Methods of treating cancer with combination therapy
By combining compounds with multiple secondary activators, the problems of drug resistance and side effects in existing cancer therapies have been solved, improving the treatment efficacy for cancers such as multiple myeloma, prolonging survival and reducing drug resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CELGENE CORP
- Filing Date
- 2021-06-24
- Publication Date
- 2026-06-23
AI Technical Summary
Existing cancer treatments such as surgery, chemotherapy, radiation therapy, and hormone therapy have significant side effects and drug resistance problems, especially for hematologic malignancies such as multiple myeloma, where existing treatments are difficult to effectively eradicate tumor cells and are prone to multidrug resistance.
Combination therapy with compounds and multiple secondary activators such as PLK1 inhibitors, BRD4 inhibitors, and NEK2 inhibitors, administered via appropriate routes, can enhance the therapeutic effect against cancer, including simultaneous, pre-, or post-administration of these drugs.
It significantly improves the treatment effect on cancers such as multiple myeloma, prolongs progression-free survival and overall survival, reduces drug resistance, and reduces side effects.
Smart Images

Figure CN115916191B_ABST
Abstract
Description
[0001] 1. Cross-references to related applications
[0002] This application claims priority to U.S. Provisional Application No. 63 / 044,127, filed June 25, 2020, the entire contents of which are incorporated herein by reference.
[0003] 2. Sequence List
[0004] This specification is submitted together with a computer-readable copy of the sequence list (CRF). The CRF, titled 14247-544-228_Seqlisting_ST25.txt, was created on June 21, 2021, and is 11,150 bytes in size, and is incorporated herein by reference in its entirety. 3. Technical Field
[0006] This article provides a method for treating cancer using a combination of compounds provided herein (e.g., compound 1, compound 2, compound 3, compound 4, compound 5, compound 6, or compound 7, or stereoisomers or mixtures thereof, pharmaceutically acceptable salts, tautomers, prodrugs, solvates, hydrates, cocrystals, cages, or polymorphs) with a second active agent. 4. Background Technology
[0008] The main characteristics of cancer are an increase in the number of abnormal cells from a given normal tissue, the invasion of these abnormal cells into adjacent tissues, or the spread of malignant cells to local lymph nodes via the lymphatic or bloodstream, and metastasis. Clinical data and molecular biological studies indicate that cancer is a multi-step process that begins with small pretumoral changes that can progress to tumor formation under certain conditions. Tumor lesions can undergo clonal evolution and develop increasingly strong invasive, growth, metastatic, and heterogeneous capabilities, especially when tumor cells evade the host's immune surveillance. Current cancer therapies may include surgery, chemotherapy, hormone therapy, and / or radiation therapy to eradicate tumor cells from the patient's body. Rajkumar et al. discussed recent advances in cancer treatment in Nature Reviews Clinical Oncology 11, 628-630 (2014).
[0009] Currently, all cancer treatments have significant drawbacks for patients. For example, surgery may be contraindicated or unacceptable to the patient due to their health condition. Furthermore, surgery may not completely remove tumor tissue. Radiation therapy is only effective when tumor tissue is more sensitive to radiation than normal tissue. Additionally, radiation therapy can often cause serious side effects. Hormone therapy is rarely used as a single agent. While hormone therapy can be effective, it is often used to prevent or delay cancer recurrence after other treatments have removed most of the cancer cells.
[0010] Despite the availability of various chemotherapy agents, chemotherapy has many drawbacks. Almost all chemotherapy agents are toxic, and chemotherapy causes serious and often dangerous side effects, including severe nausea, bone marrow suppression, and immunosuppression. Furthermore, even with combination therapy, many tumor cells develop or become resistant to chemotherapy agents. Cells that have proven resistant to a particular chemotherapy agent used in a treatment regimen often become resistant to other drugs, even if those drugs have different mechanisms of action than the drugs used in the specific treatment. This phenomenon is known as multidirectional resistance or multidrug resistance. Due to resistance, many cancers prove difficult to treat or become refractory to standard chemotherapy regimens.
[0011] Hematologic malignancies are cancers that originate in hematopoietic tissues (such as bone marrow) or immune system cells. Examples of hematologic malignancies include leukemia, lymphoma, and myeloma. More specific examples of hematologic malignancies include, but are not limited to, acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), multiple myeloma (MM), non-Hodgkin lymphoma (NHL), diffuse large B-cell lymphoma (DLBCL), Hodgkin lymphoma (HL), T-cell lymphoma (TCL), Burkitt lymphoma (BL), chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), marginal zone lymphoma (MZL), and myelodysplastic syndromes (MDS).
[0012] Multiple myeloma (MM) is a cancer of plasma cells in the bone marrow. Normally, plasma cells produce antibodies and play a crucial role in immune function. However, uncontrolled growth of these cells leads to bone pain and fractures, anemia, infections, and other complications. Multiple myeloma is the second most common blood malignancy, but its exact cause remains unclear. Multiple myeloma causes high levels of proteins (including, but not limited to, M protein and other immunoglobulins (antibodies), albumin, and β2-microglobulin) in the blood, urine, and organs. An exception is that in some patients (estimated at 1% to 5%), the myeloma cells do not secrete these proteins (a condition known as non-secretory myeloma). M protein (short for monoclonal protein), also called paraprotein, is a particularly abnormal protein produced by myeloma plasma cells and is found in the blood or urine of almost all patients with multiple myeloma, except those with non-secretory myeloma or those whose myeloma cells produce immunoglobulin light chains with heavy chains.
[0013] Bone symptoms (including bone pain) are among the most prominent clinical manifestations of multiple myeloma. Malignant plasma cells release osteoclast-stimulating factors (including IL-1, IL-6, and TNF), which cause calcium to leach from the bone, leading to lytic lesions; hypercalcemia is another symptom. Osteoclast-stimulating factors (also known as cytokines) prevent apoptosis or death of myeloma cells. Fifty percent of patients have radiologically detectable myeloma-related bone lesions at diagnosis. Other common clinical symptoms of multiple myeloma include polyneuropathy, anemia, hyperviscosity, infections, and renal insufficiency. 5. Summary of the Invention
[0015] This document provides a method for treating cancer using a combination of compounds provided herein (e.g., compound 1, compound 2, compound 3, compound 4, compound 5, compound 6, or compound 7, or stereoisomers or mixtures thereof, pharmaceutically acceptable salts, tautomers, prodrugs, solvates, hydrates, cocrystals, cages, or polymorphs) with a second active agent, wherein the second active agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), a MEK inhibitor (e.g., trametinib), a PHF19 inhibitor, or a BTK inhibitor (e.g., ibrutinib). The inhibitors include one or more of the following: brutinib, mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., linsitinib), XPO1 inhibitors (e.g., selinexor), DOT1L inhibitors (e.g., SGC0946 or pinometostat), EZH2 inhibitors (e.g., tazemetostat, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fedratinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0016] Pharmaceutical compositions are also provided for use in the methods provided herein, these pharmaceutical compositions being formulated for administration via suitable routes and means and containing an effective concentration of the compounds provided herein, such as compound 1, compound 2, compound 3, compound 4, compound 5, compound 6, or compound 7, or stereoisomers or mixtures thereof, pharmaceutically acceptable salts, tautomers, prodrugs, solvates, hydrates, cocrystals, cages, or polymorphs, and optionally comprising at least one pharmaceutical carrier. In one embodiment, the pharmaceutical composition delivers an effective amount of the compounds provided herein combined with a second active agent provided herein for the treatment of cancer.
[0017] In one embodiment, the cancer is a blood malignancy. In another embodiment, the cancer is multiple myeloma (MM).
[0018] The compounds or compositions provided herein, or their pharmaceutically acceptable derivatives, may be administered simultaneously with each other and one or more of the above-described therapies, before each other and one or more of the above-described therapies, or after each other and one or more of the above-described therapies.
[0019] These and other aspects of the subject matter described herein will become apparent when referred to the following detailed description. 6. Description of the attached drawings
[0021] Figures 1A to 1D The relationships between PLK1 and PFS in MMRF, OS in MMRF, PFS in MM010, and OS in MM010 are shown respectively.
[0022] Figure 1E The study showed that PLK1 expression was significantly upregulated in patients with relapse.
[0023] Figure 1F The expression patterns of PLK1 at various stages of MM disease progression and relapse were shown.
[0024] Figure 2A and Figure 2B The effects of pomalidomide treatment on PLK1 levels and its downstream effectors pCDC25C and CDC25C in EJM and EJM / PR cell lines were shown.
[0025] Figure 2C The effects of pomalidomide and compound 5 treatment on PLK1 levels and its downstream effectors pCDC25C and CDC25C in the MM1.S cell line were shown.
[0026] Figure 2D The effect of pomalidomide treatment on PLK1 transcript levels in MM1.S cells was shown; Figure 2E The study demonstrated the effect of pomalidomide treatment on the binding of Aiolos and Ikaros to the transcription start site (TSS) of PLK1.
[0027] Figure 2F The results showed that knocking down both Aiolos and Ikaros resulted in a decrease in PLK1 levels.
[0028] Figure 3 The changes in PLK1 signaling after treatment of cells with nocodazole and compound 5 and their combinations are shown.
[0029] Figure 4A The levels of PLK1, CDC25C, and pCDC25C, as well as cereblon, were shown in six pomalidomide-sensitive and drug-resistant cell lines.
[0030] Figure 4B The study showed an increased proportion of G2-M cells in five of the six pomalidomide-resistant cell lines.
[0031] Figure 5A The combination of compound 5 and BI2536 was demonstrated to treat the AMO1 cell line; Figure 5B The corresponding combined index values are displayed; Figure 5C The combination of compound 5 and BI2536 was shown to be effective in treating the AMO1-PR cell line; and Figure 5D The corresponding combined index values are displayed.
[0032] Figure 5E The combination of compound 5 and BI2536 was demonstrated to treat the K12PE cell line; Figure 5F The corresponding combined index values are displayed; Figure 5G The combination of compound 5 and BI2536 was shown to be effective in treating the K12PE / PR cell line; and Figure 5H The corresponding combined index values are displayed.
[0033] Figure 5I and Figure 5J The effects of the combination of compound 5 and BI2536 on early and late apoptosis in AMO1 and AMO1-PR cells were shown.
[0034] Figure 5K The study showed changes in Ikaros and pro-survival signaling in AMO1 and AMO1-PR cell lines in response to BI2536 and compound 5 after treatment.
[0035] Figure 6A The combination of compound 5 and BI2536 was demonstrated to treat Mc-CAR cells; Figure 6B The corresponding combined index values are displayed.
[0036] Figure 6C The changes in Aiolos and Ikaros levels in Mc-CAR cell lines responding to BI2536 and compound 5 after treatment were shown.
[0037] Figure 7A Patients carrying the biallelic P53 gene showed significantly elevated PLK1 expression.
[0038] Figure 7B The effects of BI2536 on the biallelic P53 cell lines K12PE and P53 wild-type AMO1 cells were shown.
[0039] Figure 8A and Figure 8BThe results showed that E2F2, CKS1B, TOP2A, and NUF2 were upregulated in terms of protein and transcript expression levels in MDMS8-like cell lines.
[0040] Figures 9A to 9D The relationships between CKS1B and OS, CKS1B and PFS, E2F2 and OS, and E2F2 and PFS are shown respectively.
[0041] Figure 9E The knockdown of CKS1B and E2F2 showed that it resulted in a significant reduction in proliferation and an increase in apoptosis.
[0042] Figure 10A and Figure 10B The effects of BRD4 inhibitors on CKS1B and E2F2 and their target genes in DF15PR and H929 cell lines were shown.
[0043] Figures 10C to 10F The effects of BRD4 inhibitors on the levels of CKS1B transcripts, E2F2 transcripts, CKS1B transcripts, and E2F2 transcripts in the DF15PR, H929, and H929 cell lines were shown.
[0044] Figure 11A and Figure 11B The study showed that four different shRNAs targeting BRD4 consistently exhibited reduced levels of CKS1B and E2F2 in the K12PE and DF15PR cell lines. Figure 11C and Figure 11D The results showed that all four shRNAs induced a significant reduction in cell proliferation in K12PE and MDMS8-like cells.
[0045] Figure 12 The effects of pomalidomide on CKS1B and E2F2 in Pom-sensitive and resistant cell lines were shown.
[0046] Figure 13A The combination of Len and JQ1 was demonstrated to treat the K12PE cell line; Figure 13B The corresponding combined index values are displayed; Figure 13C The combination of Pom and JQ1 was demonstrated to treat the K12PE cell line; Figure 13D The corresponding combined index values are displayed; Figure 13E The combination of compound 5 and JQ1 was demonstrated to treat the K12PE cell line; Figure 13F The corresponding combined index values are displayed; Figure 13G The combination of compound 6 and JQ1 was demonstrated to treat the K12PE cell line; Figure 13H The corresponding combined index values are displayed.
[0047] Figure 13I The combination of Len and JQ1 was demonstrated to treat the K12PE / PR cell line; Figure 13J The corresponding combined index values are displayed; Figure 13K The combination of Pom and JQ1 was demonstrated to treat the K12PE / PR cell line; Figure 13L The corresponding combined index values are displayed; Figure 13M The combination of compound 5 and JQ1 was demonstrated to treat the K12PE / PR cell line; Figure 13N The corresponding combined index values are displayed; Figure 13O The combination of compound 6 and JQ1 was demonstrated to treat the K12PE / PR cell line; Figure 13P The corresponding combined index values are displayed.
[0048] Figure 13Q The study demonstrated the effects of combination therapy with JQ1, Len, Pom, compound 5, and compound 6 on the levels of Aiolos, Ikaros, CKS1B, E2F2, Myc, and survival proteins.
[0049] Figure 14A and Figure 14B The relationship between NEK2 expression and progression-free survival and overall survival was shown.
[0050] Figure 14C The study showed that NEK2 expression was significantly upregulated in patients with relapse.
[0051] Figure 14D The study showed that NEK2 expression was significantly upregulated in pomalidomide-resistant cell lines.
[0052] Figures 15A to 15F The relationships between NEK2 and PFS in MMRF, OS in MMRF, PFS in DFCI, OS in DFCI, PFS in MM0010, and OS in MM0010 are shown respectively.
[0053] Figure 16A The combination of compound 5 and rac-CCT 250863 was demonstrated to treat the AMO1 cell line; Figure 16B The corresponding combined index values are displayed; Figure 16C The combination of compound 5 and rac-CCT 250863 was demonstrated to treat the AMO1 / PR cell line; Figure 16D The corresponding combined index values are displayed; Figure 16E The combination of compound 6 and rac-CCT 250863 was demonstrated to treat the AMO1 cell line; Figure 16F The corresponding combined index values are displayed; Figure 16GThe combination of compound 6 and rac-CCT 250863 was demonstrated to treat the AMO1 / PR cell line; Figure 16H The corresponding combined index values are displayed; Figure 16I The combination of compound 5 and JH295 was demonstrated to treat the AMO1 cell line; Figure 16J The corresponding combined index values are displayed; Figure 16K The combination of compound 5 and JH295 was demonstrated to treat the AMO1 / PR cell line; Figure 16L The corresponding combined index values are displayed; Figure 16M The combination of compound 6 and JH295 was demonstrated to treat the AMO1 cell line; Figure 16N The corresponding combined index values are displayed; Figure 16O The combination of compound 6 and JH295 was demonstrated to treat the AMO1 / PR cell line; Figure 16P The corresponding combined index values are displayed.
[0054] Figure 17 The study showed that when NEK2 knockdown was combined with compound 5 or compound 6, apoptotic cells increased.
[0055] Figure 18A and Figure 18B The effects of the combination of trametinib and Len on the AMO1 and AMO1-PR cell lines were shown, respectively. Figure 18C and Figure 18D The effects of the combination of trametinib and Pom on the AMO1 and AMO1-PR cell lines were shown, respectively. Figure 18E and Figure 18F The effects of trametinib combined with compound 5 on the AMO1 and AMO1-PR cell lines were shown, respectively. Figure 18G and Figure 18H The effects of the combination of trametinib and compound 6 on the AMO1 and AMO1-PR cell lines were shown, respectively.
[0056] Figure 19 The combination of trametinib and compound 6 was shown to synergistically reduce ERK, ETV4 and MYC signaling in the AMO1-PR cell line.
[0057] Figure 20A and Figure 20B The effects of trametinib combined with compound 6 on apoptosis in AMO1 and AMO1-PR cell lines on days 3 and 5 were shown, respectively.
[0058] Figure 21A and Figure 21B The effects of the combination of trametinib and compound 6 on the cell cycle in the AMO1-PR cell line on days 3 and 5 were shown.
[0059] Figure 22A and Figure 22B Patients with high BIRC5 expression showed poorer PFS and OS.
[0060] Figure 23A Several pomalidomide-resistant cell lines showed increased expression of BIRC5; Figure 23B The study showed that at 48 and 72 hours, in response to compound 5 treatment, BIRC5 levels decreased, followed by the initiation of apoptosis in the MM1.S cell line.
[0061] Figure 24A The combination of compound 5 and YM155 was demonstrated to treat the AMO1 cell line; Figure 24B The corresponding combined index values are displayed; Figure 24C The combination of compound 5 and YM155 was demonstrated to treat the AMO1 / PR cell line; Figure 24D The corresponding combined index values are displayed; Figure 24E The combination of compound 6 and YM155 was demonstrated to treat the AMO1 cell line; Figure 24F The corresponding combined index values are displayed; Figure 24G The combination of compound 6 and YM155 was demonstrated to treat the AMO1 / PR cell line; Figure 24H The corresponding combined index values are displayed.
[0062] Figure 25A The study showed that BIRC5 knockdown reduced the proliferation of AMO1-PR cells; Figure 25B The study showed that BIRC5 knockdown also downregulated the expression of the high-risk-associated gene FOXM1.
[0063] Figure 26A The study showed that the high-risk-associated genes BIRC5 and FOXM1 exhibited significant co-expression in the myeloma genome project, indicating their co-regulation. Figure 26B The study showed that YM155 inhibition of BIRC5 also downregulated FOXM1 expression in AMO1-PR and K12PE-PR cell lines in a dose-dependent manner. 7. Detailed Implementation
[0065] A. Definition
[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications are incorporated herein by reference in their entirety. Where a term has multiple definitions herein, the definition in this section shall prevail unless otherwise stated.
[0067] As used herein, in the specification, and in the appended claims, unless the context clearly indicates otherwise, the indefinite article “a / an” and the definite article “the” include both plural and singular references.
[0068] As used herein, the terms “comprising” and “including” are used interchangeably. The terms “comprising” and “including” should be interpreted as specifying the presence of the stated features or components mentioned, but do not exclude the presence or addition of one or more features or components or groups thereof. Additionally, the terms “comprising” and “including” are intended to include instances covered by the term “consisting of”. Therefore, the term “consisting of” may be used in place of the terms “comprising” and “including” to provide more specific embodiments of the invention.
[0069] The term "composed of" means that the subject matter has at least 90%, 95%, 97%, 98%, or 99% of the features or components of its declared composition. In another embodiment, the term "composed of" excludes any other features or components from any subsequently elaborated scope, except those that are not important to the technical effect to be achieved.
[0070] As used herein, the term "or" should be interpreted as inclusive "or," meaning any one or any combination thereof. Therefore, "A, B, or C" means any of the following: "A; B; C; A and B; A and C; B and C; A, B, and C." Exceptions to this definition only arise when a combination of elements, functions, steps, or behaviors is intrinsically mutually exclusive in some way.
[0071] As used herein and unless otherwise stated, when used in conjunction with the dosage, amount, or weight percentage of an ingredient in a composition or dosage form, the terms “about” and “approximately” mean a dosage, amount, or weight percentage that is generally accepted by those skilled in the art to provide a pharmacological effect equivalent to that obtained from the specified dosage, amount, or weight percentage. In some embodiments, when used in the context herein, the terms “about” and “approximately” refer to a dosage, amount, or weight percentage within the range of 30%, 20%, 15%, 10%, or 5% of the specified dosage, amount, or weight percentage.
[0072] As used herein and unless otherwise stated, the term "pharmaceutically acceptable salt" refers to a salt prepared from a pharmaceutically acceptable, relatively non-toxic acid (including inorganic and organic acids). In some embodiments, suitable acids include, but are not limited to, acetic acid, adipic acid, 4-aminosalicylic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, camphoric acid, camphorsulfonic acid, decanoic acid, hexanoic acid, caprylic acid, cinnamic acid, carbonic acid, citric acid, cyclohexylsulfamic acid, dihydrogen phosphate, 2,5-dihydroxybenzoic acid (gentianic acid), 1,2-ethanedisulfonic acid, ethanesulfonic acid, fumaric acid, galacturonic acid, gluconic acid, glucuronic acid, glutamic acid, glutamate, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, isobutylene. Acids, hydroxyethyl sulfonic acid, lactic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, monohydrocarbonic acid, monohydrophosphoric acid, monohydrosulfuric acid, mucoic acid, 1,5-naphthalenedisulfonic acid, nicotinic acid, nitric acid, oxalic acid, primic acid, pantothenic acid, phosphoric acid, phthalic acid, propionic acid, pyroglutamic acid, salicylic acid, succinic acid, sulfuric acid, tartaric acid, toluenesulfonic acid, etc. (see, for example, SMBerge et al., J. Pharm. Sci., 66:1-19 (1977); and Handbook of Pharmaceutical Salts: Properties, Selection and Use, edited by PHStahl and CGWermuth, (2002), Wiley, Weinheim). In some embodiments, suitable acids are strong acids (e.g., pKa less than about 1), including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, methanesulfonic acid, benzenesulfonic acid, toluenesulfonic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, pyridine-sulfonic acid, or other substituted sulfonic acids. Salts of other relatively non-toxic compounds with acidic characteristics are also included, including amino acids (such as aspartic acid) and other compounds (such as aspirin, ibuprofen, saccharin, etc.). Acid addition salts can be obtained by contacting the neutral form of the compound with a sufficient amount of the desired acid (pure acid or in a suitable solvent).
[0073] As used herein and unless otherwise stated, the term "prodrug" for an active compound refers to a compound that is converted in vivo to produce the active compound or a pharmaceutically acceptable form of the active compound. When administered to a subject, a prodrug may be inactive but is converted in vivo, for example, by hydrolysis (e.g., in the blood). Prodrugs include compounds in which a hydroxyl, amino, or thiol group is bound to any group that, when administered to a subject as a prodrug of an active compound, cleaves to form a free hydroxyl, free amino, or free thiol group, respectively.
[0074] As used herein and unless otherwise stated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the spatial arrangement of their atoms. "Rotation-restricted isomers" are stereoisomers resulting from the restricted rotation of a single bond. "Enantiomers" are a pair of stereoisomers that are non-overlapping mirror images of each other. A mixture of a pair of enantiomers in any proportion may be called a "racemic" mixture. "Diadiaomers" are stereoisomers having at least two asymmetric atoms, but not being mirror images of each other. Absolute stereochemistry can be specified according to the Cahn-Ingold-Prelog RS system. When the compound is an enantiomer, the stereochemistry at each chiral carbon can be specified by R or S. Resolved compounds with unknown absolute configurations are labeled (+) or (-) according to the direction of their rotation around plane-polarized light at the wavelength of the sodium D line (dextrorotatory or levorotatory). However, the optical rotation symbols (+) and (-) are independent of the absolute configurations R and S of the molecule. Some of the compounds described herein contain one or more asymmetric centers, thus yielding enantiomers, diastereomers, and other stereoisomeric forms that can be defined as (R)- or (S)- based on the absolute stereochemistry of each asymmetric atom. The chemical entities, pharmaceutical compositions, and methods of this invention are intended to include all such possible isomers, including racemic mixtures, substantially optically pure forms, and intermediate mixtures. Optically active (R)- and (S)- isomers can be prepared, for example, using chiral synthons or chiral reagents, or resolved using conventional techniques.
[0075] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In some embodiments, the compounds described herein are isolated as either E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.
