Knockout kipR gene bacitracin-producing engineered bacteria and preparation method and application thereof

Abstract

The present invention provides a bacitracin-producing engineered bacterium with a knocked-out kipR gene, a preparation method and an application thereof, and uses a genetic engineering method to knock out the kipR gene in the genome of Bacillus licheniformis. kipR Gene, knocked out kipR The recombinant strain after the gene is the Bacitracin-producing engineered bacteria, kipR The nucleotide sequence of the gene is shown in SEQ ID NO. 1. The present invention successfully knocks out the gene encoding the transcriptional regulatory factor KipR in the genome of Bacillus licheniformis by genetic engineering methods. kipR Compared with Bacillus licheniformis DW2, the recombinant strain DW2△ kipR The bacitracin production was increased by more than 16%. The research results of the present invention show that: kipR Gene expression is a very effective method to increase the production of bacitracin.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering and fermentation engineering, and in particular to a bacitracin-producing engineering bacterium with a kipR gene knocked out, and a preparation method and application thereof. Background Art

[0002] Bacillus licheniformis is an internationally recognized industrial microbial strain with biosafety (GRAS). It has the advantages of clear genetic background, strong robustness, and stable traits. Therefore, it is widely used in the fermentation production of biochemical products such as poly-γ-glutamic acid, lichenin, phenylethanol, and bacitracin.

[0003] Bacitracin is a polypeptide antibiotic synthesized by Bacillus subtilis and Bacillus licheniformis. It can strongly inhibit the growth of Gram-positive bacteria and some Gram-negative bacteria, and has a synergistic enhancement effect when used in combination with other antibiotics. Therefore, it is widely used in feed additives and veterinary medicine industries. The structure of bacitracin includes 11 amino acids: ornithine (Orn), D-phenylalanine (D-Phe), histidine (His), D-aspartic acid (D-Asp), asparagine (Asn), lysine (Lys), D-glutamic acid (D-Glu), cysteine ​​(Cys), leucine (Leu), isoleucine (Ile) and valine (Val). In recent years, strategies for high production of bacitracin have mainly focused on increasing the supply level of bacitracin precursor amino acids, while there are few reports on increasing bacitracin production by modifying transcriptional regulatory factors.

[0004] There are many genes encoding transcriptional regulatory factors in the genome of Bacillus licheniformis, most of which are closely related to the synthesis of metabolites. However, there are few studies on transcription factors that affect the synthesis of bacitracin. How to obtain engineered bacteria with high production of bacitracin through genetic engineering also needs to be further explored. kipR The only report on KipR is that it belongs to an IclR family transcriptional regulatory protein. However, the regulatory mechanism between KipR and the IclR family has not been reported. In addition, the IclR family is involved in regulating a variety of cellular physiological processes in Gram-positive and Gram-negative bacteria. There are currently no reports on the effects of the IclR family on bacitracin synthesis, so it is impossible to infer the relationship between KipR and bacitracin synthesis. Summary of the invention

[0005] One of the purposes of the present invention is to provide a method for preparing a bacitracin-producing engineered bacterium by knocking out the kipR gene, wherein the prepared bacitracin-producing engineered bacterium has a stronger ability to produce bacitracin by fermentation.

[0006] A knockout kipRA method for preparing a bacitracin-producing engineered bacterium by gene engineering, wherein a gene in the genome of Bacillus licheniformis is deleted by genetic engineering kipR Gene, knocked out kipR The recombinant strain after the gene (i.e. the Bacitracin-producing engineered bacteria) kipR The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] The present invention successfully knocks out the coding gene of the transcriptional regulatory factor KipR in the genome of Bacillus licheniformis by genetic engineering methods. kipR gene, providing a new strategy for increasing bacitracin production.

[0008] Preferably, the Bacillus licheniformis is Bacillus licheniformis DW2, which was deposited in the China Center for Type Culture Collection in Wuhan on October 12, 2011, with a deposit number of CCTCC NO: M2011344. Bacillus licheniformis DW2 is an existing strain with high bacitracin production. Using this as the starting strain, the recombinant strain has a higher bacitracin production.

