Proteins targeting b7h3 and methods of use thereof
By designing multi-specific compounds that combine targeting B7H3 protein, NK cell binding, and activation domains, the problem of poor NK cell attack on B7H3+ cancer cells was solved, achieving more effective cancer treatment.
Patent Information
- Application Number
- CN202180049778.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-06-03
- Filing Date
- 2021-06-03
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2041-06-03
AI Technical Summary
Existing technologies have difficulty effectively targeting and activating natural killer (NK) cells to attack cancer cells expressing B7H3, thus limiting the effectiveness of immunotherapy in treating cancer.
Multispecific compounds were designed and constructed, including targeting domains (anti-B7H3 protein), NK cell binding domains (such as CD16-specific binding ligands or antibodies), and immune cell activation domains (such as IL-15). Through the operative linking of these domains, the killing activity and self-maintenance signaling of NK cells were enhanced, thereby achieving specific attack on B7H3+ tumor cells.
It enhances the killing ability of NK cells against B7H3+ cancer cells, promotes the effect of cancer treatment, and overcomes the problem of immune evasion in traditional therapies by enhancing the expansion and persistence of NK cells.
Smart Images

Figure CN115968378B_ABST
Abstract
Description
Proteins targeting B7H3 and their methods of use
[0001] Cross-references to related applications
[0002] This application claims priority to U.S. Provisional Application No. 63 / 033,989, filed June 3, 2020, pursuant to 35 USC §119(e), the entire contents of which are incorporated herein by reference.
[0003] sequence list
[0004] This application contains a sequence list electronically filed with the United States Patent and Trademark Office via EFS-Web. The sequence list is an ASCII text file entitled “0110-000661WO01_ST25.txt”, 40 kilobytes in size, created on June 2, 2021. The information contained in this sequence list is incorporated herein by reference. Summary of the Invention
[0005] In one respect, this disclosure describes anti-B7H3 proteins, including at least one of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, or a functional variant thereof.
[0006] On the other hand, this disclosure describes anti-B7H3 proteins, including SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, the CDR region of SEQ ID NO:1, the CDR region of SEQ ID NO:2, the CDR region of SEQ ID NO:3, or functional variants thereof.
[0007] In another aspect, this disclosure describes multispecific compounds. Typically, multispecific compounds include a targeting domain and an immune cell-binding domain operatively linked to the targeting domain. The targeting domain includes an anti-B7H3 protein.
[0008] In some embodiments, the immune cell is a T cell or a natural killer (NK) cell. In embodiments where the immune cell is an NK cell, the immune cell conjugating domain may include a ligand or antibody that specifically binds to CD16. In embodiments where the immune cell conjugating domain includes an antibody that specifically binds to CD16, the antibody may be scFv, F(ab)2, Fab, or a single-domain antibody (sdAb).
[0009] In some embodiments, the immune cell binding domain may include SEQ ID NO:19. In some embodiments, the targeting domain may include SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In some embodiments, the immune cell binding domain may include SEQ ID NO:19, and the targeting domain may include SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.
[0010] In some embodiments, the immune cell conjugating domain and the targeting domain are connected by a adapter having an amino acid sequence of any one of SEQ ID NO:12-18. In some of these embodiments, the immune cell conjugating domain and the targeting domain are connected by a adapter having an amino acid sequence of SEQ ID NO:14.
[0011] In some embodiments, the anti-B7H3 multispecific compound includes amino acids 19-294 of SEQ ID NO:20 or amino acids 19-284 of SEQ ID NO:21.
[0012] In some embodiments, the anti-B7H3 multispecific compound may be a trispecific compound further comprising an immune cell activation domain. In embodiments where the immune cell is an NK cell, the immune cell activation domain comprises a cytokine or a functional portion thereof. In some of these embodiments, the cytokine is IL-15 or a functional variant thereof.
[0013] In some embodiments, the trispecific compound may include an amino acid of SEQ ID NO:19 as an immune cell conjugating domain, an amino acid of SEQ ID NO:19 as an immune cell activation domain, and an amino acid of any one of SEQ ID NO:1-3 as a targeting domain. The functional domains may be linked by any one or a combination of two or more linkers reflected in SEQ ID NO:12-18. In some of these embodiments, the immune cell conjugating domain may be linked to the immune cell activation domain via a linker having the amino acid sequence of SEQ ID NO:14. In some embodiments, the immune cell activation domain and the targeting domain may be linked via a linker having the amino acid sequence of SEQ ID NO:15.
[0014] In some embodiments, the anti-B7H3 trispecific compound may include the amino acid sequence of SEQ ID NO:22 or SEQ ID NO:23.
[0015] In some embodiments, functional variants of IL-15, compared to SEQ ID NO:11, include N72D or N72A amino acid substitutions.
[0016] On the other hand, this disclosure describes isolated nucleic acid sequences that encode any of the embodiments of the anti-B7H3 multispecific compound described herein.
[0017] On the other hand, this disclosure describes host cells that include any of the isolated nucleic acids outlined above. In some embodiments, the host cell is a T cell, NK cell, or macrophage.
[0018] On the other hand, this disclosure describes pharmaceutical compositions comprising an anti-B7H3 multispecific compound and a pharmaceutically acceptable carrier.
[0019] In another aspect, this disclosure describes a method that generally involves administering an anti-B7H3 multispecific compound to a subject in an amount that effectively induces natural killer (NK)-mediated cell killing. The anti-B7H3 multispecific compound includes a targeting domain (which comprises an anti-B7H3 protein) and an NK-binding domain operatively linked to the targeting domain.
[0020] In another aspect, this disclosure describes a method for stimulating the in vivo expansion of natural killer (NK) cells. Typically, this method involves administering an effective amount of an anti-B7H3 multispecific compound to a subject. The anti-B7H3 multispecific compound includes a targeting domain (which includes an anti-B7H3 protein) and an NK-binding domain operatively linked to the targeting domain.
[0021] In another aspect, this disclosure describes a method for treating a subject who has cancer or is at risk of developing cancer. Typically, this method involves administering an effective amount of an anti-B7H3 multispecific compound to the subject. The anti-B7H3 multispecific compound includes a targeting domain (which includes an anti-B7H3 peptide) and an NK-binding domain operatively linked to the targeting domain. In some embodiments, cancer cells express B7H3.
[0022] On the other hand, this disclosure describes chimeric antigen receptor compounds, including anti-B7H3 peptides.
[0023] In another aspect, this disclosure describes targeted therapeutic compounds comprising a targeting domain and a therapeutic domain connected to the targeting domain. The targeting domain includes an anti-B7H3 peptide. In some embodiments, the targeted therapy provides targeted immunotherapy. In some embodiments, the therapeutic domain includes a drug, a therapeutic radioisotope, a toxin, a cytokine, or a chemokine.
[0024] In another aspect, this disclosure describes targeted imaging compounds comprising a targeting domain and an imaging domain connected to the targeting domain. The targeting domain includes an anti-B7H3 peptide. In some embodiments, the imaging domain includes colorimetric labeling, fluorescent labeling, radiolabeling, magnetic labeling, or enzyme labeling.
[0025] On the other hand, this disclosure describes a capture assay device comprising an anti-B7H3 peptide immobilized on a substrate. Attached Figure Description
[0026] This patent or application document contains at least one color drawing. Upon request and payment of the necessary fees, a copy of this patent or application publication, containing one or more color drawings, will be provided by the Patent Office.
[0027] Figures 1A-1B illustrate schematic diagrams of a trispecific killing adaptor incorporating an exemplary embodiment of an anti-B7H3 protein. Figure 1A shows a schematic diagram of an exemplary anti-B7H3 protein sequence (e.g., sdAb) incorporated into the backbone of the trispecific killing adaptor, which also includes recombinant human IL-15 and anti-CD16 single-domain antibody (sdAb) arms, all linked by short linkers. Figure 1B shows the amino acid sequence of the novel anti-B7H3 protein.
[0028] Figures 2A-2F show NK cell degranulation and interferon-γ (IFN-γ) production as measured by flow cytometry. Figure 2A is a bar graph showing NK cell degranulation (%CD107a+) when the trispecific killer initiator (30 nM) was incubated with peripheral blood mononuclear cells (PBMCs) alone. Figure 2B is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and prostate cancer cells (PC3). Figure 2C is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and prostate cancer cells (DU145). Figure 2D is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) was incubated with PBMCs alone. Figure 2E is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and PC3 cells. Figure 2F is a bar graph showing the production of IFN-γ when the trispecific killer adaptor (30 nM) is co-cultured with PBMC and DU145 cells.
[0029] Figures 3A-3D show NK cell degranulation and IFN-γ production as measured by flow cytometry. Figure 3A is a bar graph showing NK cell degranulation (%CD107a+) when a trispecific killer initiator (30 nM) was co-cultured with PBMCs and prostate cancer cells (LnCAP). Figure 3B is a bar graph showing NK cell degranulation when a trispecific killer initiator (30 nM) was co-cultured with PBMCs and prostate cancer cells (C4-2). Figure 3C is a bar graph showing IFN-γ production when a trispecific killer initiator (30 nM) was co-cultured with PBMCs and LnCAP cells. Figure 3D is a bar graph showing IFN-γ production when a trispecific killer initiator (30 nM) was co-cultured with PBMCs and C4-2 cells.
[0030] Figures 4A-4F show NK cell degranulation and IFN-γ production as measured by flow cytometry. Figure 4A is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) is incubated with PBMCs alone. Figure 4B is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) is co-cultured with PBMCs and C4-2 cells. Figure 4C is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) is co-cultured with PBMCs and lung cancer cells (A549). Figure 4D is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) is incubated with PBMCs alone. Figure 4E is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) is co-cultured with PBMCs and C4-2 cells. Figure 4F is a bar graph showing the production of IFN-γ when the trispecific killer adaptor (30 nM) is co-cultured with PBMC and A549 cells.
[0031] Figures 5A-5F show NK cell degranulation and IFN-γ production as measured by flow cytometry. Figure 5A is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and lung cancer cells (NCI-H460). Figure 5B is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and ovarian cancer cells (OVCAR8). Figure 5C is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and ovarian cancer cells (MA148). Figure 5D is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and NCI-H460 cells. Figure 5E is a bar graph showing IFN-γ production when the trispecific killer initiator (30 nM) was co-cultured with PBMCs and OVCAR8 cells. Figure 5F is a bar graph showing the production of IFN-γ when the trispecific killer adaptor (30 nM) is co-cultured with PBMC and MA148 cells.
[0032] Figures 6A-6F show NK cell degranulation as measured by flow cytometry. Figure 6A is a bar graph showing NK cell degranulation when the trispecific killer initiator (0.3 nM) is incubated with PBMCs alone. Figure 6B is a bar graph showing NK cell degranulation when the trispecific killer initiator (3 nM) is incubated with PBMCs alone. Figure 6C is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) is incubated with PBMCs alone. Figure 6D is a bar graph showing NK cell degranulation when the trispecific killer initiator (0.3 nM) is co-cultured with PBMCs and C4-2 cells. Figure 6E is a bar graph showing NK cell degranulation when the trispecific killer initiator (3 nM) is co-cultured with PBMCs and C4-2 cells. Figure 6F is a bar graph showing NK cell degranulation when the trispecific killer initiator (30 nM) is co-cultured with PBMCs and C4-2 cells.
[0033] Figures 7A-7F show the production of IFN-γ as measured by flow cytometry. Figure 7A is a bar graph showing the production of IFN-γ when the trispecific killer initiator (0.3 nM) is incubated with PBMCs alone. Figure 7B is a bar graph showing the production of IFN-γ when the trispecific killer initiator (3 nM) is incubated with PBMCs alone. Figure 7C is a bar graph showing the production of IFN-γ when the trispecific killer initiator (30 nM) is incubated with PBMCs alone. Figure 7D is a bar graph showing the production of IFN-γ when the trispecific killer initiator (0.3 nM) is co-cultured with PBMCs and C4-2 cells. Figure 7E is a bar graph showing the production of IFN-γ when the trispecific killer initiator (3 nM) is co-cultured with PBMCs and C4-2 cells. Figure 7F is a bar graph showing the production of IFN-γ when the trispecific killer initiator (30 nM) is co-cultured with PBMCs and C4-2 cells.
[0034] Figure 8 shows a photograph demonstrating the enhanced cell-dissolving activity against ovarian cancer spheroids by incorporating an exemplary anti-B7H3 protein into a trispecific killing adaptor.
[0035] Figure 9 is a graph illustrating the quantification of the enhanced cytolytic activity against ovarian cancer spheroids by incorporating an exemplary anti-B7H3 protein trispecific killing adaptor. Detailed Implementation
[0036] This disclosure describes anti-B7H3 peptides, compounds and devices including anti-B7H3 peptides, and methods of using such compounds and devices. Exemplary platforms that may use anti-B7H3 peptides include, but are not limited to, chimeric antigen receptor therapies (e.g., CAR-NK therapy, CAR-T therapy, CAR-macrophage therapy, etc.), multispecific immune cell adaptor technologies (e.g., bispecific killer adaptors, trispecific killer adaptors, bispecific T cell adaptors, trispecific T cell adaptors, etc.), targeted immunotherapies (e.g., targeted ADAM17 blocker (TAB) therapy), therapeutic agent delivery (e.g., antibody-drug conjugates, delivery of therapeutic radioisotopes, delivery of toxins, delivery of cytokines, delivery of chemokines), imaging technologies (delivery of labeled constructs and / or labeled radioisotopes), and cell and / or ligand capture technologies (e.g., ELISA, etc.).
[0037] B7 homolog 3 (B7H3) (also known as differentiation cluster 276 (CD276)) is a human protein encoded by the CD276 gene. The B7H3 protein is a 316-amino acid-long type I transmembrane protein existing in two isoforms defined by its extracellular domain. In mice, the extracellular domain consists of a pair of immunoglobulin variable (IgV)-like domains and an immunoglobulin constant (IgC)-like domain; however, in humans, due to exon replication, this extracellular domain consists of either a pair (2Ig-B7H3) or two identical pairs (4Ig-B7H3). B7H3 mRNA is expressed in many normal tissues. In contrast, B7H3 protein expression in normal tissues is very limited due to post-transcriptional regulation by microRNA. In normal tissues, B7H3 plays a major inhibitory role in adaptive immunity, suppressing T cell activation and proliferation.
[0038] B7H3 is overexpressed in several human cancer cells. In malignant tissues, B7H3 is an immune checkpoint molecule that suppresses tumor antigen-specific immune responses. B7H3 also has non-immunoprotumor effects, such as promoting migration, invasion, angiogenesis, chemoresistance, epithelial-mesenchymal transition, and influencing tumor cell metabolism. B7H3 is considered a co-stimulatory molecule for immune responses, including, but not limited to, T cell activation and IFN-γ production. In the presence of anti-CD3 antibodies that mimic TCR signaling, human B7H3-Ig fusion protein increases CD4+ expression. + Cells and CD8 +Both B7H3 and B7H3 promote the proliferation of T cells and enhance the in vitro activity of cytotoxic T lymphocytes (CTLs). B7H3 also has antitumor effects against colon adenocarcinoma. B7H3 is also expressed in pancreatic cancer and is associated with increased therapeutic efficacy. Pancreatic cancer patients with high tumor B7H3 levels have significantly better postoperative prognosis compared with patients with low tumor B7H3 levels (Yang et al., Int J Biol Sci [International Journal of Biosciences] 2020; 16(11):1767-1773). Due to its selective expression in solid tumors and its pro-tumor effects, B7H3 is a target of several anticancer agents, including enbutuzumab, octojub, MGD009, MGC018, DS-7300a, and CAR-T cells.
[0039] Therefore, on one hand, anti-B7H3 peptides can be incorporated into immunotherapeutic compounds. Immunotherapeutic compounds can provide personalized treatments that activate or suppress the immune system to amplify or weaken the immune response, and are rapidly being developed for the treatment of various forms of cancer. Immunotherapy for cancer (such as chimeric antigen receptor (CAR)-T cells, CAR-natural killer (NK) cells, PD-1 and PD-L1 inhibitors) aims to help the subject's immune system fight cancer. T cell activation depends on both the specific combination of the T cell receptor (TCR) and the peptide-bound major histocompatibility complex (MHC) and the interaction of T cell co-stimulatory molecules with ligands on antigen-presenting cells (APCs). The B7 family (peripheral membrane proteins on activated APCs) has been shown to be involved in the regulation of T cell responses. Recent studies have shown that the upregulation of inhibitory B7 molecules in the cancer microenvironment is highly correlated with tumor immune evasion. As a newly identified member of the B7 family, B7H3 can promote T cell activation and IFN-γ production.