[0076] "Tautomers" refer to the isomeric forms of a compound that are in equilibrium with each other. The concentration of the isomeric forms will depend on the environment in which the compound is found and can vary depending on, for example, whether the compound is a solid or in an organic solution or an aqueous solution. For example, in aqueous solution, pyrazole may exhibit the following isomeric forms, which are referred to as tautomers of each other:
[0077]
[0078] It should also be noted that the compounds described herein may contain atomic isotopes in non-natural proportions on one or more atoms. For example, these compounds can be radiolabeled with radioactive isotopes, such as tritium ( 3 H), Iodine-125 ( 125 I), sulfur-35( 35 S), or carbon-14 (S), or carbon-14 14C), or it could be isotopically enriched, such as deuterium (C). 2 H), carbon-13 ( 13 C) or nitrogen-15 ( 15 (N) enriched. As used herein, an "isotope" is an isotopically enriched compound. The term "isotopically enriched" means an atom having an isotopic composition different from that of the naturally occurring atom. "Isotopically enriched" can also mean a compound containing at least one atom having an isotopic composition different from that of the naturally occurring atom. The term "isotopic composition" refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds can be used as therapeutic agents (e.g., cancer therapeutic agents), research reagents (e.g., binding assay reagents), and diagnostic agents (e.g., in vivo imaging agents). All isotopic variants of the compounds described herein, whether or not radioactive, are intended to be covered within the scope of the embodiments provided herein. In some embodiments, isotopes of the compounds described herein are provided, for example, these isotopes are enriched with deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" means that at least one hydrogen (H) has been deuterated (by D or 2 H represents a substitute compound, meaning that the compound is rich in deuterium at at least one position.
[0079] It should be noted that if there is a difference between the described structure and its name, the described structure shall prevail.
[0080] As used herein and unless otherwise indicated, the term “treatment” means relief (in whole or in part) of a disorder, disease, or condition or one or more symptoms associated with the disorder, disease, or condition, or slowing or stopping the further progression or worsening of those symptoms, or relieving or eradicating one or more causes of the disorder, disease, or condition itself.
[0081] As used herein and unless otherwise indicated, the term “prevention” means delaying and / or preventing the onset, recurrence, or spread of a disorder, disease, or condition, in whole or in part; preventing a subject from developing a disorder, disease, or condition; or methods for reducing the risk of a subject developing a disorder, disease, or condition.
[0082] As used herein and unless otherwise indicated, the term “management” encompasses preventing the recurrence of a particular disease or disorder in a patient who has previously had such disease or disorder, prolonging the time a patient who has previously had such disease or disorder remains in remission, reducing patient mortality, and / or maintaining or preventing the occurrence of symptoms associated with the managed disease or condition.
[0083] As used herein and unless otherwise indicated, the term “effective amount” in relation to a compound means an amount sufficient to treat, prevent, or manage a disorder, disease, condition, or its symptoms.
[0084] As used herein and unless otherwise indicated, the terms “subject” or “patient” include animals, including but not limited to animals such as cows, monkeys, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, which in one embodiment are mammals and in another embodiment are humans.
[0085] As used herein and unless otherwise indicated, the term “relapse” refers to a disorder, disease, or condition that initially responds to treatment (e.g., achieves a complete response) but then progresses. Treatment may include first-line or multiple-line therapy. In one embodiment, the disorder, disease, or condition has been previously treated with first-line or multiple-line therapy. In another embodiment, the disorder, disease, or condition has been previously treated with first-line, second-line, third-line, or fourth-line therapy. In some embodiments, the disorder, disease, or condition is a hematologic malignancy.
[0086] As used herein and unless otherwise indicated, the term "refractory" refers to a barrier, disease, or condition that does not respond to prior treatment, which may include first-line or multiple lines of therapy. In one embodiment, the barrier, disease, or condition has been previously treated with first-, second-, third-, or fourth-line therapy. In one embodiment, the barrier, disease, or condition has been previously treated with second- or more lines of therapy and has not achieved a complete response (CR) with a most recent regimen containing systemic therapy. In some embodiments, the barrier, disease, or condition is a hematologic malignancy.
[0087] In the context of cancer (e.g., hematologic malignancies), inhibition can be assessed by: inhibiting disease progression, inhibiting tumor growth, reducing primary tumor size, alleviating tumor-related symptoms, inhibiting tumor-secreting factors, delaying the onset of primary or secondary tumors, slowing the development of primary or secondary tumors, reducing the occurrence of primary or secondary tumors, mitigating or reducing the severity of secondary disease effects, preventing tumor growth and regression, increasing time to progression (TTP), increasing progression-free survival (PFS), and increasing overall survival (OS). OS, as used herein, refers to the time from the start of treatment to death from any cause. TTP, as used herein, refers to the time from the start of treatment to tumor progression; TTP does not include death. In one embodiment, PFS refers to the time from the start of treatment to tumor progression or death. In another embodiment, PFS refers to the time from the first dose of the compound to the first occurrence of disease progression or death from any cause. In one embodiment, the Kaplan-Meier estimate is used to calculate the PFS rate. Event-free survival (EFS) refers to the time from the start of treatment to any treatment failure (including disease progression, discontinuation of treatment for any reason, or death). In one embodiment, overall response rate (ORR) refers to the percentage of patients who achieve a response. In one embodiment, ORR refers to the sum of the percentages of patients who achieve a complete response and a partial response. In one embodiment, ORR refers to the percentage of patients who achieve an optimal response ≥ a partial response (PR). In one embodiment, duration of response (DoR) is the time from achieving a response to relapse or disease progression. In one embodiment, DoR is the time from achieving a response ≥ a partial response (PR) to relapse or disease progression. In one embodiment, DoR is the time from the first recorded response to the first recorded disease progression or death. In one embodiment, DoR is the time from the first recorded response ≥ a partial response (PR) to the first recorded disease progression or death. In one embodiment, time to response (TTR) refers to the time from the first dose of the compound to the first recorded response. In one embodiment, TTR refers to the time from the first dose of the compound to the first recorded response ≥ a partial response (PR). In extreme cases, complete inhibition is referred to herein as prophylaxis or chemoprevention. In the context of this article, the term "prevention" includes the complete prevention of the onset of clinically apparent cancer, or the prevention of the onset of cancer in its preclinical, apparent stages. This definition also aims to cover the prevention of transformation into malignant cells or the halting or reversal of the progression of preclinical cells to malignant cells. This includes preventative treatment for those at risk of developing cancer.
[0088] As used herein, “multiple myeloma” refers to a hematologic disorder characterized by malignant plasma cells and includes the following disorders: monoclonal globulinemia of undetermined significance (MGUS); low-risk, intermediate-risk, and high-risk multiple myeloma; newly diagnosed multiple myeloma (including low-risk, intermediate-risk, and high-risk newly diagnosed multiple myeloma); transplant-eligible and non-transplant-eligible multiple myeloma; stagnant (indolent) multiple myeloma (including low-risk, intermediate-risk, and high-risk stagnant multiple myeloma); active multiple myeloma; solitary plasmacytoma; extramedullary plasmacytoma; plasma cell leukemia; central nervous system multiple myeloma; light chain myeloma; non-secreting myeloma; immunoglobulin D myeloma; and immunoglobulin E myeloma. Multiple myeloma; and multiple myeloma characterized by genetic abnormalities such as cyclin D translocations (e.g., t(11;14)(q13;q32); t(6;14)(p21;32); t(12;14)(p13;q32); or t(6;20);), MMSET translocations (e.g., t(4;14)(p16;q32)), MAF translocations (e.g., t(14;16)(q32;q32); t(20;22); t(16;22)(q11;q13); or t(14;20)(q32;q11)), or other chromosomal factors (e.g., deletion of 17p13 or chromosome 13; del(17 / 17p), non-hyperdiploidy, and increase (1q)). In one embodiment, multiple myeloma is characterized according to the International Staging System for Multiple Myeloma (ISS). In one embodiment, multiple myeloma is stage I multiple myeloma characterized by ISS (e.g., serum β2-microglobulin <3.5 mg / L and serum albumin ≥3.5 g / dL). In one embodiment, multiple myeloma is stage III multiple myeloma characterized by ISS (e.g., serum β2-microglobulin >5.4 mg / L). In one embodiment, multiple myeloma is stage II multiple myeloma characterized by ISS (e.g., not stage I or III).
[0089] In some embodiments, treatment for multiple myeloma can be assessed using the International Uniform Response Criteria for Multiple Myeloma (IURC) (see Durie BGM, Harousseau JL, Miguel JS, et al., International uniform response criteria for multiple myeloma. Leukemia, 2006; (10) 10: 1-7), with the response and endpoint definitions shown below:
[0090]
[0091]
[0092] Abbreviations: CR, complete response; FLC, free light chain; PR, partial response; SD, stable disease; sCR, strict complete response; VGPR, very good partial response.
[0093] a All response categories require two consecutive evaluations at any time before any new therapy is established; if a radiographic study is conducted, evidence of known progressive or new bone lesions is also not required for any category. These response requirements are not required for radiographic studies.
[0094] b Repeated bone marrow biopsies are not required to confirm this.
[0095] c The presence / absence of clonal cells is based on the κ / λ ratio. Abnormal κ / λ ratios obtained by immunohistochemistry and / or immunofluorescence require a minimum of 100 plasma cells for analysis. Abnormal ratios reflecting the presence of abnormal clones are κ / λ > 4:1 or < 1:2.
[0096] d Measurable disease defined by at least one of the following measurements: bone marrow plasma cells ≥30%; serum M protein ≥1 g / dl (≥10 gm / l) [10 g / l]; urinary M protein ≥200 mg / 24 h; serum FLC assay: affected FLC level ≥10 mg / dl (≥100 mg / l); condition is abnormal serum FLC ratio.
[0097] As used in this article, ECOG status refers to the performance status of the Eastern Cooperative Oncology Group (ECOG) (Oken M, et al., Toxicity and response criteria of the Eastern Cooperative Oncology Group, Am J Clin Oncol, 1982; 5(6):649-655), as shown below:
[0098]
[0099] In some embodiments, disease stability or its absence can be determined by methods known in the art, such as assessing patient symptoms, physical examination, visualization of imaged tumors, for example using FDG-PET (fluorodeoxyglucose positron emission tomography), PET / CT (positron emission tomography / computed tomography) scans, MRI (magnetic resonance imaging) of the brain and spine, CSF (cerebrospinal fluid), ophthalmological examination, vitreous fluid sampling, retinal photographs, bone marrow assessment, and other generally accepted assessment methods.
[0100] As used herein and unless otherwise indicated, the terms "co-administered" and "in combination with" include the simultaneous, parallel, or sequential administration of one or more therapeutic agents (e.g., the compounds provided herein and another anticancer agent or supportive care agent) without specific time limitations. In one embodiment, these agents are simultaneously present in cells or in the patient's body, or exert their biological or therapeutic effects simultaneously. In one embodiment, these therapeutic agents are in the same composition or unit dosage form. In another embodiment, these therapeutic agents are in separate compositions or unit dosage forms.
[0101] The term "supportive care agent" refers to any substance that treats, prevents, or manages the adverse effects of treatment with another therapeutic agent.
[0102] As used in this article, "induction therapy" refers to the first-line treatment given for a disease, or the first-line treatment given with the aim of inducing complete remission of a disease (such as cancer). When used alone, induction therapy is a recognized best-of-breed treatment available. If residual cancer is detected, the patient is treated with another therapy (called re-induction). If the patient achieves complete remission after induction therapy, additional consolidation and / or maintenance therapy is given to prolong the remission or potentially cure the patient.
[0103] As used in this article, "consolidation therapy" refers to treatment given after the initial achievement of remission for a disease. For example, consolidation therapy for cancer is treatment given after the cancer has disappeared following initial therapy. Consolidation therapy may include radiation therapy, stem cell transplantation, or treatment with cancer drugs. Consolidation therapy is also known as intensive therapy or post-remission therapy.
[0104] As used in this article, "maintenance therapy" refers to treatment given to prevent or delay relapse of a disease after remission or optimal response has been achieved. Maintenance therapy may include chemotherapy, hormone therapy, or targeted therapy.
[0105] As used in this article, “remission” is the reduction or disappearance of signs and symptoms of cancer (such as multiple myeloma). In partial remission, some, but not all, signs and symptoms of cancer disappear. In complete remission, although cancer may still be in the body, all signs and symptoms of cancer have disappeared.
[0106] As used herein, “transplantation” refers to high-dose therapy accompanying stem cell salvage. Hematopoietic (blood) or bone marrow stem cells are not used for treatment but rather to salvage the patient following high-dose therapy, such as high-dose chemotherapy and / or radiation therapy. Transplantation includes “autologous” stem cell transplantation (ASCT), which refers to harvesting stem cells from the patient’s own body and using them as replacement cells. In some embodiments, transplantation also includes tandem transplantation or multiple transplantations.
[0107] The term "biological therapy" refers to the application of biological therapeutic agents, such as umbilical cord blood, stem cells, and growth factors.
[0108] B. Compounds
[0109] The following compound, 4-amino-2-(2,6-dioxopiperidin-3-yl)isoindoline-1,3-dione (compound 1), is provided for use in the methods provided herein:
[0110]
[0111] It may be a stereoisomer or mixture of stereoisomers, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. As used herein, compound 1 is also referred to as pomalidomide or Pom. In one embodiment, compound 1 is used in the method provided herein.
[0112] Also provided is compound 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione (compound 2) for use in the methods provided herein:
[0113]
[0114] It may be a stereoisomer or mixture of stereoisomers, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. As used herein, compound 2 is also referred to as lenalidomide or Len. In one embodiment, compound 2 is used in the method provided herein.
[0115] Also provided is compound 2-(2,6-dioxo-3-piperidinyl)-1H-isoindole-1,3(2H)-dione (compound 3) for use in the methods provided herein:
[0116]
[0117] It may be a stereoisomer or mixture of stereoisomers, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. As used herein, compound 3 is also referred to as thalidomide or Thal. In one embodiment, compound 3 is used in the method provided herein.
[0118] Also provided is compound 3-(5-amino-2-methyl-4-oxo-4H-quinazolin-3-yl)-piperidine-2,6-dione (compound 4) for use in the methods provided herein:
[0119]
[0120] It may be a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. A method for preparing compound 4 is described in U.S. Patent No. 7,635,700, which is incorporated herein by reference in its entirety. In one embodiment, compound 4 is used in the method provided herein. In one embodiment, a hydrochloride salt of compound 4 is used in the method provided herein.
[0121] Also provided is the compound (S)-3-(4-((4-(morpholinomethyl)benzyl)oxy)-1-oxoisoindololin-2-yl)piperidine-2,6-dione (compound 5) for use in the methods provided herein:
[0122]
[0123] It may be a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. A method for preparing compound 5 is described in U.S. Patent No. 8,518,972, which is incorporated herein by reference in its entirety. In one embodiment, compound 5 is used in the method provided herein. In one embodiment, a hydrochloride salt of compound 5 is used in the method provided herein.
[0124] Also provided is the compound (S)-4-(4-(4-(((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-4-yl)oxy)methyl)benzyl)piperazin-1-yl)-3-fluorobenzonitrile (compound 6) for use in the methods provided herein:
[0125]
[0126] It may be a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. A method for preparing compound 6 is described in U.S. Patent No. 10,357,489, which is incorporated herein by reference in its entirety. In one embodiment, compound 6 is used in the method provided herein. In one embodiment, the hydrobromide of compound 6 is used in the method provided herein.
[0127] Also provided is 2-(4-chlorophenyl)-N-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindoline-5-yl)methyl)-2,2-difluoroacetamide (compound 7) for use in the methods provided herein:
[0128]
[0129] It may be a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof. A method for preparing compound 7 is described in U.S. Patent No. 9,499,514, which is incorporated herein by reference in its entirety. In one embodiment, compound 7 is used in the method provided herein.
[0130] In one embodiment, the method provided herein uses isotopically enriched analogs of these compounds.
[0131] C. Second activator
[0132] In one embodiment, the second active agent used in the method provided herein is a polo-like kinase 1 (PLK1) inhibitor. In one embodiment, the PLK1 inhibitor is BI2536, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the PLK1 inhibitor is BI2536. BI2536 has the chemical name (R)-4-((8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl)amino)-3-methoxy-N-(1-methylpiperidin-4-yl)benzamide, and has the following structure:
[0133]
[0134] In one embodiment, the PLK1 inhibitor is vorasetib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the PLK1 inhibitor is vorasetib. Vorazetib (also known as BI6727) has the following structure:
[0135]
[0136] In one embodiment, the PLK1 inhibitor is CYC140, or a stereoisomer, a mixture of stereoisomers, a tautomer, an isotope, or a pharmaceutically acceptable salt thereof.
[0137] In one embodiment, the PLK1 inhibitor is onvansertib, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the PLK1 inhibitor is onvansertib. Onvansertib (also known as NMS-1286937) has the following structure:
[0138]
[0139] In one embodiment, the PLK1 inhibitor is GSK461364, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the PLK1 inhibitor is GSK461364. GSK461364 has the following structure:
[0140]
[0141] In one embodiment, the PLK1 inhibitor is TAK960, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the PLK1 inhibitor is TAK960. In one embodiment, the PLK1 inhibitor is the hydrochloride salt of TAK960. TAK960 has the following structure:
[0142]
[0143] In one embodiment, the second active agent used in the method provided herein is a bromodomain 4 (BRD4) inhibitor. BRD4 is a member of the BET (bromodomain and superterminal domain) family. In one embodiment, the BRD4 inhibitor is JQ1, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BRD4 inhibitor is JQ1. JQ1 has the chemical name (S)-tert-butyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazaphen-6-yl)acetate and has the following structure:
[0144]
[0145] In one embodiment, the second active agent used in the method provided herein is a BET inhibitor. In one embodiment, the BET inhibitor is birabresib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BET inhibitor is birabresib. Birabresib (also known as OTX015 or MK-8628) has the chemical name (S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazaphen-6-yl)-N-(4-hydroxyphenyl)acetamide and has the following structure:
[0146]
[0147] In one embodiment, the BET inhibitor is compound A, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the BET inhibitor is compound A. Compound A has the chemical name 4-[2-(cyclopropylmethoxy)-5-(methanesulfonyl)phenyl]-2-methylisoquinoline-1(2H)-one and has the following structure:
[0148]
[0149] In one embodiment, the BET inhibitor is BMS-986158, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BET inhibitor is BMS-986158. BMS-986158 has the following structure:
[0150]
[0151] In one embodiment, the BET inhibitor is RO-6870810, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BET inhibitor is RO-6870810. RO-6870810 has the following structure:
[0152]
[0153] In one embodiment, the BET inhibitor is CPI-0610, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BET inhibitor is CPI-0610. CPI-0610 has the following structure:
[0154]
[0155] In one embodiment, the BET inhibitor is molibrexib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BET inhibitor is molibrexib. Molibrexib (also known as GSK-525762) has the following structure:
[0156]
[0157] In one embodiment, the second active agent used in the method provided herein is a serine / threonine-protein kinase (NEK2) inhibitor. In one embodiment, the NEK2 inhibitor is JH295, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the NEK2 inhibitor is JH295. JH295 has the chemical name (Z)-N-(3-((2-ethyl-4-methyl-1H-imidazol-5-yl)methylene)-2-oxoindololin-5-yl)propyneamide and has the following structure:
[0158]
[0159] In one embodiment, the NEK2 inhibitor is rac-CCT 250863, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the NEK2 inhibitor is rac-CCT 250863. Rac-CCT 250863 has the chemical name 4-[2-amino-5-[4-[(dimethylamino)methyl]-2-thienyl]-3-pyridyl]-2-[[(2Z)-4,4,4-trifluoro-1-methyl-2-buten-1-yl]oxy]benzamide, and has the following structure:
[0160]
[0161] In one embodiment, the second active agent used in the method provided herein is an aurorakinase B (AURKB) inhibitor. In one embodiment, the AURKB inhibitor is barasertib (also known as AZD1152) or AZD1152-HQPA, or a tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the AURKB inhibitor is barasertib. In one embodiment, the AURKB inhibitor is AZD1152-HQPA. AZD1152-HQPA (also known as AZD2811) has the chemical name 2-(3-((7-(3-(ethyl(2-hydroxyethyl)amino)propoxy)quinazolin-4-yl)amino)-1H-pyrazol-5-yl)-N-(3-fluorophenyl)acetamide and has the following structure:
[0162]
[0163] Balasetide is a dihydrogen phosphate prodrug of AZD1152-HQPA and has the following structure:
[0164]
[0165] In one embodiment, the AURKB inhibitor is alisertib, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is alisertib. Alisertib has the chemical name 4-((9-chloro-7-(2-fluoro-6-methoxyphenyl)-5H-benzo[c]pyrimidino[4,5-e]azapyro-2-yl)amino)-2-methoxybenzoic acid and has the following structure:
[0166]
[0167] In one embodiment, the AURKB inhibitor is danusertib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the AURKB inhibitor is danusertib. Danusertib (also known as PHA-739358) has the following structure:
[0168]
[0169] In one embodiment, the AURKB inhibitor is AT9283, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is AT9283. AT9283 has the following structure:
[0170]
[0171] In one embodiment, the AURKB inhibitor is PF-03814735, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the AURKB inhibitor is PF-03814735. PF-03814735 has the following structure:
[0172]
[0173] In one embodiment, the AURKB inhibitor is AMG900, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is AMG900. AMG900 has the following structure:
[0174]
[0175] In one embodiment, the AURKB inhibitor is tozasertib, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is tozasertib. Tozasertib (also known as VX-680 or MK-0457) has the following structure:
[0176]
[0177] In one embodiment, the AURKB inhibitor is ZM447439, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is ZM447439. ZM447439 has the following structure:
[0178]
[0179] In one embodiment, the AURKB inhibitor is MLN8054, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is MLN8054. MLN8054 has the following structure:
[0180]
[0181] In one embodiment, the AURKB inhibitor is hesperadin, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is hesperadin. In one embodiment, the AURKB inhibitor is the hydrochloride salt of hesperadin. Hesperadin has the following structure:
[0182]
[0183] In one embodiment, the AURKB inhibitor is SNS-314, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is SNS-314. In one embodiment, the AURKB inhibitor is a mesylate of SNS-314. SNS-314 has the following structure:
[0184]
[0185] In one embodiment, the AURKB inhibitor is PHA-680632, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is PHA-680632. PHA-680632 has the following structure:
[0186]
[0187] In one embodiment, the AURKB inhibitor is CYC116, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is CYC116. CYC116 has the following structure:
[0188]
[0189] In one embodiment, the AURKB inhibitor is GSK1070916, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is GSK1070916. GSK1070916 has the following structure:
[0190]
[0191] In one embodiment, the AURKB inhibitor is TAK-901, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is TAK-901. TAK-901 has the following structure:
[0192]
[0193] In one embodiment, the AURKB inhibitor is CCT137690, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the AURKB inhibitor is CCT137690. CCT137690 has the following structure:
[0194]
[0195] In one embodiment, the second active agent used in the method provided herein is a mitogen-activated extracellular signal-regulated kinase (MEK) inhibitor. In one embodiment, the MEK inhibitor disrupts the function of the RAF / RAS / MEK signaling cascade. In one embodiment, the MEK inhibitor is trametinib, trametinib dimethyl sulfoxide, cobimetinib, binimetinib, or selumetinib, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the MEK inhibitor is trametinib or trametinib dimethyl sulfoxide, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the MEK inhibitor is trametinib. In one embodiment, the MEK inhibitor is trametinib dimethyl sulfoxide. In one embodiment, the MEK inhibitor is cobimetinib. In one embodiment, the MEK inhibitor is binimetinib. In one embodiment, the MEK inhibitor is selumetinib. Trametinib dimethyl sulfoxide has the chemical name N-[3-[3-cyclopropyl-5-[(2-fluoro-4-iodophenyl)amino]-3,4,6,7-tetrahydro-6,8-dimethyl-2,4,7-trioxopyridino[4,3-d]pyrimidin-1(2H)-yl]phenyl]acetamide, which is a compound with dimethyl sulfoxide (1:1). Trametinib dimethyl sulfoxide has the following structure:
[0196]
[0197] In one embodiment, the second active agent used in the method provided herein is a PHD finger protein 19 (PHF19) inhibitor.