[0009] Preferably, the method of using genetic engineering to knock out the kipR Gene, including the following steps:

[0010] (1) Using the genome of Bacillus licheniformis as a template, PCR was used to amplify kipR The upstream and downstream homology arms of the gene;

[0011] (2) Using overlap extension PCR, the upstream homology arm and the downstream homology arm of step (1) are connected together to obtain a fusion fragment;

[0012] (3) Use restriction endonucleases BamH I and Xba I double-digests the fusion fragment obtained in step (2) to obtain a digested fusion fragment A; and BamH I and Xba I. Perform double restriction digestion on plasmid T2(2)-ori to obtain linear plasmid fragments after restriction digestion;

[0013] (4) The enzyme-cut fusion fragment A obtained in step (3) and the linear plasmid fragment were connected by T4-DNA ligase, and the enzyme-linked product was transformed into Escherichia coli DH5α by calcium chloride transformation method, and kanamycin was used as a resistance screening marker. After colony PCR, positive transformants were obtained, and sequencing was performed to obtain kipR Gene knockout plasmid T2(2)-ori- kipR ;

[0014] (5) T2(2)-ori- kipR The cells were transferred into Bacillus licheniformis DW2, and positive transformants were obtained by kanamycin resistance screening;

[0015] (6) The positive transformants verified by colony PCR in step (5) were cultured several times and tested by colony PCR to screen for kipR The upstream arm of the gene or kipR The downstream arm of the gene produced a single crossover-positive single crossover conjugant strain with the genomic DNA of Bacillus licheniformis DW2;

[0016] (7) The positive single exchange conjugate strain obtained in step (6) was cultured several times and screened by PCR to obtain the knockout kipR The gene of Bacillus licheniformis was named: DW2△ kipR .

[0017] The second object of the present invention is to provide a Bacitracin-producing engineered bacterium with a knockout kipR gene, which is a knockout bacterium of one of the objects of the present invention. kipR The recombinant strain is constructed by a method for preparing bacitracin-producing engineered bacteria using genes.

[0018] The third object of the present invention is to provide the use of the bacitracin-producing engineered bacteria described in the second object of the present invention in bacitracin production, including seed culture and fermentation culture.

[0019] In the above application, the seed culture medium used for the seed culture is: 5-13 g / L peptone, 2-7 g / L yeast extract, 5-15 g / L sodium chloride, pH 6.5-7.5.

[0020] In the above application, the fermentation medium used in the fermentation culture is formulated as 60-100 g / L soybean meal; 30-50 g / L corn starch; 4-8 g / L calcium carbonate and 0.5-2 g / L ammonium sulfate.

[0021] Compared with the prior art, the present invention has the following technical effects:

[0022] The present invention firstly knocks out the kipR Compared with Bacillus licheniformis DW2, the recombinant strain DW2△ kipR The bacitracin production was increased by more than 16%. The research results of the present invention show that: kipR Gene expression is a very effective method to increase the production of bacitracin. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is obtained in step (1) kipR Gene upstream homology arms and kipR Agarose gel electrophoresis of the downstream homology arms of the gene; lane M is the DNA marker, lane 1 is kipR The upstream homology arm of the gene, lane 2 is kipR downstream homology arms of the gene;

[0024] Figure 2 is an agarose gel electrophoresis diagram of the fusion fragment obtained in step (2); wherein lane M is a DNA marker and lane 1 is a fusion fragment;

[0025] Figure 3 The knockout vector T2(2)-ori- kipR Colony PCR verification diagram; Lane M is a DNA marker, and Lane 1 is a knockout vector T2(2)-ori- kipR Bands for colony PCR verification;

[0026] Figure 4 A colony PCR verification diagram for the positive transformant strain obtained in step (5), wherein lane M is a DNA marker and lane 1 is a verification band of the positive transformant strain;

[0027] Figure 5 The knockout obtained in step (7) kipR Bacillus licheniformis DW2△ kipR The verification bands, where lane M is a DNA marker and lane 1 is a Bacillus licheniformis DW2△ kipR Verification strips;

[0028] Among them, the molecular weights corresponding to the bands from top to bottom in the above DNA marker lane are: 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750bp, 500 bp, 250 bp, and 100 bp. DETAILED DESCRIPTION

[0029] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. The technical solutions described in the present invention are conventional solutions in the art unless otherwise specified; the reagents or materials described are all from commercial sources unless otherwise specified.