[0040] In one embodiment, this disclosure describes an anti-B7H3 polypeptide comprising at least one complementarity-determining region (CDR), as reflected in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. Exemplary anti-B7H3 polypeptides including each of these CDRs are reflected in the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. As used herein, the terms “peptide,” “polypeptide,” and “protein” interchangeably refer to any chain of at least two amino acids linked by covalent chemical binding. Thus, as used herein, the term “polypeptide” can refer to a complete amino acid sequence encoding a complete protein or a portion thereof. As used herein, the terms “anti-B7H3 peptide,” “anti-B7H3 protein,” “B7H3-binding peptide,” and “B7H3-targeting peptide” generally refer to any peptide or polypeptide (including proteins or fusion proteins) that can specifically bind to B7H3.
[0041] In some embodiments, the anti-B7H3 peptide may be an antibody or antibody fragment including a CDR region. As used herein, a "CDR region" refers to one or more of the three complementarity-determining regions (CDRs) of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. The CDRs are identified as SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively. In some aspects, the peptide encodes the light and heavy chains of the B7H3 target protein.
[0042] A "protein-coding sequence," or sequence that "encodes" a specific polypeptide, is a nucleic acid sequence that, when transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) end and a translation stop codon at the 3' (carboxyl) end. Coding sequences can include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. The transcription termination sequence will typically be located at the 3' end of the coding sequence.
[0043] The term "antibody" refers to a molecule containing at least one antigen-binding site that specifically binds to a particular target antigen. Therefore, the term "antibody" includes, but is not limited to, full-length antibodies and / or variants thereof, fragments thereof, peptide antibodies and variants thereof, monoclonal antibodies (including full-length monoclonal antibodies), multispecific antibodies (e.g., bispecific antibodies) formed from at least two complete antibodies, human antibodies, humanized antibodies, and antibody mimics (including single-chain antibodies and fragments thereof) that mimic the structure and / or function of an antibody or a specified fragment or portion thereof. Thus, as used herein, the term "antibody" encompasses antibody fragments capable of binding to a biomolecule (such as an antigen or receptor) or a portion thereof, including but not limited to Fab, Fab' and F(ab')2, pFc', Fd, single-domain antibodies (sdAb), variable fragments (Fv), single-chain variable fragments (scFv) or disulfide-linked Fv (sdFv); biantibodies or bivalent biantibodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies (e.g., triantibodies) formed from antibody fragments. Antibodies can belong to any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass.
[0044] The anti-B7H3 protein described herein can be any protein that selectively binds to B7H3. Exemplary anti-B7H3 proteins include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and functional variants thereof. As used herein, a protein is a “functional variant” of a reference protein if its amino acid sequence has a specified amount of identity with a reference protein and retains the activity of the reference protein. The structural similarity of two proteins can be determined by comparing residues of two proteins (e.g., a candidate protein and, for example, a protein of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3) to optimize the number of identical amino acids along their sequence length; to optimize the number of identical amino acids, vacancies are allowed in one or both sequences during the comparison, but the amino acids in each sequence must still maintain their correct order. A candidate protein is a protein compared to a reference protein (e.g., SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3). Candidate proteins can, for example, be isolated from animals, or can be produced using recombinant technologies, or synthesized chemically or enzymatically.
[0045] Pairwise comparison analysis of amino acid sequences can be performed using, for example, the BESTFIT algorithm (version 10.2, Madison, Wisconsin) from the GCG software package. Alternatively, proteins can be compared using the Blastp procedure with the BLAST 2 search algorithm, as described by Tatiana et al. (FEMS Microbiol Lett, 174, 247-250 (1999)), and this procedure is available on the National Center for Biotechnology Information (NCBI) website. All BLAST 2 search parameters can be used with default values, including matrix = BLOSUM62; development void penalty = 11, extension void penalty = 1, void x reduction = 50, expectation = 10, word length = 3, and filter on.
[0046] In comparing two amino acid sequences, structural similarity can be referred to as a percentage of "identity" or a percentage of "similarity." "Identity" means the presence of the same amino acid. "Similarity" means not only the presence of the same amino acid but also the presence of conserved substitutions. Conserved substitutions of amino acids in anti-B7H3 proteins can be selected from other members of the same amino acid's class. For example, it is well known in protein biochemistry that amino acids belonging to a group of amino acids with specific sizes or characteristics (e.g., charge, hydrophobicity, and hydrophilicity) can be substituted by another amino acid without altering protein activity, especially in regions of proteins not directly related to biological activity. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions include, for example, Lys replacing Arg, and vice versa, to maintain a positive charge; Glu replacing Asp, and vice versa, to maintain a negative charge; Ser replacing Thr, thereby maintaining free -OH; and Gln replacing Asn, to maintain free -NH2. Similarly, bioactive analogs of proteins containing the deletion or addition of one or more continuous or discontinuous amino acids that do not eliminate the functional activity of the protein are also considered.
[0047] Typically, the portions of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 outside the CDRs are more likely to change while maintaining anti-B7H3 functionality—that is, specific binding to B7H3. Therefore, anti-B7H3 proteins may include one, two, or all three of the CDRs of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3—that is, amino acids of SEQ ID NO:4 (CDR1), SEQ ID NO:5 (CDR2), and SEQ ID NO:6 (CDR3).
[0048] The anti-B7H3 protein described herein may include proteins having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence similarity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.
[0049] The anti-B7H3 protein described herein may include a protein having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.
[0050] Variants of the disclosed sequence also include proteins or full-length proteins with substitutions, deletions, or insertions on the protein backbone, which will still retain at least about 70% homology with the original protein in the corresponding portions. A greater degree of homology deviation is permitted if similar amino acids (i.e., conserved amino acid substitutions) are not considered sequence changes. Examples of conserved substitutions involve amino acids with the same or similar properties. Descriptive conserved amino acid substitutions include the following changes: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glutamine to asparagine; glutamic acid to aspartic acid; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamic acid; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; valine to isoleucine to leucine.
[0051] In some aspects, the anti-B7H3 protein may include additional sequences, such as, for example, amino acids attached to the C-terminus or N-terminus of the anti-B7H3 protein. Such modifications can, for example, facilitate recovery by on-column capture, purification using antibodies, or when recombinantly expressed in microorganisms. Such tags include, for example, histidine-rich tags (e.g., SEQ ID NO:8) and / or leader sequences (e.g., SEQ ID NO:7) that allow purification of the protein on a nickel column, which can deliver the recombinantly expressed protein to the cell membrane where it is recombinantly expressed. Such gene modification techniques and suitable additional sequences are well known in the field of molecular biology. In some embodiments, C-terminal and / or N-terminal modifications may be cleaved from the anti-B7H3 protein prior to incorporation, for example, a pharmaceutical composition. In other embodiments, for a given application (i.e., facilitating immobilization to a substrate), it may be necessary to retain either the C-terminal or N-terminal modifications.
[0052] In another aspect, this disclosure describes multispecific compounds comprising a targeting domain including an anti-B7H3 protein. The anti-B7H3 protein comprises at least one CDR from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, such as, for example, the amino acid sequence of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. The multispecific compounds further comprise an immune cell-binding domain operatively linked to the targeting domain.
[0053] The terms "multispecific compound" and "multispecific protein" refer to a "fusion molecule" or "fusion protein," and specifically to a bioactive polypeptide comprising two or more binding domains, with or without additional effector molecules, covalently linked (e.g., fused) by recombination, chemical means, or other suitable methods. For example, a binding domain may be linked to another binding domain via a peptide linker sequence. Alternatively, peptide linkers may be used to facilitate the construction of fusion molecules.
[0054] As used herein, the term "operably linked" refers to a direct or indirect covalent connection between domains of a multispecific compound. Thus, two operably linked domains can be directly covalently coupled to each other. Conversely, two operably linked domains can be connected by mutual covalent connection to a spacer portion (e.g., a flanking sequence or a connector). If, for example, two domains are separated by a third domain having or not having one or more spacer flanking sequences, then the two domains can be considered operably linked.
[0055] Domains of multispecific compounds can be operatively linked together using one or more linkers. As used herein, the term "linker" refers to any bond, small molecule, peptide sequence, or other mediator that physically connects domains. Linkers can be readily cleaved or substantially resistant to cleavage while the compound or antibody remains active, including acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage. Linkers are classified according to their chemical motifs well known in the art, including disulfide groups, hydrazine or peptide (cleavable), or thioester groups (non-cleavable). Linkers also include charged linkers and their hydrophilic forms known in the art.
[0056] Suitable linkers for connecting the domains of multispecific anti-B7H3 compounds can include native linkers, empirical linkers, or a combination of native and empirical linkers. Native linkers are derived from multidomain proteins, which are naturally present between protein domains. Desired properties can be imparted to multidomain compounds comprising native linkers that connect functional domains by utilizing the characteristics of native linkers (e.g., length, hydrophobicity, amino acid residues, and / or secondary structure).
[0057] Studies of linkers in natural multi-domain proteins have led to the development of numerous empirical linkers with diverse sequences and conformations for constructing recombinant fusion proteins. Empirical linkers can be categorized into three types: flexible linkers, rigid linkers, and cleavable linkers. Flexible linkers provide a degree of movement or interaction within the linked domains. They typically consist of small, nonpolar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids that provide flexibility and allow movement of the linked functional domains. Rigid linkers can successfully maintain a fixed distance between domains to preserve their independent function, providing efficient separation of protein domains and / or significantly reducing interference between functional domains. Cleavable linkers allow for the controlled in vivo release of functional domains. By utilizing unique in vivo processes, cleavable linkers can be cleaved under specific conditions, such as in the presence of reducing agents or proteases. This type of linker can reduce steric hindrance, improve biological activity, and / or enable the independent functioning / metabolism of individual domains of the recombinant fusion protein after linker cleavage.
[0058] Exemplary adapters are reflected in the amino acid sequences of SEQ ID NO:12-18.
[0059] In one exemplary application, the anti-B7H3 peptide can be incorporated into a multispecific NK adaptor compound, which includes at least the anti-B7H3 protein and the NK adaptor domain.
[0060] Natural killer (NK) cells are cytotoxic lymphocytes of the innate immune system capable of immune surveillance. Like T cells, NK cells deliver large quantities of permeable membrane-penetrating granzymes and perforin granules that induce apoptosis. Unlike T cells, NK cells do not require antigen initiation and recognize targets by binding to activated receptors in the absence of MHC recognition.
[0061] NK cells express CD16, an activated receptor that binds to the Fc portion of IgG antibodies and is involved in antibody-dependent cell-mediated cytotoxicity (ADCC). NK cells are regulated by IL-15, which can induce increased antigen-dependent cytotoxicity, lymphokine-activated killing activity, and / or mediate interferon (IFN), tumor necrosis factor (TNF), and / or granulocyte-macrophage colony-stimulating factor (GM-CSF) responses. IL-15 can also drive NK cell proliferation and survival, thereby enhancing NK cell expansion and persistence. All these functions of IL-15 activation contribute to improved cancer defense.
[0062] Adoptive transfer of NK cells can be therapeutically used, for example, to induce remission in subjects with refractory acute myeloid leukemia (AML) (when combined with lymphocyte depletion chemotherapy and IL-2 to stimulate NK cell survival and in vivo expansion). This therapy may be limited by a lack of antigen specificity and IL-2-mediated induction of regulatory T (Treg) cells, which suppress NK cell proliferation and function. Agents that generate NK cell antigen specificity, expansion, and / or persistence while bypassing the negative effects of Treg suppression can enhance NK cell-based immunotherapies.
[0063] Therefore, in one aspect, this disclosure describes the design, construction, and use of a trispecific molecule, including one capable of driving NK cell-mediated B7H3. + Two domains that kill tumor cells, and an intramolecular NK activation domain that generates NK cell self-maintenance signals. These three specific molecules can drive NK cell proliferation and / or enhance NK cell-driven targeting of, for example, B7H3. + Cancer cells may originate from B7H3 + Cytotoxicity of cancer cell lines.
[0064] In one aspect, this disclosure describes trispecific cytotoxic adaptor molecules that generally include a targeting domain that selectively targets B7H3, an NK cell adaptor domain (e.g., CD16, CD16+CD2, CD16+DNAM, NKp46, CD16+NKp46, NKG2D, NK2C), and an NK activation domain (e.g., IL-15, IL-12, IL-18, IL-21, or other NK cell-enhancing cytokines, chemokines, and / or activating molecules), wherein each domain is operatively linked to the other domains. As used herein, the terms “selective targeting” and “selective binding” refer to the ability to distinguish between two or more alternatives, such as, for example, having any degree of differential affinity for a particular target. In particular, in the context of trispecific compounds, the term “operatively linked” includes domains linked to spacer portions (e.g., flanking sequences, multiple flanking sequences, and / or other functional domains) via mutual covalent linkage. Therefore, if, for example, two domains are separated by a third functional domain having or not having one or more interval flanking sequences, then the two domains can be considered to be operatively connected.
[0065] The target domain may include B7H3 + Targets (e.g., tumor cells, targets in the cancer stroma, or immobilized B7H3) +The target domain can selectively bind to any portion of the cell. Therefore, the target domain may include, for example, an anti-B7H3 antibody. In some embodiments, the anti-B7H3 antibody may include an anti-B7H3 peptide as described in detail herein. In one exemplary embodiment, the anti-B7H3 peptide may include one or more of the complementarity-determining regions (CDRs) of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. In some embodiments, the anti-B7H3 protein may include two or all three of the CDRs of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. In some embodiments, the anti-B7H3 protein may include SEQ ID NO:1, SEQ ID NO:2, or variants thereof (e.g., SEQ ID NO:3). Suitable alternative variants are described herein.
[0066] The NK conjugating domain may include any portion that binds to and / or activates NK cells and / or blocks NK cell inhibition. In some embodiments, the NK conjugating domain may include an antibody that selectively binds to components on the surface of NK cells. In other embodiments, the NK conjugating domain may include a ligand or small molecule that selectively binds to components on the surface of NK cells. Therefore, for the sake of brevity, reference to an antibody that selectively binds to components on the surface of NK cells includes any antibody fragment exhibiting the described binding characteristics. Similarly, reference to a ligand that selectively binds to components on the surface of NK cells includes any fragment of a ligand exhibiting the described binding characteristics.
[0067] In some embodiments, the NK conjugating domain may selectively bind to a receptor at least partially located on the surface of NK cells. In some embodiments, the NK conjugating domain may provide the function of binding to NK cells, thereby bringing NK cells into spatial proximity to a target space where the targeting domain selectively binds. However, in some embodiments, the NK conjugating domain may selectively bind to a receptor that activates NK cells and, therefore, also has an activating function. As mentioned above, activation of the CD16 receptor can cause antibody-dependent cell-mediated cytotoxicity. Therefore, in some embodiments, the NK conjugating domain may include at least a portion of an anti-CD16 receptor antibody that effectively binds selectively to the CD16 receptor. In other embodiments, the NK adaptor cellular domain may interrupt the mechanism of NK cell inhibition. In such embodiments, the NK adaptor domain may include, for example, anti-PD1 / PDL1, anti-NKG2A, anti-TIGIT, anti-killer immunoglobulin receptor (KIR), and / or any other inhibitory blocking domain.
[0068] NK-conjugating domains can be designed to have a desired level of NK selectivity and, therefore, desired immunoconjugating properties. For example, CD16 has been identified as Fc receptors FcγRIIIa (CD16a) and FcγRIIIb (CD16b). These receptors bind to the Fc portion of IgG antibodies, which then activates NK cells, producing antibody-dependent cell-mediated cytotoxicity. Anti-CD16 antibodies selectively bind to NK cells and can also bind to neutrophils. Anti-CD16a antibodies selectively bind to NK cells but not to neutrophils. Trispecific cytotoxic adaptor compounds including NK-conjugating domains (including anti-CD16a antibodies) can bind to NK cells but not to neutrophils. Therefore, in cases where it may be desirable to bind to NK cells without binding to neutrophils, the NK-conjugating domain of a trispecific cytotoxic adaptor compound can be designed to include an anti-CD16a antibody.