[0198] In one embodiment, the second active agent used in the method provided herein is a Bruton's tyrosine kinase (BTK) inhibitor. In one embodiment, the BTK inhibitor is ibrutinib, or acalabrutinib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BTK inhibitor is ibrutinib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the BTK inhibitor is ibrutinib. In one embodiment, the BTK inhibitor is acalabrutinib. Ibrutinib has the chemical name 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1Hpyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one and has the following structure:
[0199]
[0200] In one embodiment, the second active agent used in the method provided herein is a mammalian target of rapamycin (mTOR) inhibitor. In one embodiment, the mTOR inhibitor is rapamycin or an analogue thereof (also known as a rapalog). In one embodiment, the mTOR inhibitor is everolimus, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the mTOR inhibitor is everolimus. Everolimus has the chemical name 40-O-(2-hydroxyethyl)-rapamycin and has the following structure:
[0201]
[0202] In one embodiment, the second active agent used in the method provided herein is a proviral integration site (PIM) inhibitor of Moloney mouse leukemia kinase. In one embodiment, the PIM inhibitor is a pan-PIM inhibitor. In one embodiment, the PIM inhibitor is LGH-447, AZD1208, SGI-1776, or TP-3654, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the PIM inhibitor is LGH-447, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the PIM inhibitor is LGH-447. In one embodiment, the PIM inhibitor is a pharmaceutically acceptable salt of LGH-447. In one embodiment, the PIM inhibitor is the hydrochloride salt of LGH-447. In one embodiment, the hydrochloride salt of LGH-447 is a dihydrochloride. In one embodiment, the hydrochloride salt of LGH-447 is a monohydrochloride. In one embodiment, the PIM inhibitor is AZD1208. In one embodiment, the PIM inhibitor is SGI-1776. In another embodiment, the PIM inhibitor is TP-3654. LGH-447 has the chemical name N-[4-[(1R,3S,5S)-3-amino-5-methylcyclohexyl]-3-pyridyl]-6-(2,6-difluorophenyl)-5-fluoro-2-pyridinecarboxamide and has the following structure:
[0203]
[0204] In one embodiment, the second active agent used in the method provided herein is an insulin-like growth factor 1 receptor (IGF-1R) inhibitor. In one embodiment, the IGF-1R inhibitor is lincitinib, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the IGF-1R inhibitor is lincitinib. Lincitinib has the chemical name cis-3-[8-amino-1-(2-phenyl-7-quinolinyl)imidazo[1,5-a]pyrazin-3-yl]-1-methylcyclobutanol and has the following structure:
[0205]
[0206] In one embodiment, the second active agent used in the method provided herein is an export protein 1 (XPO1) inhibitor. In one embodiment, the XPO1 inhibitor is celiniso, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the XPO1 inhibitor is celiniso. Celiniso has the chemical name (2Z)-3-{3-[3,5-bis(trifluoromethyl)phenyl]-1H-1,2,4-triazol-1-yl}-N'-(pyrazin-2-yl)prop-2-enoylhydrazine and has the following structure:
[0207]
[0208] In one embodiment, the second active agent used in the method provided herein is a telomere-like interferon 1 (DOT1L) inhibitor. In one embodiment, the DOT1L inhibitor is SGC0946, or pinoxastat, or a stereoisomer, a mixture of stereoisomers, a tautomer, an isotope, or a pharmaceutically acceptable salt thereof. In one embodiment, the DOT1L inhibitor is SGC0946, or a stereoisomer, a mixture of stereoisomers, a tautomer, an isotope, or a pharmaceutically acceptable salt thereof. In one embodiment, the DOT1L inhibitor is SGC0946. SGC0946 has the chemical name 5bromo-7-[5-deoxy-5-[[3-[[[[[4-(1,1-dimethylethyl)phenyl]amino]carbonyl]amino]propyl](1-methylethyl)amino]-β-D-ribofurano]-7H-pyrrolo[2,3-d]pyrimidin-4-amine, and has the following structure:
[0209]
[0210] In one embodiment, the DOT1L inhibitor is pinoxastat, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the DOT1L inhibitor is pinoxastat. Pinoxastat (also known as EPZ-5676) has the chemical name (2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl)amino)methyl)tetrahydrofuran-3,4-diol, and has the following structure:
[0211]
[0212] In one embodiment, the second active agent used in the method provided herein is a zeste homolog enhancer 2 (EZH2) inhibitor. In one embodiment, the EZH2 inhibitor is tazestat, deazaneplanocin A (DZNep), EPZ005687, EI1, GSK126, UNC1999, CPI-1205, or sinefungin, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the EZH2 inhibitor is tazestat, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or a pharmaceutically acceptable salt thereof. In one embodiment, the EZH2 inhibitor is tazestat. In one embodiment, the EZH2 inhibitor is 3-deazaneplanocin A. In one embodiment, the EZH2 inhibitor is EPZ005687. In one embodiment, the EZH2 inhibitor is EI1. In one embodiment, the EZH2 inhibitor is GSK126. In another embodiment, the EZH2 inhibitor is sinefenoxan. Tazestat (also known as EPZ-6438) has the chemical name N-[(1,2-dihydro-4,6-dimethyl-2-oxo-3-pyridyl)methyl]-5-[ethyl(tetrahydro-2H-pyran-4-yl)amino]-4-methyl-4'-(4-morpholinylmethyl)-[1,1'-biphenyl]-3-carboxamide, and has the following structure:
[0213]
[0214] In one embodiment, the EZH2 inhibitor is UNC1999, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the EZH2 inhibitor is UNC1999. UNC1999 has the chemical name 1-isopropyl-6-(6-(4-isopropylpiperazin-1-yl)pyridin-3-yl)-N-((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)methyl)-1H-indazole-4-carboxamide, and has the following structure:
[0215]
[0216] In one embodiment, the EZH2 inhibitor is CPI-1205, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the EZH2 inhibitor is CPI-1205. CPI-1205 has the chemical name (R)-N-((4-methoxy-6-methyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-2-methyl-1-(1-(1-(2,2,2-trifluoroethyl)piperidin-4-yl)ethyl)-1H-indole-3-carboxamide, and has the following structure:
[0217]
[0218] In one embodiment, the second active agent used in the method provided herein is a Janus kinase 2 (JAK2) inhibitor. In one embodiment, the JAK2 inhibitor is phenotypeinib, ruxolitinib, baricitinib, gandotinib, lestaurtinib, molotinib, or parritinib, or a stereoisomer, mixture of stereoisomers, tautomers, isotopes, or pharmaceutically acceptable salt thereof. In one embodiment, the JAK2 inhibitor is phenotypeinib, or a tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the JAK2 inhibitor is phenotypeinib. In one embodiment, the JAK2 inhibitor is ruxolitinib. In one embodiment, the JAK2 inhibitor is baricitinib. In one embodiment, the JAK2 inhibitor is gandotinib. In one embodiment, the JAK2 inhibitor is lestaurtinib. In one embodiment, the JAK2 inhibitor is molotinib. In one embodiment, the JAK2 inhibitor is parritinib. Fizzotinib has the chemical name N-tert-butyl-3-[(5-methyl-2-{4-[2-(pyrrolidone-1-yl)ethoxy]anilinoyl}pyrimidin-4-yl)amino]benzenesulfonamide, and has the following structure:
[0219]
[0220] In one embodiment, the second active agent used in the method provided herein is a survival protein (also known as a baculoviral inhibitor of apoptosis repeat-containing 5 or BIRC5) inhibitor. In one embodiment, the BIRC5 inhibitor is YM155, or its tautomer, isotope, or pharmaceutically acceptable salt. In one embodiment, the BIRC5 inhibitor is YM155. YM155 has the chemical name 1-(2-methoxyethyl)-2-methyl-4,9-dioxo-3-(pyrazin-2-ylmethyl)-4,9-dihydro-1H-naphtho[2,3-d]imidazol-3-onium bromide and has the following structure:
[0221]
[0222] In one embodiment, the second active agent used in the method provided herein is a DNA methyltransferase inhibitor. In one embodiment, the DNA methyltransferase inhibitor is azacitidine, or a stereoisomer, mixture of stereoisomers, tautomer, isotope, or pharmaceutically acceptable salt thereof. In one embodiment, the hypomethylating agent is azacitidine. Azacitidine (also known as azacitidine or 5-azacitidine) has the chemical name 4-amino-1-β-D-rifuranosyl-1,3,5-triazine-2(1H)-one and has the following structure:
[0223]
[0224] D. Usage Method
[0225] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 1, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0226] In one embodiment, this document provides a method of treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 2, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0227] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 3, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0228] In one embodiment, this document provides a method of treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 4, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0229] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0230] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0231] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient in need a therapeutically effective amount of compound 7, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a second agent, wherein the second agent is a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), or a MEK inhibitor (e.g., trametinib). The inhibitors may be one or more of the following: PHF19 inhibitors, BTK inhibitors (e.g., ibrutinib), mTOR inhibitors (e.g., everolimus), PIM inhibitors (e.g., LGH-447), IGF-1R inhibitors (e.g., lincitinib), XPO1 inhibitors (e.g., celiniso), DOT1L inhibitors (e.g., SGC0946 or pinoxetine), EZH2 inhibitors (e.g., tazocine, UNC1999, or CPI-1205), JAK2 inhibitors (e.g., fenzotinib), BIRC5 inhibitors (e.g., YM155), or DNA methyltransferase inhibitors (e.g., azacitidine).
[0232] In one embodiment, cancer is a blood malignancy.
[0233] In one embodiment, the cancer is leukemia. In one embodiment, the cancer is acute myeloid leukemia. In one embodiment, the acute myeloid leukemia is B-cell acute myeloid leukemia. In one embodiment, the cancer is acute lymphoblastic leukemia. In one embodiment, the cancer is chronic lymphocytic leukemia / small lymphocytic lymphoma.
[0234] In one embodiment, the cancer is a B-cell malignancy.
[0235] In one embodiment, the cancer is lymphoma. In one embodiment, the cancer is non-Hodgkin's lymphoma. In one embodiment, the cancer is diffuse large B-cell lymphoma (DLBCL). In one embodiment, the cancer is mantle cell lymphoma (MCL). In one embodiment, the cancer is marginal zone lymphoma (MZL). In one embodiment, the marginal zone lymphoma is splenic marginal zone lymphoma (SMZL). In one embodiment, the cancer is indolent follicular cell lymphoma (iFCL). In one embodiment, the cancer is Burkitt lymphoma.
[0236] In one embodiment, the cancer is a T-cell lymphoma. In one embodiment, the T-cell lymphoma is an anaplastic large cell lymphoma (ALCL). In one embodiment, the T-cell lymphoma is Sezary syndrome.
[0237] In one embodiment, the cancer is Hodgkin's lymphoma.
[0238] In one embodiment, the cancer is myelodysplastic syndrome.
[0239] In one embodiment, the cancer is myeloma. In one embodiment, the cancer is multiple myeloma. In one embodiment, the multiple myeloma is plasma cell leukemia (PCL).
[0240] In one embodiment, the multiple myeloma is a newly diagnosed multiple myeloma.
[0241] In one embodiment, the multiple myeloma is relapsed or refractory. In one embodiment, the multiple myeloma is refractory to lenalidomide. In one embodiment, the multiple myeloma is refractory to pomalidomide. In one embodiment, the multiple myeloma is refractory to pomalidomide used in combination with a proteasome inhibitor. In one embodiment, the proteasome inhibitor is selected from bortezomib, carfilzomib, and ixazomib. In one embodiment, the multiple myeloma is refractory to pomalidomide used in combination with an inflammatory steroid. In one embodiment, the inflammatory steroid is selected from dexamethasone or prednisone. In one embodiment, the multiple myeloma is refractory to pomalidomide used in combination with a CD38-directed monoclonal antibody.
[0242] In one embodiment, this document provides methods for achieving a full response, partial response, or disease stabilization in a patient, methods comprising administering to a patient suffering from a cancer described herein a combination of a therapeutically effective amount of a compound described herein with a second active agent described herein.
[0243] In one embodiment, this document also provides methods for inducing a therapeutic response in a patient, the therapeutic response being assessed using the International Uniform Response Criteria for Multiple Myeloma (IURC) (see Durie BGM, Harousseau JL, Miguel JS, et al., International uniform response criteria for multiple myeloma. Leukemia, 2006; (10) 10: 1-7), these methods comprising administering to a patient with multiple myeloma an effective or therapeutically effective amount of a combination of the compound provided herein and a second activator provided herein.
[0244] In another embodiment, this document provides methods for achieving a strictly complete response, a complete response, or a very good partial response (as determined by the International Unified Standard for Response in Multiple Myeloma (IURC)) in patients, methods comprising administering to a patient with multiple myeloma an effective or therapeutically effective amount of a combination of the compound provided herein and a second active agent provided herein.
[0245] In another embodiment, this document provides methods for achieving an increase in overall survival, progression-free survival, event-free survival, time to progression, or disease-free survival in patients, methods comprising administering to a patient with multiple myeloma an effective or therapeutically effective amount of a combination of the compound provided herein and a second active agent provided herein.
[0246] In one embodiment, this document provides a method for identifying, or predicting, the responsiveness of a subject with hematologic malignancies to a combination of a therapeutic compound and a second agent, a method comprising:
[0247] a. Obtain samples from the subject;
[0248] b. Determine the levels of biomarkers in the sample;
[0249] c. If the level of the biomarker is altered relative to the reference level of the biomarker, the diagnosis is that the subject may be responding to the combination of the therapeutic compound and the second agent.
[0250] In one embodiment, this document provides a method for selectively treating a subject with hematologic malignancies, the method comprising:
[0251] a. Obtain samples from the subject;
[0252] b. Determine the levels of biomarkers in the sample;
[0253] c. If the level of the biomarker is altered relative to a reference level for that biomarker, the diagnosis is that the subject may be responding to the combination of the therapeutic compound and the second agent; and
[0254] d. Administer a therapeutically effective amount of the combination of the therapeutic compound and the second agent to a subject who is diagnosed as potentially responsive to the combination of the therapeutic compound and the second agent.
[0255] In one embodiment, the biomarker is the expression of a gene or combination of genes selected from BRD4, PLK1, AURKB, PHF19, NEK2, MEK, BTK, MTOR, PIM, IGF-1R, XPO1, DOT1L, EZH2, JAK2, and BIRC5.
[0256] In one embodiment, the level of change is an increase relative to a reference level for the biomarker. In another embodiment, the level of change is a decrease relative to a reference level for the biomarker.
[0257] In one embodiment, the therapeutic compound is a compound provided herein (e.g., compound 1, compound 2, compound 3, compound 4, compound 5, compound 6, or compound 7, or a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph).
[0258] In one embodiment, the second agent is a second agent provided herein: a PLK1 inhibitor (e.g., BI2536), a BRD4 inhibitor (e.g., JQ1), a BET inhibitor (e.g., compound A), a NEK2 inhibitor (e.g., JH295), an AURKB inhibitor (e.g., AZD1152), a MEK inhibitor (e.g., trametinib), a PHF19 inhibitor, a BTK inhibitor (e.g., ibrutinib), an mTOR inhibitor (e.g., everolimus), a PIM inhibitor (e.g., LGH-447), an IGF-1R inhibitor (e.g., lincitinib), an XPO1 inhibitor (e.g., celiniso), a DOT1L inhibitor (e.g., SGC0946 or pinoxetine), an EZH2 inhibitor (e.g., tazestat, UNC1999, or CPI-1205), a JAK2 inhibitor (e.g., finzotinib), a BIRC5 inhibitor (e.g., YM155), or a DNA methyltransferase inhibitor (e.g., azacitidine).
[0259] In one embodiment, the biomarker is the PLK1 gene, the therapeutic compound is compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph, and the second agent is a PLK1 inhibitor.
[0260] In one embodiment, the biomarker is the PLK1 gene, the therapeutic compound is compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph, and the second agent is a PLK1 inhibitor.
[0261] In one embodiment, the biomarker is the BRD4 gene, the therapeutic compound is compound 5, or a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph, and the second agent is a BRD4 inhibitor.
[0262] In one embodiment, the biomarker is the BRD4 gene, the therapeutic compound is compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph, and the second agent is a BRD4 inhibitor.
[0263] In one embodiment, the biomarker is the NEK2 gene, the therapeutic compound is compound 5, or a stereoisomer or mixture of stereoisomers thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph, and the second agent is an NEK2 inhibitor.
[0264] In one embodiment, the biomarker is the NEK2 gene, the therapeutic compound is compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph, and the second agent is an NEK2 inhibitor.
[0265] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 1, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 1 and BI2536.
[0266] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 1, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 1 and JQ1.
[0267] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 1, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 1 and compound A.
[0268] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 1, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 1 in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 1 in combination with rac-CCT250863.
[0269] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 2, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 2 and BI2536.
[0270] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 2, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 2 and JQ1.
[0271] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 2, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 2 and compound A.
[0272] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 2, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 2 in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 2 in combination with rac-CCT250863.
[0273] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 3, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 3 and BI2536.
[0274] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 3, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 3 and JQ1.
[0275] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 3, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 3 and compound A.
[0276] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 3, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 3 in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 3 in combination with rac-CCT250863.
[0277] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 4, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 4, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 4), in combination with BI2536.
[0278] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 4, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 4, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 4), in combination with JQ1.
[0279] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 4, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 4, or a pharmaceutically acceptable salt thereof (e.g., a hydrochloride salt of compound 4), in combination with compound A.
[0280] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 4, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 4, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 4), in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 4, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 4), in combination with rac-CCT 250863.
[0281] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 5, or a pharmaceutically acceptable salt thereof (e.g., the hydrochloride salt of compound 5), in combination with BI2536.
[0282] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 5, or a pharmaceutically acceptable salt thereof (e.g., the hydrochloride salt of compound 5), in combination with JQ1.
[0283] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 5, or a pharmaceutically acceptable salt thereof (e.g., a hydrochloride salt of compound 5), in combination with compound A.
[0284] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 5, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 5, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 5), in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 5, or a pharmaceutically acceptable salt thereof (e.g., hydrochloride of compound 5), in combination with rac-CCT 250863.
[0285] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 6, or a pharmaceutically acceptable salt thereof (e.g., hydrobromide of compound 6), in combination with BI2536.
[0286] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 6, or a pharmaceutically acceptable salt thereof (e.g., hydrobromide of compound 6), in combination with JQ1.
[0287] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, a tautomer, a prodrug, a solvate, a hydrate, a cocrystal, a cage compound, or a polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 6, or a pharmaceutically acceptable salt thereof (e.g., hydrobromide of compound 6), in combination with compound A.
[0288] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 6, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 6, or a pharmaceutically acceptable salt thereof (e.g., hydrobromide of compound 6), in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 6, or a pharmaceutically acceptable salt thereof (e.g., hydrobromide of compound 6), in combination with rac-CCT 250863.
[0289] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 7, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a PLK1 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 7 and BI2536.
[0290] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 7, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BRD4 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 7 and JQ1.
[0291] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 7, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with a BET inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of a combination of compound 7 and compound A.
[0292] In one embodiment, this document provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of compound 7, or a stereoisomer or mixture thereof, a pharmaceutically acceptable salt, tautomer, prodrug, solvate, hydrate, cocrystal, cage compound, or polymorph thereof, in combination with an NEK2 inhibitor. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 7 in combination with JH295. In one embodiment, this document provides a method for treating multiple myeloma, comprising administering to a patient a therapeutically effective amount of compound 7 in combination with rac-CCT250863.
[0293] This article also provides methods for treating patients who have previously received treatment for multiple myeloma but have not responded to standard therapy, as well as patients who have not previously received treatment. It also covers methods for treating patients who have undergone surgery for multiple myeloma and patients who have not undergone surgery. This article further provides methods for treating patients who have previously received transplant therapy and patients who have not received transplant therapy.
[0294] The methods provided herein include the treatment of relapsed, refractory, or drug-resistant multiple myeloma. The methods provided herein also include the prevention of relapsed, refractory, or drug-resistant multiple myeloma. The methods provided herein further include the management of relapsed, refractory, or drug-resistant multiple myeloma. In some such embodiments, the myeloma is primary, secondary, three-relapsed, four-relapsed, or five-relapsed multiple myeloma. In one embodiment, the methods provided herein reduce, maintain, or eliminate minimal residual disease (MRD). In one embodiment, the methods provided herein increase MRD negativity and / or persistence in patients with multiple myeloma, comprising administering a therapeutically effective amount of a compound provided herein in combination with a second active agent provided herein. In one embodiment, the methods provided herein cover the treatment, prevention, or management of various types of multiple myeloma by administering a therapeutically effective amount of the compounds described herein, such as monoclonal gammopathy of undetermined significance (MGUS), low-risk, intermediate-risk, and high-risk multiple myeloma, newly diagnosed multiple myeloma (including low-risk, intermediate-risk, and high-risk newly diagnosed multiple myeloma), transplant-eligible and non-transplant-eligible multiple myeloma, stagnant (indolent) multiple myeloma (including low-risk, intermediate-risk, and high-risk stagnant multiple myeloma), active multiple myeloma, solitary plasmacytoma, extramedullary plasmacytoma, plasma cell leukemia, central nervous system multiple myeloma, light chain myeloma, non-secreting myeloma, immunoglobulin D myeloma, and immunoglobulin E myeloma. In another embodiment, the methods provided herein encompass the treatment, prevention, or management of multiple myeloma characterized by genetic abnormalities such as cyclin D translocations (e.g., t(11;14)(q13;q32); t(6;14)(p21;32); t(12;14)(p13;q32); or t(6;20);), MMSET translocations (e.g., t(4;14)(p16;q32)), MAF translocations (e.g., t(14;16)(q32;q32); t(20;22); t(16;22)(q11;q13); or t(14;20)(q32;q11)), or other chromosomal factors (e.g., deletion of 17p13 or chromosome 13; del(17 / 17p), non-hyperdiploidy, and increase (1q)). In one embodiment, multiple myeloma is characterized according to the International Staging System (ISS) for Multiple Myeloma. In one embodiment, the multiple myeloma is stage I multiple myeloma characterized by the ISS (e.g., serum β2-microglobulin <3.5 mg / L and serum albumin ≥3.5 g / dL). In one embodiment, the multiple myeloma is stage III multiple myeloma characterized by the ISS (e.g., serum β2-microglobulin >5.4 mg / L).In one embodiment, multiple myeloma is stage II multiple myeloma characterized by ISS (e.g., not stage I or III).
[0295] In some embodiments, these methods include administering a therapeutically effective amount of a combination of the compound provided herein and a second active agent provided herein as an induction therapy. In some embodiments, these methods include administering a therapeutically effective amount of a combination of the compound provided herein and a second active agent provided herein as a consolidation therapy. In some embodiments, these methods include administering a therapeutically effective amount of a combination of the compound provided herein and a second active agent provided herein as a maintenance therapy.
[0296] In one particular embodiment of the method described herein, multiple myeloma is plasma cell leukemia.
[0297] In one embodiment of the method described herein, the multiple myeloma is a high-risk multiple myeloma. In some such embodiments, the high-risk multiple myeloma is relapsed or refractory. In one embodiment, the high-risk multiple myeloma is a multiple myeloma that relapses within 12 months of initial treatment. In yet another embodiment, the high-risk multiple myeloma is a multiple myeloma characterized by a genetic abnormality (e.g., one or more of del(17 / 17p) and t(14;16)(q32;q32)). In some such embodiments, the high-risk multiple myeloma is relapsed or refractory to one, two, or three prior treatments.
[0298] In one embodiment, multiple myeloma is characterized by a p53 mutation. In one embodiment, the p53 mutation is a Q331 mutation. In one embodiment, the p53 mutation is an R273H mutation. In one embodiment, the p53 mutation is a K132 mutation. In one embodiment, the p53 mutation is a K132N mutation. In one embodiment, the p53 mutation is an R337 mutation. In one embodiment, the p53 mutation is an R337L mutation. In one embodiment, the p53 mutation is a W146 mutation. In one embodiment, the p53 mutation is an S261 mutation. In one embodiment, the p53 mutation is an S261T mutation. In one embodiment, the p53 mutation is an E286 mutation. In one embodiment, the p53 mutation is an E286K mutation. In one embodiment, the p53 mutation is an R175 mutation. In one embodiment, the p53 mutation is an R175H mutation. In one embodiment, the p53 mutation is an E258 mutation. In one embodiment, the p53 mutation is an E258K mutation. In one embodiment, the p53 mutation is an A161 mutation. In one embodiment, the p53 mutation is an A161T mutation.