[0030] Embodiment 1:

[0031] A knockout kipRA method for preparing a bacitracin-producing engineered bacterium by gene engineering, wherein a gene in the genome of Bacillus licheniformis is deleted by genetic engineering kipR Gene, knocked out kipR The recombinant strain after the gene kipR The nucleotide sequence of the gene is shown in SEQ ID NO.1. The Bacillus licheniformis is Bacillus licheniformis DW2, which was deposited in the China Center for Type Culture Collection in Wuhan on October 12, 2011, with a deposit number of CCTCC NO:M2011344. kipR The specific steps of the gene are as follows:

[0032] (1) Based on the DNA sequence of the genome of Bacillus licheniformis DW2 kipR Genetic sequencing, design kipR The upstream homology arm primers (kipR-F1, kipR-R1) and downstream homology arm primers (kipR-F2, kipR-R2) of the gene were used as templates, and the genomic DNA of Bacillus licheniformis DW2 was used as templates. kipR The upstream homology arm primer and the downstream homology arm primer of the gene were used for PCR amplification to obtain kipR The upstream homology arm fragment of the gene and kipR The downstream homology arm fragment of the gene (such as Figure 1 As shown, kipR The upstream homology arm fragment of the gene is 582 bp. kipR The downstream homology arm fragment of the gene is 585 bp);

[0033] Among them, the sequences of kipR-F1, kipR-R1, kipR-F2, and kipR-R2 are:

[0034] kipR-F1:CGGGATCCTGGCGATGGCTTAGGCTT

[0035] kipR-R1: CAAATAAGGAAGACGGTCACAGATTGAGCAGGGTCA

[0036] kipR-F2:TGACCCTGCTCAATCTGTGACCGTCTTCCTTATTTG

[0037] kipR-R2:GCTCTAGA GACGGAAAAGGGTTGTAT

[0038] (2) kipR The upstream homology arm fragment of the gene and kipRThe downstream homology arm fragment of the gene was used as a template, the upstream homology arm primer kipR-F1 and the downstream homology arm primer kipR-R2 were used as primers, and overlap extension PCR was used to kipR The upstream homology arms of the gene and kipR The downstream homology arms of the gene are connected together to obtain a fusion fragment (such as Figure 2 As shown, the fusion fragment is 1167 bp);

[0039] (3) Adoption Xba I and Bam The fusion fragment in step (2) is double-digested with HI restriction endonuclease to obtain a digested fusion fragment;

[0040] (4) Prepare plasmid T2(2)-ori (wherein, the construction method of plasmid T2(2)-ori is as follows: 194-ori from pE194 plasmid, kanamycin resistance gene from pDG780 plasmid, and pUC-ori from plasmid pBluescript II SK(+)-X52328 are amplified by PCR reaction, recovered, and digested. 194-ori, kanamycin resistance gene, and pUC-ori are connected in the order. This construction method refers to the following literature: Guo Xinghua, Xiong Zhan, et al. (1991). Construction of Bacillus subtilis-Escherichia coli multifunctional shuttle vector [J]. Journal of Biotechnology. 7(3): 224-229 and Peng Qingzhong, Zhang Weicai, et al. (2002). Construction of Bacillus pumilus-Escherichia coli shuttle secretion expression vector [J]. Journal of Biotechnology. 18(4): 438-441), and use Xba I and Bam HI restriction endonuclease double digested the plasmid T2(2)-ori to obtain a linear plasmid fragment (4250 bp); wherein the restriction endonuclease Xba I and Bam HI restriction endonucleases were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0041] (5) The gene fragment cut in step (3) and the linear plasmid fragment in step (4) were connected by T4 DNA ligase to obtain a connection product; the connection product was transformed into Escherichia coli DH5α by calcium chloride transformation method, and screened in a medium containing kanamycin resistance at 37°C to obtain transformants, and the transformants were verified by colony PCR using primers T2-F and T2-R (the primers used were: T2-F and T2-R). The PCR verification result of the transformant was: an electrophoresis band appeared at 1455 bp (such as Figure 3 As shown in the figure, it means that the knockout vector was successfully constructed and named as knockout vector T2(2)-ori- kipR ;