[0069] In some embodiments, the NK cell conjugating domain may involve a humanized CD16 adaptor derived from an animal-derived nanobody. The scFv has a variable heavy chain component and a variable light chain component linked by a linker, while the nanobody consists of a monomeric variable single chain (i.e., a variable heavy chain or a variable light chain) capable of specifically conjugating a target. Single-domain antibodies (sdAbs) can be derived from any antibody suitable for an animal (e.g., camelids, llamas, or camels) or cartilaginous fish). Compared to larger antibody fragments, single-domain antibodies can provide better physical stability, the ability to bind deep grooves, and increased yield.
[0070] In one exemplary embodiment, the sdAb-based NK adaptor molecule may involve a humanized CD16 nanobody derived from a llama nanobody (GeneBank sequence EF561291; Behar et al., 2008. Protein Engineering, Design & Selection 21(1):1-10), referred to as EF91. After determining the function of the molecule, the CDR was cloned into a humanized camelid scaffold (Vincke et al., 2009. J Biol Chem. 284(5):3273-3284) to humanize the CD16 adaptor (SEQ ID NO:19). The use of a humanized camelid sdAb in the NK-binding domain of a trispecific cytotoxic adaptor compound can increase drug yield, improve stability, and / or enhance NK cell-mediated antibody-dependent cytotoxicity (ADCC) efficacy.
[0071] Although described herein in the context of various embodiments (where the NK conjugating domain includes anti-CD16 sdAb or anti-CD16 scFv), the NK conjugating domain may include any antibody or other ligand that selectively binds to CD16. Furthermore, the NK conjugating domain may include an antibody or ligand that selectively binds to any NK cell receptor, such as, for example, cytotoxic receptor 2B4, low-affinity Fc receptor CD16, cytotoxic immunoglobulin-like receptor (KIR), CD2, NKG2A, TIGIT, NKG2C, LIR-1, and / or DNAM-1.
[0072] On one hand, immune cells are T cells or natural killer (NK) cells. On the other hand, immune cells are NK cells; and immune cell conjugating domains include ligands or antibodies that specifically bind to CD16. In some aspects, antibodies that specifically bind to CD16 include scFv, F(ab)2, Fab, or single-domain antibodies.
[0073] As explained in more detail above, “antibody” generally refers to an immunoglobulin or a fragment thereof and therefore encompasses monoclonal antibodies, fragments thereof (e.g., scFv, Fab, F(ab')2, Fv, sdAb, or other modified forms of antibodies (including humanized forms of antibodies or fragments thereof)). Therefore, for the sake of brevity, references to antibodies selectively binding to B7H3 include any antibody or antibody fragment exhibiting the described binding characteristics. Similarly, references to antibodies selectively binding to CD16 (or any other NK cell receptor) include any antibody or antibody fragment exhibiting the described binding characteristics. In some aspects, immune cell conjugating domains include ligands or antibodies that specifically bind to CD16, such as, for example, antibody fragments having the amino acid sequence shown in SEQ ID NO:19.
[0074] In some embodiments, any of the linkers reflected in SEQ ID NO:12-18 can be used to connect the NK-binding domain and the targeting domain. In a particular embodiment, the bispecific anti-B7H3 compound may include the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:21. In some embodiments, the bispecific anti-B7H3 compound may include the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:21, wherein the leader sequence is missing, the VDE linker and the HID tag are missing, or both the leader sequence and the VDE linker and the HIS tag are missing.
[0075] On the other hand, the multispecific anti-B7H3 compound further includes an immune cell activation domain. In some embodiments, the immune cell may be an NK cell, and the immune cell activation domain includes an NK-activated cytokine or a functional portion thereof.
[0076] NK activation domains can include “immune cell activation domains,” such as amino acid sequences that activate NK cells, promote maintenance of NK cells, or otherwise promote NK cell activity. For example, NK cells respond to various cytokines (including, but not limited to, IL-15), which are involved in NK cell homeostasis, proliferation, survival, activation, and / or development. IL-15 and IL-2 share several signaling components, including IL-2 / IL-15Rβ (CD122) and the common γ chain (CD132). Unlike IL-2, IL-15 does not stimulate Tregs, allowing NK cell activation while bypassing Treg suppression of the immune response. In addition to promoting NK cell homeostasis and proliferation, IL-15 can also rescue NK cell functional deficiencies that may occur in the post-transplant environment. IL-15 can also stimulate CD8+. + T-cell function is further enhanced, thus increasing its immunotherapeutic potential. Additionally, preclinical studies suggest that at low doses, IL-15 may exhibit more favorable toxicity profiles than IL-2.
[0077] Therefore, the NK activation domain can be or may be derived from one or more cytokines that can activate and / or maintain NK cells. As used herein, the term "derived from" refers to an amino acid fragment of a cytokine (e.g., IL-15) sufficient to provide NK cell activation and / or maintenance activity. In embodiments including more than one NK activation domain, the NK activation domains may be provided in tandem or in any other combination. Additionally, each cytokine-based NK activation domain may comprise the full-length amino acid sequence of the cytokine or may be an amino acid fragment, regardless of the nature of other NK activation domains included in the trispecific killing adaptor compound. Exemplary cytokines that the NK activation domain may be based on include, for example, IL-15, IL-18, IL-12, and IL-21. Therefore, although described in detail herein in the context of exemplary model embodiments in which the NK activation domain is derived from IL-15, trispecific killing adaptor compounds can be designed using NK activation domains (which are or are derived from any suitable cytokine).
[0078] For the sake of brevity, in this specification, references to NK-activating domains (by identifying the cytokine upon which they are based) include the full-length amino acid sequence of the cytokine, any suitable amino acid fragment of the cytokine, and / or modified versions of the cytokine including one or more amino acid substitutions. Therefore, references to the “IL-15” NK-activating domain include an NK-activating domain comprising the full-length amino acid sequence of IL-15, an NK-activating domain comprising a fragment of IL-15 (e.g., SEQ ID NO: 11), a functional variant thereof, or an NK-activating domain comprising amino acid substitutions compared to the wild-type IL-15 amino acid sequence. For example, an NK-activating domain may comprise a fragment of IL-15 comprising an N-to-D or N-to-A amino acid substitution at position 72 of SEQ ID NO: 11. References to position 72 of SEQ ID NO: 11 refer only to the position of the amino acid substitution, regardless of the specific fragment of IL-15 that may be used as an NK-activating domain. Therefore, the NK activation domain may also include a fragment of IL-15 different from the fragment reflected in SEQ ID NO:11, and this fragment may have an N-to-D or N-to-A amino acid substitution at position 72 corresponding to position 72 of SEQ ID NO:11, which replaces the IL-15 fragment.
[0079] In some embodiments, the trispecific anti-B7H3 compound includes domains connected via one or more of the connectors reflected in SEQ ID NO:12-18, or a combination of the connectors reflected in SEQ ID NO:12-18. In a particular exemplary embodiment, the connector of SEQ ID NO:14 is used to connect the NK-binding domain to the NK-activating domain, while the connector of SEQ ID NO:15 (e.g., SEQ ID NO:22-25) is used to connect the NK-activating domain to the targeting domain.
[0080] On the other hand, this disclosure describes isolated nucleic acid sequences encoding any embodiment of an anti-B7H3 compound (one of the compounds described herein). In some embodiments, the isolated nucleic acid is a nucleic acid sequence of any one of SEQ ID NO: 26-33. Given the amino acid sequence of any anti-B7H3 polypeptide, or a multispecific anti-B7H3 compound comprising an anti-B7H3 polypeptide, those skilled in the art can determine the full range of polynucleotides encoding the amino acid sequence using conventional, general methods.
[0081] As used herein, the terms “nucleic acid” or “oligonucleotide” refer to polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Nucleic acids include, but are not limited to, genomic DNA, cDNA, mRNA, iRNA, miRNA, tRNA, ncRNA, rRNA, and molecules produced by recombination and chemical synthesis (such as aptamers, plasmids, antisense DNA strands, shRNA, ribozymes, nucleic acid conjugates, and oligonucleotides). Nucleic acids can be single-stranded, double-stranded, linear, or covalently circular closed molecules. Nucleic acids can be isolated. The term “isolated nucleic acid” means that the nucleic acid is (i) amplified in vitro, for example, by polymerase chain reaction (PCR), (ii) produced by recombination through cloning, (iii) purified, for example, by cleavage and separation by gel electrophoresis, (iv) synthesized, for example, by chemical synthesis, or (vi) extracted from a sample. Nucleic acids can be introduced—that is, transfected—into cells. When RNA is used for transfecting cells, it can be modified by stabilization, capping, or polyadenylation.
[0082] As used herein, “amplified DNA” or “PCR product” refers to an amplified fragment of DNA of a defined size. Various techniques are available and are well known in the art for detecting PCR products. Methods for detecting PCR products include, but are not limited to, gel electrophoresis using agarose or polyacrylamide gels with ethidium bromide staining (DNA intercalation agent), labeled probes (radioactive or non-radioactive labeled, DNA blotting), labeled deoxyribonucleotides (for direct incorporation of radioactive or non-radioactive labeled) or silver staining (for direct visualization of amplified PCR products); restriction endonuclease digestion relying on agarose or polyacrylamide gels or high-performance liquid chromatography (HPLC); dot blotting, using hybridization of amplified DNA on specific labeled probes (radioactive or non-radioactive labeled); high-performance liquid chromatography using ultraviolet detection; electrochemiluminescence coupled to voltage-induced chemical reaction / photon detection; and direct sequencing using radioactive or fluorescently labeled deoxyribonucleotides (for determining the precise sequence of nucleotides containing the target DNA fragment), oligonucleotide ligation assay (OLA), PCR, qPCR, DNA sequencing, fluorescence, gel electrophoresis, magnetic beads, allele-specific primer extension (ASPE), and / or direct hybridization.
[0083] Nucleic acids can typically be extracted, isolated, amplified, or analyzed using various techniques, such as those described in: Green and Sambrook, *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratory Press, Woodbury, New York, p. 2,028 (2012); or as described in: U.S. Patent Nos. 7,957,913; 7,776,616; 5,234,809; U.S. Publication No. 2010 / 0285578; and U.S. Publication No. 2002 / 0190663. Examples of nucleic acid analysis include, but are not limited to, sequencing and DNA-protein interactions. Sequencing can be performed using any method known in the art. DNA sequencing technologies include typical dideoxy sequencing reactions (Sanger methods) (using labeled terminators or primers and gel separation in plates or capillaries), and next-generation sequencing methods such as sequencing by synthesizing labeled nucleotides with reversible termination, pyrosequencing, 454 sequencing, Illumina / Solexa sequencing, allele-specific hybridization to libraries of labeled oligonucleotide probes, sequencing by synthesizing libraries of labeled clones with allele-specific hybridization (followed by ligation), real-time monitoring of the incorporation of labeled nucleotides during the polymerization step, polymerase cloning sequencing, and SOLiD sequencing. Separated molecules can be sequenced by sequential or single extension reactions using polymerases or ligases, and by single or sequential differential hybridization of libraries with probes.
[0084] In another aspect, this disclosure describes proteins encoded by any of the nucleic acid sequences described herein. In some embodiments, the protein may have the following amino acid sequences, including those of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, or any protein having 90% or more amino acid identity with them.
[0085] On the other hand, this disclosure describes host cells, which include any isolated nucleic acid sequences and / or proteins described herein.
[0086] The nucleic acid constructs of the present invention can be introduced into host cells to be modified, and then the expression of chimeric proteins within the cells can be allowed, thereby generating genetically engineered cells. Various methods are known in the art and suitable for introducing nucleic acids into cells; these methods include viral and non-viral mediated techniques. Typical examples of non-viral mediated techniques include, but are not limited to, electroporation, calcium phosphate-mediated transfer, nuclear transfection, acoustic perforation, heat shock, magnetic transfection, liposome-mediated transfer, microinjection, microelastic-mediated transfer (nanoparticles), cationic polymer-mediated transfer (DEAE-dextran, polyethyleneimine, polyethylene glycol (PEG), etc.), or cell fusions. Other transfection methods include proprietary transfection reagents such as LIPOFECTAMINE (Thermo Fisher Scientific, Inc., Waltham, Massachusetts), HILYMAX (Dojindo Molecular Technologies, Inc., Rockville, Maryland), FUGENE (Promega Corp., Madison, Wisconsin), JETPEI (PolyplusTransfection, Ilkish, France), EFFECTENE (Qiagen, Hilden, Germany), and DreamFect (OZ Bioscience, Inc., San Diego, California, USA).
[0087] The nucleic acid constructs described herein can be introduced into host cells to be modified, thereby allowing the expression of proteins encoded by nucleic acids within the cells. Various host cells are known in the art and suitable for protein expression. Examples of typical cells used for transfection and protein expression include, but are not limited to, bacterial cells, eukaryotic cells, yeast cells, insect cells, or plant cells, such as, for example, *Escherichia coli*, *Bacillus*, *Streptomyces*, *Pichia pastoris*, *Salmonella typhimurium*, *Drosophila S2*, *Noctua SJ9*, *CHO*, *COS* (e.g., *COS-7*), 3T3-F442A, *HeLa*, *HUVEC*, *HUAEC*, NIH 3T3, *Jurkat*, 293, 293H, or 293F.
[0088] In some respects, the host cells are T cells, NK cells, or macrophages.
[0089] In another aspect, this disclosure describes pharmaceutical compositions comprising any of the multispecific anti-B7H3 compounds described herein and a pharmaceutically acceptable carrier.
[0090] Multispecific anti-B7H3 compounds, such as the trispecific cytotoxic linker compounds described herein, can be formulated with pharmaceutically acceptable carriers. As used herein, "carrier" includes any solvent, dispersion medium, medium, coating, diluent, antibacterial agent, and / or antifungal agent, isotonic agent, absorption delay agent, buffer, carrier solution, suspension, colloid, etc. The use of such media and / or agents for pharmaceutically active substances is well known in the art. Their use in therapeutic compositions is considered unless any conventional media or agent is incompatible with the active ingredient. Additional active ingredients may also be incorporated into the composition. As used herein, "pharmaceutically acceptable" means a material that is not biologically or otherwise undesirable, i.e., that the material can be administered to an individual with the trispecific cytotoxic linker compound without causing any undesirable biological effects or interacting in a harmful manner with any other component of the pharmaceutical composition containing it.
[0091] Therefore, multispecific compounds (such as trispecific killing adaptor compounds) can be formulated into pharmaceutical compositions. Pharmaceutical compositions can be formulated into various forms suitable for preferred routes of administration. Thus, the compositions can be administered via known routes, including, for example, oral, parenteral (e.g., intradermal, transdermal, subcutaneous, intramuscular, intravenous, intraperitoneal, etc.), or topical (e.g., intranasal, intrapulmonary, intramammary, intravaginal, intrauterine, intradermal, transdermal, rectal, etc.). Pharmaceutical compositions can be applied to mucosal surfaces, such as by application to, for example, the nasal or respiratory mucosa (e.g., via spray or aerosol). The compositions can also be administered via sustained or delayed release.
[0092] Therefore, multispecific compounds, such as trispecific cytotoxic linker compounds, can be provided in any suitable form, including but not limited to solutions, suspensions, emulsions, sprays, aerosols, or mixtures. Compositions can be delivered in formulations having any pharmaceutically acceptable excipients, carriers, or mediators. For example, formulations can be delivered in conventional topical dosage forms, such as creams, ointments, aerosol formulations, non-aerosol sprays, gels, lotions, etc. Formulations may further include one or more additives, including, for example, adjuvants, skin penetration enhancers, colorants, fragrances, flavorings, humectants, thickeners, etc.
[0093] Formulations can be readily available in unit dosage forms and can be prepared using methods well-known in the pharmaceutical industry. Methods for preparing compositions having pharmaceutically acceptable carriers include the step of binding a multispecific or trispecific cytotoxic linker compound to a carrier constituting one or more auxiliary components. Generally, formulations can be prepared by uniformly and / or tightly binding an active molecule to a liquid carrier, a finely fragmented solid carrier, or both, and then, if necessary, shaping the product into the desired formulation.
[0094] The amount of multispecific or trispecific cytotoxic adjuvant compound administered can vary depending on various factors, including, but not limited to, the specific trispecific cytotoxic adjuvant compound used, its weight, physical conditions, and / or the age of the subject, and / or the route of administration. Therefore, the absolute weight of the trispecific cytotoxic adjuvant compound included in a given unit dosage form can vary widely and depends on factors such as the species, age, weight, and physical conditions of the subject, and / or the method of administration. Therefore, it is impractical to generally define the amount of the constituent multispecific or trispecific cytotoxic adjuvant compound that is effective for all possible applications. However, those skilled in the art can readily determine an appropriate amount after properly taking such factors into account.