[0299] In one embodiment, multiple myeloma is characterized by homozygous loss of p53. In another embodiment, multiple myeloma is characterized by homozygous loss of wild-type p53.
[0300] In one embodiment, multiple myeloma is characterized by wild-type p53.
[0301] In one embodiment, multiple myeloma is characterized by the activation of one or more oncogenic drivers. In one embodiment, the one or more oncogenic drivers are selected from the group consisting of: C-MAF, MAFB, FGFR3, MMset, cyclin D1, and cyclin D. In one embodiment, multiple myeloma is characterized by the activation of C-MAF. In one embodiment, multiple myeloma is characterized by the activation of MAFB. In one embodiment, multiple myeloma is characterized by the activation of FGFR3 and MMset. In one embodiment, multiple myeloma is characterized by the activation of C-MAF, FGFR3, and MMset. In one embodiment, multiple myeloma is characterized by the activation of cyclin D1. In one embodiment, multiple myeloma is characterized by the activation of MAFB and cyclin D1. In one embodiment, multiple myeloma is characterized by the activation of cyclin D.
[0302] In one embodiment, multiple myeloma is characterized by one or more chromosomal translocations. In one embodiment, the chromosomal translocation is t(14;16). In one embodiment, the chromosomal translocation is t(14;20). In one embodiment, the chromosomal translocation is t(4;14). In one embodiment, the chromosomal translocation is t(4;14) and t(14;16). In one embodiment, the chromosomal translocation is t(11;14). In one embodiment, the chromosomal translocation is t(6;20). In one embodiment, the chromosomal translocation is t(20;22). In one embodiment, the chromosomal translocation is t(6;20) and t(20;22). In one embodiment, the chromosomal translocation is t(16;22). In one embodiment, the chromosomal translocation is t(14;16) and t(16;22). In one embodiment, the chromosomal translocation is t(14;20) and t(11;14).
[0303] In one embodiment, multiple myeloma is characterized by a Q331 p53 mutation, C-MAF activation, and a chromosomal translocation at t(14;16). In one embodiment, multiple myeloma is characterized by homozygous deletion of p53, C-MAF activation, and a chromosomal translocation at t(14;16). In one embodiment, multiple myeloma is characterized by a K132N p53 mutation, MAFB activation, and a chromosomal translocation at t(14;20). In one embodiment, multiple myeloma is characterized by activation of wild-type p53, FGFR3, and MMset, and a chromosomal translocation at t(4;14). In one embodiment, multiple myeloma is characterized by activation of wild-type p53, C-MAF, and a chromosomal translocation at t(14;16). In one embodiment, multiple myeloma is characterized by homozygous deletion of p53, activation of FGFR3, MMset, and C-MAF, and chromosomal translocations at t(4;14) and t(14;16). In one embodiment, multiple myeloma is characterized by homozygous deletion of p53, activation of cyclin D1, and a chromosomal translocation at t(11;14). In one embodiment, multiple myeloma is characterized by an R337L p53 mutation, activation of cyclin D1, and a chromosomal translocation at t(11;14). In one embodiment, multiple myeloma is characterized by a W146 p53 mutation, activation of FGFR3 and MMset, and a chromosomal translocation at t(4;14). In one embodiment, multiple myeloma is characterized by an S261T p53 mutation, activation of MAFB, and chromosomal translocations at t(6;20) and t(20;22). In one embodiment, multiple myeloma is characterized by an E286K p53 mutation, activation of FGFR3 and MMset, and a chromosomal translocation at t(4;14). In one embodiment, multiple myeloma is characterized by an R175H p53 mutation, activation of FGFR3 and MMset, and a chromosomal translocation at t(4;14). In one embodiment, multiple myeloma is characterized by an E258K p53 mutation, activation of C-MAF, and chromosomal translocations at t(14;16) and t(16;22). In another embodiment, multiple myeloma is characterized by activation of wild-type p53, MAFB, and cyclin D1, and chromosomal translocations at t(14;20) and t(11;14). In yet another embodiment, multiple myeloma is characterized by an A161T p53 mutation, activation of cyclin D, and chromosomal translocation at t(11;14).
[0304] In some embodiments of the method described herein, the multiple myeloma is a newly diagnosed multiple myeloma that meets the criteria for transplantation. In another embodiment, the multiple myeloma is a newly diagnosed multiple myeloma that does not meet the criteria for transplantation.
[0305] In yet another embodiment, multiple myeloma is characterized by early progression after initial treatment (e.g., less than 12 months). In still another embodiment, multiple myeloma is characterized by early progression after autologous stem cell transplantation (e.g., less than 12 months). In another embodiment, multiple myeloma is refractory to lenalidomide. In another embodiment, multiple myeloma is refractory to pomalidomide. In some of these embodiments, multiple myeloma is predicted to be refractory to pomalidomide (e.g., by molecular characterization). In another embodiment, the multiple myeloma is relapsed or refractory to three or more prior therapies and exposed to proteasome inhibitors (e.g., bortezomib, carfilzomib, ixazomib, octopzomib, or marizomib) and immunomodulatory compounds (e.g., thalidomide, lenalidomide, pomalidomide, iberdomide, or avadomide), or is doubly refractory to both proteasome inhibitors and immunomodulatory compounds. In yet another embodiment, the multiple myeloma is relapsed or refractory to three or more prior therapies (including, for example, CD38 monoclonal antibodies (CD38...). Multiple myeloma is refractory to a proteasome inhibitor (e.g., daratumumab or isatuximab), a proteasome inhibitor (e.g., bortezomib, carfilzomib, ixazomib, or marizomib), and an immunomodulatory compound (e.g., thalidomide, lenalidomide, pomalidomide, ibelidomide, or avalidomide), or is doubly refractory to a proteasome inhibitor or immunomodulatory compound and a CD38 mAb. In other embodiments, multiple myeloma is triple-refractory, for example, multiple myeloma is refractory to a proteasome inhibitor (e.g., bortezomib, carfilzomib, ixazomib, octopzomib, or marizomib), an immunomodulatory compound (e.g., thalidomide, lenalidomide, pomalidomide, ibelidomide, or avalidomide), and one other active agent as described herein.
[0306] In some embodiments, this document provides methods for treating, preventing, and / or managing multiple myeloma (including relapsed / refractory multiple myeloma) or its symptoms in patients with impaired renal function, methods comprising administering to a patient with relapsed / refractory multiple myeloma who has impaired renal function a combination of a therapeutically effective amount of a compound provided herein with a second active agent provided herein.
[0307] In some embodiments, this document provides methods for treating, preventing, and / or managing multiple myeloma (including relapsed or refractory multiple myeloma) or its symptoms in debilitated patients, methods comprising administering to a debilitated patient with multiple myeloma a therapeutically effective amount of a compound provided herein in combination with a second active agent provided herein. In some such embodiments, the debilitated patient is characterized by not meeting the criteria for induction therapy or being intolerant to dexamethasone treatment. In some such embodiments, the debilitated patient is an elderly person, for example, over 65 years of age.
[0308] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, which include administering to a patient a therapeutically effective amount of a compound provided herein combined with a second active agent provided herein, wherein the multiple myeloma is fourth-line relapsed / refractory multiple myeloma.
[0309] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, which include administering to a patient a therapeutically effective amount of a combination of a compound provided herein and a second active agent provided herein as an induction therapy, wherein the multiple myeloma is a newly diagnosed transplantable multiple myeloma.
[0310] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, which include administering to a patient a therapeutically effective amount of a compound provided herein in combination with a second active agent provided herein as a maintenance therapy following other treatments or transplantation, wherein the multiple myeloma is a newly diagnosed multiple myeloma that is eligible for transplantation prior to other treatments or transplantation.
[0311] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, including administering to a patient a therapeutically effective amount of a compound provided herein in combination with a second active agent provided herein as additional therapy or post-transplantation maintenance therapy. In some embodiments, the multiple myeloma is a newly diagnosed multiple myeloma that is eligible for transplantation prior to other therapies and / or transplantation. In some embodiments, the other pre-transplantation therapy is treatment with chemotherapy or a compound provided herein.
[0312] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, which include administering to a patient a therapeutically effective amount of a compound provided herein combined with a second active agent provided herein, wherein the multiple myeloma is relapsed or a high-risk multiple myeloma refractory to one, two, or three prior treatments.
[0313] In some embodiments, this document provides methods for treating, preventing, or managing multiple myeloma, which include administering to a patient a therapeutically effective amount of a compound provided herein combined with a second active agent provided herein, wherein the multiple myeloma is a newly diagnosed multiple myeloma that is not eligible for transplantation.
[0314] In some embodiments, the patient to be treated with one of the methods provided herein has not received multiple myeloma therapy prior to administration of the combination of the compound provided herein and the second active agent provided herein. In some embodiments, the patient to be treated with one of the methods provided herein has received multiple myeloma therapy prior to administration of the combination of the compound provided herein and the second active agent provided herein. In some embodiments, the patient to be treated with one of the methods provided herein has developed resistance to anti-multiple myeloma therapy. In some such embodiments, the patient has developed resistance to one, two, or three anti-multiple myeloma therapies selected from CD38 monoclonal antibodies (CD38 mAb, e.g., daratumumab or ixartuximab), proteasome inhibitors (e.g., bortezomib, carfilzomib, ixartuximab, or marizomib), and immunomodulatory compounds (e.g., thalidomide, lenalidomide, pomalidomide, ibelidomide, or avalidomide).
[0315] The methods provided herein cover the treatment of patients regardless of their age. In some embodiments, the subject is 18 years of age or older. In other embodiments, the subject is over 18, 25, 35, 40, 45, 50, 55, 60, 65, or 70 years of age. In other embodiments, the subject is under 65 years of age. In other embodiments, the subject is over 65 years of age. In one embodiment, the subject is an elderly multiple myeloma subject, such as a subject older than 65 years of age. In one embodiment, the subject is an elderly multiple myeloma subject, such as a subject older than 75 years of age.
[0316] E. Administration of the second active agent
[0317] In one embodiment, the specific amount (dosage) of the second active agent provided herein, as used in the methods provided herein, is determined by factors such as the specific agent used, the type of multiple myeloma being treated or managed, the severity and stage of the disease, the amount of the compound provided herein, and any optional additional active agents administered concurrently to the patient.
[0318] In one embodiment, the dosage of the second active agent provided herein, as used in the methods provided herein, is determined based on the drug commercial packaging insert (e.g., label) approved by the FDA or a similar regulatory agency outside the United States for the active agent. In one embodiment, the dosage of the second active agent provided herein, as used in the methods provided herein, is the dosage approved by the FDA or a similar regulatory agency outside the United States for the active agent. In one embodiment, the dosage of the second active agent provided herein, as used in the methods provided herein, is the dosage of the active agent in a human clinical trial. In one embodiment, the dosage of the second active agent provided herein, as used in the methods provided herein, is lower than the dosage approved by the FDA or a similar regulatory agency outside the United States for the active agent or the dosage of the active agent in a human clinical trial, depending on, for example, the synergistic effect between the second active agent provided herein and the compound.
[0319] In one embodiment, the second active agent used in the method provided herein is a BTK inhibitor. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose ranging from about 140 mg to about 700 mg, about 280 mg to about 560 mg, or about 420 mg to about 560 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose not exceeding about 700 mg, not exceeding about 560 mg, not exceeding about 420 mg, not exceeding about 280 mg, or not exceeding about 140 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose of about 560 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose of about 420 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose of about 280 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered once daily at a dose of about 140 mg. In one embodiment, the BTK inhibitor (e.g., ibrutinib) is administered orally.
[0320] In one embodiment, the second active agent used in the method provided herein is an mTOR inhibitor. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered once daily at a dose ranging from about 1 mg to about 20 mg, about 2.5 mg to about 15 mg, or about 5 mg to about 10 mg. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered once daily at a dose not exceeding about 20 mg, not exceeding about 15 mg, not exceeding about 10 mg, not exceeding about 5 mg, or not exceeding about 2.5 mg. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered once daily at a dose of about 10 mg. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered once daily at a dose of about 5 mg. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered once daily at a dose of about 2.5 mg. In one embodiment, the mTOR inhibitor (e.g., everolimus) is administered orally.
[0321] In one embodiment, the second active agent used in the method provided herein is a PIM inhibitor. In one embodiment, the PIM inhibitor (e.g., LGH-447) is administered once daily at a dose ranging from about 30 mg to about 1000 mg, about 70 mg to about 700 mg, about 150 mg to about 500 mg, about 200 mg to about 350 mg, or about 250 mg to about 300 mg. In one embodiment, the PIM inhibitor (e.g., LGH-447) is administered once daily at a dose not exceeding about 700 mg, not exceeding about 500 mg, not exceeding about 350 mg, not exceeding about 300 mg, not exceeding about 250 mg, not exceeding about 200 mg, not exceeding about 150 mg, or not exceeding about 70 mg. In one embodiment, the PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 500 mg. In one embodiment, the PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 350 mg. In one embodiment, a PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 300 mg. In one embodiment, a PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 250 mg. In one embodiment, a PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 200 mg. In one embodiment, a PIM inhibitor (e.g., LGH-447) is administered once daily at a dose of about 150 mg. In one embodiment, the PIM inhibitor (e.g., LGH-447) is administered orally.
[0322] In one embodiment, the second active agent used in the method provided herein is an IGF-1R inhibitor. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered daily at a dose ranging from about 100 mg to about 500 mg, about 150 mg to about 450 mg, about 200 mg to about 400 mg, or about 250 mg to about 300 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered twice daily (BID) at a dose ranging from about 50 mg to about 250 mg, about 75 mg to about 225 mg, about 100 mg to about 200 mg, or about 125 mg to about 150 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered daily at a dose not exceeding about 450 mg, not exceeding about 400 mg, not exceeding about 300 mg, not exceeding about 250 mg, not exceeding about 200 mg, or not exceeding about 150 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered daily at a dose not exceeding about 450 mg, about 400 mg, about 300 mg, about 250 mg, about 200 mg, or about 150 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered twice daily at a dose not exceeding about 225 mg, about 200 mg, about 150 mg, about 125 mg, about 100 mg, or about 75 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered daily at a dose not exceeding about 450 mg, about 400 mg, about 300 mg, about 250 mg, about 200 mg, or about 150 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered twice daily at a dose not exceeding about 225 mg, about 200 mg, about 150 mg, about 125 mg, about 100 mg, or about 75 mg. In one embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered on days 1 through 3 of every 7 days. In another embodiment, an IGF-1R inhibitor (e.g., lincitinib) is administered orally.
[0323] In one embodiment, the second active agent used in the method provided herein is a MEK inhibitor. In one embodiment, the MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose ranging from about 0.25 mg to about 3 mg, about 0.5 mg to about 2 mg, or about 1 mg to about 1.5 mg. In one embodiment, the MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose not exceeding about 2 mg, not exceeding about 1.5 mg, not exceeding about 1 mg, or not exceeding about 0.5 mg. In one embodiment, the MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose of about 2 mg. In one embodiment, the MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose of about 1.5 mg. In one embodiment, the MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose of about 1 mg. In one embodiment, a MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered once daily at a dose of about 0.5 mg. In another embodiment, a MEK inhibitor (e.g., trametinib or trametinib dimethyl sulfoxide) is administered orally.
[0324] In one embodiment, the second active agent used in the method provided herein is an XPO1 inhibitor. In one embodiment, the XPO1 inhibitor (e.g., celiniso) is administered twice weekly at a dose ranging from about 30 mg to about 200 mg, twice weekly at a dose ranging from about 45 mg to about 150 mg, or twice weekly at a dose ranging from about 60 mg to about 100 mg. In one embodiment, the XPO1 inhibitor (e.g., celiniso) is administered twice weekly at a dose not exceeding about 100 mg, not exceeding about 80 mg, not exceeding about 60 mg, or not exceeding about 40 mg. In one embodiment, the XPO1 inhibitor (e.g., celiniso) is administered twice weekly at a dose of about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, or about 100 mg. In one embodiment, the dose is about 40 mg twice weekly. In one embodiment, the dose is about 60 mg twice weekly. In one embodiment, the dose is about 80 mg twice weekly. In one embodiment, the dose is about 100 mg twice weekly. In one embodiment, an XPO1 inhibitor (e.g., celiniso) is administered orally.
[0325] In one embodiment, the second active agent used in the method provided herein is a DOT1L inhibitor. In one embodiment, the DOT1L inhibitor (e.g., SGC0946) is administered daily at a dose ranging from about 10 mg to about 500 mg, about 25 mg to about 400 mg, about 50 mg to about 300 mg, about 75 mg to about 200 mg, or about 100 mg to about 150 mg. In one embodiment, the DOT1L inhibitor (e.g., SGC0946) is administered daily at a dose not exceeding about 500 mg, not exceeding about 400 mg, not exceeding about 300 mg, not exceeding about 200 mg, not exceeding about 150 mg, not exceeding about 100 mg, not exceeding about 75 mg, not exceeding about 50 mg, or not exceeding about 25 mg. In one embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered at a dose of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 300 mg, about 400 mg, or about 500 mg. In one embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered at a dose of about 18 mg / m². 2 Approximately 126 mg / m 2 Approximately 36 mg / m 2 Approximately 108 mg / m 2 or approximately 54 mg / m 2 Approximately 90 mg / m 2 The dose is administered daily within the range. In one embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered at a dose not exceeding about 126 mg / m². 2 Not exceeding approximately 108 mg / m³ 2 Not exceeding approximately 90 mg / m 2 Not exceeding approximately 72 mg / m 2 Not exceeding approximately 54 mg / m 2 Not exceeding approximately 36 mg / m 2 or not exceeding approximately 18 mg / m² 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered at approximately 18 mg / m². 2 Approximately 36 mg / m 2 Approximately 54 mg / m 2 Approximately 72 mg / m 2 Approximately 90 mg / m 2 Approximately 108 mg / m³ 2 or approximately 126 mg / m³ 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered orally. In another embodiment, a DOT1L inhibitor (e.g., SGC0946) is administered intravenously.
[0326] In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 18 mg / m². 2 Approximately 108 mg / m 2 Approximately 36 mg / m 2 Approximately 90 mg / m 2 or approximately 54 mg / m 2 Approximately 72 mg / m 2 The dose is administered daily within the range. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at a dose not exceeding approximately 108 mg / m². 2 Not exceeding approximately 90 mg / m 2 Not exceeding approximately 72 mg / m 2 Not exceeding approximately 54 mg / m 2 Not exceeding approximately 36 mg / m 2 or not exceeding approximately 18 mg / m² 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 18 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 36 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 54 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 70 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 72 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 90 mg / m². 2 The dosage is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered at approximately 108 mg / m². 2 The dose is administered daily. In one embodiment, a DOT1L inhibitor (e.g., pinoxastat) is administered intravenously.
[0327] In one embodiment, the second active agent used in the method provided herein is an EZH2 inhibitor. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily (BID) at a dose ranging from about 50 mg to about 1600 mg, about 100 mg to about 800 mg, or about 200 mg to about 400 mg. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily at a dose not exceeding about 800 mg, not exceeding about 600 mg, not exceeding about 400 mg, not exceeding about 200 mg, or not exceeding about 100 mg. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily at a dose of about 800 mg. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily at a dose of about 600 mg. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily at a dose of about 400 mg. In one embodiment, the EZH2 inhibitor (e.g., tazestat) is administered twice daily at a dose of about 200 mg. In one embodiment, an EZH2 inhibitor (e.g., tazetazidine) is administered orally.
[0328] In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose ranging from about 100 mg to about 3200 mg, about 200 mg to about 1600 mg, or about 400 mg to about 800 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose not exceeding about 3200 mg, not exceeding about 1600 mg, not exceeding about 800 mg, not exceeding about 400 mg, not exceeding about 200 mg, or not exceeding about 100 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 3200 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 1600 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 800 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 400 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 200 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered twice daily at a dose of about 100 mg. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered for one or more 28-day cycles. In one embodiment, an EZH2 inhibitor (e.g., CPI-1205) is administered orally.
[0329] In one embodiment, the second active agent used in the method provided herein is a JAK2 inhibitor. In one embodiment, a JAK2 inhibitor (e.g., phenotypeinib) is administered once daily at a dose ranging from about 120 mg to about 680 mg, about 240 mg to about 500 mg, or about 300 mg to about 400 mg. In one embodiment, a JAK2 inhibitor (e.g., phenotypeinib) is administered once daily at a dose not exceeding about 680 mg, not exceeding about 500 mg, not exceeding about 400 mg, not exceeding about 300 mg, or not exceeding about 240 mg. In one embodiment, a JAK2 inhibitor (e.g., phenotypeinib) is administered once daily at a dose of about 500 mg. In one embodiment, a JAK2 inhibitor (e.g., phenotypeinib) is administered once daily at a dose of about 400 mg. In one embodiment, a JAK2 inhibitor (e.g., phenotypeinib) is administered once daily at a dose of about 300 mg.
[0330] In one embodiment, the second active agent used in the method provided herein is a PLK1 inhibitor. In one embodiment, the PLK1 inhibitor (e.g., BI2536) is administered daily at a dose ranging from about 20 mg to about 200 mg, about 40 mg to about 100 mg, or about 50 mg to about 60 mg. In one embodiment, the PLK1 inhibitor (e.g., BI2536) is administered daily at a dose not exceeding about 200 mg, not exceeding about 100 mg, not exceeding about 60 mg, not exceeding about 50 mg, not exceeding about 40 mg, or not exceeding about 20 mg. In one embodiment, the PLK1 inhibitor (e.g., BI2536) is administered daily at a dose of about 200 mg, about 100 mg, about 60 mg, about 50 mg, about 40 mg, or about 20 mg. In one embodiment, the PLK1 inhibitor (e.g., BI2536) is administered once every 21 days at a dose of about 200 mg. In one embodiment, a PLK1 inhibitor (e.g., BI2536) is administered daily at a dose of approximately 100 mg on days 1 and 8 of a 21-day cycle. In one embodiment, a PLK1 inhibitor (e.g., BI2536) is administered daily at a dose of approximately 50 mg on days 1 through 3 of a 21-day cycle. In one embodiment, a PLK1 inhibitor (e.g., BI2536) is administered daily at a dose of approximately 60 mg on days 1 through 3 of a 21-day cycle. In one embodiment, a PLK1 inhibitor (e.g., BI2536) is administered intravenously.
[0331] In one embodiment, the second active agent used in the method provided herein is an AURKB inhibitor. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered daily at a dose ranging from about 50 mg to about 200 mg, about 75 mg to about 150 mg, or about 100 mg to about 110 mg. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered daily at a dose not exceeding about 200 mg, not exceeding about 150 mg, not exceeding about 110 mg, not exceeding about 100 mg, not exceeding about 75 mg, or not exceeding about 50 mg. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered daily at a dose of about 200 mg, about 150 mg, about 110 mg, about 100 mg, about 75 mg, or about 50 mg. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered on days 1, 2, 15, and 16 of a 28-day cycle at the doses described herein. In one embodiment, an AURKB inhibitor (e.g., AZD1152) is administered intravenously. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered at a dose of approximately 150 mg via a continuous 48-hour infusion every 14 days in a 28-day cycle. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered at a dose of approximately 220 mg via a 2×2-hour infusion every 14 days in a 28-day cycle (e.g., 110 mg / day on days 1, 2, 15, and 16). In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered at a dose of approximately 200 mg via a 2-hour infusion every 7 days. In one embodiment, the AURKB inhibitor (e.g., AZD1152) is administered at a dose of approximately 450 mg via a 2-hour infusion every 14 days.
