora thermophila with 0.05% Tween 80 sterilized water. After filtering out the mycelium through lens paper, spread it on an MM plate covered with cellophane and culture at 45°C for 14 h.
[0353] 2) Protoplast preparation
[0354] Place the cellophane with mycelium in 30 mL of lysis solution (formulation: 0.15 g of lytic enzyme, added aseptically to 30 mL of solution A, filtered and sterilized; solution A: 1.0361 g of potassium dihydrogen phosphate, 21.864 g of sorbitol, dissolved in 90 mL of deionized water, adjusted to pH 5.6 with potassium hydroxide, made up to 100 mL, autoclaved). Incubate at 28 °C for 2 h, gently shaking every 20 min.
[0355] Then, after filtration through cellophane, centrifuge at 2000 rpm at 4 °C for 10 min, discard the supernatant, add 4 mL of solution B (0.735 g of calcium chloride, 18.22 g of sorbitol, 1 mL of Tris-HCl 1 M pH 7.5, dissolved in 90 mL of deionized water, adjusted to pH 7.6 with hydrochloric acid, made up to 100 mL, autoclaved), and centrifuge at 2000 rpm at 4 °C for 10 min; discard the supernatant, and add a certain volume of solution B at 200 μL / plasmid.
[0356] 3) Protoplast transformation
[0357] In a pre-chilled 15 mL centrifuge tube, add successively 50 μL of pre-chilled PEG (12.5 g of PEG6000, 0.368 g of calcium chloride, 500 μL of Tris-HCl 1 M pH 7.5), 10 μL of plasmid linearized with HindIII, and 200 μL of protoplasts. After placing on ice for 20 min, add 2 mL of pre-chilled PEG, incubate at room temperature for 5 min, add 4 mL of solution B, and mix gently. Take 3 mL of the above solution and add it to 12 mL of melted MM medium containing the corresponding antibiotic, place it in a petri dish, incubate at 45 °C, and after 2 - 4 d, pick single mycelia under a stereomicroscope and grow them on the corresponding resistance plate, and then verify by PCR.
[0358] III. Determination of the malic acid production ability of Thermomyces lanuginosus transformants
[0359] All of the above-verified transformants were inoculated into 50 mL of a medium with crystalline cellulose (Avicel) as the carbon source in a 250 mL Erlenmeyer flask (formula: carbon source 75 g / l, peptone 6.0 g / l, 0.15 g / l KH2PO4, 0.15 g / l K2HPO4, 0.10 g / l CaCl2·2H2O, 0.10 g / l MgSO4·7H2O, calcium carbonate 80.0 g / l, 1 mL / L of 0.5 g / l biotin, 1 ml / l of trace element solution; trace element formula (100 ml): 5 g C6H8O·7H2O, 5 g ZnSO4·7H2O, 1 g Fe(NH4)2(SO4)·6H2O, 0.25 g CuSO4·5H2O, 0.05 g MnSO4·H2O, 0.05 g H3BO3, 0.05 g NaMoO4·2H2O, dissolved in water and made up to 100 ml), and the inoculation amount was 2.5*10 5 cells / ml, cultured at 45 °C and 150 rpm, and samples were taken on the eighth day to measure the malic acid content.
[0360] 1) Sample treatment:
[0361] Take 1 ml of the fermentation broth into a 15 ml centrifuge tube, add 1 ml of 1M H2SO4, then place it at 80 °C for 30 min, and shake it well every 10 min. Then add 2 ml of double-distilled water to the centrifuge tube, shake it well, take 1 ml of the liquid into a 1.5 ml centrifuge tube, centrifuge at 12,000 rpm for 10 min, and take the supernatant to measure the malic acid content.
[0362] 2) Determination of malic acid content
[0363] The malic acid content of the treated sample was determined by high-performance liquid chromatography. The detector was an ultraviolet detector, 5 mM H2SO4 was used as the mobile phase, and the flow rate was 0.5 ml / min. The results showed that after the malic acid transporter was modified, compared with the wild-type transporter, it could significantly promote the production of malic acid. On the eighth day, the malic acid yield of the transformant MaeKA was 46 g / l, which was 9.5% higher than that of the control strain WtMae (42 g / l). The experiment showed that after the C4-dicarboxylic acid transporter was modified, it could significantly improve the malic acid production ability of the thermophilic fungus Myceliophthora thermophila.