[0095] In some embodiments, the method may include administering sufficient multispecific or trispecific cytotoxic adjuvant compound to a subject to provide, for example, a dose of about 100 ng / kg to about 50 mg / kg, although in some embodiments, these methods may be performed by administering the multispecific or trispecific cytotoxic adjuvant compound at a dose exceeding this range. In some of these embodiments, the method includes administering sufficient multispecific or trispecific cytotoxic adjuvant compound to provide a dose of about 10 μg / kg to about 5 mg / kg to a subject, for example, a dose of about 100 μg / kg to about 1 mg / kg.
[0096] Alternatively, the dosage can be calculated using the actual body weight obtained just before the start of the treatment procedure. For dosages calculated in this manner, the body surface area (m²) is calculated using the Dubois method before the start of the treatment procedure. 2 ):m 2 =(Weight kg 0.425 ×Height (cm) 0.725 )×0.007184.
[0097] In some embodiments, the method may include administering sufficient multispecific or trispecific cytotoxic adaptor compounds to provide, for example, about 0.01 mg / m³. 2 Approximately 10 mg / m 2 The dosage.
[0098] In another aspect, this disclosure describes a method comprising administering to a subject a multispecific compound in an amount that effectively induces NK-mediated cell killing, the multispecific compound comprising a targeting domain (which includes one of the anti-B7H3 proteins described herein); and an NK-binding domain operatively linked to the anti-B7H3 protein.
[0099] On the other hand, this disclosure describes a method for stimulating the in vivo expansion of NK cells, comprising administering to a subject an effective amount of a multispecific compound comprising a targeting domain (which includes one of the anti-B7H3 proteins described herein) and an NK-binding domain operatively linked to the anti-B7H3 protein.
[0100] On the other hand, this disclosure describes a method for killing target cells in a subject. Typically, this method involves administering an anti-B7H3 multispecific compound to the subject in an amount that effectively induces NK-mediated killing of target cells. “Treatment” or variations thereof means, to any extent, a reduction, limitation of progression, mitigation, or elimination of symptoms or signs associated with a condition. As used herein, “mitigation” means any reduction in the degree, severity, frequency, and / or likelihood of a symptom or clinical sign characteristic of a particular condition; “symptom” means any subjective evidence of the disease or the subject’s condition; and “sign” or “clinical sign” means any objective physical finding related to a particular condition that can be detected in addition to the subject.
[0101] "Treatment" can be therapeutic or preventative. "Therapeutic" and its variations refer to treatment that alleviates one or more existing symptoms or clinical signs associated with a condition. "Preventative" and its variations refer to treatment that, to any extent, limits the development and / or occurrence of symptoms or clinical signs of a condition. Typically, "therapeutic" treatment begins after a subject develops a condition, while "preventative" treatment begins before a subject develops a condition. Therefore, in some embodiments, the method may involve preventative treatment of a subject at risk of developing a condition. "At risk" refers to a subject who may or may not actually have the described risk. Thus, for example, a subject "at risk of developing a specific condition" is a subject with one or more indicators of increased risk of having or developing a specific condition, compared to an individual lacking one or more indicators, regardless of whether the subject exhibits any symptoms or clinical signs of having or developing a specific condition. Exemplary indicators of a condition may include, for example, genetic predisposition, ancestry, age, sex, geographic location, lifestyle, or medical history. Treatment may also continue after symptoms have subsided, for example, to prevent or delay their recurrence.
[0102] In some cases, treatment may involve administering an anti-B7H3 multispecific compound to a subject so that the compound can stimulate endogenous NK cells in vivo. Using an anti-B7H3 multispecific compound as part of an in vivo component can make NK cells antigen-specific, while simultaneously co-stimulating, enhancing survival, and expanding them, which can be antigen-specific. In other cases, the anti-B7H3 multispecific compound can be used in vitro as an adjuvant for NK cell adoptive transfer therapy. The terms “administration” and / or “administration” should be understood as meaning the provision of a therapeutically effective amount of the pharmaceutical composition to a subject in need of treatment. Routes of administration may be enteric, local, or parenteral. Similarly, routes of administration include, but are not limited to, intradermal, subcutaneous, intravenous, intraperitoneal, intraarticular, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, percutaneous, transtracheal, subcutaneous, intra-articular, subcapsular, subarachnoid, intraspinal, intrasternal, oral, sublingual, oral, rectal, vaginal, nasal, ocular administration, as well as infusion, inhalation, and nebulization. As used in this article, the phrase “parenteral administration” refers to a mode of administration other than enteral and local administration.
[0103] Therefore, the anti-B7H3 multispecific compound can be administered before, during, or after a subject first exhibits symptoms or clinical signs of the disease. Initiating treatment before a subject first exhibits symptoms or clinical signs associated with the disease can result in a reduced likelihood of the subject experiencing clinical evidence of the disease (compared to subjects who did not receive the anti-B7H3 multispecific compound), a reduced severity of symptoms and / or clinical signs, and / or complete remission of the disease. Initiating treatment after a subject first exhibits symptoms or clinical signs associated with the disease can result in a reduced severity of symptoms and / or clinical signs (compared to subjects who did not receive the composition), and / or complete remission of the disease.
[0104] The anti-B7H3 multispecific compound can be any embodiment of the anti-B7H3 multispecific compound described above (having a targeting domain that selectively binds to an appropriate target cell population). In some cases, the target cells may include tumor cells, making the method applicable to treating cancers associated with tumor cells. Thus, in some embodiments, the method may include alleviating at least one symptom or clinical sign of the tumor.
[0105] In embodiments where the target cells include tumor cells, the method may further include surgical resection of the tumor and / or reduction of the tumor size by chemotherapy (e.g., chemotherapy) and / or radiation therapy. Exemplary tumors that can be treated include those associated with: prostate cancer, lung cancer, colon cancer, rectal cancer, bladder cancer, melanoma, kidney cancer, renal cancer, oral cancer, pharyngeal cancer, pancreatic cancer, uterine cancer, thyroid cancer, skin cancer, head and neck cancer, cervical cancer, ovarian cancer, and / or hematopoietic system cancers.
[0106] Therefore, in some embodiments, the treated subject includes a subject who has cancer or is at risk of developing cancer. Typically, the method involves administering to the subject an effective amount of a multispecific compound comprising a targeting domain (which includes one of the anti-B7H3 proteins described herein) and an NK-binding domain operatively linked to the anti-B7H3 protein. As used herein, the term “cancer” refers to a group of diseases characterized by the initiation of abnormal and uncontrolled cell proliferation at one site (primary site) and the potential to invade and spread to other sites (secondary sites, metastases), distinguishing benign tumors from cancer (malignant tumors). Almost any organ can be affected, meaning that more than 100 types of cancer can affect humans. Cancer can be caused by a number of factors, including genetic predisposition, viral infection, exposure to ionizing radiation, exposure to environmental pollution, tobacco and / or alcohol use, obesity, poor diet, lack of physical activity, or any combination thereof. As used herein, “neoplasm” (“neoplasm” or “tumor”) (and its grammatical variations) refers to new and abnormal tissue growth, which can be benign or cancerous. In related contexts, tumor refers to neoplastic diseases or disorders, including but not limited to, various types of cancer. For example, such cancers can include prostate cancer, pancreatic cancer, bile duct cancer, colon cancer, rectal cancer, liver cancer, kidney cancer, lung cancer, testicular cancer, breast cancer, ovarian cancer, brain cancer, head and neck cancer, melanoma, sarcoma, multiple myeloma, leukemia, lymphoma, etc.
[0107] Exemplary cancers described by the National Cancer Institute include: acute lymphoblastic leukemia (ALL), adults; acute lymphoblastic leukemia (ALL), children; acute myeloid leukemia (AML), adults; adrenocortical carcinoma; adrenocortical carcinoma, children; AIDS-related lymphoma; AIDS-related malignancies; anal cancer; astrocytoma, cerebellum in children; astrocytoma, brain in children; extrahepatic bile duct cancer; bladder cancer; bladder cancer in children; bone cancer, osteosarcoma / malignant fibrous histiocytoma; brainstem glioma. Children; Brain tumors, adults; Brain tumors, brainstem gliomas, children; Brain tumors, cerebellar astrocytomas, children; Brain tumors, cerebral astrocytomas / malignant gliomas, children; Brain tumors, ependymomas, children; Brain tumors, medulloblastomas, children; Brain tumors, supratentorial primitive neuroectodermal tumors, children; Brain tumors, visual pathway and hypothalamic gliomas, children; Brain tumors, children (other); Breast cancer; Breast cancer and pregnancy; Breast cancer, children; Breast cancer, men; Bronchial adenoma / carcinoid, children: carcinoid tumors. Children; carcinoid tumors, gastrointestinal tract; carcinoma, adrenal cortex; carcinoma, insular cell; carcinoma of unknown proto-oncogene; central nervous system lymphoma, primary; cerebellar astrocytoma, children; cerebral astrocytoma / malignant glioma, children; cervical cancer; childhood cancer; chronic lymphocytic leukemia; chronic myeloid leukemia; chronic myelodysplastic disorder; clear cell sarcoma of the tendon sheath; colon cancer; colorectal cancer, children; cutaneous T-cell lymphoma; endometrial cancer; ependymoma, children; epithelial carcinoma, ovary; esophageal cancer Esophageal cancer, children; Ewing family tumors; extracranial germ cell tumors, children; extragonadal germ cell tumors; extrahepatic bile duct cancer; ocular cancer, intraocular melanoma; ocular cancer, retinoblastoma; gallbladder cancer; gastric (gastric or stomach) cancer; gastric (gastric or stomach) cancer, children; gastrointestinal carcinoid tumors; germ cell tumors, extracranial, children; germ cell tumors, extragonadal; germ cell tumors, ovaries; gestational trophoblastic tumors; gliomas. Childhood brainstem; gliomas. Visual pathway and hypothalamus in children; hairy cell leukemia; head and neck cancer; hepatocellular carcinoma, adults (primary); hepatocellular carcinoma, children (primary); Hodgkin's lymphoma, adults; Hodgkin's lymphoma, children; Hodgkin's lymphoma during pregnancy; hypopharyngeal cancer; hypothalamic and visual pathway glioma, children; ocular melanoma; insular cell carcinoma (endocrine pancreas); Kaposi's sarcoma; renal cell carcinoma; laryngeal cancer; laryngeal cancer, children; leukemia, acute lymphoblastic leukemia, adults; leukemia Diseases, acute lymphoblastic leukemia, children; leukemia, acute myeloid leukemia, adults; leukemia, acute myeloid leukemia, children; leukemia, chronic lymphocytic leukemia; leukemia, chronic myeloid leukemia; hairy cell leukemia; lip and oral cancer; liver cancer, adults (primary); liver cancer, children (primary); lung cancer, non-small cell; lung cancer, small cell; lymphoblastic leukemia, acute in adults; lymphoblastic leukemia, acute in children; lymphocytic leukemia, chronic; lymphoma, AIDS-related;Lymphoma, Central Nervous System (Primary); Lymphoma, Cutaneous T-Cell; Lymphoma, Hodgkin's, Adult; Lymphoma, Hodgkin's, Child; Lymphoma, Hodgkin's during Pregnancy; Lymphoma, Non-Hodgkin's, Adult; Lymphoma, Non-Hodgkin's, Child; Lymphoma, Non-Hodgkin's during Pregnancy; Lymphoma, Primary Central Nervous System; Macroglobulinemia, Waldenström; Male Breast Cancer; Malignant Mesothelioma, Adult; Malignant Mesothelioma, Child; Malignant Thymoma; Medulloblastoma, Child; Melanoma; Melanoma, Intraocular; Merkel Cell Carcinoma; Mesothelioma, Malignant; Primary Metastatic Squamous Neck Carcinoma with Latent Primary Formation; Multiple Endocrine Necrosis Syndrome, Child; Multiple Myeloma / Plasma Cell Tumor; Mycosis Fungoides; Myelodysplastic Syndrome Syndrome; Myeloid leukemia, chronic; Myeloid leukemia, acute in children; Multiple myeloma; Myelodysplastic disorder, chronic; Nasal cavity and sinus carcinoma; Nasopharyngeal carcinoma; Nasopharyngeal carcinoma, children; Neuroblastoma; Non-Hodgkin's lymphoma, adults; Non-Hodgkin's lymphoma, children; Non-Hodgkin's lymphoma during pregnancy; Non-small cell lung cancer; Oral cancer, children; Oral and lip cancer; Oropharyngeal carcinoma; Osteosarcoma / malignant fibrous histiocytoma of bone; Ovarian cancer, children; Ovarian epithelial carcinoma; Ovarian germ cell tumor; Low-grade malignant potential ovarian tumor; Pancreatic cancer; Pancreatic cancer, children; Pancreatic cancer, insular cells; Paranasal sinus and nasal cavity carcinoma; Parathyroid carcinoma; Penile cancer; Pheochromocytoma; Pineal and supratentorial primitive neuroectodermal tumors, children; Pituitary adenoma; Plasma cell tumor Multiple myeloma; Pleural pulmonary germ cell tumor; Breast cancer during pregnancy; Pregnancy and Hodgkin's lymphoma; Pregnancy and non-Hodgkin's lymphoma; Primary central nervous system lymphoma; Primary liver cancer, adults; Primary liver cancer, children; Prostate cancer; Rectal cancer; Renal cell (kidney) carcinoma; Renal cell carcinoma, children; Renal pelvis and ureter, transitional cell carcinoma; Retinoblastoma; Rhabdomyosarcoma, children; Salivary gland carcinoma; Salivary gland carcinoma, children; Sarcoma, Ewing family tumor; Sarcoma, Kaposi's; Bone sarcoma (osteosarcoma) Malignant fibrous histiocytoma; Sarcoma, rhabdomyosarcoma, children; Sarcoma, soft tissue, adults; Sarcoma, soft tissue, children; Cézari syndrome; Skin cancer; Skin cancer, children; Skin cancer (melanoma); Skin cancer, Merkel Cellular cancer; small cell lung cancer; small intestinal cancer; soft tissue sarcoma, adults; soft tissue sarcoma, children; primary squamous cell carcinoma of the neck with latent potential, metastatic; gastric (stomach or gastric) cancer; gastric (stomach or gastric) cancer, children; supratentorial primitive neuroectodermal tumor, children; T-cell lymphoma, skin; testicular cancer; thymoma, children; thymoma, malignant; thyroid cancer; thyroid cancer, children; transitional cell carcinoma of the kidney stones and ureter; trophoblastic tumor, pregnancy; cancer of unknown primary site in children; abnormal cancer in children; transitional cell carcinoma of the ureter and renal pelvis; urethral cancer; uterine sarcoma; vaginal cancer; optic pathway and hypothalamic glioma, children; vulvar cancer; Waldenström macroglobulinemia; and nephroblastoma.
[0108] In some embodiments, cancer may include or involve prostate cancer, lung cancer, colon cancer, rectal cancer, bladder cancer, melanoma, kidney cancer, renal cancer, oral cancer, pharyngeal cancer, pancreatic cancer, uterine cancer, thyroid cancer, skin cancer, head and neck cancer, cervical cancer, ovarian cancer, and / or hematopoietic system cancer.
[0109] On the one hand, multispecific compounds are administered before, during, or after chemotherapy, surgical removal of tumors, or radiotherapy.
[0110] In some embodiments, the multispecific compound or trispecific cytotoxic adjuvant compound may be administered, for example, as a single to multiple doses per week, although in some embodiments, the method may be performed by administering the trispecific cytotoxic adjuvant compound at a frequency exceeding this range. In some embodiments, the multispecific compound or trispecific cytotoxic adjuvant compound may be administered from about once a month to about five times a week.