[0042] Among them, the sequences of T2-F and T2-R are:

[0043] T2-F: ATGTGATAACTCGGCGTA,

[0044] T2-R: GCAAGCAGCAGATTACGC;

[0045] (6) Insert the knockout vector T2(2)-ori- kipR The strain was transformed into Bacillus licheniformis DW2 by electroporation and screened in a medium containing kanamycin resistance at 37°C. The transformants obtained by screening were verified by colony PCR using primers T2-F and T2-R. If the PCR verification result of the transformant is: an electrophoretic band appears at 1455 bp, it proves that the knockout vector T2(2)-ori- kipR It was successfully transformed into Bacillus licheniformis DW2, and the transformant was a positive transformant;

[0046] (7) The positive transformants obtained in step (6) were transferred and cultured three times on a medium containing kanamycin resistance at 45°C for 12 h each time, and colony PCR was performed using primers T2-F and kipR-KYR (or primers T2-R and kipR-KYF) to verify the single-exchange strain. If the electrophoresis band size is 1353 bp or 1979 bp, it is confirmed that the single-exchange strain is successful (e.g. Figure 4 shown);

[0047] The sequences of primers kipR-KYF and kipR-KYR are:

[0048] kipR-KYF:GACGCCGTTGTCGGAAGC

[0049] kipR-KYR:TGATTTGCGGAGCGGACT

[0050] (8) The single exchange strain obtained in step (7) was inoculated into a culture medium without kanamycin at 37°C and cultured for 3 to 6 times. The transformants were selected for colony PCR verification (primers are kipR-KYF and kipR-KYR). If the PCR verification results of the transformants are: when an electrophoresis band appears at 1909 bp, it indicates that the gene is reversed and the transformant is Bacillus licheniformis DW2; when an electrophoresis band appears at 1283 bp, it indicates that the gene is reversed and the transformant is Bacillus licheniformis DW2. kipR The gene was successfully knocked out in Bacillus licheniformis DW2, and the transformant was a positive transformant (e.g. Figure 5 The positive transformants were then sequenced and verified to have knocked out kipR Bacillus licheniformis DW2△ kipR .

[0051] Next, the applicant also used the above-mentioned constructed Bacillus licheniformis DW2△ kipR To ferment and produce bacitracin. Among them, Bacillus licheniformis DW2△ kipR Application in bacitracin production, including seed culture and fermentation culture.

[0052] The specific steps of seed fermentation are: firstly, Bacillus licheniformis DW2△ kipR Activation, i.e., inoculating 1% by volume from the glycerol tube into 5 mL of LB medium, culturing at 230 r / min and 37°C for 12 hours, then inoculating the activated bacterial liquid into the seed culture medium at an inoculation rate of 1% by volume, and culturing at 230 r / min and 37°C for 12 hours to obtain a seed culture solution (the formula of the seed culture medium requires: 5-13 g / L peptone, 2-7 g / L yeast extract, 5-15 g / L sodium chloride, pH 6.5-7.5).

[0053] The specific steps of the fermentation culture are as follows: 20 mL of fermentation medium of different formulations is added to a 250 mL conical flask (the specific formulation is shown in Table 1, the pH of the fermentation medium used in each embodiment in Table 1 is natural, and the seed culture medium used in each embodiment is: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2), and then the seed culture bacterial liquid is inoculated with an inoculation amount of 3% (volume percentage), the rotation speed is 230 r / min, the temperature is 37°C, and the fermentation culture is carried out for 48 hours to obtain the fermentation liquid.

[0054] The inventors used high performance liquid chromatography (HPLC) to determine the yield of bacitracin in the fermented bacterial solution in the above embodiment. The specific determination conditions are: using an Agilent 1200 liquid chromatograph for detection; the chromatographic column is Hypersil BDS C18 (5μm, 4.6 mm× 250 mm); the mobile phase is A:B=35:65 (phase A: 100 mL pH6.0 phosphate buffer mixed evenly in 300 mL water; phase B: 520 mL methanol and 40 mL acetonitrile mixed evenly); flow rate: 1.0mL / min; column temperature 30°C; UV detector wavelength: 254 nm; injection volume 20μL. The yield of bacitracin in the fermented bacterial solution was calculated based on the standard curve prepared by the bacitracin standard (see Table 2).