[0332] In one embodiment, the second active agent used in the method provided herein is a BIRC5 inhibitor. In one embodiment, the BIRC5 inhibitor (e.g., YM155) is administered at approximately 2 mg / m². 2 Approximately 15 mg / m 2 or approximately 4 mg / m 2 Approximately 10 mg / m 2 The dose is administered daily within the range. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at a dose not exceeding about 15 mg / m². 2 Not exceeding approximately 10 mg / m 2 Not exceeding approximately 4.8 mg / m³ 2 Not exceeding approximately 4 mg / m 2 or not exceeding approximately 2 mg / m 2The dosage is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at approximately 15 mg / m². 2 The dosage is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at approximately 10 mg / m². 2 The dosage is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at approximately 4.8 mg / m². 2 The dosage is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at approximately 4 mg / m². 2 The dosage is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered at approximately 2 mg / m². 2 The dose is administered daily. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered intravenously. In another embodiment, a BIRC5 inhibitor (e.g., YM155) is administered every 3 weeks via a continuous IV infusion of approximately 4.8 mg / m² over approximately 168 hours. 2 / day dose administration. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered every 3 weeks via a continuous IV infusion of approximately 5 mg / m² over approximately 168 hours. 2 / day dose administration. In one embodiment, a BIRC5 inhibitor (e.g., YM155) is administered every 3 weeks via a continuous IV infusion of approximately 10 mg / m² over approximately 72 hours. 2 / day dosage.
[0333] In one embodiment, the second active agent used in the method provided herein is a BET inhibitor. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose ranging from about 10 mg to about 160 mg, about 20 mg to about 120 mg, or about 40 mg to about 80 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose not exceeding about 160 mg, not exceeding about 120 mg, not exceeding about 80 mg, not exceeding about 40 mg, not exceeding about 20 mg, or not exceeding about 10 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 160 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 120 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 80 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 40 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 20 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered once daily at a dose of about 10 mg. In one embodiment, a BET inhibitor (e.g., pilarix) is administered on days 1 to 7 of a 21-day cycle at the dose described herein. In one embodiment, a BET inhibitor (e.g., pilarix) is administered on days 1 to 14 of a 21-day cycle at the dose described herein. In one embodiment, a BET inhibitor (e.g., pilarix) is administered on days 1 to 21 of a 21-day cycle at the dose described herein. In one embodiment, a BET inhibitor (e.g., pilarix) is administered on days 1 to 5 of a 7-day cycle at the dose described herein. In one embodiment, a BET inhibitor (e.g., pilarix) is administered orally.
[0334] In one embodiment, the second active agent used in the method provided herein is a DNA methyltransferase inhibitor. In one embodiment, the DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 25 mg / m². 2 Approximately 150 mg / m 2 Approximately 50 mg / m 2 Approximately 125 mg / m 2 or approximately 75 mg / m 2 Approximately 100 mg / m 2 Administered daily at a dose within the range. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at a dose not exceeding about 150 mg / m². 2 Not exceeding approximately 125 mg / m 2 Not exceeding approximately 100 mg / m 2 Not exceeding approximately 75 mg / m2 Not exceeding approximately 50 mg / m 2 or not exceeding approximately 25 mg / m² 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 150 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 125 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 100 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 75 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 50 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered at approximately 25 mg / m². 2 The dosage is administered daily. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered subcutaneously. In another embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered intravenously.
[0335] In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose ranging from about 100 mg to about 500 mg or from about 200 mg to about 400 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose not exceeding about 500 mg, not exceeding about 400 mg, not exceeding about 300 mg, not exceeding about 200 mg, or not exceeding about 100 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose of about 500 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose of about 400 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose of about 300 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose of about 200 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered once daily at a dose of about 100 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose ranging from about 100 mg to about 300 mg or from about 150 mg to about 250 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose not exceeding about 300 mg, not exceeding about 250 mg, not exceeding about 200 mg, not exceeding about 150 mg, or not exceeding about 100 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose of about 300 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose of about 250 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose of about 200 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose of about 150 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered twice daily at a dose of about 100 mg. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered on days 1 through 14 of a 28-day cycle at the dose described herein. In one embodiment, a DNA methyltransferase inhibitor (e.g., azacitidine) is administered on days 1 through 21 of a 28-day cycle at the dose described herein. In one embodiment, the DNA methyltransferase inhibitor (e.g., azacitidine) is administered orally.
[0336] F. Combination therapy with other active agents
[0337] In one embodiment, the method provided herein (the combination of the compounds provided herein with the second active agent provided herein) further includes administering an additional active agent (a third agent) to the patient. In one embodiment, the third agent is a steroid.
[0338] The combination of the compounds described herein with the second active agent described herein can also be further combined or used in conjunction with conventional therapies (e.g., before, during, or after conventional therapies), including but not limited to surgery, biological therapies (including immunotherapy, such as the use of checkpoint inhibitors), radiation therapy, chemotherapy, stem cell transplantation, cell therapy, or other non-pharmacological therapies currently used to treat, prevent, or manage cancer (e.g., multiple myeloma). The combination of the compounds described herein, the second active agent described herein, and conventional therapies may provide a unique and unexpectedly effective treatment regimen in certain patients. Without being theoretically limited, it is believed that the compounds described herein and the second active agent described herein may provide additional or synergistic effects when administered concurrently with conventional therapies.
[0339] As discussed elsewhere herein, this document covers methods for reducing, treating, and / or preventing adverse or undesirable effects associated with conventional therapies, including but not limited to surgery, chemotherapy, radiation therapy, biotherapy, and immunotherapy. The compounds, secondary active agents, and additional active ingredients described herein may be administered to a patient before, during, or after the occurrence of adverse effects associated with conventional therapies. In one such embodiment, the additional active agent is dexamethasone.
[0340] The combination of the compounds provided herein with the second active agent provided herein can also be further combined or used in combination with other therapeutic agents described herein for the treatment and / or prevention of multiple myeloma. In one such embodiment, the additional active agent is dexamethasone.
[0341] In one embodiment, this document provides a method for treating, preventing, or managing multiple myeloma, the method comprising administering to a patient a combination of a compound provided herein with a second active agent provided herein, further with one or more additional active agents, and optionally further with a combination of radiotherapy, blood transfusion, or surgery.
[0342] As used herein, the term "combination" includes the use of more than one therapy (e.g., one or more preventative and / or therapeutic agents). However, the use of the term "combination" does not limit the order in which therapies (e.g., preventative and / or therapeutic agents) are administered to patients with a disease or disorder. The first therapy (e.g., a prophylactic or therapeutic agent, such as a compound provided herein) may be administered to the subject before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks prior), concurrently with, or subsequently after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks prior). The first and second therapies can be administered independently before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concurrently with, or subsequently after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a third therapy (e.g., an additional prophylactic or therapeutic agent). Quadruple and pentavalent therapies are also considered herein. In one embodiment, the third therapy is dexamethasone.
[0343] The compounds described herein, the second active agent described herein, and one or more additional active agents may be administered to a patient simultaneously or sequentially via the same or different routes of administration. The suitability of a particular route of administration for a particular active agent will depend on the active agent itself (e.g., whether it can be administered orally and does not break down before entering the bloodstream).
[0344] The routes of administration of the compounds provided herein are independent of the routes of administration of the second active agent and other therapies provided herein. In one embodiment, the compounds provided herein are administered orally. In another embodiment, the compounds provided herein are administered intravenously. In one embodiment, the second active agent provided herein is administered orally. In one embodiment, the second active agent provided herein is administered intravenously. Thus, according to these embodiments, the compounds provided herein are administered orally or intravenously, the second active agent provided herein is administered orally or intravenously, and other therapies may be administered orally, parenterally, intraperitoneally, intravenously, intra-arterially, percutaneously, sublingually, intramuscularly, rectally, sublingually, intranasally, via liposomes, via inhalation, intravaginally, intraocularly, via local delivery (through a catheter or stent), subcutaneously, intra-fatally, intra-articularly, intrathecally, or in sustained-release formulations. In one embodiment, the compounds provided herein, the second active agent provided herein, and other therapies are administered by the same route of administration (orally or IV). In another embodiment, the compounds provided herein are administered by one route of administration (e.g., IV), while the second active agent or other agents (anti-multiple myeloma agents) provided herein are administered by another route of administration (e.g., orally).
[0345] In one embodiment, an additional active agent is administered intravenously or subcutaneously once or twice daily in a dose of about 1 to about 1000 mg, about 5 to about 500 mg, about 10 to about 350 mg, or about 50 to about 200 mg. The specific amount of the additional active agent will depend on the specific drug used, the type of multiple myeloma being treated or managed, the severity and stage of the disease, the amount of the compound provided herein, the amount of the second active agent provided herein, and any optional additional active agents administered concurrently to the patient.
[0346] One or more additional active ingredients or agents may be used together with the compounds and second active agents provided herein in the methods and compositions provided herein. The additional active agents may be macromolecules (e.g., proteins), small molecules (e.g., synthetic inorganic, organometallic, or organic molecules), or cell therapies (e.g., CAR cells).
[0347] Examples of other active agents that may be used in the methods and compositions described herein include one or more of the following: melphalan, vincristine, cyclophosphamide, etoposide, doxorubicin, bendamustine, obbinutuzumab, proteasome inhibitors (e.g., bortezomib, carfilzomib, ixazomib, octopozomib, or marizomib), histone deacetylase inhibitors (e.g., panobinostat, ACY241), and BET inhibitors (e.g., GSK525762A, OTX015, BMS-986158, TEN-010, CPI-0610, INCB54329, BAY1238097, FT-1101, ABBV-075, BI). 894999, GS-5829, GSK1210151A (I-BET-151), CPI-203, RVX-208, XD46, MS436, PFI-1, RVX2135, ZEN3365, XD14, ARV-771, MZ-1, PLX5117, 4-[2-(cyclopropylmethoxy)-5-(methanesulfonyl)phenyl]-2-methylisoquinoline-1(2H)-one, EP11313 and EP11336), BCL2 inhibitors (e.g., venetoclax or navitoclax), MCL-1 inhibitors (e.g., AZD5991, AMG176, MIK665, S64315 or S63845), LSD-1 inhibitors (e.g., ORY-1001, ORY-2001, INCB-59872, IMG-7289, TAK-418, GSK-2879552, 4-[2-(4-amino-piperidin-1-yl)-5-(3-fluoro-4-methoxy-phenyl)-1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl]-2-fluoro-benzyl nitrile or salts thereof), corticosteroids (e.g., prednisone), dexamethasone; antibodies (e.g., CS1 antibodies, such as elotuzumab; CD38 antibodies, such as daratumumab or ixartuximab; or BCMA antibodies or antibody-conjugates, such as GSK2857916 or BI 836909), checkpoint inhibitors (as described herein) or CAR cells (as described herein).
[0348] In one embodiment, in the methods and compositions described herein, an additional active agent used with the compounds and the second active agent provided herein is dexamethasone.
[0349] In some embodiments, dexamethasone is administered at a dose of 4 mg on days 1 and 8 of a 21-day cycle. In some other embodiments, dexamethasone is administered at a dose of 4 mg on days 1, 4, 8, and 11 of a 21-day cycle. In some embodiments, dexamethasone is administered at a dose of 4 mg on days 1, 8, and 15 of a 28-day cycle. In some other embodiments, dexamethasone is administered at a dose of 4 mg on days 1, 4, 8, 11, 15, and 18 of a 28-day cycle. In some embodiments, dexamethasone is administered at a dose of 4 mg on days 1, 8, 15, and 22 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 4 mg on days 1, 10, 15, and 22 of cycle 1. In some embodiments, dexamethasone is administered at a dose of 4 mg on days 1, 3, 15, and 17 of a 28-day cycle. In one such embodiment, dexamethasone was administered at a dose of 4 mg on days 1, 3, 14 and 17 of cycle 1.
[0350] In some other embodiments, dexamethasone is administered at a dose of 8 mg on days 1 and 8 of a 21-day cycle. In some other embodiments, dexamethasone is administered at a dose of 8 mg on days 1, 4, 8, and 11 of a 21-day cycle. In some embodiments, dexamethasone is administered at a dose of 8 mg on days 1, 8, and 15 of a 28-day cycle. In some other embodiments, dexamethasone is administered at a dose of 8 mg on days 1, 4, 8, 11, 15, and 18 of a 28-day cycle. In some embodiments, dexamethasone is administered at a dose of 8 mg on days 1, 8, 15, and 22 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 8 mg on days 1, 10, 15, and 22 of cycle 1. In some embodiments, dexamethasone is administered at a dose of 8 mg on days 1, 3, 15, and 17 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 8 mg on days 1, 3, 14, and 17 of cycle 1.
[0351] In some embodiments, dexamethasone is administered at a dose of 10 mg on days 1 and 8 of a 21-day cycle. In some other embodiments, dexamethasone is administered at a dose of 10 mg on days 1, 4, 8, and 11 of a 21-day cycle. In some embodiments, dexamethasone is administered at a dose of 10 mg on days 1, 8, and 15 of a 28-day cycle. In some other embodiments, dexamethasone is administered at a dose of 10 mg on days 1, 4, 8, 11, 15, and 18 of a 28-day cycle. In some embodiments, dexamethasone is administered at a dose of 10 mg on days 1, 8, 15, and 22 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 10 mg on days 1, 10, 15, and 22 of cycle 1. In some embodiments, dexamethasone is administered at a dose of 10 mg on days 1, 3, 15, and 17 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 10 mg on days 1, 3, 14, and 17 of cycle 1.
[0352] In some embodiments, dexamethasone is administered at a dose of 20 mg on days 1 and 8 of a 21-day cycle. In some other embodiments, dexamethasone is administered at a dose of 20 mg on days 1, 4, 8, and 11 of a 21-day cycle. In some embodiments, dexamethasone is administered at a dose of 20 mg on days 1, 8, and 15 of a 28-day cycle. In some other embodiments, dexamethasone is administered at a dose of 20 mg on days 1, 4, 8, 11, 15, and 18 of a 28-day cycle. In some embodiments, dexamethasone is administered at a dose of 20 mg on days 1, 8, 15, and 22 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 20 mg on days 1, 10, 15, and 22 of cycle 1. In some embodiments, dexamethasone is administered at a dose of 20 mg on days 1, 3, 15, and 17 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 20 mg on days 1, 3, 14, and 17 of cycle 1.
[0353] In some embodiments, dexamethasone is administered at a dose of 40 mg on days 1 and 8 of a 21-day cycle. In some other embodiments, dexamethasone is administered at a dose of 40 mg on days 1, 4, 8, and 11 of a 21-day cycle. In some embodiments, dexamethasone is administered at a dose of 40 mg on days 1, 8, and 15 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 40 mg on days 1, 10, 15, and 22 of cycle 1. In some other embodiments, dexamethasone is administered at a dose of 40 mg on days 1, 4, 8, 11, 15, and 18 of a 28-day cycle. In other such embodiments, dexamethasone is administered at a dose of 40 mg on days 1, 8, 15, and 22 of a 28-day cycle. In other such embodiments, dexamethasone is administered at a dose of 40 mg on days 1, 3, 15, and 17 of a 28-day cycle. In one such embodiment, dexamethasone is administered at a dose of 40 mg on days 1, 3, 14, and 17 of cycle 1.
[0354] In another embodiment, in the methods and compositions described herein, the additional active agent used with the compounds and second active agents provided herein is bortezomib. In yet another embodiment, in the methods and compositions described herein, the additional active agent used with the compounds and second active agents provided herein is daratumumab. In some such embodiments, these methods further include administration of dexamethasone. In some embodiments, these methods include administration of the compounds and second active agents provided herein, along with proteasome inhibitors, CD38 inhibitors, and corticosteroids as described herein.
[0355] In some embodiments, the compounds and second active agents provided herein are administered in combination with checkpoint inhibitors. In one embodiment, a checkpoint inhibitor is used in combination with the compounds and second active agents provided herein in relation to the methods provided herein. In another embodiment, two checkpoint inhibitors are used in combination with the compounds and second active agents provided herein in relation to the methods provided herein. In yet another embodiment, three or more checkpoint inhibitors are used in combination with the compounds and second active agents provided herein in relation to the methods provided herein.
[0356] As used herein, the term "immune checkpoint inhibitor" or "checkpoint inhibitor" refers to a molecule that completely or partially reduces, inhibits, interferes with, or modulates one or more checkpoint proteins. Without being bound by any particular theory, checkpoint proteins regulate the activation or function of T cells. Many checkpoint proteins are known, such as CTLA-4 and its ligands CD80 and CD86; and PD-1 and its ligands PD-L1 and PD-L2 (Pardoll, Nature Reviews Cancer, 2012, 12, 252-264). These proteins appear to be responsible for co-stimulatory or inhibitory interactions in T cell responses. Immune checkpoint proteins appear to regulate and maintain self-tolerance and the duration and magnitude of physiological immune responses. Immune checkpoint inhibitors include antibodies or antibody-derived antibodies.
[0357] In one embodiment, the checkpoint inhibitor is a CTLA-4 inhibitor. In another embodiment, the CTLA-4 inhibitor is an anti-CTLA-4 antibody. Examples of anti-CTLA-4 antibodies include, but are not limited to, those described in U.S. Patent Nos. 5,811,097, 5,811,097, 5,855,887, 6,051,227, 6,207,157, 6,682,736, 6,984,720, and 7,605,238, all of which are incorporated herein by reference in their entirety. In one embodiment, the anti-CTLA-4 antibody is tremelimumab (also known as ticilimumab or CP-675,206). In another embodiment, the anti-CTLA-4 antibody is ipilimumab (also known as MDX-010 or MDX-101). Ipilimumab is a fully human monoclonal IgG antibody that binds to CTLA-4. Ipilimumab is marketed under the trade name Yervoy. TM sell.
[0358] In one embodiment, the checkpoint inhibitor is a PD-1 / PD-L1 inhibitor. Examples of PD-1 / PD-L1 inhibitors include, but are not limited to, those described in U.S. Patent Nos. 7,488,802, 7,943,743, 8,008,449, 8,168,757, 8,217,149, and PCT Patent Application Publications Nos. WO 2003042402, WO 2008156712, WO 2010089411, WO 2010036959, WO2011066342, WO 2011159877, WO 2011082400, and WO 2011161699, all of which are incorporated herein by reference in their entirety.
[0359] In one embodiment, the checkpoint inhibitor is a PD-1 inhibitor. In another embodiment, the PD-1 inhibitor is an anti-PD-1 antibody. In one embodiment, the anti-PD-1 antibody is BGB-A317, nivolumab (also known as ONO-4538, BMS-936558, or MDX1106), or pembrolizumab (also known as MK-3475, SCH 900475, or lambrolizumab). In one embodiment, the anti-PD-1 antibody is nivolumab. Nivolumab is a human IgG4 anti-PD-1 monoclonal antibody and is marketed under the trade name Opdivo. TM For sale. In another embodiment, the anti-PD-1 antibody is pembrolizumab. Pembrolizumab is a humanized monoclonal IgG4 antibody and is marketed under the trade name Keytruda. TM For sale. In yet another embodiment, the anti-PD-1 antibody is the humanized antibody CT-011. CT-011 alone did not show a response in the treatment of relapsed acute myeloid leukemia (AML). In yet another embodiment, the anti-PD-1 antibody is the fusion protein AMP-224. In yet another embodiment, the PD-1 antibody is BGB-A317. BGB-A317 is a monoclonal antibody specifically designed to bind to Fcγ receptor I, possessing unique binding characteristics to PD-1 with high affinity and excellent target specificity.
[0360] In one embodiment, the checkpoint inhibitor is a PD-L1 inhibitor. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the anti-PD-L1 antibody is MEDI4736 (durvalumab). In another embodiment, the anti-PD-L1 antibody is BMS-936559 (also known as MDX-1105-01). In yet another embodiment, the PD-L1 inhibitor is atezolizumab (also known as MPDL3280A and...). ).
[0361] In one embodiment, the checkpoint inhibitor is a PD-L2 inhibitor. In one embodiment, the PD-L2 inhibitor is an anti-PD-L2 antibody. In one embodiment, the anti-PD-L2 antibody is rHIgM12B7A.
[0362] In one embodiment, the checkpoint inhibitor is a lymphocyte activation gene-3 (LAG-3) inhibitor. In one embodiment, the LAG-3 inhibitor is the soluble Ig fusion protein IMP321 (Brignone et al., J. Immunol. [Journal of Immunology], 2007, 179, 4202-4211). In another embodiment, the LAG-3 inhibitor is BMS-986016.
[0363] In one embodiment, the checkpoint inhibitor is a B7 inhibitor. In another embodiment, the B7 inhibitor is a B7-H3 inhibitor or a B7-H4 inhibitor. In one embodiment, the B7-H3 inhibitor is MGA271, an anti-B7-H3 antibody (Loo et al., Clin. Cancer Res., 2012, 3834).
[0364] In one embodiment, the checkpoint inhibitor is a TIM3 (T cell immunoglobulin domain and mucin domain 3) inhibitor (Fourcade et al., J. Exp. Med., 2010, 207, 2175-86; Sakuishi et al., J. Exp. Med., 2010, 207, 2187-94).
[0365] In one embodiment, the checkpoint inhibitor is an OX40 (CD134) agonist. In one embodiment, the checkpoint inhibitor is an anti-OX40 antibody. In one embodiment, the anti-OX40 antibody is anti-OX-40. In another embodiment, the anti-OX40 antibody is MEDI6469.
[0366] In one embodiment, the checkpoint inhibitor is a GITR agonist. In one embodiment, the checkpoint inhibitor is an anti-GITR antibody. In one embodiment, the anti-GITR antibody is TRX518.
[0367] In one embodiment, the checkpoint inhibitor is a CD137 agonist. In one embodiment, the checkpoint inhibitor is an anti-CD137 antibody. In one embodiment, the anti-CD137 antibody is urelumab. In another embodiment, the anti-CD137 antibody is PF-05082566.
[0368] In one embodiment, the checkpoint inhibitor is a CD40 agonist. In one embodiment, the checkpoint inhibitor is an anti-CD40 antibody. In one embodiment, the anti-CD40 antibody is CF-870,893.
[0369] In one embodiment, the checkpoint inhibitor is recombinant human interleukin-15 (rhIL-15).
[0370] In one embodiment, the checkpoint inhibitor is an IDO inhibitor. In one embodiment, the IDO inhibitor is INCB024360. In another embodiment, the IDO inhibitor is indoximod.
[0371] In some embodiments, the combination therapies provided herein include two or more of the checkpoint inhibitors described herein (including checkpoint inhibitors of the same or different classes). Furthermore, the combination therapies described herein may be used in combination with one or more second active agents described herein, as appropriate, to treat diseases described herein and understood in the art.
[0372] In some embodiments, the compounds and second active agents provided herein may be used in combination with one or more immune cells (e.g., modified immune cells) that express one or more chimeric antigen receptors (CARs) on their own surface. Typically, a CAR comprises an extracellular domain, a transmembrane domain, and an intracellular signaling domain derived from a first protein (e.g., an antigen-binding protein). In some embodiments, once the extracellular domain binds to a target protein (such as a tumor-associated antigen (TAA) or tumor-specific antigen (TSA)), a signal is generated via the intracellular signaling domain of the activated immune cell, for example, to target and kill cells expressing the target protein.
[0373] Extracellular domain: The extracellular domain of the CAR binds to the target antigen. In some embodiments, the extracellular domain of the CAR includes a receptor or a portion of a receptor that binds to the antigen. In some embodiments, the extracellular domain includes an antibody or its antigen-binding portion. In a particular embodiment, the extracellular domain includes a single-chain Fv (scFv) domain. The single-chain Fv domain may include, for example, a domain connected to a V via a flexible linker. H V L Wherein V L and V H Antibodies derived from binding to the antigen.