[0111] In some embodiments, the method further includes administering one or more additional therapeutic agents. The one or more additional therapeutic agents may be administered before, after, and / or simultaneously with the administration of the multispecific compound or the trispecific cytotoxic adjuvant compound. The multispecific compound or the trispecific cytotoxic adjuvant compound and the additional therapeutic agents may be co-administered. As used herein, “co-administration” means the combined administration of two or more components such that the combined therapeutic or prophylactic effect may be greater than the therapeutic or prophylactic effect of each component administered alone. The two components may be co-administered simultaneously or sequentially. Components that can be co-administered simultaneously may be provided in one or more pharmaceutical compositions. Sequential co-administration of two or more components includes administering components such that each component can be present at the treatment site at the same time. Alternatively, sequential co-administration of two components may include situations where at least one component has been cleared from the treatment site, but at least one cellular effect of the administered component (e.g., cytokine production, activation of certain cell populations, etc.) persists at the treatment site until one or more additional components are administered to the treatment site. Thus, in some cases, the co-administered combination may include components that have never been present in a chemical mixture of each other. In other embodiments, the multispecific compound or trispecific cytotoxic adjuvant compound, along with additional therapeutic agents, may be administered as part of a mixture or cocktail. In some aspects, administration of the multispecific compound or trispecific cytotoxic adjuvant compound may allow for the effectiveness of lower doses of other therapeutic agents compared to administration of other therapeutic agents or agents alone, thereby reducing the likelihood, severity, and / or extent of observed toxicity when higher doses of other therapeutic agents or agents are administered.
[0112] As used herein, the term "chemotherapy agent" refers to any therapeutic agent used to treat cancer. Examples of chemotherapy agents include, but are not limited to, actinomycin, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, docetaxel, deoxyfluorouridine, doxorubicin, epirubicin, epothilone, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, dichloromethyldiethylamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, thioguanine, topotecan, penoxorubicin, vinblastine, vincristine, vinorelbine, vinorelbine, panitumumab, erbitux TM (Cetuximab), Matozumab, IMC-IIF 8, TheraCIM hR3, Dinosumab, Avastin TM (bevacizumab), Humira TM (adalimumab), Herceptin TM (trastuzumab), Remicade TM (Infliximab), Rituximab, Synagis TM (palizumab), Mylotarg TM (Giruzumab / Ozomicin), Raptiva TM (Efazolidin), Tysabri TM (Natazumab), Zenapax TM (Dacitumab), NeutroSpec TM (Technetium [99mTc]fasoxumab), Tocilizumab, ProstaScint TM (Indium-Ill-labeled calolomide pendipeptide), Bexxar TM (Tosimomumab), Zevalin TM (Teimomab (IDEC-Y2B8) conjugated with yttrium 90), Xolair TM (Omalizumab), MabThera TM (Rituximab), ReoPro TM (Abciximab), MabCampath TM (alemumab), Simulect TM (Bariximab), LeukoScan TM (Thioxol), CEA-Scan TM (Acimozide), Verluma TM (Nofitumomab), Panorex TM(Ejuzalofop-P-ethyl), alenzab, CDP 870, nastatin (Gilotrif) TM (Afatinib), Lynparza TM (Olapani), Perjeta TM (pertuzumab), Otdivo TM (Nivolumab), Bosulif TM (Bosutinib), Cabometyx TM (Cabozantinib), Ogivri TM (trastuzumab-dkst), Sutent TM (sunitinib malate), Adcetris TM (Vitin-Brentuximab), Alecensa TM (Alectinib), Calquence TM (Acalatinib), Yescarta TM (Ciroise), Verzenio TM (Abesili), Keytruda TM (Pembrolizumab), Aliqopa TM (Kupanisi), Nerlynx TM (Lenatinib), Imfinzi TM (dulvarumab), Darzalex TM (Daralimumab), Tecentriq TM (Atezolizumab), and Tarceva TM (Erlotinib). Examples of immunotherapeutic agents include, but are not limited to, interleukins (Il-2, Il-7, Il-12), cytokines (interferon, G-CSF, imiquimod), chemokines (CCL3, CCl26, CXCL7), and immunomodulatory imide drugs (thalidomide and its analogues).
[0113] In some cases, chemotherapy is selected from the following groups: hexamethylmelamine, acridine, L-asparaginase, asparaginase, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, cyclophosphamide, cytophosphane, cytarabine, dacarbazine, doxycycline, docetaxel, doxorubicin, epirubicin, etoposide, and fluorouracil. Pyrimidine, fludarabine, formustin, ganciclovir, gemcitabine, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine, melphalan, mercaptopurine, methotrexate, mitoxantrone, mitomycin C, nimustine, oxaliplatin, paclitaxel, pemetrexed, procarbazine, raltitrexed, temozolomide, teniposide, thioguanine, thiotepa, topotecan, vinblastine, vincristine, vindesine, and vinorelbine.
[0114] In some embodiments, the method may include administering sufficient amounts of a multispecific compound or trispecific cytotoxic adjuvant compound as described herein and administering at least one additional therapeutic agent to demonstrate a therapeutic synergy. In some aspects of the method of the invention, the same measurement of the response to treatment observed after administering both a multispecific compound or trispecific cytotoxic adjuvant compound as described herein and an additional therapeutic agent is improved compared to measurements of the response to treatment observed after administering the multispecific compound or trispecific cytotoxic adjuvant compound or the additional therapeutic agent alone.
[0115] As used herein, the term "subject" refers to any individual or subject to whom the subject method is performed. In many embodiments, the subject is a human, although the subject can be any non-human animal. Suitable non-human animals include, but are not limited to, vertebrates such as rodents (including mice, rats, hamsters, or guinea pigs), cats, dogs, rabbits, farm animals (including cattle, horses, goats, sheep, pigs, chickens, etc.), or primates (including monkeys, chimpanzees, orangutans, or gorillas).
[0116] In some embodiments of this aspect, the anti-B7H3 multispecific compound may include an immune cell activation domain comprising IL-15 or a functional portion thereof, operatively linked to an NK-binding domain. In some embodiments, the multispecific anti-B7H3 compound may have an amino acid sequence as shown in any one of SEQ ID NO:20-25.
[0117] On the other hand, this disclosure describes chimeric antigen receptor compounds, including one of the anti-B7H3 proteins described herein. Chimeric antigen receptors (CARs, also known as chimeric immune receptors, chimeric T-cell receptors, or artificial T-cell receptors) are receptor proteins engineered to give T cells a novel ability to target specific proteins. These receptors are chimeric because they combine both antigen binding and T-cell activation functions into a single receptor.
[0118] CAR-T cell therapy uses CAR-engineered T cells for cancer treatment. The premise of CAR-T immunotherapy is the modification of T cells to recognize cancer cells, thereby more effectively targeting and destroying them. T cells are harvested from a donor (autologous or allogeneic), genetically modified, and then fused into a subject to attack the subject's tumor. CAR-T cells can be derived from T cells in the subject's own blood (autologous) or from donor T cells (allogeneic). Once isolated from the body, these T cells are genetically engineered to express a specific CAR, which programs the T cells to target antigens present on the surface of the tumor. For safety reasons, CAR-T cells are engineered to be specific to antigens expressed on tumors but not on healthy cells. After CAR-T cells are fused into the subject, they act as "living drugs" against cancer cells. When CAR-T cells come into contact with their target antigens on cells, the CAR-T cells bind to the antigen, are activated, proliferate, and produce cytotoxicity. CAR-T cells damage cells through several mechanisms, including extensively stimulated cell proliferation, increased cytotoxicity to other living cells (cytotoxicity), and increased secretion of factors that can affect other cells (e.g., cytokines, interleukins, and / or growth factors).
[0119] On the other hand, this disclosure describes targeted therapeutic compounds comprising a targeting domain and a therapeutic domain connected to the targeting domain. The targeting domain includes any of the embodiments of the anti-B7H3 protein described herein. In some embodiments, the targeted therapeutic compound can provide immunotherapy and is therefore a targeted immunotherapeutic compound. In some embodiments, the therapeutic domain may include a drug, a therapeutic radioisotope, a toxin, a cytokine, or a chemokine.
[0120] As used herein, the term "drug" refers to any chemical substance that produces a biological effect when administered to a living organism. A pharmaceutical drug is a chemical substance intended to treat, cure, prevent, or diagnose a disease or to promote health. Drugs can be obtained by extraction from medicinal plants or through organic synthesis. Pharmaceutical drugs can be used for a limited duration or periodically to treat chronic disorders.
[0121] A "radioactive isotope" or "radionucleus" is an atom with excess nuclear energy, making it unstable. This excess energy can be used in one of three ways: emitted from the cell nucleus as gamma radiation; transferred to one of its electrons to release it as a converted electron; or used to create and emit new particles (alpha or beta particles) from the cell nucleus. In those processes, radionuclides are said to undergo radioactive decay. These emissions are considered ionizing radiation because they are strong enough to release an electron from another atom. Radioactive decay can produce stable nuclides or sometimes new, unstable radionuclides that can undergo further decay.
[0122] As used herein, the term "toxin" refers to a substance that is harmful to cells. Toxins can be small molecules, peptides, or proteins that can cause disease or cell death upon contact with or absorption by body tissues. The toxicity of toxins varies greatly. Toxins are primarily secondary metabolites, which are organic compounds that are not directly involved in the growth, development, or reproduction of an organism, but often assist the organism in defense. In some applications, toxins can be used therapeutically by targeting the effects of one or more undesirable cells (e.g., tumor cells).
[0123] Cytokines are a large class of small proteins (approximately 5-20 kDa) involved in cell signaling. Cytokines are peptides and cannot cross the lipid bilayer of a cell to enter the cytoplasm, but they still participate in autocrine, paracrine, and endocrine signaling as immunomodulators. Cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factor, but generally do not include hormones or growth factors (although there is some overlap in the terminology). Cytokines are produced by a wide range of cells, including immune cells such as macrophages, B lymphocytes, T lymphocytes, mast cells, endothelial cells, fibroblasts, and various stromal cells. Cytokines regulate the balance between humoral and cellular immune responses, and they modulate the maturation, growth, and responsiveness of specific cell populations.
[0124] In another aspect, this disclosure describes targeted imaging compounds comprising a targeting domain and an imaging domain connected to the targeting domain. The targeting domain includes any embodiment of one of the anti-B7H3 proteins described herein. The imaging domain may include any portion capable of generating a detectable signal. Exemplary imaging portions include, but are not limited to, colorimetric labeling, fluorescent labeling, radioactive labeling, magnetic labeling, or enzyme labeling.
[0125] In another aspect, this disclosure describes a capture assay apparatus comprising any embodiment of one of the anti-B7H3 proteins described herein immobilized on a substrate. For example, the anti-B7H3 proteins described herein can be incorporated into cell and / or ligand capture techniques, such as, for example, ELISA-based assays. The substrate for immobilizing the anti-B7H3 protein may include, for example, a cell culture plate or dish, a glass slide, or any other support that may be used for performing an assay requiring immobilized anti-B7H3 protein.
[0126] In the preceding description and the following claims, the term “and / or” means one or all of the listed elements or a combination of any two or more of the listed elements; the terms “comprises” and variations thereof shall be interpreted as open-ended—that is, additional elements or steps are optional and may or may not be present; unless otherwise stated, “a / an”, “the” and “at least one” are used interchangeably and mean one or more; and numerical ranges described by endpoints include all numerical values contained within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
[0127] In the preceding description, specific embodiments may be described independently for clarity. Unless otherwise expressly stated, features of a particular embodiment are incompatible with features of another embodiment, some embodiments may include combinations of compatible features described herein in conjunction with one or more embodiments.
[0128] For any method disclosed herein that includes discontinuous steps, these steps may be performed in any feasible order. Furthermore, any combination of two or more steps may be performed simultaneously, if appropriate.
[0129] The following provides examples of trispecific compounds, including those for the B7H3-binding proteins, considered for the applications discussed. These examples are provided to further illustrate embodiments of the invention, but are not intended to limit the scope of the invention. While they are typical of those that may be used, other procedures, methods, or techniques known to those skilled in the art may be used alternatively.
[0130] Example
[0131] Example 1
[0132] Construction of cam1615B7H3 trispecific killing adaptor compound
[0133] The CDR region of anti-CD16 from camels (Behar et al., Protein Eng Des Sel. [Protein Engineering, Design & Selection] 2008; 21(1):1-10. doi:10.1093 / protein / gzm064. PubMed PMID:18073223) was spliced into a universal, humanized, heavy chain scaffold (Vincke et al., J Biol Chem. [Journal of Biochemistry] 2009; 284(5):3273-84. doi:10.1074 / jbc.M806889200. PubMed PMID:19010777). This novel, humanized camel sequence was used to manufacture the sdAb B7H3 trispecific killer adaptor. Heterozygous coding regions for cam16, (SGGGG)4 adapter (SEQ ID NO:27), wild-type rhIL-15, whitlow adapter, and annotated (Fig. 1B “CD276-new-2”, SEQ ID NO:2) anti-B7H3 sdAb were synthesized using Hi-fi DNA cloning technology. In-frame accuracy of the gene sequence and construct was validated at the University of Minnesota Biomedical Genome Center in St. Paul, Minnesota. The gene product was amplified, and the vector was transfected into Expi-293 cells. The supernatant was separated for 4–7 days, followed by enrichment on the Akta Pure platform using an HIS column. Protein purity was determined by SDS-PAGE stained with Simply Blue Safe Stain (Invitrogen, Carlsbad, CA).
[0134] Cancer cell line
[0135] MA-148 (Geller et al., 2013. Cytotherapy 15(10):1297-1306) is a human epithelial high-grade serous ovarian cancer cell line. For in vivo experiments, the cell line was transfected with a luciferase reporter construct using a transfection reagent (LIPOFECTAMINE reagent, Ingenie, Carlsbad, CA) and selective pressure of 10 μg / mL blastomycin. Ovarian cancer cells OVCAR-8 (RRID:CVCL_1629) were obtained from the Free Biotesting Branch, the Developmental Therapeutics Program, and the NCI, NIH-sponsored DTP, and DCTD tumor databases. Other cell lines were obtained from the American Type Culture Collection, including C4-2 (prostate; RRID: CVCL_4782), DU145 (prostate; RRID: CVCL_0105), LNCaP (prostate; RRID: CVCL_0395), PC-3 (prostate; RRID: CVCL_0035), A549 (lung; RRID: CVCL_0023), and NCI-H460 (lung; RRID: CVCL_0459). All cell lines were maintained in RPMI 1640 RPMI supplemented with 10%–20% fetal bovine serum (FBS) and 2 mmol / L L-glutamine. Cell lines were incubated at a constant 37°C in a humidified atmosphere containing 5% CO2. When adherent cells reached over 90% confluence, they were separated and passaged using trypsin-EDTA. Cell counting was performed using a standard hemocytometer. Only those cells with a viability >95% were used in experiments, as determined by trypan blue exclusion.
[0136] Cell products
[0137] After obtaining informed consent and approval from the Institutional Review Board (IRB), the guidelines of the Committee on the Use of Human Subjects in Studies were followed, and peripheral blood mononuclear cells (PBMCs) were obtained from healthy volunteers or subjects in accordance with the Declaration of Helsinki. The cells were pelleted, the red blood cells were lysed, cryopreserved in 10% DMSO / 90% FBS, and stored in liquid nitrogen.
[0138] Assessment of cytotoxicity and NK cell activation
[0139] Antibody-dependent cell-mediated cytotoxicity (ADCC) was measured in flow cytometry assays by evaluating degranulation of CD107a (a lysosome-associated membrane protein LAMP-1) and intracellular IFN-γ production. After thawing, PBMCs or ascites cells derived from normal donors and subjects were incubated overnight (37°C, 5% CO2) in RPMI 1640 medium supplemented with 10% fetal bovine serum. The following morning, after washing twice with RPMI-10, they were resuspended in tumor target cells or culture medium. Cells were then incubated for 10 minutes at 37°C with a trispecific killing adaptor compound or a control. A FITC-conjugated anti-human CD107a monoclonal antibody (BD Biosciences, San Jose, CA) was then added and incubated for one hour. Following incubation, GOLGISTOP (1:1,500, BD Biosciences, San Jose, CA) and GOLGIPLUG (1:1,000, BD Biosciences, San Jose, CA) were added for three hours (37°C, 5% CO2). After washing with phosphate-buffered saline, cells were stained with PE / Cy 7-conjugated anti-CD56 mAb, APC / Cy 7-conjugated anti-CD16 mAb, and PE-CF594-conjugated anti-CD3 mAb (BioLegend, Inc., San Diego, CA). Cells were incubated at 4°C for 15 minutes, washed, and fixed with 2% paraformaldehyde. Cells were then permeabilized with intracellular permeabilization buffer (BioLegend, San Diego, CA) to assess IFN-gamma (IFN-γ) production via detection of an aBV650-conjugated anti-human IFN-γ antibody (BioLegend, San Diego, CA). The samples were washed and evaluated in an LSRII flow cytometer (BD Biosciences, San Jose, California).