[0055] Table 1

[0056]

[0057] Table 2

[0058]

[0059] It can be seen from Table 2 that under the same fermentation conditions, compared with the prior art Bacillus licheniformis DW2, the Bacillus licheniformis DW2 of the present invention is more kipR The bacitracin production in the fermentation broth was significantly increased (increased by more than 16%), indicating that the technical solution of the present invention has important application value in increasing the bacitracin production of Bacillus licheniformis. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. A knockout kipR A method for genetically preparing engineered bacteria producing bacitracin, characterized in that: Using genetic engineering to knock out the genome of Bacillus licheniformis kipR Gene, knocked out kipR The recombinant strain after the gene is the Bacitracin-producing engineered bacteria, kipR The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The knockout according to claim 1 kipR A method for genetically preparing engineered bacteria producing bacitracin, characterized in that: The Bacillus licheniformis is Bacillus licheniformis DW2 ( Bacillus licheniformis DW2), which was deposited in the China Center for Type Culture Collection in Wuhan on October 12, 2011, with the deposit number being CCTCC NO: M2011344.

3. The knockout according to claim 1 kipR A method for genetically preparing engineered bacteria producing bacitracin, characterized in that: Using genetic engineering to knock out the genome of Bacillus licheniformis kipR Gene, including the following steps: (1) Using the genome of Bacillus licheniformis as a template, PCR was used to amplify kipR The upstream and downstream homology arms of the gene; (2) Using overlap extension PCR, the upstream homology arm and the downstream homology arm of step (1) are connected together to obtain a fusion fragment; (3) Use restriction endonucleases Bm I and XB I double-digests the fusion fragment obtained in step (2) to obtain a digested fusion fragment A; and Bm I and XB I. Perform double restriction digestion on plasmid T2(2)-ori to obtain linear plasmid fragments after restriction digestion; (4) The enzyme-cut fusion fragment A obtained in step (3) and the linear plasmid fragment were connected by T4-DNA ligase, and the enzyme-linked product was transformed into Escherichia coli DH5α by calcium chloride transformation method, and kanamycin was used as a resistance screening marker. After colony PCR, positive transformants were obtained, and sequencing was performed to obtain kipR Gene knockout plasmid T2(2)-ori- kipR ; (5) T2(2)-ori- kipR The cells were transferred into Bacillus licheniformis DW2, and positive transformants were obtained by kanamycin resistance screening. (6) The positive transformants verified by colony PCR in step (5) were cultured several times and tested by colony PCR to screen for kipR The upstream arm of the gene or kipR The downstream arm of the gene produced a single crossover-positive single crossover conjugant strain with the genomic DNA of Bacillus licheniformis DW2; (7) The positive single exchange conjugate strain obtained in step (6) was cultured several times and screened by PCR to obtain the knockout kipR The gene of Bacillus licheniformis was named: DW2△ kipR .

4. A Bacitracin-producing engineered bacterium with a knockout kipR gene, characterized in that: The knockout according to any one of claims 1 to 3 kipR The recombinant strain is constructed by a method for preparing bacitracin-producing engineered bacteria using genes.

5. Application of Bacitracin-producing engineered bacteria with kipR gene knocked out in Bacitracin production, characterized in that: The Bacitracin-producing engineered bacteria is the Bacitracin-producing engineered bacteria according to claim 4, and the application method includes seed culture and fermentation culture.

6. The use of the Bacitracin-producing engineered bacteria with the kipR gene knocked out according to claim 5 in Bacitracin production, characterized in that: The seed culture medium used in the seed culture is: 5-13 g / L peptone, 2-7 g / L yeast extract, 5-15 g / L sodium chloride, pH 6.5-7.

5.

7. The use of the Bacitracin-producing engineered bacteria with the kipR gene knocked out according to claim 5 in Bacitracin production, characterized in that: The fermentation medium used in the fermentation culture comprises 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate and 0.5-2 g / L ammonium sulfate.

Images