[0364] Example 7 Modifying the key enzyme pyruvate carboxylase of the reductive TCA cycle to improve the malic acid synthesis ability of Myceliophthora thermophila
[0365] I. Construction of overexpression vector
[0366] The pyruvate carboxylase gene Cgpyc and its mutated gene CgpycA726D / P826E were amplified from the genome of Corynebacterium glutamicum ATCC13032 and the plasmid pGAPzA-his-CgPycDE respectively. After digestion with SpeI and EcoRV, they were ligated into the linearized vector pAN52-C1pgdA-neo digested with the same restriction enzymes. The ligation products were digested and identified with restriction enzymes to obtain the overexpression vectors, named pAN52-Wtpyc and pAN52-pycA726D / P826E. The primers are as follows
[0367] CgPYC-F SEQ ID NO:173 GGACTAGTATGTCGACTCACACATCTTCA
[0368] CgPYC-R SEQ ID NO:174 AAAAAGATATCTTAGGAAACGACGACGATCAA
[0369] G
[0370] II. Determination of the malic acid production ability of Thermomyces lanuginosus transformants
[0371] The overexpression vectors pAN52-Wtpyc and pAN52-pycA726D / P826E were linearized with BglII and then integrated into the genome of the Thermomyces lanuginosus WtMae strain. With a final concentration of 100 μg / ml G418 as the screening antibiotic, the method is shown in step 2 of Example 1. Using the primers CgPYC-F and CgPYC-R, the transformants were verified and named WtPYC and PYCA726D / P826E
[0372] All the verified transformants were inoculated into 50 ml of the medium with crystalline cellulose (Avicel) as the carbon source in a 250 ml Erlenmeyer flask (the formula is shown in step 3 of Example 1), and the inoculation amount was 2.5×10 5 cells / ml. They were cultured at 45 °C and 150 rpm, and samples were taken on the eighth day. After the samples were processed by the method described in step 3.2 of Example 1, the malic acid content in the fermentation broth was measured
[0373] The results showed that compared with the wild-type pyruvate carboxylase, its mutation could significantly increase the malic acid production of the transformants. On the eighth day, the malic acid production of the transformant WtPYC was 49.9 g / l, while that of the overexpressed mutant pyc transformant reached 57.9 g / l, an increase of 16%. The experiment showed that after improving the pyruvate activity through protein modification, the malic acid synthesis ability of Thermomyces lanuginosus could be significantly improved
[0374] All documents mentioned in this invention are cited herein for reference as if each individual document was cited for reference separately. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.
Claims
1. A malate transporter mutant protein, characterized in that, The malate transporter mutant protein has only the amino acid mutations of R272A or R272F compared with the sequence shown in SEQ ID NO: 22; and the malate transporter mutant protein has the activity of transporting malate from inside the cell to outside the cell.
2. An isolated polynucleotide or combination thereof, characterized in that, The polynucleotide encodes the malate transporter mutant protein according to claim 1.
3. A carrier, characterized in that, The vector contains the isolated polynucleotide according to claim 2.
4. A host cell, characterized in that, The host cell contains the vector according to claim 3, or the isolated polynucleotide according to claim 2 is integrated into the nucleic acid of the host cell. The host cell is not a plant variety or an animal variety.
5. A method for preparing the malate transporter mutant protein as claimed in claim 1, characterized in that, Comprising the steps of: culturing the host cell according to claim 4 under conditions suitable for expression, so as to express the malate transporter mutant protein according to claim 1; and isolating the expression product, so as to obtain the malate transporter mutant protein according to claim 1.
6. A method for increasing the yield of malic acid, characterized in that Comprising the steps of: i) introducing the polynucleotide according to claim 2 or a combination thereof into a suitable host cell; ii) culturing the host cell in the presence of a carbon source, so as to increase the malate yield.
Citation Information
Patent Citations
Malic acid production in recombinant yeast
CN101365782A
Methods for improving malic acid production in filamentous fungi
US20110053233A1