[0140] Real-time tumor killing assay
[0141] Tumor killing was assessed in real time using the INCUCYTE platform (Essen Biosciences, Inc., Ann Arbor, Michigan). 40,000 CD3+ cells enriched with magnetic beads were used. - CD56 +NK effector cells were plated with GFP stably expressing OVCAR8 spheroids in 96-well ULA clear flat-bottomed polystyrene tissue culture microplates (Corning, Flintshire, UK) to allow 20,000 cells to establish spheroids during the first three days of co-culture. Annotated treatment was then added at a concentration of 30 nM, and the plates were placed in an INCUCYTE S3 platform (Essen Biosciences, Ann Arbor, Michigan) in a cell culture incubator at 37°C / 5% CO2. Images were taken hourly from three technical replicates using a 4X objective for 120 hours and then analyzed using INCUCYTE Basic Software (Essen Biosciences, Ann Arbor, Michigan). Graphical readings represent the fluorescence intensity of the integrated spheroid GFP, normalized relative to the individual tumor at the start (0hr) time point.
[0142] Statistical analysis
[0143] PRISM software (GraphPad Software, Inc., La Jolla, CA) was used to create all statistical tests. For all in vitro studies, repeated measures one-way ANOVA was used to calculate significance compared to the cam1615B7H3 group. Bars represent mean ± SEM. Statistical significance is shown as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
[0144] Example 2
[0145] A second-generation trispecific killing adaptor compound capable of both antibody-dependent cytotoxicity (ADCC) and NK cell expansion was constructed by modifying a previously reported trispecific killing adaptor compound platform (Vallera et al., ClinCancer Res. 2016; 22(14):3440-50. doi:10.1158 / 1078-0432.CCR-15-2710.PubMed PMID:26847056; PMCID:PMC4947440; US Patent Application Publication No. 2018 / 0282386 A1). In an exemplary construct, a wild-type human IL-15 crosslinker with two modified flanking regions is inserted between two antibody fragments (N-terminal VHH humanized camelid anti-CD16 fragment and C-terminal anti-B7H3 VHH, or single-domain antibody) to create an anti-B7H3 trispecific killing adaptor, as illustrated in Figure 1.
[0146] To evaluate the ability of an exemplary anti-B7H3 protein-sdAb to target a trispecific NK adaptor, the anti-B7H3 trispecific NK adaptor molecule was used to induce NK cell activity against B7H3-containing targets in prostate cancer cell lines, lung cancer cell lines, and ovarian cancer cell lines. Typically, the trispecific NK adaptor molecule recruits and activates NK cells targeting the target cell population. For example, a measurement of natural killer (NK) cell degranulation (detecting CD107a) can be used. + NK cell activation was measured by flow cytometry counting of NK cells and the production of inflammatory cytokines (e.g., IFN-γ).
[0147] An exemplary anti-B7H3 protein sequence was incorporated into the trispecific killer adaptor backbone and compared with a trispecific killer adaptor incorporated with the anti-B7H3scFv sequence. NK cell degranulation (measured as CD107a) was assessed by flow cytometry in various cancer cell lines and in the presence of various concentrations of the trispecific killer adaptor, as described in Example 1. + NK cell percentage) and interferon-γ (IFN-γ) production (measured as IFN-γ) + (Percentage of NK cells). In short, the trispecific cytokine adaptor compound was incubated for five hours before NK cell degranulation and inflammatory cytokine (IFN-γ) production were measured by flow cytometry. The results shown reflect the mean of N=3 independent experiments.
[0148] When co-cultured with peripheral blood mononuclear cells (PBMCs) at a concentration of 30 nM, the exemplary anti-B7H3 protein incorporated into the trispecific killer adaptor molecule enhanced NK cell degranulation and IFN-γ production against prostate cancer cells, as demonstrated in PC3 and DU145 cells (see Figures 2B, 2C, 2E, and 2F) and LnCAP and C4-2 cells (see Figures 3A, 3B, 3C, and 3D), as compared to incubation with PBMCs alone (see Figures 2A and 2D).
[0149] Figures 2 and 3 provide data demonstrating the NK cell activity induced by a trispecific NK adaptor molecule containing an exemplary anti-B7H3 sdAb protein against a B7H3-expressing target cell population. The anti-B7H3 trispecific NK adaptor induced NK cell degranulation and the production of NK cell inflammatory cytokines against various prostate cancer cell lines. For both measurements of NK activation, the trispecific NK adaptor molecule containing sdAb (black bar) induced a greater response compared to the anti-B7H3 trispecific NK adaptor molecule containing anti-B7H3 scFv (gray bar).
[0150] When co-cultured with PBMCs at a concentration of 30 nM, the exemplary anti-B7H3 protein incorporated into the trispecific killing adaptor molecule also enhanced NK cell degranulation and IFN-γ production against lung cancer cells (as demonstrated in A549 and NCI-H460 cells (see Figures 4C, 4F, 5A, and 5D)) and ovarian cancer cells (as demonstrated in OVCAR8 and MA148 cells (see Figures 5B, 5C, 5E, and 5F)); compared to incubation with PBMCs alone (see Figures 4A and 4D) or co-culture with C4-2 cells (see Figures 4B and 4E).
[0151] Figures 4 and 5 provide data showing the activity of NK cells induced by trispecific NK adaptor molecules containing exemplary anti-B7H3 sdAb proteins against the following additional B7H3-expressing target cell populations: prostate cancer cell line C4-2, lung cancer cell lines A549 and NCI-H460, and ovarian cancer cell lines OVCAR8 and MA148. Again, the trispecific NK adaptor containing sdAb (black bars) induced a greater response compared to the anti-B7H3 trispecific NK adaptor molecule containing anti-B7H3 scFv (gray bars).
[0152] It was demonstrated that, at three test doses (0.3, 3, and 30 nM), the exemplary anti-B7H3 protein incorporated into the trispecific killer adaptor molecule enhanced NK cell degranulation against the prostate, compared to no effect when incubated alone with PBMCs (see Figures 6A, 6B, and 6C) (dose independent).
[0153] Similar effects were observed when IFN-γ production was evaluated; at three test doses (0.3, 3, and 30 nM), the exemplary anti-B7H3 protein incorporated into the trispecific killing adaptor molecule enhanced IFN production against the prostate, compared to no effect when incubated alone with PBMC (see Figures 7A, 7B, and 7C) (dose independent).
[0154] Figures 6 and 7 provide data showing that the activity of the trispecific NK adaptor is target-dependent. Background NK activity is low in the absence of target cells expressing B7H3. When target cells expressing B7H3 are co-cultured with PBMC NK cells and a trispecific adaptor molecule containing anti-B7H3, NK cell degranulation and IFN-γ production are induced. Again, the trispecific NK adaptor molecule containing sdAb (black bar) induces a greater response compared to the anti-B7H3 trispecific NK adaptor molecule containing anti-B7H3 scFv (gray bar).
[0155] The ability of the trispecific killing adaptor incorporating the exemplary anti-B7H3 protein to enhance cytolytic activity against ovarian cancer spheroids was then evaluated in vitro, as described in Example 1. Briefly, the exemplary anti-B7H3 protein was incorporated into the trispecific killing adaptor backbone, and its activity was compared with that of NK cells alone in a spheroid assay. 20,000 GFP-expressing OVCAR8 cells were plated in the wells of a 96-well ULA plate and allowed to set for three days. Then, 40,000 enriched NK cells were added individually or together with 30 nM of the trispecific killing adaptor. Images showing GFP intensity measurements were taken hourly for 120 hours. A transient increase in cell death-induced green fluorescence should be noted. Three technical replicates were performed for each of the three biological replicates. As shown in Figure 8 and further quantified in Figure 9, the trispecific killing adaptor incorporating the exemplary anti-B7H3 protein enhanced cytolytic activity against ovarian cancer spheroids, as compared with the activity of NK cells alone.
[0156] Figures 8 and 9 provide data demonstrating the ability of a trispecific NK adaptor containing anti-B7H3-sdAb to kill ovarian cancer cells using an advanced imaging-based cell lysis assay. In this assay, 20,000 OVCAR8 ovarian cancer cells were stably transduced with a GFP cassette (to provide green fluorescence) and then plated in ultra-low adhesion (ULA) 96-well plates to allow spheroid formation over a three-day period. After three days, 40,000 NK cells with a small amount of cytokines were added to the tumor+NK group to maintain survival, or 40,000 NK cells and 30 nM of a trispecific NK adaptor containing anti-B7H3-sdAb were added. Spheroid killing was observed over a five-day (120-hour) period, measured as the loss of spheroid green fluorescence intensity. NK cells killed spheroids better when treated with the trispecific NK adaptor molecule containing anti-B7H3-sdAb compared to when the trispecificity was absent, demonstrating that this trispecificity can induce killing of three-dimensional tumor formation.
[0157] All patents, patent applications, and publications cited herein, and electronically available materials (including, for example, nucleotide sequence submissions in GenBank and RefSeq, and amino acid sequence submissions in SwissProt, PIR, PRF, PDB, and translations of annotated coding regions from GenBank and RefSeq) are incorporated herein by reference in their entirety. In the event of any inconsistency between the disclosures of this application and the disclosures of any documents incorporated herein by reference, the disclosures of this application shall prevail. The detailed descriptions and examples above are given only for clarity and should not be construed as unnecessarily limiting. The invention is not limited to the precise details shown and described, as variations that will be apparent to those skilled in the art will be included within the scope of the invention as defined in the claims.
[0158] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0159] Unless otherwise indicated, all figures representing amounts of components, molecular weights, etc., used in the specification and claims should be understood to be modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the specification and claims are approximate values and may vary according to the desired characteristics sought to be obtained according to the invention. At least, it is not an attempt to limit the doctrine of equivalence to the scope of the claims; each numerical parameter should be interpreted at least according to the number of significant digits reported and by applying ordinary rounding techniques.
[0160] While the numerical ranges and parameters illustrating the broad scope of the invention are approximations, the values described in specific instances are reported as precisely as possible. However, all values inherently contain a range, which necessarily arises from the standard deviation present in their respective test measurements.
[0161] All headings are intended to facilitate the reader and should not be used to limit the meaning of the text following the heading, unless otherwise stated.
[0162] Although the invention has been described with reference to the foregoing examples, it should be understood that modifications and variations are covered within the spirit and scope of the invention. Therefore, the invention is limited only by the following claims.
[0163] Sequence List Independent Text
[0164] SEQ ID NO:1
[0165]
[0166] SEQ ID NO:2
[0167]
[0168] SEQ ID NO:3
[0169]
[0170] SEQ ID NO:4
[0171] SYWMY
[0172] SEQ ID NO:5
[0173] INRDGSATWY ADSVKGRFT
[0174] SEQ ID NO:6
[0175] DPDNYSSDEM VPY
[0176] SEQ ID NO:7
[0177] MKWVTFISLL FLFSSAYS
[0178] SEQ ID NO:8
[0179] VDEHHHHHHH HHH
[0180] SEQ ID NO:9
[0181]
[0182] SEQ ID NO:10
[0183]
[0184] SEQ ID NO:11
[0185]
[0186] SEQ ID NO:12
[0187] PSGQAGAAAS ESLFVSNHAY
[0188] SEQ ID NO:13
[0189] EASGGPE
[0190] SEQ ID NO:14
[0191] SGGGGSGGGG SGGGGSGGGG
[0192] SEQ ID NO:15
[0193] GSTSGSGKPG SGEGSTKG
[0194] SEQ ID NO:16
[0195] EPKSSDKTHT SPPSPEL
[0196] SEQ ID NO:17
[0197] RATPSHNSHQ VPSAGGPTAN SGTSG
[0198] SEQ ID NO:18
[0199] SSGGGGSGGG GGGSSRSSL
[0200] SEQ ID NO:19
[0201]
[0202] CDR1: Amino acids 31-35
[0203] CDR2: Amino acids 51-69
[0204] CDR3: Amino Acids 97-111
[0205] SEQ ID NO:20
[0206]
[0207] Amino acids 1-18: Leader
[0208] Amino acids 19-140: Humanized camCD16
[0209] Amino Acids 141-162: Connector
[0210] Amino Acids 163-284: Anti-B7H3 Clones
[0211] Amino Acid 285-297: VDE connector, 10X His tag
[0212] SEQ ID NO:21
[0213]
[0214] Amino acids 1-18: Leader
[0215] Amino acids 19-140: Humanized camCD16
[0216] Amino Acids 141-162: Connector
[0217] Amino acid 163-284: Anti-B7H3 clone 2
[0218] Amino Acid 285-297: VDE connector, 10X His tag
[0219] SEQ ID NO:22
[0220]
[0221]
[0222] Amino Acid 1-122: Humanized camCD16
[0223] Amino Acid 123-142: Connector
[0224] Amino acid 143-258: IL-15 fragment
[0225] Amino Acids 259-276: Connector
[0226] Amino acid 277-498: camB7H3 clone 1
[0227] SEQ ID NO:23
[0228]
[0229] Amino Acid 1-122: Humanized camCD16
[0230] Amino Acid 123-142: Connector
[0231] Amino acid 143-258: IL-15 fragment
[0232] Amino Acids 259-276: Connector
[0233] Amino acid 277-398: camB7H3 clone 2
[0234] SEQ ID NO:24
[0235]
[0236] Amino acids 1-18: Leader
[0237] Amino acids 19-140: Humanized camCD16
[0238] Amino Acids 141-162: Connector
[0239] Amino acid 163-276: IL-15 fragment
[0240] Amino Acid 277-294: Connector
[0241] Amino acid 295-416: camB7H3 clone 1
[0242] Amino Acids 417-429: VDE adapter and 10X His label
[0243] SEQ ID NO:25
[0244]
[0245] Amino acids 1-18: Leader
[0246] Amino acids 19-140: Humanized camCD16
[0247] Amino Acids 141-162: Connector
[0248] Amino acid 163-276: IL-15 fragment
[0249] Amino Acid 277-294: Connector
[0250] Amino acid 295-416: camB7H3 clone 2
[0251] Amino Acids 417-429: VDE adapter and 10X His label
[0252] SEQ ID NO:26
[0253]
[0254] SEQ ID NO:27
[0255]
[0256] SEQ ID NO:28
[0257]
[0258] SEQ ID NO:29
[0259]
[0260] SEQ ID NO:30
[0261]
[0262] Nucleotides 1-9: Kozak sequence
[0263] Nucleotide 10-900: Encodes SEQ ID NO:20
[0264] SEQ ID NO:31
[0265]
[0266] Nucleotides 1-9: Kozak sequence
[0267] Nucleotide 10-900: Encodes SEQ ID NO:21
[0268] SEQ ID NO:32
[0269]
[0270]
[0271] Nucleotides 1-9: Kozak sequence
[0272] Nucleotide 10-1296: Encodes SEQ ID NO:24
[0273] SEQ ID NO:33
[0274]
[0275] Nucleotides 1-9: Kozak sequence