[0374] In some embodiments, the extracellular domains of the peptides described herein recognize tumor-associated antigens (TAAs) or tumor-specific antigens (TSAs). In various specific embodiments, tumor-associated antigens or tumor-specific antigens are, but are not limited to, Her2, prostate stem cell antigen (PSCA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calreticulin, MUC-1, B-cell maturation antigen (BCMA), epithelial membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma-24-associated antigen (MAGE), CD19, CD22, CD27, CD30, CD34, CD45, CD70, CD99, CD117, EGFRvIII (epidermal growth factor variant III), mesothelin, PAP (prostatic acid phosphatase), and prostate-specific protein (prostein). The following proteins are included: TARP (T-cell receptor γ-alternative reading frame protein), Trp-p8, STEAPI (prostate six-transmembrane epithelial antigen 1), chromogranin, cytokeratin, myoderm, glial fibrillary acidic protein (GFAP), cystopathic liquid protein (GCDFP-15), HMB-45 antigen, protein melan-A (T-lymphocyte recognized melanoma antigen; MART-I), myo-D1, muscle-specific actin (MSA), neurofilaments, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysis, thyroglobulin, thyroid transcription factor-1, pyruvate kinase isoenzyme M2 type (tumor M2-PK) dimer form, aberrant ras protein, or aberrant p53 protein. In some other embodiments, the TAA or TSA recognized by the extracellular domain of the CAR is integrin αvβ3 (CD61), prolactin, or Ral-B.
[0375] In some embodiments, the TAA or TSA recognized by the extracellular domain of the CAR is a cancer / testis (CT) antigen, such as BAGE, CAGE, CTAGE, FATE, GAGE, HCA661, HOM-TES-85, MAGEA, MAGEB, MAGEC, NA88, NY-ES0-1, NY-SAR-35, OY-TES-1, SPANXBI, SPA17, SSX, SYCPI, or TPTE.
[0376] In some other embodiments, the TAA or TSA recognized by the extracellular domain of the CAR is a carbohydrate or ganglioside, such as fuc-GMI, GM2 (carcinoembryonic antigen-immunogenic-1; OFA-I-1); GD2 (OFA-I-2), GM3, GD3, etc.
[0377] In some other embodiments, the TAA or TSA recognized by the extracellular domain of the CAR is α-actin-4, Bage-1, BCR-ABL, Bcr-Abl fusion protein, β-catenin, CA 125, CA 15-3 (CA 27.29 / BCAA), CA195, CA 242, CA-50, CAM43, Casp-8, cdc27, cdk4, cdkn2a, CEA, coa-1, dek-can fusion protein, EBNA, EF2, Epstein-Barr II. Barr virus antigen, ETV6-AML1 fusion protein, HLA-A2, HLA-All, hsp70-2, KIAA0205, Mart2, Mum-1, 2 and 3, new PAP, class I myosin, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomerase, Gage 3, 4, 5, 6, 7, GnTV, Herv-K-mel, Lage-1, NA-88, NY-Eso-1 / Lage-2, SP17, SSX-2, TRP2-Int2, gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, RAGE, GAGE-1, GAGE-2, p15(58), RAGE, SCP-1, Hom / Mel-40, PRAME, p53, HRAs, HER-2 / neu, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Human Papillomavirus (HPV) Antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, 13-catenin, Mum-1, p16, TAGE, PSMA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, 13HCG, BCA225, BTAA, CD68 / KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90, TAAL6, TAG72, TLP or TPS.
[0378] In various specific embodiments, the tumor-associated antigen or tumor-specific antigen is an AML-associated tumor antigen, as described in S. Anguille et al., Leukemia (2012), 26, 2186-2196.
[0379] Other tumor-associated and tumor-specific antigens are known to those skilled in the art.
[0380] Receptors, antibodies, and scFvs that bind to TSA and TAA, as well as the nucleotide sequences encoding them, are useful in constructing chimeric antigen receptors and are known in the art.
[0381] In certain specific embodiments, the antigen recognized by the extracellular domain of the chimeric antigen receptor is an antigen that is not normally considered a TSA or TAA, but it is still associated with tumor cells or tumor-induced damage. In some embodiments, the antigen is, for example, a growth factor, cytokine, or interleukin, such as a growth factor, cytokine, or interleukin associated with angiogenesis or vascularization. Such growth factors, cytokines, or interleukins may include, for example, vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), platelet-derived growth factor (PDGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), or interleukin-8 (IL-8). Tumors can also create a hypoxic environment locally. Therefore, in other specific embodiments, the antigen is a hypoxia-associated factor, such as HIF-1α, HIF-1β, HIF-2α, HIF-2β, HIF-3α, or HIF-3β. Tumors can also cause localized damage to normal tissue, resulting in the release of molecules called damage-associated molecular pattern molecules (DAMPs, also known as alarm molecules). Therefore, in some other specific embodiments, the antigen is DAMP, such as heat shock protein, chromatin-associated high-mobility group box 1 (HMGB 1), S100A8 (MRP8, cadherin A), S100A9 (MRP14, cadherin B), serum amyloid A (SAA), or may be deoxyribonucleic acid, adenosine triphosphate, uric acid, or heparin sulfate.
[0382] Transmembrane domain: In some embodiments, the extracellular domain of the CAR is linked to the transmembrane domain of the peptide via a linker, spacer, or hinge peptide sequence (e.g., a sequence from CD28 or from CTLA4). The transmembrane domain can be obtained or derived from the transmembrane domain of any transmembrane protein and can include all or part of such a transmembrane domain. In specific embodiments, the transmembrane domain can be obtained or derived from, for example, CD8, CD16, cytokine receptors, interleukin receptors, or growth factor receptors.
[0383] Intracellular signaling domain: In some embodiments, the intracellular domain of the CAR is or is contained within an intracellular domain or motif of a protein expressed on the surface of T cells and triggering the activation and / or proliferation of said T cells. Such a domain or motif is capable of transmitting a primary antigen-binding signal, which is necessary for the activation of T lymphocytes in response to the binding of an antigen to the extracellular portion of the CAR. Typically, the domain or motif contains or is ITAM (an immune receptor tyrosine-based activation motif). Suitable ITAM-containing peptides for CARs include, for example, the ζCD3 chain (CD3ζ) or an ITAM-containing portion thereof. In a particular embodiment, the intracellular domain is the CD3ζ intracellular signaling domain. In other particular embodiments, the intracellular domain is derived from a lymphocyte receptor chain, a TCR / CD3 complex protein, an Fe receptor subunit, or an IL-2 receptor subunit. In some embodiments, the CAR also contains one or more co-stimulatory domains or motifs, for example, as part of the intracellular domain of the peptide. The one or more costimulatory domains or motifs may be, or may contain, one or more of the costimulatory CD27 polypeptide sequence, the costimulatory CD28 polypeptide sequence, the costimulatory OX40 (CD134) polypeptide sequence, the costimulatory 4-1BB (CD137) polypeptide sequence, or the costimulatory-induced T cell costimulatory (ICOS) polypeptide sequence, or other costimulatory domains or motifs, or any combination thereof.
[0384] CARs may also contain T-cell survival motifs. T-cell survival motifs can be any polypeptide sequence or motif that promotes T-lymphocyte survival upon antigen stimulation. In some embodiments, the T-cell survival motif is or is derived from the intracellular signaling domains of CD3, CD28, the IL-7 receptor (IL-7R), the IL-12 receptor, the IL-15 receptor, the IL-21 receptor, or the transforming growth factor β (TGFβ) receptor.
[0385] The modified immune cells expressing CAR can be, for example, T lymphocytes (T cells, such as CD4+ T cells or CD8+ T cells), cytotoxic lymphocytes (CTLs), or natural killer (NK) cells. The T lymphocytes used in the compositions and methods provided herein can be naive T lymphocytes or MHC-restricted T lymphocytes. In some embodiments, the T lymphocytes are tumor-infiltrating lymphocytes (TILs). In some embodiments, the T lymphocytes have been isolated from a tumor biopsy or have been expanded from T lymphocytes isolated from a tumor biopsy. In some other embodiments, the T cells have been isolated from peripheral blood, cord blood, or lymph, or expanded from T lymphocytes isolated from peripheral blood, cord blood, or lymph. The immune cells used to generate the modified immune cells expressing CAR can be isolated using conventional methods accepted by the art, such as blood collection followed by apheresis, and optionally antibody-mediated cell separation or sorting.
[0386] The modified immune cells are preferably autologous to the individual receiving the modified immune cells. In some other embodiments, the modified immune cells and the individual receiving the modified immune cells are allogeneic. When preparing modified T lymphocytes using allogeneic T lymphocytes or NK cells, T lymphocytes or NK cells that reduce the likelihood of graft-versus-host disease (GVHD) in the individual are preferably selected. For example, in some embodiments, virus-specific T lymphocytes are selected for preparing modified T lymphocytes; it is anticipated that the native ability of such lymphocytes to bind to any recipient antigen will be greatly reduced, thereby preventing activation by any recipient antigen. In some embodiments, recipient-mediated allogeneic T lymphocyte rejection can be reduced by co-administering one or more immunosuppressants (e.g., cyclosporine, tacrolimus, sirolimus, cyclophosphamide, etc.) to the host.
[0387] T lymphocytes, such as unmodified T lymphocytes, or T lymphocytes expressing CD3 and CD28, or T lymphocytes containing a polypeptide containing a CD3ζ signaling domain and a CD28 co-stimulatory domain, can be amplified using antibodies against CD3 and CD28, such as antibodies that attach to beads; see, for example, U.S. Patent Nos. 5,948,893, 6,534,055, 6,352,694, 6,692,964, 6,887,466, and 6,905,681.
[0388] Modified immune cells (e.g., modified T lymphocytes) may optionally contain a “suicide gene” or “safety switch” that, when needed, can kill substantially all of the modified immune cells. For example, in some embodiments, the modified T lymphocytes may contain an HSV thymidine kinase gene (HSV-TK) that causes the modified T lymphocytes to die upon contact with gancyclovir. In another embodiment, the modified T lymphocytes include inducible caspase, for example, inducible caspase 9 (i-caspase 9), such as a fusion protein between caspase 9 and human FK506 binding protein, allowing dimerization with specific small molecule drugs. See Straathof et al., Blood 1 05(11):4247-4254 (2005).
[0389] In some embodiments, the compounds and second active agents provided herein are combined with chimeric antigen receptor (CAR) T cells and administered to patients with various types or stages of multiple myeloma. In some embodiments, the CAR T cells in the combination target B cell maturation antigen (BCMA), and in more specific embodiments, the CAR T cells are bb2121 or bb21217. In some embodiments, the CAR T cells are JCARH125.
[0390] It should be understood that the foregoing detailed descriptions and accompanying examples are merely illustrative and should not be considered as limiting the scope of the subject matter. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the spirit and scope of the invention, including but not limited to changes and modifications relating to the chemical structures, substituents, derivatives, intermediates, synthesis, formulations, and / or methods of use provided herein. U.S. patents and publications cited herein are incorporated herein by reference.
[0391] 8. Examples
[0392] The following non-limiting examples illustrate certain embodiments of the present invention.
[0393] Example 1: PLK1 inhibition reduces cell proliferation in multiple myeloma cell lines. All MM cell lines (ATCC, Manassas, VA, USA) were routinely tested for mycoplasma and maintained in RPMI 1640 medium supplemented with L-glutamine, fetal bovine serum, penicillin, and streptomycin (all from Invitrogen, Carlsbad, CA). These cell lines were validated periodically.
[0394] Antibodies. Several antibodies were used in these experiments for immunoblotting and flow cytometry. These antibodies included Plk1 (catalog number 4513), Aiolos (catalog number 15103), Ikaros (catalog number 14859), CDC25C (catalog number 4688), pCDC25C (catalog number 4901), lysed caspase 3 (catalog number 9664), survivin (catalog number 2803), Bcl2 (catalog number 2872), BRD4 (catalog number 13440), c-Myc (catalog number 5605), pERK (catalog number 4376), ERK (catalog number 4695), IRF7 (catalog number 13014), FOXM1 (catalog number 5436), phosphorylated histone H3 (Ser10)(D2C8)(Alexa) 594 conjugates (catalog number 8481) (all from Cell Signaling Technologies (Danvers, MA, USA)), E2F2 (catalog number Ab-138515, Abcam, Cambridge, MA, USA), CKS1B (catalog number 36-6800, Ingenium, Waltham, MA, USA), NUF2 (catalog number NBP2-43779, Novus, Saint Charles, Missouri) Charles, MO, USA), TOP2A (catalog number PA5-46814, Ingentech, Waltham, Massachusetts, USA), ETV4 (catalog number 10684-1, Ingentech, Waltham, Massachusetts, USA), IRF5 (catalog number 10547-1-AP, Proteintech, Rosemont, Illinois).
[0395] Proliferation and viability assays: Cell growth curves were determined by monitoring cell viability using trypan blue exclusion on a Vi-Cell-XR (Becton Dickinson, Franklin Lakes, NJ, USA). Proliferation assays were performed using (3H)-thymidine incorporation, in triplicate, at least three times (n=3). All data were plotted and analyzed using GraphPad Prism 7 (GraphPad Software, La Jolla, CA, USA) software, and are expressed as mean with error defined as ± sd.
[0396] Immunoblot: Immunoblot analysis was performed using a WES kit (Protein Simple, San Jose, CA, USA), with each sample analyzed at least twice (n≥2), where the best representative was shown.
[0397] RNA extraction, reverse transcription, and real-time PCR analysis: Total RNA was extracted using the RNeasy plus kit (Qiagen, Germantown, MD, USA) and reverse transcribed using the iScrip reverse transcription kit (Bio-Rad, Philadelphia, PA, USA). Quantitative real-time PCR (qPCR) analysis was performed using the Taqman PCR Master Mix and the ViiA 7 real-time PCR system (Applied Biosystems, Foster City, CA, USA). Gene expression was calculated after normalization to GAPDH levels using the comparative CT method (ΔΔCT method). The primer sequences for qPCR are as follows: PLK1 RT F: CACAGTGTCAATGCCTCCAA (SEQ ID NO:1), PLK1 RT R: GACCCAGAAGATGGGGATG (SEQ ID NO:2), ACTB RT F: CTCTTCCAGCCTTCCTTCCT (SEQ ID NO:3), ACTB RT R: GGATGTCCACGTCACACTTC (SEQ ID NO:4).
[0398] ChIP-PCR and ChIP-seq studies: ChIP-PCR and ChIP-seq experiments were performed on H929 and DF15 cell lines using standard methods. The primer sequences for ChIP-PCR are as follows: PLK1 transcription start site (TSS) ChIP F: GCGCAGGCTTTTGTAACG (SEQ ID NO:5), PLK1 TSS ChIP R: CTCCTCCCCGAATTCAAAC (SEQ ID NO:6).
[0399] Flow cytometry: Following the manufacturer's protocols, at least three independent experiments were performed using annexin V Alexa Fluor 488-conjugated antibody (Thermo Scientific, Waltham, MATLAB, USA) and To-Pro-3 (Thermo Scientific, Waltham, MATLAB, USA) and processed using Flow Jo software. For cell cycle analysis, cells were stained with propidium iodide (PI) staining kit (Epclusa, Cambridge, MATLAB, USA) and analyzed on Flow Jo V10 software. pHH3-Ser was also used. 10 Double staining with PI to detect mitotic markers pHH3-Ser 10 The staining.
[0400] Confocal imaging: Cells were cultured in chamber slides and fixed and permeabilized for microscopic examination. Cells were incubated for 2 hours in a cold room with primary antibodies targeting PLK1 and CDC25C in 1X intracellular staining buffer. Cells were then stained with a secondary antibody conjugated with Alexa Flour 488 and 594 under RT for 30 minutes, washed, and counterstained with DAPI. Confocal images were captured using a Nikon A1R (Melville, NY, USA).
[0401] Single-cell transcript analysis: Single-cell sequencing was performed using a 10x Genomics kit (Pleasanton, CA, USA) following the manufacturer's instructions. The dataset was analyzed using the Seurat algorithm with the 10x Genomics Cell Ranger series.
[0402] shRNA knockdown: A doxycycline (DOX)-induced PLK1-targeting shRNA construct was generated using the pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro plasmid by Cellecta (Mountain View, CA, USA). A luciferase negative control was generated as previously described (PMID: 21189262). Briefly, 293T cells were co-transfected with a mixture of lentiviral packaging plasmids (Celecta, catalog number CPCP-K2A) and the pRSITEP-shRNA construct. Viral particles were collected 48 hours post-transfection and concentrated 10-fold using an Amicon Ultra-15 centrifuge filter. At infection, cells were incubated overnight with the concentrated viral supernatant in the presence of 8 μg / ml polybrene. Cells were then washed to remove the polybrene. Cells were screened with puromycin (1 μg / ml) for at least 3 weeks prior to infection, 48 hours after infection. The target sequences for shRNA were: PLK1 shRNA1: GTTCTTTACTTCTGGCTATAT (SEQ ID NO:7); PLK1 shRNA2: CTGCACCGAAACCGAGTTATT (SEQ ID NO:8).
[0403] result.
[0404] PLK1 upregulation is associated with high disease risk and relapse in MM patients. PLK1 expression was analyzed in newly diagnosed (MMRF) and relapsed / refractory (MM010) datasets. Changes in survival were plotted by progression-free survival and overall survival. In both datasets, higher PLK1 expression was associated with significantly lower progression-free survival and overall survival. Figures 1A-1D Further evaluation of PLK1 expression in various clusters of the Myeloma Genome Project (MGP) revealed that PLK1 expression was most upregulated in high-risk clusters (data not shown). PLK1 expression in CD138+ cell samples from 12 pairs of MM patients, obtained before lenalidomide treatment initiation and after the development of resistance, was analyzed by RNA-seq. PLK1 expression was significantly upregulated in relapsed patients (FDR < 0.00001). Figure 1E Each of the 12 relapsed patients showed upregulated PLK1 levels at the time of relapse. Analysis of PLK1 expression patterns at various stages of MM disease progression and relapse in the Mayo Clinic gene expression dataset showed a significant increase in PLK1 expression in the relapsed patient cohort, with a trend towards further increase after disease progression. Figure 1F ).
[0405] In sensitive cells, PLK1 signaling is downregulated in response to antiproliferative compounds. The effects of pomalidomide on isogenetic sensitive (EJM) and resistant (EJM-PR) cell lines, as well as the MM1.S cell line, were analyzed. Based on changes in proliferation, the MM1.S cell line showed the highest sensitivity to pomalidomide, while EJM-PR exhibited the strongest resistance. To determine the role of PLK1 in the pomalidomide response, EJM and EJM-PR cell lines were treated with pomalidomide, and changes in PLK1 levels and downstream signaling were analyzed. Only in sensitive cells did pomalidomide treatment induce a dose-dependent decrease in PLK1 levels and its downstream effectors pCDC25C and CDC25C. Figure 2A and Figure 2B Expression of the CDC25C gene was significantly correlated with PLK1 expression in MGPs. In response to pomalidomide, cerebellar protein substrates Ikaros and Aiolos were also downregulated in pomalidomide-sensitive cells. Antiproliferative agents (such as compound 5) have been shown to be more effective in mediating substrate degradation. MMS.1 cells treated with escalating concentrations of pomalidomide and compound 5 showed dose-dependent reductions in PLK1 signaling by both inhibitors. Figure 2C Consistent with the difference in activity between the two inhibitors, compound 5 exhibited reduced PLK1 levels and downstream signaling at a dose ten-fold lower than that of pomalidomide. Compared to EJM cells, the MMS.1 cell line showed a more pronounced reduction in PLK1 levels at matched doses of pomalidomide, which is related to the difference in sensitivity of the two cell lines to pomalidomide. In MM1.S cells, changes in PLK1 transcript levels in response to pomalidomide treatment were further examined, and treatment reduced PLK1 transcript levels in a dose-dependent manner. Figure 2D Confocal microscopy was used to investigate changes in PLK1 and CDC25C staining in MM1.S cells, and it was observed that PLK1 levels decreased in response to pomalidomide and compound 5 treatment, along with a decrease in CDC25C staining. Furthermore, ChIP-PCR analysis revealed that Aiolos and Ikaros bind to the transcription start site (TSS) of PLK1, and this binding was eliminated in response to pomalidomide. Figure 2EFurther analysis of the Aiolos ChIP-seq dataset confirmed that the binding of Aiolos to the TSS of PLK1 has an overlapping transcriptional activation H3K27Ac signature, inferred from the publicly available ChIP-seq dataset (Encode project) of the GM12878 cell line. Since changes in PLK1 levels are due to decreased PLK1 transcription in response to antiproliferative compounds, the effects of Aiolos and Ikaros knockdown on PLK1 levels were analyzed using MM1.S cells inducibly expressing Aiolos and Ikaros shRNA. Both Aiolos and Ikaros knockdown resulted in decreased PLK1 levels. Figure 2F This indicates that the substrate of the cerebellar protein regulates the transcription of PLK1.
[0406] Compound 5 treatment induced a reduction in the G2-M phase of the cell cycle. Since PLK1 plays a crucial role in the G2 and mitotic phases of the cell cycle, the cell cycle changes in response to compound 5 were examined. The results showed that compound 5 treatment resulted in a dose-dependent increase in the sub-G1 population (5.02, 4.98, 11.3, and 13.9 for the mediator, 10 nM compound 5, 30 nM compound 5, and 100 nM compound 5, respectively) and the G0-G1 population (69.2, 75.8, 78.3, and 75.1 for the mediator, 10 nM compound 5, 30 nM compound 5, and 100 nM compound 5, respectively), and a simultaneous dose-dependent decrease in the G2-M population (16.3, 12.3, 6.94, and 6.27 for the mediator, 10 nM compound 5, 30 nM compound 5, and 100 nM compound 5, respectively). Changes in phosphorylated Ser10-histone H3 (a specific marker of G2-M phase) were measured using flow cytometry. Consistent with the overall cell cycle distribution, the level of phosphorylated Ser10-histone H3 also decreased in a dose-dependent manner in response to compound 5 treatment (16.5, 9.3, 6.37, and 4.53 for the mediator, 10 nM compound 5, 30 nM compound 5, and 100 nM compound 5, respectively). To demonstrate that the observed changes in PLK1 signaling were not a result of mitotic exit, changes in PLK1 signaling at various time points after cell treatment with nocodazole and compound 5, as well as their combinations, were analyzed. Nocodazole synchronized cells to the G2-M phase of the cell cycle. At time points of 30 min, 2 h, and 6 h after overnight nocodazole treatment rescue, PLK1 levels were significantly higher compared to the mediator condition. Figure 3Then, PLK1 levels returned to normal due to cell cycle synchronization rescue following nocodazole treatment. Ikaros degradation began 30 minutes after treatment in response to compound 5 treatment, while downregulation of PLK1 and CDC25C levels was significant at 48 hours post-treatment. The decrease in PLK1 levels was accelerated in response to combined treatment with nocodazole and compound 5. Changes in cleaved caspase 3 were negatively correlated with PLK1 levels; cleaved caspase 3 increased while PLK1 levels decreased at 48 and 72 hours post-compound 5 treatment. Cell cycle studies were matched to these time points. Nocodazole treatment showed an increase in G2-M cells at early rescue time points. Compound 5 treatment caused an initial increase in G1 cells, followed by an increase in sub-G1 cells and a decrease in G2-M cells at 48 and 72 hours (data not shown). In the case of combined nocodazole and compound 5 treatment, an accelerated decrease in G2-M cells and a higher increase in sub-G1 cells were observed.
[0407] Pomalidomide-resistant cells exhibited activated PLK1 signaling and increased mitosis. To investigate the role of PLK1 in pomalidomide resistance, the levels of PLK1, CDC25C, and pCDC25C, as well as cerebellar proteins, were analyzed in six pomalidomide-sensitive and pomalidomide-resistant cell line pairs: AMO1 and AMO1-PR (pomalidomide-resistant), H929 and H929-PR, K12PE and K12PE-PR, K12BM and K12BM-PR, EJM and EJM-PR, and MMS.1 and MMS.1PR. These cell lines were developed by exposing them to progressively increasing concentrations of pomalidomide over three to four months. PLK1 levels were moderately upregulated in four of the six resistant cell lines. Figure 4A Compared to parental cells, drug-resistant cell lines also exhibited varying degrees of cerebellar protein level loss. A comparative study of asynchronous cell cycle distribution between parental and drug-resistant cell lines demonstrated an increased proportion of G2-M cells in five of the six drug-resistant cell lines. Figure 4B To further analyze the expression changes of PLK1 at different stages of the cell cycle between sensitive and resistant cell lines, single-cell RNA sequencing was performed on AMO1 and AMO1-PR cell lines. Gene expression clustering analysis based on cell cycle characteristic genes showed that PLK1 expression was significantly restricted during the G2-M phase of the cell cycle, and it was confirmed that PLK1 expression was upregulated in AMO1-PR cells compared to the AMO1-parental line (data not shown). Aiolos and Ikaros were found to be more prevalently expressed at different stages of the cell cycle (data not shown).