[0276] Nucleotide 10-1296: Encoding the sequence listed in SEQ ID NO:25 <110> The Regents of the University of Minnesota <120> Proteins targeting B7H3 and their methods of use <130> 0110-000661WO01 <150> 63 / 033,989 <151> 2020-06-03 <160> 33 <170> PatentIn version 3.5 <210> 1 <211> 122 <212> PRT <213> artificial <220> <223> polypeptide <400> 1His Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr20 25 30Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp Val35 40 45Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp Ser Val50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Gly Tyr65 70 75 80Leu Gln Met Asn Ser Leu Glu Pro Asp Asp Thr Ala Val Tyr Tyr Cys85 90 95Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro Tyr Trp100 105 110Gly Gln Gly Thr Gln Val Thr Val Ser Ser115 120 <210> 2 <211> 122 <212> PRT <213> artificial <220> <223> polypeptide <400> 2Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr20 25 30Trp Met Tyr TrpVal Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp Val35 40 45Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp Ser Val50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Gly Tyr65 70 75 80Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys85 90 95Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro Tyr Trp100 105 110Gly Gln Gly Thr Gln Val Thr Val Ser Ser115 120 <210> 3 <211> 122 <212> PRT <213> artificial <220> <223> polypeptide <220> <221> Unclassified features <222> (1)..(122) <223> X is any amino acid. <400> 3Xaa Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Xaa1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr20 25 30Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp Val35 40 45Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp Ser Val50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Gly Tyr65 70 75 80Leu Gln Met Asn Ser Leu Xaa Pro Asp Asp Thr Ala Val Tyr Tyr Cys85 90 95Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro Tyr Trp100 105 110GlyGln Gly Thr Gln Val Thr Val Ser Ser115 120 <210> 4 <211> 5 <212> PRT <213> artificial <220> <223> polypeptide <400> 4Ser Tyr Trp Met Tyr1 5 <210> 5 <211> 19 <212> PRT <213> artificial <220> <223> polypeptide <400> 5Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp Ser Val Lys Gly1 5 10 15Arg Phe Thr <210> 6 <211> 13 <212> PRT <213> artificial <220> <223> polypeptide <400> 6Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro Tyr1 5 10 <210> 7 <211> 18 <212> PRT <213> artificial <220> <223> polypeptide <400> 7Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser <210> 8 <211> 13 <212> PRT <213> artificial <220> <223> polypeptide <400> 8Val Asp Glu His His His His His His His His His His1 5 10 <210> 9 <211> 153 <212> PRT <213> artificial <220> <223> polypeptide <400> 9Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser His Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser35 40 45Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu50 55 60Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr AlaAsp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr85 90 95Gly Tyr Leu Gln Met Asn Ser Leu Glu Pro Asp Asp Thr Ala Val Tyr100 105 110Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro115 120 125Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Val Asp Glu His130 135 140His His His His His His His His His145 150<210> 10<211> 153<212> PRT<213> Artificial<220><223> Polypeptide<400> 10Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser35 40 45Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu50 55 60Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr85 90 95Gly Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr100 105 110Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro"115 120 125Tyr Trp Gly GlnGly Thr Gln Val Thr Val Ser Ser Val Asp Glu His 130 135 140 His His His His His His His His His 145 150 <210> 11 <211> 114 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 1 Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile 1 5 10 15 Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His 20 25 30 Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln 35 40 45 Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu 50 55 60 Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly Asn Val 65 70 75 80 Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile 85 90 95 Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn 100 105 110 Thr Ser <210> 12 <211> 20 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 12 Pro Ser Gly Gln Ala Gly Ala Ala Ala Ser Glu Ser Leu Phe Val Ser 1 5 10 15 Asn His Ala Tyr 20 <210> 13 <211> 7 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 13 Glu Ala Ser Gly Gly Pro Glu 1 5 <210> 14 <211> 20 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 14 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly GlyGly Gly Ser 1 5 10 15 Gly Gly Gly Gly 20 <210> 15 <211> 18 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 15 Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr 1 5 10 15 Lys Gly <210> 16 <211> 17 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 16 Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Glu 1 5 10 15 Leu <210> 17 <211> 25 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 17 Arg Ala Thr Pro Ser His Asn Ser His Gln Val Pro Ser Ala Gly Gly 1 5 10 15 Pro Thr Ala Asn Ser Gly Thr Ser Gly 20 25 <210> 18 <211> 19 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 18 Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Ser Ser Arg 1 5 10 15 Ser Ser Leu <210> 19 <211> 122 <212> PRT <213> Artificial <220> <223> Polypeptide <400> 19 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Ser Tyr 20 25 30 Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu Ala Val 35 40 45 Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn ThrLeu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys85 90 95Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr Tyr Trp100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser115 120<210> 20<211> 297<212> PRT<213> Artificial<220><223> Polypeptide<400> 20Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser35 40 45Ser Tyr Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu50 55 60Ala Val Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr85 90 95Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr100 105 110Tyr Cys Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr115 120 125Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly130 135 140Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly145 150 155 160SerGly His Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro165 170 175Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser180 185 190Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu195 200 205Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp210 215 220Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr225 230 235 240Gly Tyr Leu Gln Met Asn Ser Leu Glu Pro Asp Asp Thr Ala Val Tyr245 250 255Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro260 265 270Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Val Asp Glu His275 280 285His His His His His His His His His290 295<210> 21<211> 297<212> PRT<213> 人工<220><223> 多肽<400> 21Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1 5 10 15Tyr Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser35 40 45Ser Tyr Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu50 55 60Ala Val Ala Ser Ile Thr 甘氨酸 组氨酸 缬氨酸 谷氨酰胺 亮氨酸 缬氨酸 谷氨酸 丝氨酸 甘氨酸 甘氨酸 甘氨酸 亮氨酸 缬氨酸 谷氨酰胺 脯氨酸165 170 175甘氨酸 精氨酸 丝氨酸 亮氨酸 精氨酸 亮氨酸 丝氨酸 半胱氨酸 丙氨酸 丙氨酸 丝氨酸 甘氨酸 苯丙氨酸 苏氨酸 苯丙氨酸 丝氨酸180 185 190丝氨酸 酪氨酸 色氨酸 甲硫氨酸 酪氨酸 色氨酸 缬氨酸 精氨酸 谷氨酰胺 苏氨酸 脯氨酸 甘氨酸 赖氨酸 甘氨酸 亮氨酸 谷氨酸195 200 205色氨酸 缬氨酸 丝氨酸 苏氨酸 异亮氨酸 天冬酰胺 精氨酸 天冬氨酸 甘氨酸 丝氨酸 Ala 苏氨酸 色氨酸 酪氨酸 丙氨酸 天冬氨酸210 215 220丝氨酸 缬氨酸 赖氨酸 甘氨酸 精氨酸 苯丙氨酸 苏氨酸 异亮氨酸 丝氨酸 精氨酸 天冬氨酸 天冬酰胺 丙氨酸 赖氨酸 天冬酰胺 苏氨酸225 230 235 240甘氨酸 酪氨酸 亮氨酸 谷氨酰胺 甲硫氨酸 天冬酰胺 丝氨酸 亮氨酸 谷氨酸 脯氨酸 天冬氨酸 天冬氨酸 苏氨酸 丙氨酸 缬氨酸 酪氨酸245 250 255酪氨酸 半胱氨酸 缬氨酸 丝氨酸 天冬氨酸 脯氨酸 天冬氨酸 天冬酰胺 酪氨酸 丝氨酸 丝氨酸 天冬氨酸 谷氨酸 甲硫氨酸 缬氨酸 脯氨酸260 265 270酪氨酸 色氨酸 甘氨酸 谷氨酰胺 甘氨酸 苏氨酸 谷氨酰胺 缬氨酸 苏氨酸 缬氨酸 丝氨酸 丝氨酸 缬氨酸 天冬氨酸 谷氨酸 组氨酸275 280 285组氨酸 组氨酸 组氨酸 组氨酸 组氨酸 组氨酸 组氨酸 组氨酸 组氨酸290 295<210> 21<211> 297<212> PRT<213> 人工<220><223> 多肽<400> 21甲硫氨酸 赖氨酸 色氨酸 缬氨酸 苏氨酸 苯丙氨酸 异亮氨酸 丝氨酸 亮氨酸 亮氨酸 苯丙氨酸 亮氨酸 苯丙氨酸 丝氨酸 丝氨酸 丙氨酸1 5 10 15酪氨酸 丝氨酸 谷氨酰胺 缬氨酸 谷氨酰胺 亮氨酸 缬氨酸 谷氨酸 丝氨酸 甘氨酸 甘氨酸 甘氨酸 亮氨酸 缬氨酸 谷氨酰胺 脯氨酸20 25 30甘氨酸 甘氨酸 丝氨酸 亮氨酸 精氨酸 亮氨酸 丝氨酸 半胱氨酸 丙氨酸 丙氨酸 丝氨酸 甘氨酸 亮氨酸 苏氨酸 苯丙氨酸 丝氨酸35 40 45丝氨酸 酪氨酸 天冬酰胺 甲硫氨酸 甘氨酸 色氨酸 苯丙氨酸 精氨酸 谷氨酰胺 丙氨酸 脯氨酸 甘氨酸 谷氨酰胺 甘氨酸 亮氨酸 谷氨酸50 55 60丙氨酸 缬氨酸 丙氨酸 丝氨酸 异亮氨酸 苏氨酸Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr85 90 95Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr100 105 110Tyr Cys Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr115 120 125Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly130 135 140Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly145 150 155 160Ser Gly Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro165 170 175Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser180 185 190Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu195 200 205Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr Ala Asp210 215 220Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr225 230 235 240Gly Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr245 250 255Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met Val Pro260 265 270Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Val AspGlu His275 280 285His His His His His His His His His290 295<210> 22<211> 398<212> PRT<213> Artificial<220><223> Polypeptide<400> 22Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Ser Tyr20 25 30Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu Ala Val35 40 45Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp Ser Val50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys85 90 95Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr Tyr Trp100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly Gly Ser115 120 125Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly130 135 140Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile145 150 155 160Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His165 170 175Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln180 185 190Val IleSer Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu195 200 205Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly Asn Val210 215 220Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile225 230 235 240Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn245 250 255Thr Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly260 265 270Ser Thr Lys Gly His Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val275 280 285Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr290 295 300Phe Ser Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly305 310 315 320Leu Glu Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr325 330 335Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys340 345 350Asn Thr Gly Tyr Leu Gln Met Asn Ser Leu Glu Pro Asp Asp Thr Ala355 360 365Val Tyr Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met370 375 380Val Pro Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser385 390 395<210> 23<211> 398<212> PRT<213> Artificial<220><223>Polypeptide <400> 23 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Ser Tyr20 25 30 Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu Ala Val35 40 45 Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp Ser Val50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys85 90 95 Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr Tyr Trp100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly Gly Ser115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly130 135 140 Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile145 150 155 160 Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His165 170 175 Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln180 185 190 Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu195 200 205 Asn Leu Ile Ile Leu Ala Asn Asn SerLeu Ser Ser Asn Gly Asn Val 210 215 220 Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile 225 230 235 240 Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn 245 250 255 Thr Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly 260 265 270 Ser Thr Lys Gly Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val 275 280 285 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 290 295 300 Phe Ser Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly Lys Gly 305 310 315 320 Leu Glu Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr Trp Tyr 325 330 335 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys 340 345 350 Asn Thr Gly Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala 355 360 365 Val Tyr Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp Glu Met 370 375 380 Val Pro Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 385 390 395 <210> 24 <2Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser35 40 45Ser Tyr Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu50 55 60Ala Val Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr85 90 95Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr100 105 110Tyr Cys Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr115 120 125Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly130 135 140Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly145 150 155 160Ser Gly Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp165 170 175Leu Ile Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp180 185 190Val His Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu195 200 205Leu Gln Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr210 215 220Val Glu Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly225230 235 240Asn Val Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys245 250 255Asn Ile Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe260 265 270Ile Asn Thr Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly275 280 285Glu Gly Ser Thr Lys Gly His Val Gln Leu Val Glu Ser Gly Gly Gly290 295 300Leu Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly305 310 315 320Phe Thr Phe Ser Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly325 330 335Lys Gly Leu Glu Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr340 345 350Trp Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn355 360 365Ala Lys Asn Thr Gly Tyr Leu Gln Met Asn Ser Leu Glu Pro Asp Asp370 375 380Thr Ala Val Tyr Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp385 390 395 400Glu Met Val Pro Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser405 410 415Val Asp Glu His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His His HisSer Ser Ala1 5 10 15Tyr Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser35 40 45Ser Tyr Asn Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Gly Leu Glu50 55 60Ala Val Ala Ser Ile Thr Trp Ser Gly Arg Asp Thr Phe Tyr Ala Asp65 70 75 80Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr85 90 95Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr100 105 110Tyr Cys Ala Ala Asn Pro Trp Pro Val Ala Ala Pro Arg Ser Gly Thr115 120 125Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ser Gly Gly Gly130 135 140Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly145 150 155 160Ser Gly Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp165 170 175Leu Ile Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp180 185 190Val His Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu195 200 205Leu Gln Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr210 215 220Val Glu Asn Leu Ile IleLeu Ala Asn Asn Ser Leu Ser Ser Asn Gly 225 230 235 240 Asn Val Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys 245 250 255 Asn Ile Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe 260 265 270 Ile Asn Thr Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly 275 280 285 Glu Gly Ser Thr Lys Gly Gln Val Gln Leu Val Glu Ser Gly Gly Gly 290 295 300 Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly 305 310 315 320 Phe Thr Phe Ser Ser Tyr Trp Met Tyr Trp Val Arg Gln Thr Pro Gly 325 330 335 Lys Gly Leu Glu Trp Val Ser Thr Ile Asn Arg Asp Gly Ser Ala Thr 340 345 350 Trp Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 355 360 365 Ala Lys Asn Thr Gly Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp 370 375 380 Thr Ala Val Tyr Tyr Cys Val Ser Asp Pro Asp Asn Tyr Ser Ser Asp 385 390 395 400 Glu Met Val Pro Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 405 410 415 Val Asp Glu His His His His His His His His His 420 425 <210> 26 <211> 366 <212> DNA <213> Artificial <220> <223> Polynucleotide <400>26catgtgcagc tggtggagtc tgggggaggc ttggtgcagc ctgggaggtc tctgagactc 60tcctgtgcag cctctggatt caccttcagt agctactgga tgtactgggt ccgccagact 120ccagggaagg ggctcgagtg ggtctcaact attaatcgtg atggtagtgc cacatggtat 180gcagactcag tgaagggccg attcaccatc tccagagaca acgccaagaa cacggggtat 240ctgcaaatga acagcctgga acctgacgac acggccgtgt attactgtgt gagcgatccg 