[0408] The combination of the PLK1 inhibitor and compound 5 exhibited stronger activity in AMO1-PR cells than in the AMO-1 parent. The activity of the PLK1 inhibitor BI2536 and compound 5 as single agents and in combination was tested in the AMO1 parent and AMO1-PR cell lines. The combination of BI2536 and compound 5 showed a dose-dependent decrease in proliferation. Figure 5A , Figure 5C Synergistic effects analysis using Calcusyn software showed that the combined treatments had a synergistic effect at several concentrations of BI2536 and compound 5. Figure 5B , Figure 5D In response to BI2536, AMO1-PR cells exhibited a more significant reduction in proliferation, and at several concentrations in these cells, BI2536 was synergistic with compound 5. These results indicate that AMO1-PR cells are more dependent on PLK1 signaling. Another pomalidomide-sensitive and resistant cell line showed similar synergistic activity against the combination of BI2536 and compound 5 in K12PE and K12PE-PR. Figure 5E , Figure 5F , Figure 5G , Figure 5H Changes in apoptosis were analyzed using annexin V and Topro staining with single-agent treatments and combinations thereof. Compared with the mediator, single-agent treatment with BI2536 resulted in a modest increase in early apoptosis (10.9% vs. 2.69%) and late apoptosis (4.25% vs. 2.24%) in AMO-1 cells. Figure 5I Compared to the mediator, treatment with compound 5 showed a slight increase in early apoptosis (4.86% vs. 2.69%) and little effect on late apoptosis (3.07% vs. 2.24%). The combination treatment with BI2536 and compound 5 showed a more significant increase in both early (22.7% vs. 2.69%) and late (7.09% vs. 2.24%) apoptosis compared to the mediator. In the case of AMO1-PR cells, BI2536 alone was more effective than in AMO-1 parental cells, with more significant early (23.2% vs. 3.82%) and late (7.55% vs. 2.77%) changes compared to the mediator. Similarly, in these cells, the combination of BI2536 and compound 5 showed higher early (33.3% vs. 3.82%) and late (11.8% vs. 2.77%) apoptosis rates compared to the mediator. Figure 5JThe synergistic mechanism of BI2536 and compound 5 treatment was investigated by studying changes in cell cycle and mitotic fidelity. In AMO1 cells, BI2536 treatment induced a moderate increase in the G2-M and polyploid populations, consistent with the reported mechanism of action of the inhibitor. Compound 5 caused a moderate increase in G0-G1 cells and a decrease in G2-M cells. Compared with single-agent treatment, the combination treatment showed an increase in sub-G1 cells, consistent with changes in apoptosis. In the case of AMO1-PR cells, BI2536 caused a more significant increase in G2-M, polyploid, and sub-G1 cells compared with AMO1 parental cells. The combination of BI2536 and compound 5 showed a higher increase in sub-G1 cells compared with single treatment. Changes in Ikaros and pro-survival signaling in response to BI2536 and compound 5 were analyzed in these cell lines at 24 and 72 hours after treatment. Figure 5K In both AMO1 and AMO-1PR cells, Ikaros levels decreased in response to compound 5. The combination of BI2536 and compound 5 resulted in a greater decrease in Ikaros levels at 24 hours. Consequently, in the AMO1 and AMO1-PR cell lines, the increase in lysed caspase 3 levels was more significant at 72 hours following combination treatment. At 24 hours, compared with the use of single agents, the combination of BI2536 and compound 5 showed a greater decrease in pro-survival signaling markers, survival proteins, and Bcl2, which may lead to subsequent enhanced apoptosis, as seen in the lysed caspase 3 levels. Expression of survival protein genes was significantly correlated with PLK1 expression. Furthermore, confocal imaging performed to investigate changes in DAPI staining response to these treatments in AMO1 and AMO1PR cells indicated higher mitotic errors in these cell lines with BI2536 and the combination of BI2536 and compound 5 (data not shown).
[0409] Synergistic cytotoxicity of BI2536 in combination with compound 5 in refractory cells. Since PLK1 is expressed at higher rates in the high-risk population of MGP, the activity of the PLK1 inhibitor combined with compound 5 was analyzed in the refractory cell line Mc-CAR. In Mc-CAR cells, the combination of BI2536 and compound 5 at different concentrations exhibited a synergistic reduction in cell proliferation (…). Figure 6A , Figure 6B Compared to individual treatments, combined treatment resulted in a more significant reduction in Aiolos and Ikaros levels. Figure 6C ), and the subsequent increase in the stagnation of G1 (data not shown).
[0410] PLK1 knockdown decreased proliferation and increased apoptosis in AMO1 and AMO1-PR cells. To further determine the role of PLK1 in drug resistance, inducible PLK1 knockdown was performed in the AMO1 and AMO1-PR cell lines. Two inducible PLK1 shRNAs exhibited potent PLK1 protein knockdown in the AMO1 and AMO1-PR cell lines, and significantly reduced cell proliferation at 48 and 72 hours post-knockdown compared to the control shRNA. In both cell lines, knockdown induced G2-M arrest and an increase in the sub-G1 population at 48 and 72 hours. Apoptosis analysis further confirmed increased apoptosis in the AMO1 and AMO1-PR cell lines due to PLK1 shRNA knockdown, with the AMO1-PR cell line exhibiting significantly higher overall apoptosis.
[0411] Targeting PLK1 in the dysregulation segment of P53. To further identify clinically actionable segments for PLK1 targeting in MM patients, PLK1 expression in the biallelic P53 segment was analyzed, as PLK1 regulates P53 stability. In MGP, patients carrying the biallelic P53 segment showed significantly elevated PLK1 expression ( Figure 7A This indicates an antagonistic relationship between the two proteins. Furthermore, compared to wild-type P53 AMO1 cells, the PLK1 inhibitor BI2536 showed higher activity in the biallelic P53 cell line K12PE. Figure 7B This demonstrates the potential to target the dysfunctional P53 segment.
[0412] Example 2: BET inhibition reduces cell proliferation in multiple myeloma cell lines
[0413] method.
[0414] Patients and Datasets. The Myeloma Genome Project (MGP) is a collaborative research initiative aimed at compiling and unifying the analysis of genetic datasets generated from samples obtained from MM patients. Next-generation sequencing (NGS) data from NDMM patients in the MGP dataset were processed and analyzed in the unified manner described above. Patients with a complete dataset (n=514) from the complete MGP dataset (N=1273) were used for this analysis. The MGP dataset includes whole-exome and genome sequencing (WES and WGS), RNA sequencing (RNAseq), progression-free survival (PFS), and overall survival (OS). Differences between study design, data collection, and sequencing methodologies resulted in inconsistencies in the availability of all data features from all patients in the MGP dataset.
[0415] Cell lines: All MM cell lines (ATCC, Manassas, Virginia, USA) were routinely tested for mycoplasma and maintained as previously described in Example 1.
[0416] Antibodies: Several antibodies were used in these experiments for immunoblotting, including Aiolos (catalog number 15103), Ikaros (catalog number 14859), BRD4 (catalog number 13440), c-Myc (catalog number 5605), lysed caspase 3 (catalog number 9664), survival protein (catalog number 2803), GAPDH (catalog number 14C10) (all from Cell Signaling Technologies, Inc. (Danfoss, Massachusetts, USA)), E2F2 (catalog number Ab-138515, Abogen Laboratories, Inc., Cambridge, Massachusetts, USA), CKS1B (catalog number 36-6800, Ingenium Laboratories, Inc., Waltham, Massachusetts, USA), PRKDC (catalog number 4602, Cell Signaling, Inc., Danfoss, Massachusetts, USA), and NUP93 (catalog number A303-979A, Bethyl Laboratories, Inc. ... The following are listed as laboratories: Montgomery, TX, USA; RUSC1 (Catalog No. NBP1-81006, Novus, St. Charles, Missouri, USA); RBL1 (Catalog No. TA811337, Rockville, MD, USA); NUF2 (Catalog No. NBP2-43779, Novus, St. Charles, Missouri, USA); TOP2A (Catalog No. PA5-46814, Ingenie, Waltham, Massachusetts, USA); KI67-FITC (Catalog No. NBP2-2211F, Novus, St. Charles, Missouri, USA); and cleaved caspase 3-AF488 (Catalog No. IC835G, Minneapolis, MN, USA).
[0417] Proliferation and viability assays: Cell growth curves were determined by monitoring cell viability using trypan blue exclusion on a Vi-Cell-XR (Becton Dickinson, Franklin Lakes, NJ, USA). Proliferation assays were performed using (3H)-thymidine incorporation, in triplicate, at least three times (n=3). All data were plotted and analyzed using GraphPad Prism 7 (GraphPad Software, La Jolla, CA, USA) software, and are expressed as mean with error defined as ± sd.
[0418] Immunoblotting: Immunoblotting analysis was performed according to the recommendations of the WES kit (Protein Simple, San Jose, California, USA), with each sample analyzed at least twice (n≥2) to show the best representativeness.
[0419] RNA extraction, reverse transcription, and real-time PCR analysis: Total RNA was extracted using the RNeasy plus kit (Qiagen, Germantown, MD, USA) and reverse transcribed using the iScrip reverse transcription kit (Bio-Rad Laboratories, Philadelphia, PA, USA). Quantitative real-time PCR (qPCR) analysis was performed using a Taqman PCR Master Mix and a ViiA 7 real-time PCR system (Applied Biosystems, Foster City, CA, USA). Gene expression was calculated after normalization to GAPDH levels using the comparative CT method (ΔΔCT method). The primer sequences for qPCR are listed in the table below.
[0420] List of primers and their sequences for MR and target genes used in transcriptomic studies
[0421]
[0422] ChIP-seq studies: ChIP-sequencing experiments were performed in DF15, MM1.S, and AMO1 cell lines using standard methods.
[0423] Flow cytometry: Following the manufacturer's protocols, at least three independent experiments were performed using Annexin V Alexa Fluor 488-conjugated antibody (Thermo Fisher Scientific, Waltham, MATLAB, USA) and To-Pro-3 (Thermo Fisher Scientific, Waltham, MATLAB, USA) and processed using Flow Jo software. For cell cycle analysis, cells were stained with a PI staining kit (Epclusa, Cambridge, MATLAB, USA) and analyzed using Flow Jo V10 software.
[0424] Confocal imaging: Cells were cultured in chamber slides and fixed and permeabilized for microscopic examination. Cells were incubated for 2 hours in a cold room with primary antibodies targeting CKS1B, E2F2, and KI67-FITC in 1X intracellular staining buffer. Cells were then stained with Alexa Flour 488 and 594 conjugated secondary antibodies at RT for 30 minutes for CKS1B and E2F2, washed, and counterstained with DAPI. Confocal images were captured using a Nikon A1R (Melville, New York, USA).
[0425] shRNA knockdown: Doxycycline (DOX)-induced shRNA constructs targeting CKS1B, E2F2, and BRD4 were generated using the pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro plasmid from Cellecta (Mountain View, California, USA). A luciferase negative control was generated as previously described (PMID: 21189262). Briefly, 293T cells were co-transfected with a mixture of lentiviral packaging plasmids (Celecta, catalog number CPCP-K2A) and the pRSITEP-shRNA construct. Viral particles were collected 48 hours post-transfection and concentrated 10-fold using an Amicon Ultra-15 centrifuge filter. At infection, cells were incubated overnight with the concentrated viral supernatant in the presence of 8 μg / ml polybrene. Cells were then washed to remove the polybrene. Cells were screened with puromycin (1 μg / ml) at 48 hours post-infection, prior to experiments, for at least 3 weeks. The shRNA target sequences are: CKS1B shRNA1: 5'GACCCACAGCCTAAGCTGAGT 3' (SEQ ID NO: 53); E2F2 shRNA2: 5'GTACGGGTGAGGAGTGGATAA 3' (SEQ ID NO: 54), BRD4 shRNA1: 5'GACGTGGGAGGAAAGAAACAG 3' (SEQ ID NO: 55), BRD4 shRNA2: 5'GTGCTCGACGTCCGATTGATGT 3' (SEQ ID NO:56), BRD4 shRNA3: 5'CGCAAGCTCCAGGATGTGTTC 3' (SEQ ID NO:57), BRD4 shRNA4: 5'GCTCCTCTGACAGCGAAGACT 3' (SEQ ID NO:58).
[0426] result.
[0427] Expression of MRs in MDMS8-like cells. Identification of MRs provides an opportunity to explore their role in the biology of high-risk MM. A group of myeloma cell lines were enriched based on MDMS8 gene signatures to infer activation of that signature in the samples. This approach identified various cell lines significantly associated with the GE phenotype of MDMS8. An MDMS8-like cell line (DF15PR) and a non-MDMS8-like cell line (MM1.S) were selected as controls for further functional experiments. qRT-PCR and Western blot experiments showed that in the MDMS8-like cell lines, two MRs (E2F2 and CKS1B) and downstream genes (including TOP2A and NUF2) were upregulated at both protein and transcript expression levels compared to the control cell lines. Figure 8Aand Figure 8B CKS1B and E2F2 showed significant correlations with the expression of their target genes NUF2 and TOP2A in MGP (data not shown). MDMS8-like cells proliferated more rapidly, with a mean doubling time of approximately 12.55 ± 0.8 hours, compared to 17.6 ± 2.2 hours for control cell lines (P < 0.05). In asynchronous cell culture, analysis of cell cycle stage distribution between MDMS8-like cell lines and control cell lines showed an increased proportion of S1 (16.9% vs. 8.14%) and G2 / M (23.5% vs. 17%) cells, while the sub-G1 fraction was reduced (1.1% vs. 7.7%), indicating hyperproliferative behavior.
[0428] Single-cell MDMS8 GE phenotype. To further understand the function of the high-risk phenotype and MR, single-cell gene expression analysis was used to explore whether the MDMS8 MR regulator is expressed systemically or in a subset of tumor cells. Transcriptional analysis was performed on control and MDMS8-like cell lines using a 10X single-cell gene expression platform. Asynchronous growth control and MDMS8 cell lines were examined, followed by analysis of the E2F2 and CKS1B regulators, and MDMS8 GE signature activity in each cell. tSNE plots (data not shown) show cells rich in MDMS8 signature, and this analysis confirms that not all cells in MDMS8-like cell lines are positive for this phenotype, suggesting that MR activity is limited to a subset of the entire cell population. Active cells (those with the MDMS8 phenotype) were selected based on empirical thresholds, and a higher subset (>40% vs. <20%, respectively) was observed in MDMS8-like cell lines compared to control cell lines. These findings also suggest that the two MRs, CKS1B and E2F2, are more important in controlling the cell cycle profile of MDMS8-like cells (data not shown).
[0429] The prognostic and functional roles of CKS1B and E2F2. The relationship between CKS1B and E2F2 expression and overall survival (OS) and progression-free survival (PFS) in MGP patients was analyzed, and it was found that higher expression of these two genes was significantly associated with lower OS and PFS. Figure 9A , Figure 9B , Figure 9C and Figure 9D shRNA cell lines were established to study the knockdown of CKS1B and E2F2. Knockdown of CKS1B and E2F2 significantly reduced the proliferation of MDMS8-like cells and increased apoptosis. Figure 9E This indicates the functional role of these two MRs in the viability of these cells.
[0430] Effects of BRD4 inhibitors on CKS1B and E2F2 and their target genes. CKS1B and E2F2 have been listed as super-enhancer (SE)-related genes in MM (Loven, J., et al., Cell, 2013, 153(2): p. 320-34). To pharmacologically target CKS1B and E2F2, the BET inhibitor JQ1 and compound A were used in MDMS8-like and H929 cell lines. Both JQ1 and compound A showed dose- and time-dependent reductions in CKS1B and E2F2 protein levels ( Figure 10A and Figure 10B As an alternative to the active ingredient, protein expression of the target genes NUF2 and TOP2A, respectively, targeting CKS1B and E2F2, was also reduced. BET inhibitors also promoted decreased levels of cerebellar protein substrates, Ikaros, Aiolos, and c-Myc. Furthermore, an increase in p27 levels, a negative regulator of CKS1B signaling, was observed. Immunofluorescence staining was performed to analyze the localization and expression of CKS1B and E2F2 in response to JQ1, and their decreased nuclear expression in MDMS8-like cells was confirmed (data not shown). Since BET inhibitors primarily mediate changes in CKS1B and E2F2 at the transcript level, the transcript levels of CKS1B and E2F2 in response to BET inhibitors were analyzed. In MDMS8-like and H929 cell lines, BET inhibitors promoted decreased levels of CKS1B and E2F2 transcripts (…). Figure 10C , Figure 10D , Figure 10E and Figure 10F In response to the BET inhibitor, the expression of NUF2, TOP2A, Ikaros, and Aiolos was also downregulated at the transcript level (data not shown). To determine SE-mediated regulation of CKS1B and E2F2, CDK7 inhibitors targeting SE-associated complexes in MM cell lines were utilized. The CDK7 inhibitor THZ1 showed a potent reduction in the proliferation of several MM cell lines by downregulating CKS1B, E2F2, Myc, Aiolos, and Ikaros (data not shown).
[0431] BRD4 binding to SE-associated regions on CKS1B and E2F2. BRD4 binding to SE-associated regions on CKS1B and E2F2 was analyzed using BRD4-ChIP-Seq data from AMO1 and MM1.S cell lines. Robust binding of BRD4 to SE-associated regions on CKS1B and E2F2 was observed, and this binding was eliminated in both cell lines in response to JQ1 (data not shown).
[0432] Effects of BRD4 knockdown on CKS1B and E2F2 expression. Doxycycline-induced BRD4 knockdown cell lines were established in the context of K12PE and MDMS8-like cells. In both cell lines, four different BRD4-targeting shRNAs consistently showed reduced levels of CKS1B and E2F2. Figure 11A , Figure 11B BRD4 knockdown also led to decreased levels of Aiolos, Ikaros, and c-Myc, consistent with the findings of BRD4 inhibitors. Changes in cell proliferation, apoptosis, and cell cycle in response to BRD4 knockdown were also analyzed. In K12PE and MDMS8-like cells, all four shRNAs resulted in significantly reduced cell proliferation. Figure 11C , Figure 11D As a result of the knockdown, apoptosis and cell cycle assays showed increased apoptosis and decreased cell proportion in the G2-M phase of the cell cycle, and increased cell proportion in the sub-G1 phase (data not shown).
[0433] BRD4 inhibition in 1q-amplified MM cell lines. CKS1B is located at 1q 21.3, and 1q amplification is a high-risk segment in MM. The BRD4 inhibitory activity of several 1q-amplified cell lines (U266, MM1.S, MDMS8-like, H929, KMS11) was compared with that of non-1q-amplified cell lines (MC-CAR). As shown in the table below, the efficacy of the BRD4 inhibitor in 1q-amplified cell lines was observed to be two to five times that in non-1q-amplified cell lines.
[0434] MM cell line 1q amplification cell lines <![CDATA[JQ1 IC 50 (μM)]]> <![CDATA[Compound A IC 50 (μM)]]> McCAR normal 0.08352 0.09344 U266 3x 0.01482 0.03394 MM1.S 3x 0.01521 0.02815 DF15 / PR 3x 0.03782 0.03589 H929 3-4x 0.05167 0.05407 KMS11 6-8x 0.03618 0.04035
[0435] Effects of pomalidomide (Pom) on CKS1B and E2F2 in Pom-sensitive and Pom-resistant cell lines. CKS1B and E2F2 have been reported to primarily participate in the cell cycle by regulating the p27 and RB-CDK4-CDK6-CCND1 signaling pathways, respectively, while immunomodulatory compounds have demonstrated their cell cycle effects by promoting G1 arrest in MM cell lines. Based on these reports, changes in CKS1B and E2F2 in response to Pom were analyzed in isogenetic Pom-sensitive and Pom-resistant EJM and EJM-PR cell lines, and it was found that both proteins were downregulated at the transcriptional level only in Pom-sensitive cells. Figure 12Since Aiolos was not degraded in the EJM-PR cell line, consistent with the lack of downregulation of CKS1B and E2F2, the binding of Aiolos to the transcription start sites (TSS) of CKS1B and E2F2 was analyzed. ChIP-seq data from the DF15 cell line showed that Aiolos binds to the H3K27Ac activation marker at the TSS of CKS1B and E2F2 (supporting data from the GM12878 cell line of the Encode project), indicating the downstream role of these two proteins in Aiolos (data not shown). The effects of BRD4 inhibitors on four isogenetic Pom-sensitive and resistant cell lines (K12PE, K12PE-PR, AMO1, AMO1-PR, H929, H929-PR, DF15, DF15-PR) were analyzed, showing that these cell lines were equally sensitive to BRD4 inhibitors regardless of their Pom resistance (data not shown).
[0436] Combination activity of BRD4 inhibitors and antiproliferative compounds. Based on the activity of BRD4 inhibitors and Pom against CKS1B, E2F2, and cerebellar protein substrates, changes in proliferation were investigated by combining BRD4 inhibitors with these compounds. JQ1 combined with Len, Pom, compound 5, and compound 6 showed a dose-dependent reduction in proliferation in K12PE cells. Figure 13A , Figure 13C , Figure 13E , Figure 13G Synergistic effects analysis using Calculusyn software showed that the combination therapy had a synergistic effect at several concentrations of JQ1 and Len, Pom, compound 5, and compound 6. Figure 13B , Figure 13D , Figure 13F , Figure 13H This combination can also synergistically reduce the proliferation of the K12PE-PR cell line, which is resistant to Pom. Figures 13I to 13P The changes in signal transduction response to combination therapy with BRD4 inhibitors and Len, Pom, compound 5, and compound 6 were analyzed. Compared with monotherapy, combination therapy with JQ1 and Len, Pom, compound 5, and compound 6 resulted in a greater decrease in Aiolos, Ikaros, CKS1B, E2F2, Myc, and survival protein levels, as well as a greater increase in cleaved caspase 3. Figure 13Q Furthermore, cell cycle and apoptosis assays confirmed that, compared with monotherapy, the combination of BRD4 inhibitors with Len, Pom, compound 5, and compound 6 resulted in a more significant reduction in G2-M and an increase in apoptosis (data not shown).
[0437] Example 3: NEK2 inhibition reduces cell proliferation in multiple myeloma cell lines
[0438] Cell lines. The cell lines used in this study were AMO1, H929, K12PE, and MMIS, purchased from ATCC, USA. The cells were cultured in RPMI 1640 medium supplemented with L-glutamine, sodium pyruvate, fetal bovine serum, penicillin, and streptomycin (all from Ingenium Biotech). Pomalidomide-resistant cell lines AMO1, H929, K12PE, and MMIS were generated as previously described (Bjorklund et al., J Biol Chem. 2011, 286(13):11009-11020).
[0439] NEK2 inhibitors. Two NEK2 inhibitors were used—the irreversible inhibitor JH295 and the reversible inhibitor rac-CCT 250863 (Tocris Bioscience). Both JH295 and rac-CCT 250863 are selective inhibitors of NEK2 and have minimal effects on other kinases, including Cdk1 and Aurora B. In addition, JH295 and rac-CCT 250863 do not affect PLK1, bipolar spindle assembly, or spindle assembly checkpoints. (Henise et al., J Med Chem. 2011, 54(12):4133-4146; Innocenti et al., J Med Chem. 2012, 55(7):3228-3241).
[0440] Antibodies. In this example, antibodies are used for immunoblotting and flow cytometry. The antibodies used are: NEK2 (Santa Cruz Biotechnologies, catalog 55601), Aiolos (Cell Signaling Technologies, catalog 15103), Ikaros (Cell Signaling Technologies, catalog 14859), ZFP91 (internal antibody), and GAPDH (Cell Signaling Technologies, catalog 2118).