300gacaactact ctagcgatga gatggtccct tactggggcc aggggaccca ggtcaccgtc 360tcctca 366<210> 27<211> 366<212> DNA<213> Artificial<220><223> Polynucleotide<400> 27caggtgcagc tggtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60tcctgtgcag cctctggatt caccttcagt agctactgga tgtactgggt ccgccagact 120ccagggaagg ggctcgagtg ggtctcaact attaatcgtg atggtagtgc cacatggtat 180gcagactcag tgaagggccg attcaccatc tccagagaca acgccaagaa cacggggtat 240ctgcaaatga acagcctgaa acctgacgac acggccgtgt attactgtgt gagcgatccg 300gacaactact ctagcgatga gatggtccct tactggggcc aggggaccca ggtcaccgtc 360tcctca 366<210> 28<211> 459<212> DNA<213> Artificial<220><223> Polynucleotide<400> 28atgaagtggg taacctttat ttcccttctttttctcttta gctcggctta ttcccacgtt 60cagctcgttg aatcaggcgg tgggctcgtg cagcctggaa gatctctccg cttgagctgc 120gcggcttcag gctttacctt ttccagttat tggatgtatt gggtccggca gacgccagga 180aaggggcttg aatgggtgtc aacgatcaac cgggacggca gcgcaacctg gtatgccgac 240tccgttaaag ggaggttcac aataagccga gacaatgcga aaaacacagg atacctgcaa 300atgaatagct tggagcctga tgatacggct gtatattatt gcgtgtctga tcccgacaac 360tatagtagtg acgagatggt cccatattgg gggcagggaa cacaagtcac agtctccagc 420gtcgacgagc atcatcatca tcaccaccac caccaccac 459<210> 29<211> 459<212> DNA<213> 人工<220><223> 多核苷酸<400> 29atgaagtggg taacctttat ttcccttctt tttctcttta gctcggctta ttcccaggtg 60cagctggtgg agtctggggg aggcttggtg cagcctgggg ggtcactgag actctcctgt 120gcagcctctg gattcacctt cagtagctac tggatgtact gggtccgcca gactccaggg 180aaggggctcg agtgggtatc aactattaat cgtgatggta gtgccacatg gtatgcagac 240tcagtgaagg gccgattcac catctccaga gacaacgcca agaacacggg gtatctgcaa 300atgaacagcc tgaaacctga cgacacggcc gtgtattact gtgtgagcga tccggacaac 360tactctagcg atgagatggt cccttactgg tttctcttta gctcggctta ttcccacgtt 60cagctcgttg aatcaggcgg tgggctcgtg cagcctggaa gatctctccg cttgagctgc 120gcggcttcag gctttacctt ttccagttat tggatgtatt gggtccggca gacgccagga 180aaggggcttg aatgggtgtc aacgatcaac cgggacggca gcgcaacctg gtatgccgac 240tccgttaaag ggaggttcac aataagccga gacaatgcga aaaacacagg atacctgcaa 300atgaatagct tggagcctga tgatacggct gtatattatt gcgtgtctga tcccgacaac 360tatagtagtg acgagatggt cccatattgg gggcagggaa cacaagtcac agtctccagc 420gtcgacgagc atcatcatca tcaccaccac caccaccac 459<210> 29<211> 459<212> DNA<213> artificial<220><223> polynucleotide<400> 29atgaagtggg taacctttat ttcccttctt tttctcttta gctcggctta ttcccaggtg 60cagctggtgg agtctggggg aggcttggtg cagcctgggg ggtcactgag actctcctgt 120gcagcctctg gattcacctt cagtagctac tggatgtact gggtccgcca gactccaggg 180aaggggctcg agtgggtatc aactattaat cgtgatggta gtgccacatg gtatgcagac 240tcagtgaagg gccgattcac catctccaga gacaacgcca agaacacggg gtatctgcaa 300atgaacagcc tgaaacctga cgacacggcc gtgtattact gtgtgagcga tccggacaac 360tatactctagcg atgagatggt cccttactggggccagggga cccaggtcac cgtctcctca 420gtcgacgagc atcatcatca tcaccaccac caccaccac 459<210> 30<211> 900<212> DNA<213> Artificial<220><223> Polynucleotide<400> 30gccgccacca tgaagtgggt aacctttatt tcccttcttt ttctctttag ctcggcttat 60tcccaggtgc agctggtgga gtctggggga ggcttggtgc agcctggggg ctctctgaga 120ctctcctgtg cagcctctgg cctcaccttc agtagctata acatgggctg gttccgccag 180gctccagggc aaggccttga ggctgtagca tctattacct ggagtggtcg ggacacattc 240tatgcagact ccgtgaaggg ccgattcacc atctccagag acaactccaa gaacactctc 300tatctgcaaa tgaacagcct gcgcgcggag gacacggccg tttattattg tgctgcaaac 360ccctggccag tggcggcgcc acgtagtggc acctactggg gccaagggac cctggtcacc 420gtctcctcat ctggcggcgg cggttctggt ggaggaggta gtgggggggg aggaagcgga 480gggggtggct cagggcacgt tcagctcgtt gaatcaggcg gtgggctcgt gcagcctgga 540agatctctcc gcttgagctg cgcggcttca ggctttacct tttccagtta ttggatgtat 600tgggtccggc agacgccagg aaaggggctt gaatgggtgt caacgatcaa ccgggacggc 660agcgcaacct ggtatgccga ctccgttaaa gggaggttca caataagccg agacaatgcg 720aaaaacacag gatacctgca aatgaatagcttggagcctg atgatacggc tgtatattat 780tgcgtgtctg atcccgacaa ctatagtagt gacgagatgg tcccatattg ggggcaggga 840acacaagtca cagtctccag cgtcgacgag catcatcatc atcaccacca ccaccaccac 900<210> 31<211> 900<212> DNA<213> Artificial<220><223> Polynucleotide<400> 31gccgccacca tgaagtgggt aacctttatt tcccttcttt ttctctttag ctcggcttat 60tcccaggtgc agctggtgga gtctggggga ggcttggtgc agcctggggg ctctctgaga 120ctctcctgtg cagcctctgg cctcaccttc agtagctata acatgggctg gttccgccag 180gctccagggc aaggccttga ggctgtagca tctattacct ggagtggtcg ggacacattc 240tatgcagact ccgtgaaggg ccgattcacc atctccagag acaactccaa gaacactctc 300tatctgcaaa tgaacagcct gcgcgcggag gacacggccg tttattattg tgctgcaaac 360ccctggccag tggcggcgcc acgtagtggc acctactggg gccaagggac cctggtcacc 420gtctcctcat ctggcggcgg cggttctggt ggaggaggta gtgggggggg aggaagcgga 480gggggtggct cagggcaggt gcagctggtg gagtctgggg gaggcttggt gcagcctggg 540gggtcactga gactctcctg tgcagcctct ggattcacct tcagtagcta ctggatgtac 600tgggtccgcc agactccagg gaaggggctc gagtgggtat caactattaa tcgtgatggt 660agtgccacatggtatgcaga ctcagtgaag ggccgattca ccatctccag agacaacgcc 720aagaacacgg ggtatctgca aatgaacagc ctgaaacctg acgacacggc cgtgtattac 780tgtgtgagcg atccggacaa ctactctagc gatgagatgg tcccttactg gggccagggg 840acccaggtca ccgtctcctc agtcgacgag catcatcatc atcaccacca ccaccaccac 900<210> 32<211> 1296<212> DNA<213> 人工<220><223> 多核苷酸<400> 32gccgccacca tgaagtgggt aacctttatt tcccttcttt ttctctttag ctcggcttat 60tcccaggtgc agctggtgga gtctggggga ggcttggtgc agcctggggg ctctctgaga 120ctctcctgtg cagcctctgg cctcaccttc agtagctata acatgggctg gttccgccag 180gctccagggc aaggccttga ggctgtagca tctattacct ggagtggtcg ggacacattc 240tatgcagact ccgtgaaggg ccgattcacc atctccagag acaactccaa gaacactctc 300tatctgcaaa tgaacagcct gcgcgcggag gacacggccg tttattattg tgctgcaaac 360ccctggccag tggcggcgcc acgtagtggc acctactggg gccaagggac cctggtcacc 420gtctcctcat ctggcggcgg cggttctggt ggaggaggta gtgggggggg aggaagcgga 480gggggtggct cagggaactg ggtgaatgta ataagtgatt tgaaaaaaat tgaagatctt 540attcaatcta tgcatattga tgctacttta tatacggaaa gtgatgttca ggtatgcaga ctcagtgaag ggccgattca ccatctccag agacaacgcc 720aagaacacgg ggtatctgca aatgaacagc ctgaaacctg acgacacggc cgtgtattac 780tgtgtgagcg atccggacaa ctactctagc gatgagatgg tcccttactg gggccagggg ८५० ३२<२१०> ३२<२११> १२९६<२१२> DNA<२१३> Artificial<२२०><२२३> Polynucleotide<४००> ३२gccgccacca tgaagtgggt aacctttatt tcccttcttt ttctctttag ctcggcttat ६०tcccaggtgc agctggtgga gtctggggga ggcttggtgc agcctggggg ctctctgaga १२०ctctcctgtg cagcctctgg cctcaccttc agtagctata acatgggctg gttccgccag १८०gctccagggc aaggccttga ggctgtagca tctattacct ggagtggtcg ggacacattc २४०tatgcagact ccgtgaaggg ccgattcacc atctccagag acaactccaa gaacactctc ३००tatctgcaaa tgaacagcct gcgcgcggag gacacggccg tttattattg tgctgcaaac ३६०ccctggccag tggcggcgcc acgtagtggc acctactggg gccaagggac cctggtcacc ४२०gtctcctcat ctggcggcgg cggttctggt ggaggaggta gtgggggggg aggaagcgga ४८०gggggtggct cagggaactg ggtgaatgta ataagtgatt tgaaaaaaat tgaagatctt ५४०attcaatcta tgcatattga tgctacttta tatacggaaa gtgatgttcaccccagttgc 600aaagtaacag caatgaagtg ctttctcttg gagttacaag ttatttcact tgagtccgga 660gatgcaagta ttcatgatac agtagaaaat ctgatcatcc tagcaaacaa cagtttgtct 720tctaatggga atgtaacaga atctggatgc aaagaatgtg aggaactgga ggaaaaaaat 780attaaagaat ttttgcagag ttttgtacat attgtccaaa tgttcatcaa cacttctggc 840agtaccagcg ggtcagggaa acctggcagt ggggaaggtt ccacaaaagg tcacgttcag 900ctcgttgaat caggcggtgg gctcgtgcag cctggaagat ctctccgctt gagctgcgcg 960gcttcaggct ttaccttttc cagttattgg atgtattggg tccggcagac gccaggaaag 1020gggcttgaat gggtgtcaac gatcaaccgg gacggcagcg caacctggta tgccgactcc 1080gttaaaggga ggttcacaat aagccgagac aatgcgaaaa acacaggata cctgcaaatg 1140aatagcttgg agcctgatga tacggctgta tattattgcg tgtctgatcc cgacaactat 1200agtagtgacg agatggtccc atattggggg cagggaacac aagtcacagt ctccagcgtc 1260gacgagcatc atcatcatca ccaccaccac caccac 1296<210> 33<211> 1296<212> DNA<213> Artificial<220><223> Polynucleotide<400> 33gccgccacca tgaagtgggt aacctttatt tcccttcttt ttctctttag ctcggcttat 60tcccaggtgc agctggtgga gtctggggga ggcttggtgcagcctgggg ctctctgaga 120ctctcctgtg cagcctctgg cctcacctt agtagctata acatgggctg gttccgccag 180gctccagggc aaggccttga ggctgtagca tctattacct ggagtggtcg ggacacattc 240tatgcagact ccgtgaaggg ccgattcacc atctccagag acaactccaa gaacactctc 300tatctgcaaa tgaacagcct gcgcgcggag gacacggccg tttattattg tgctgcaaac 360ccctggccag tggcggcgcc acgtagtggc acctactggg gccaagggac cctggtcacc 420gtctcctcat ctggcggcgg cggttctggt ggaggaggta gtgggggggg aggaagcgga 480gggggtggct cagggaactg ggtgaatgta ataagtgatt tgaaaaaat tgaagatctt 540attcaatcta tgcatattga tgctacttta tatacggaaa gtgatgttca ccccagttgc 600aaagtaacag caatgaagtg ctttctcttg gagttacaag ttattcact tgagtccgga 660gatgcaagta ttcatgatac agtagaaaat ctgatcatcc tagcaaacaa cagtttgtct 720tctaatggga atgtaacaga atctggatgc aaagaatgtg aggaactgga ggaaaaaaaat 780attaaagaat ttttgcagag ttttgtacat attgtccaaa tgttcatcaa cacttctggc 840agtaccagcg ggtcagggaa acctggcagt ggggaaggtt ccacaaaagg tcaggtgcag 900ctggtggagt ctgggggagg cttggtgcag cctgggggt cactgagact ctcctgtgca960gcctctggat tcaccttcag tagctactgg atgtactggg tccgccagac tccagggaag 1020gggctcgagt gggtatcaac tattaatcgt gatggtagtg ccacatggta tgcagactca 1080gtgaagggcc gattcaccat ctccagagac aacgccaaga acacggggta tctgcaaatg 1140aacagcctga aacctgacga cacggccgtg tattactgtg tgagcgatcc ggacaactac 1200tctagcgatg agatggtccc ttactggggc caggggaccc aggtcaccgt ctcctcagtc 1260gacgagcatc atcatcatca ccaccaccac caccac 1296
Claims
1. An anti-B7H3 single-domain antibody comprising SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:
6.
2. An anti-B7H3 single-domain antibody comprising SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:
3.
3. A multispecific compound comprising: a targeting domain comprising an anti-B7H3 single-domain antibody comprising: SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6; or SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3; and an immune cell conjugating domain operatively linked to the targeting domain.
4. The multispecific compound of claim 3, wherein the immune cell is a T cell or a natural killer (NK) cell.
5. The multispecific compound of claim 4, wherein the immune cell is an NK cell; and the immune cell binding domain comprises a ligand or antibody that specifically binds to CD16.
6. The multispecific compound of any one of claims 3-5, wherein the immune cell binding domain comprises SEQ ID NO:19; and the targeting domain comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:
3.
7. The multispecific compound of claim 6, wherein the targeting domain and the immune cell adaptor domain are linked by SEQ ID NO:
14.
8. The multispecific compound of claim 6, wherein the compound comprises amino acids 19-294 of SEQ ID NO:20 or amino acids 19-284 of SEQ ID NO:
21.
9. The multispecific compound of any one of claims 3-5 and 7-8, further comprising an immune cell activation domain.
10. The multispecific compound of claim 9, wherein the immune cell comprises an NK cell; and the immune cell activation domain comprises a cytokine or a functional portion thereof.
11. The multispecific compound of claim 10, wherein the cytokine is IL-15 or a functional variant thereof.
12. The multispecific compound of any one of claims 10-11, wherein the compound comprises: SEQ ID NO:19; SEQ ID NO:11 operatively connected to SEQ ID NO:19; and a targeting domain operatively connected to SEQ ID NO:19 and SEQ ID NO:11, wherein the targeting domain comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:
3.
13. The multispecific compound of claim 12, wherein SEQ ID NO:19 and SEQ ID NO:11 are linked by SEQ ID NO:14; and SEQ ID NO:11 is linked to the target domain by SEQ ID NO:
15.
14. The multispecific compound of claim 13, wherein the compound is as shown in SEQ ID NO:22 or SEQ ID NO:
23.
15. The multispecific compound of any one of claims 11 and 13-14, wherein the functional variant of IL-15 comprises an N72D or N72A amino acid substitution compared to SEQ ID NO:
11.
16. An isolated nucleic acid sequence encoding a multispecific compound as described in any one of claims 3-15.
17. The isolated nucleic acid sequence of claim 16, wherein the sequence is any one of SEQ ID NO:26-33.
18. A protein encoded by any one of the nucleic acid sequences as described in claim 16.
19. The protein of claim 18, wherein the protein comprises the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24 or SEQ ID NO:
25.
20. A host cell comprising the isolated nucleic acid as described in claim 16 or claim 17.
21. The host cell of claim 20, wherein the cell is a T cell, NK cell, or macrophage.
22. A pharmaceutical composition comprising: a multispecific compound as described in any one of claims 3-15; and a pharmaceutically acceptable carrier.
23. Use of a multispecific compound in the preparation of a medicament for treating a subject with or at risk of developing cancer, the multispecific compound comprising: a targeting domain comprising an anti-B7H3 single-domain antibody as described in claim 1 or claim 2; and an NK-binding domain operatively linked to the anti-B7H3 single-domain antibody, wherein the cancer is selected from ovarian cancer, prostate cancer, and non-small cell lung cancer.
24. The use as claimed in claim 23, wherein the multispecific compound further comprises an immune cell activation domain comprising IL-15 or a functional portion thereof, operatively linked to the NK binding domain.
25. The use as claimed in claim 23, wherein the multispecific compound is shown in any one of SEQ ID NO:20-25.
26. The use as described in claim 23, wherein the cancer cells express B7H3.
27. The use as described in claim 23, wherein the multispecific compound is administered before, during, or after chemotherapy, surgical resection of a tumor, or radiotherapy.
28. The use as described in claim 27, wherein the chemotherapy comprises hexamethylmelamine, acridine, L-asparaginase, asparaginase, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, cyclophosphamide, cyclophosphamide, cytarabine, dacarbazine, daunomycin, docetaxel, doxorubicin, epirubicin, etoposide, fluorouracil, and fludara. Labin, Formosine, Ganciclovir, Gemcitabine, Hydroxyurea, Idarubicin, Ifosfamide, Irinotecan, Lomustine, Melphalan, Mercaptopurine, Methotrexate, Mitoxantrone, Mitomycin C, Nimustine, Oxaliplatin, Paclitaxel, Pemetrexed, Procarbazine, Raltitrexed, Temozolomide, Teniposide, Thioguanine, Thiotepa, Topotecan, Vincristine, Vincristine, Vincristine, or Vinorelbine.
29. A chimeric antigen receptor compound comprising the anti-B7H3 single-domain antibody as described in claim 1 or claim 2.
30. A targeted immunotherapy compound comprising: a targeting domain comprising an anti-B7H3 single-domain antibody as described in claim 1 or claim 2; and an immunotherapy domain connected to the targeting domain.
31. A targeted therapeutic compound comprising: a targeting domain comprising an anti-B7H3 single-domain antibody as described in claim 1 or claim 2; and a therapeutic domain connected to the targeting domain.
32. The targeted therapeutic compound of claim 31, wherein the therapeutic domain comprises a drug, a therapeutic radioisotope, a toxin, a cytokine, or a chemokine.
33. A targeted imaging compound comprising: a targeting domain comprising an anti-B7H3 single-domain antibody as described in claim 1 or claim 2; and an imaging domain connected to the targeting domain.
34. The targeted imaging compound of claim 33, wherein the imaging domain comprises colorimetric labeling, fluorescent labeling, radioactive labeling, magnetic labeling, or enzyme labeling.
35. A capture assay device comprising an anti-B7H3 single-domain antibody as described in claim 1 or claim 2, immobilized on a substrate.
Citation Information
Patent Citations
Method and apparatuses for providing uniform electron beams from field emission displays
US20020190663A1
Nucleic Acid Purification
US20100285578A1
Therapeutic compounds and methods
US20180282386A1
Process for isolating nucleic acid
US5234809A
Apparatuses and methods for isolating nucleic acid
US7776616B2