[0441] Confocal imaging. Cells were cultured in chamber slides and fixed and permeabilized for microscopic examination. Cells were incubated with NEK2-specific primary antibody in 1X intracellular staining buffer in a cold room for 2 hours. Cells were then stained with AlexaFlour 488-conjugated secondary antibody under RT for 30 minutes, washed, and counterstained with DAPI. Confocal images were captured using a Nikon A1R (Melville, New York, USA).
[0442] Proliferation and viability assays. Cell growth curves were determined by monitoring cell viability using trypan blue exclusion on a Vi-Cell-XR (Becton Dickinson, Franklin Lakes, NJ, USA). Cell lines were seeded in triplicate in 96-well round-bottom plates with the specified drug concentration or by knockdown. Proliferation was assayed in triplicate, at least three times (n=3), using WST-1 tetrazolium salt (Roche Applied Science) reagent according to manufacturer's specifications or by (3H)-thymidine incorporation as previously described (Bjorklund et al., Blood Cancer Journal 5, e354, 2015). All data were plotted and analyzed using GraphPadPrism 7 (GraphPad Software, La Jolla, CA, USA) software and expressed as mean with error determined to be ± sd.
[0443] Immunoblot analysis was performed according to the recommendations of the WES kit (Protein Simple, San Jose, CA, USA), with each analysis performed at least twice (n≥2) to show the best representativeness.
[0444] Flow cytometry. Following the manufacturer's protocols, at least three independent experiments were performed using annexin V Alexa Fluor 488-conjugated antibody (Thermo Fisher Scientific, Waltham, MATLAB, USA) and To-Pro-3 (Thermo Fisher Scientific, Waltham, MATLAB, USA), and processed using Flow Jo software as previously described. For cell cycle analysis, cells were stained with propidium iodide (PI) staining kit (Epclusa, Cambridge, MATLAB, USA) and analyzed using Flow Jo V10 software.
[0445] A two-parameter assay was used to detect cell cycle and apoptosis. Cell viability was measured using annexin V-FITC and propidium iodide according to published protocols (Rieger et al., J Vis Exp. [Video Experiment Journal] 2011, (50): 2597; Léonce et al., Mol Pharmacol. [Molecular Pharmacology] 2001, 60(6): 1383-1391).
[0446] result:
[0447] Upregulation of NEK2 was associated with high-risk disease and relapse in MM patients. A molecular classification of newly diagnosed multiple myeloma (ndMM) was developed, dividing ndMM into 12 distinct molecularly defined disease segments (MDMS 1–12). This meta-analysis identified molecularly defined disease segment 8 (MDMS8) as the high-risk cluster with the worst clinical outcomes. Further analysis of MDMS8 revealed upregulation of several chromosomal instability (CIN) genes. Aberrant expression of a specific CIN gene—NEK2—was found in approximately 10% of the ndMM population. Higher NEK2 expression was significantly associated with lower progression-free survival and overall survival (P = 1.733 e^(-1.5%). -05 and 1.365e -03 ()( Figure 14A , Figure 14B In a lenalidomide-based trial, NEK2 expression was assessed in 12 pairs of samples. RNA seq was used to measure NEK2 expression in treatment-naïve and relapsed samples, and a significant increase in NEK2 expression was found during disease relapse (FDR < 0.0001). Figure 14C As previously reported, increased NEK2 expression is associated with drug resistance and relapse (Zhou et al., Cancer Cell 23(1), p48-62, 2013). To further confirm this, pomalidomide-resistant cell lines MM1S, DF15, and U266 were generated through sustained drug exposure. RNA seq analysis of drug-sensitive and drug-resistant cell lines showed that NEK2 expression was significantly upregulated in the drug-sensitive cell lines compared to the drug-sensitive cell lines. Figure 14D Immunocytochemistry combined with confocal microscopy also showed increased NEK2 expression in the nucleus of drug-resistant myeloma cell lines compared to parental cell lines (data not shown). These findings suggest that increased NEK2 expression is associated with poor prognosis, acquired resistance, and disease relapse.
[0448] To further validate the relationship between elevated NEK2 expression and poor survival, Kaplan-Mayer analysis was performed on additional myeloma datasets: newly diagnosed MMRF and newly diagnosed DFCI, and the relapsed / refractory MM0010 dataset. In the newly diagnosed MMRF and relapsed / refractory MM0010 datasets, elevated NEK2 expression was associated with poor progression-free survival (PFS). Figure 15A and Figure 15E The p-values in ND MMRF and MM0010 were <6.4e, respectively. -06 and 0.0027) and OS ( Figure 15B and Figure 15FThe correlation was significant in ND MMRF and MM0010 (P values < 0.0058 and 0.00033, respectively). Elevated NEK2 expression also indicated poor PFS and OS in the DFCI dataset, but this was not statistically significant. Figure 15C and Figure 15D ).
[0449] NEK2 inhibition reduces cell proliferation in multiple myeloma (MM) cell lines. To test the functional role of NEK in myeloma biology, the effect of NEK2 chemoinhibition on MM cell proliferation was analyzed in the presence of the irreversible inhibitor JH295 (Henise et al., J Med Chem. 2011, 54(12):4133-4146) and the reversible inhibitor Rac-CCT250863 (Innocenti et al., J Med Chem. 2012, 55(7):3228-3241). NEK2 inhibition was observed to have a strong anti-proliferative effect on multiple myeloma cell lines (H929, AMO1, K12PE, and MC-CAR). On day 3 post-treatment, the IC50 of JH295 was significantly higher than that of H929, AMO1, K12PE, and MC-CAR cell lines. 50 The concentrations were 0.37 μM, 0.48 μM, 4 μM, and 0.56 μM, respectively. On day 3 post-treatment, the IC50 of Rac-CCT 250863 was [value missing] for H929, AMO1, and K12PE cell lines. 50 The concentrations were 8.0 μM, 7.1 μM, and 8.7 μM, respectively.
[0450] NEK2 inhibitors reduced the proliferation of pomalidomide-sensitive and pomalidomide-resistant cell lines. Higher NEK2 expression was found to be associated with acquired resistance. Figure 14D The effect of NEK2 inhibition in pomalidomide-sensitive and resistant (PR) cell lines (H929, H929-PR, AMO1, AMO1-PR, K12PE, and K12PE-PR) was assessed by treating three isogenetic pomalidomide-sensitive and resistant (PR) cell lines (H929, H929-PR, AMO1, AMO1-PR, K12PE, and K12PE-PR) with gradually increasing concentrations of JH295 and Rac-CCT250863 inhibitors. The effects of JH295 and Rac-CCT250863 inhibitors on proliferation were analyzed. Both NEK2 inhibitors reduced the proliferation of both pomalidomide-sensitive and resistant cell lines. For the H929, H929-PR, AMO1, AMO1-PR, K12PE, and K12PE-PR cell lines, the IC50 of JH295 was significantly higher than that of PR. 50The concentrations were 0.37 μM, 0.27 μM, 0.48 μM, 0.31 μM, 4.00 μM, and 10.8 μM, respectively. For H929, H929-PR, AMO1, AMO1-PR, K12PE, and K12PE-PR cell lines, the IC50 of Rac-CCT 250863 was... 50 The concentrations were 7.90 μM, 5.20 μM, 7.00 μM, 3.60 μM, 8.50 μM, and 5.17 μM, respectively. In pomalidomide-resistant cell lines, JH295 was more effective than Rac-CCT 250863, and JH295 more effectively reduced the proliferation of H929-PR and AMO1-PR cell lines (compared to their parental counterparts). This indicates that resistant lines are more vulnerable to NEK2 inhibition. Compared to H929 and AMO1 cell lines, H929 PR and AMO1 PR showed lower IC50 values for NEK2 inhibitors. 50 The values indicate that the sensitivity to NEK2 inhibitors is increased in drug-resistant cell lines, suggesting an increased dependence of drug-resistant cell lines on NEK2 expression.
[0451] NEK2 knockdown reduces cell proliferation in both drug-sensitive and drug-resistant MM cell lines. To investigate the effect of NEK2 knockdown on MM cell proliferation, tetracycline-induced NEK2 shRNA cell lines were established through puromycin selection over a two- to three-week period. Following doxycycline induction, significant NEK2 knockdown was observed in three NEK2 shRNA cell lines in DF15 and DF15-PR backgrounds, resulting in significantly reduced cell proliferation in both DF15 and DF15-PR cell lines (data not shown). NEK2 shRNA cell lines were also created in AMO1 and AMO1-PR backgrounds, and robust downregulation of NEK2 protein was observed after induction in both lines (data not shown). In both AMO1 and AMO1-PR cell lines, NEK2 knockdown resulted in reduced proliferation (data not shown). These results indicate that NEK2 knockdown reduces the proliferation of both drug-sensitive and drug-resistant cell lines.
[0452] NEK2 inhibition exhibited a strong synergistic effect with anti-proliferative compounds. Combination experiments were conducted using JH295 and Rac-CCT 250863 inhibitors with compounds 5 and 6. Five concentrations (0.016, 0.08, 0.4, 2, and 10 μM) of JH295 and Rac-CCT 250863 were combined with progressively increasing concentrations of compounds 5 and 6, and the combined activity was investigated in AMO1 and AMO1-PR cell lines. In both cell lines, the combination of JH295 and Rac-CCT 250863 with compounds 5 and 6 resulted in a concentration-dependent decrease in proliferation (…). Figure 16A , 16C16E, 16G, 16I, 16K, 16M, and 16O. The synergistic effects of these combination datasets were analyzed using the Calculusyn method, and a strong synergistic effect was found between the NEK2 inhibitors (JH295 and rac-CCT250863) and compounds 5 and 6. Figure 16B , 16D (16F, 16H, 16J, 16L, 16N, and 16P). Further analysis showed that the combination of NEK2 inhibitors with compounds 5 and 6 was more effective against resistant cell lines. Several stronger synergistic concentrations of NEK2i+ compounds 5 and 6 were observed in the AMO-PR cell line compared to the AMO1 line. Similar experiments were repeated with the MMS.1, K12PE, and K12PE-PR cell lines, and a strong synergistic effect between compounds 5 and 6 and the NEK2 inhibitor was observed in the MMS.1, K12PE, and K12PE-PR cell lines (data not shown).
[0453] To further confirm the synergistic effect, shRNA knockdown was combined with treatment with either compound 5 or compound 6. Expression of control and NEK2 shRNA was induced in AMO1 cell lines, followed by exposure to progressively increasing concentrations of compounds 5 and 6. Results were measured by proliferation assays. NEK2 knockdown cells showed greater vulnerability to treatment with compounds 5 and 6. Compared to the control shRNA cell line, the combination of NEK2 knockdown increased the activity of compound 5 by 5-fold (IC5 of compound 5 in control cells was significantly higher). 50 =0.1053 μM IC50 of compound 5 relative to NEK2 knockdown cells 50 =0.01870 μM), the activity of compound 6 increased 10-fold (IC50 of compound 6 in control cells). 50 =0.02965 μM IC50 of compound 6 relative to NEK2 knockdown cells 50 =0.002892μM).
[0454] To further confirm the synergistic effect of NEK2 knockdown in combination with compounds 5 and 6, NEK2 knockdown cells were incubated with the mediator, compounds 5, and 6, and the induction of apoptosis was measured by annexin V staining. A significant increase in apoptotic cells was observed when NEK2 knockdown was combined with either compound 5 or compound 6. Figure 17 Quantitative results showed that, compared with the DMSO control, NEK2 shRNA knockdown combined with compound 5 or compound 6 increased the percentage of apoptotic cells by 2-3 times.
[0455] The effect of NEK2 downregulation on substrate degradation induced by compounds 5 and 6 was investigated. T cells were treated with a combination of pomalidomide, compounds 5 and 6, and different concentrations of the NEK2 inhibitor JH295, and substrate protein expression (Ikaros (IKZF1), Aiolos (IKZF3), and ZFP91) was analyzed by Western blotting. Compared with the DMSO control, single-agent NEK2 inhibitor JH295 had no effect on substrate degradation. Similarly, the combination of pomalidomide, compounds 5 and 6 with JH295 showed no significant effect on substrate degradation. The effect of NEK2 knockdown on pomalidomide-mediated substrate degradation was also investigated. Control and NEK2 shRNA cells were incubated with different concentrations of pomalidomide. Pomalidomide treatment caused Ikaros (IKZF1), Aiolos (IKZF3), and ZFP91 to degrade in a concentration-dependent manner in the control shRNA line. A similar substrate degradation pattern was maintained in NEK2 knockdown cell lines. These experiments demonstrate that NEK2 knockdown does not affect the substrate degradation kinetics of compounds 5, 6, and pomalidomide.
[0456] NEK2 knockdown and its combination preferentially kill cells in the G1 / S phase of the cell cycle. The cell cycle effects of NEK2 knockdown were analyzed. NEK2 activity is preferentially required during the G2 / M phase of the cell cycle (Fry et al., J Cell Sci. 2012, 125(Pt 19):4423-4433), where it participates in centrosome separation (Hayward et al., Cancer Lett. 237:155-166, 2006; O'regan et al., Cell Div. 2007, 2:25) and kinetochore microtubule attachment (RandyWei, Bryan Ngo, Guikai Wu and Wen Hwa Lee: Phosphorylation of the Ndc80 complex protein, HEC1, by Nek2 kinase modulates chromosome alignment and signaling of the spindle assembly checkpoint). [Nek2 kinase phosphorylation of Ndc80 complex protein HEC1 regulates chromosome alignment and signaling of spindle assembly checkpoint] (2011) Molecular Biology of the Cell [Cell Molecular Biology] 22:19, 3584-3594). Cell cycle profiles of control and NEK2 shRNA cells were analyzed using PI staining. Simultaneously, the percentage of apoptotic cells was measured by annexin V staining of the same samples. An increase in apoptotic cells was observed after NEK2 shRNA induction in both drug-sensitive and drug-resistant cell lines. No effect on cell cycle profiles was observed (data not shown). NEK2 knockdown cells circulated throughout the cell cycle, with no cells accumulating in the G2 / M phase. The effect of NEK2 on mitosis was then explored using data from mitocheck (https: / / www.mitocheck.org / ). Comparison of data from PLK1 and NEK2 knockdown experiments in HeLa cells showed that PLK1 knockdown resulted in strong prometaphase arrest, while cells underwent apoptosis after prolonged mitotic arrest, and 100% of cells followed a similar process of mitotic arrest and apoptosis (data not shown). NEK2 knockdown cells remain cyclical throughout the cell cycle and undergo intermittent apoptosis, as evidenced by the sudden induced nuclear fragmentation after several cell cycles. Three distinct phenotypes were observed in NEK2 knockdown cells: Phenotype 1: Aneuploid cells were produced. Phenotype 2: After a normal cell cycle, two daughter cells underwent apoptosis in subsequent cell cycles. Phenotype 3: After a normal cell cycle, only one daughter cell underwent apoptosis in subsequent cell cycles.
[0457] Pomalidomide treatment combined with NEK2 inhibition increased apoptosis. Two-parameter annexin V and propidium iodide (PI) assays were performed to analyze cell cycle and apoptosis in the same sample and to quantify the proportion of cells undergoing apoptosis at each stage of the cell cycle (Rieger et al., J Vis Exp. [Video Experiment Journal] 2011, (50): 2597; Léonce et al., Mol Pharmacol. [Molecular Pharmacology] 2001, 60(6): 1383-1391). Control shRNA and NEK2 shRNA cell lines were treated with pomalidomide, and cell cycle and apoptosis were tracked over two cell cycle durations. At 72 hours, the control shRNA line had approximately 5.04% apoptosis, compared to 21.1% in the NEK2 shRNA cell line. This indicates that pomalidomide induces stronger apoptosis in the NEK2 shRNA cell line compared to the control line. Cell cycle and apoptosis analysis of the same samples showed that most apoptotic cells originated from the G1-S phase of the cell cycle. At 96 hours, approximately 9.5% of cells in the control shRNA line and 24.7% of cells in the NEK2 shRNA line underwent apoptosis, with the majority of apoptotic cells again originating from the G1-S phase. This analysis indicates that antiproliferative compounds such as pomalidomide primarily act on the G1 / S phase of the cell cycle, while NEK2 inhibition acts on the G2 / M phase. The combination of these two agents resulted in apoptosis in 20%-25% of cells per cycle, with the majority of apoptotic cells originating from the G1 / S phase. In summary, the results show that cells treated with NEK2 inhibitors and knocked down do not undergo mitotic arrest, but they accumulate mitotic defects over time and eventually undergo apoptosis from the G1 / S phase due to pomalidomide treatment.
[0458] Example 4
[0459] The methods and experimental data in this example (e.g., proliferation assays, immunoblotting, and flow cytometry of changes in proliferation, signal transduction, and apoptosis) are similar to those for the other targets described in Example 1.
[0460] Trametinib response was correlated with p-ERK-1 / 2 levels in MM cell lines, but not with RAS / RAF mutation status. To analyze the relationship between p-ERK-1 / 2 expression and trametinib activity, proliferation assays were performed in several MM cell lines with high p-ERK-1 / 2 expression (U266, H929, AMO1, MC-CAR, KARPAS-620, KMM-1, KMS-20, MOLP8) and low p-ERK-1 / 2 expression (K12PE, EJM, LP1, DF15, DF15PR, RPMI-8226). These results are shown in the table below. Cell lines with high p-ERK-1 / 2 expression were significantly more sensitive to trametinib compared to cell lines with low p-ERK-1 / 2 expression.
[0461]
[0462]
[0463] Trametinib showed synergistic effects with immunomodulatory compounds, compound 5, and compound 6 in pomalidomide-sensitive and pomalidomide-resistant cells. Proliferation assays were also performed to analyze the combined activity of trametinib with immunomodulatory compounds (Len and Pom) or compound 5 or compound 6 in pomalidomide-sensitive and pomalidomide-resistant AMO1 and AMO1-PR cell lines. Results showed... Figures 18A to 18H These proliferation assays demonstrated the strong synergistic effect of trametinib with immunomodulatory compounds, compound 5, and compound 6.
[0464] Trametinib and compound 6 synergistically reduced ERK, ETV4, and MYC signaling in the AMO1-PR cell line. To establish the mechanistic basis of the synergistic effect between trametinib and compound 6, Western blotting was performed to detect changes in p-ERK, ETV4, AIOLOS, IKAROS, IRF4, IRF5, IRF7, and MYC signaling. Results are as follows: Figure 19 As shown. Compared with monotherapy, the combination of trametinib and compound 6 demonstrated a greater reduction in p-ERK, ETV4, MYC, and IRF4 levels, and an increase in the levels of interferon genes IRF5 and IRF7.
[0465] Trametinib combined with compound 6 increased apoptosis in the AMO1 and AMO1-PR cell lines. The effect of trametinib combined with compound 6 on apoptosis in the AMO1 and AMO1-PR cell lines was further analyzed on days 3 and 5. In both cell lines, compared with monotherapy, trametinib combined with compound 6 increased apoptosis on day 3 (… Figure 20A ) and the 5th day ( Figure 20B It showed higher levels of apoptosis.
[0466] Trametinib in combination with compound 6 reduced G2-M and S phase cells in the AMO1 and AMO1-PR cell lines. To analyze the cell cycle-related mechanisms of the synergistic effect between trametinib and compound 6, cell cycle responses to combination therapy and monotherapy were investigated. Cell cycle results confirmed that on day 3 (… Figure 21A ) and the 5th day ( Figure 21B Compared with monotherapy, combination therapy resulted in a greater reduction in the G2-M and S phases of the cell cycle.
[0467] Example 5
[0468] The methods and experimental data in this example (e.g., proliferation assays, immunoblotting, and flow cytometry of changes in proliferation, signal transduction, and apoptosis) are similar to those for the other targets described in Example 1.
[0469] The BIRC5 inhibitor YM155 reduces the proliferation of both Pom-sensitive and resistant cell lines. MM patients with high BIRC5 expression in the Myeloma Genome Project (data from the Myeloma XI trial, the Dana-Faber Cancer Institute / Intergroupe Francophone du Myelome, and the CoMMpass study of the Multiple Myeloma Research Foundation, all of which have been reported) showed poorer PFS (progression-free survival). Figure 22A ) and OS Figure 22B Treatment of AMO1, AMO1-PR, K12PE, and K12PE-PR cell lines with the BIRC5 inhibitor YM155 demonstrated their affinity for the parental cell line AMO1 (EC1). 50 =1.09nM) and K12PE(EC 50 =1.47nM) compared to AMO1-PR (EC 50 =0.12nM) and K12PE-PR (EC 50 =1.07nM) is more sensitive to BIRC5 inhibitors.
[0470] BIRC5 (survival protein) is downregulated in response to compound 5, leading to late apoptosis. BIRC5 expression was investigated in pomalidomide-sensitive and pomalidomide-resistant cell lines such as MM, and several pomalidomide-resistant cell lines showed increased BIRC5 expression. Figure 23A At 48 and 72 hours, in response to compound 5 treatment, BIRC5 levels decreased, followed by the initiation of apoptosis in the MM1.S cell line. Figure 23B ).
[0471] YM155 synergistically reduced the proliferation of pomalidomide-sensitive and pomalidomide-resistant cell lines with compounds 5 or 6. AMO1 and AMO1-PR cell lines were treated with gradually increasing doses of YM155 with compounds 5 or 6, and proliferation assays were performed. Results showed... Figures 24A to 24H Combinatorial analysis using Calcusyn showed that YM155 exhibited synergistic activity with either compound 5 or compound 6 in both the AMO1 and AMO1-PR cell lines.
[0472] BIRC5 knockdown reduced the proliferation of MM cell lines. A doxycycline-induced BIRC5 knockdown cell line was developed. BIRC5 knockdown reduced the proliferation of AMO1-PR cells. Figure 25A BIRC5 knockdown also downregulated the expression of the high-risk-associated gene FOXM1. Figure 25B ).
[0473] YM155 inhibition of BIRC5 also downregulated FOXM1 and pro-survival signaling. High-risk-associated genes BIRC5 and FOXM1 showed significant co-expression in the myeloma genome project, indicating their co-regulation (…). Figure 26A YM155 inhibition of BIRC5 downregulated FOXM1 expression in AMO1-PR and K12PE-PR cell lines in a dose-dependent manner. Figure 26B ).
[0474] The above embodiments are intended to be exemplary only, and those skilled in the art will recognize or will be able to determine many equivalents of a particular compound, material, and procedure using only conventional experiments. All such equivalents are considered to be within the scope of the invention and are covered by the appended claims.
[0475] Many references have been cited, and their contents are incorporated into this paper in their entirety through citation.
Claims
1. Use of a combination of (S)-3-(4-((4-(morpholinomethyl)benzyl)oxy)-1- oxoisoindolin-2-yl)piperidine-2,6-dione or a pharmaceutically acceptable salt thereof and a second active agent in the manufacture of a medicament for the treatment of multiple myeloma, wherein the second active agent is a PLK1 inhibitor, wherein the PLK1 inhibitor is BI2536.
2. The use of claim 1, wherein the multiple myeloma is relapsed or refractory.
3. The use of claim 1, wherein the multiple myeloma is refractory to lenalidomide.
4. The use of claim 1, wherein the multiple myeloma is newly diagnosed multiple myeloma.
5. The use of claim 1, wherein the multiple myeloma is refractory to pomalidomide.
6. The use of claim 5, wherein the multiple myeloma is refractory to pomalidomide used in combination with a proteasome inhibitor.
7. The use of claim 6, wherein the proteasome inhibitor is selected from bortezomib, carfilzomib, and ixazomib.
8. The use of claim 5, wherein the multiple myeloma is refractory to pomalidomide used in combination with an inflammatory steroid.
9. The use of claim 8, wherein the inflammatory steroid is selected from dexamethasone or prednisone.
10. The use of claim 5, wherein the multiple myeloma is refractory to pomalidomide used in combination with a CD38-directed monoclonal antibody.
11. The use of any one of claims 1 to 10, wherein the medicament is for additional combination with a third active agent.
12. The use of claim 11, wherein the third active agent is a steroid.
Citation Information
Patent Citations
Road vehicle electrical systems
EP0011313A1
Sealing for a door without a sill and with a revolving wing
EP0011336A1
Antiproliferative compounds and methods of use thereof
US10357489B2
Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US5811097A
Blockade of lymphocyte down-regulation associated with CTLA-4 signaling
US5855887A