Single-stranded circular DNA virus GyH1 recombinant polyepitope adenovirus vector vaccine and application thereof

By constructing a GyH1 recombinant multi-epitope adenovirus vector vaccine, the problem of the lack of effective control over GyH1 virus in existing technologies has been solved. It achieves efficient induction of immune response and protective effect in chickens, and has good market competitiveness and safety.

CN115974987BActive Publication Date: 2025-12-05SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211308871.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-25
Publication Date
2025-12-05
Estimated Expiration
2042-10-25

AI Technical Summary

Technical Problem

There is a lack of effective prevention and control measures for single-stranded circular DNA virus GyH1, especially the GyH1 virus that causes infectious proventriculitis in chickens. Furthermore, existing vaccine research only involves the antigenic epitope regions of the VP1 and VP2 proteins of the GyH1 virus, which has failed to fully stimulate an immune protective response.

Method used

A recombinant multi-epitope adenovirus vector vaccine against the single-stranded circular DNA virus GyH1 was constructed by linking the epitope regions of the GyH1 virus VP1, VP2, and VP3 proteins on CD8+ T cells, CD4+ T cells, and B cells into an antigenic epitope polypeptide, which was then inserted into a human type 5 replication-defective adenovirus vector to construct a recombinant plasmid and prepare the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV.

Benefits of technology

This vaccine can induce strong cellular and humoral immune responses in chickens, has good immunogenicity and protective properties, avoids the influence of pre-existing adenovirus antibodies, has high safety, does not require the addition of adjuvants, is suitable for multiple immunization routes, is low in cost, and has broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115974987B_ABST
    Figure CN115974987B_ABST
Patent Text Reader

Abstract

The application discloses a single-chain circular DNA virus GyH1 recombinant polyepitope adenovirus vector vaccine and application thereof, and belongs to the technical field of vaccines.The antigen epitopes of GyH1 VP1, VP2 and VP3 proteins are screened through an online bioinformation analysis server, the antigen epitopes are connected by using a linker to construct a polyepitope vaccine GyMEV, and the nucleotide sequence of the GyMEV is obtained through reverse translation and codon optimization.The antigen polypeptide GyMEV nucleotide sequence is cloned into a plasmid vector pMD19-T through artificial synthesis, the GyMEV is directionally cloned into a linearized adenovirus vector by using seamless cloning technology to obtain a recombinant adenovirus plasmid rAd5-GyMEV, and the recombinant plasmid is transfected into HEK 293 cells to obtain the recombinant polyepitope adenovirus vector vaccine GyMEV.The results show that the GyMEV can more effectively stimulate the immune response of the body and has stronger protection.The vaccine also has the safety of a subunit vaccine and can adopt various immunization modes, can stimulate the immune response of the body in all directions, and thus has a wide development and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of vaccine technology, and in particular to a single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and its application. BACKGROUND

[0002] Transmissible viral proventriculitis (TVP) is an infectious disease characterized by enlarged and underdeveloped gizzard and low feed conversion rate, which has caused great harm to the poultry industry in China. However, the pathogenic agent of TVP has not been determined. Against this background, Li Gen et al. isolated and identified a new virus GyV3 from diseased chickens with transmissible viral proventriculitis by Pacbio third-generation sequencing, and reproduced TVP using the pure culture of GyV3. Further studies confirmed that GyV3 is one of the pathogens causing chicken transmissible proventriculitis, and also causes anemia and immunosuppression in chicks ("Isolation and identification of chicken transmissible proventriculitis virus Gyrovirus 3 and its pathogenic mechanism", doctoral dissertation of Shandong Agricultural University). In addition, GyV3 can also cross-species transmission to infect mice, causing anemia and enteritis in mice, and is a potential zoonotic virus that endangers public health safety. Through genetic evolution analysis, in 2021, Kraberger et al. changed the name of Gyrovirus 3 (Gyrovirus 3, GyV3) to Gyrovirus homsal (Gyrovirus homsal, GyH 1) according to the similarity of genetic structure and the species found.

[0003] Since GyH 1 is a new type of single-stranded circular DNA virus (GenBank accession number MG366592, original virus name "Gyrovirus GyV3") first identified in chickens with proventriculitis, there is currently a lack of effective prevention and control measures for GyH 1.

[0004] Vaccines are an effective means of preventing and controlling viral infections, but there are few reports of GyH 1 virus vaccines. In order to obtain a vaccine with strong immunogenicity and good effect, Jia Meiyu prepared a subunit vaccine and a DNA vaccine, selected the 90th to 463rd amino acids of VP1 for expression to prepare a subunit vaccine, and expressed the 90th to 463rd amino acids of VP1 and VP2 in series through a flexible amino acid linker to prepare a subunit vaccine; constructed a pEGFP-VP1 eukaryotic expression plasmid for the inoculation of chicken DNA vaccine. The results showed that the immunogenicity and immunoprotection of the subunit vaccine were superior to those of the DNA vaccine; the immunogenicity and immunoprotection of the subunit vaccine prepared by linking VP1 and VP2 through a flexible amino acid linker were superior to those of the subunit vaccine prepared by expressing the 90th to 463rd amino acids of VP1. 90-463 Subunit vaccine is superior to VP1 90-463The -VP2 subunit vaccine indicates that VP1+VP2 did not achieve better results. Since the above study only involved the antigenic epitope regions of the VP1 and VP2 proteins of the GyH1 virus, further in-depth research is needed on vaccines against the GyH1 virus. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides an antigenic epitope polypeptide of a single-stranded circular DNA virus GyH1, comprising:

[0008] (1) CD8 of GyH1 virus VP1, VP2 and VP3 proteins + T cell epitope regions;

[0009] (2) CD4 of GyH1 virus VP1, VP2 and VP3 proteins + T cell epitope regions;

[0010] (3) B-cell epitope regions of GyH1 virus VP1, VP2 and VP3 proteins;

[0011] (4) Linker;

[0012] The CD8 + The T-cell epitope region is selected from one or more segments of the amino acid sequences shown in SEQ ID NO.9-SEQ ID NO.16;

[0013] The CD4 + The T-cell epitope region is selected from one or more segments of the amino acid sequences shown in SEQ ID NO.17-SEQ ID NO.24;

[0014] The B-cell epitope region is selected from one or more segments of the amino acid sequences shown in SEQ ID NO.25-SEQ ID NO.36.

[0015] Preferably, the sequence of the Linker arm is AAY, GGPPG and / or KK.

[0016] Preferably, the amino acid sequence of the antigenic epitope polypeptide is shown in SEQ ID NO.4, specifically as follows:

[0017]

[0018] Note: the shaded area in the sequence is the linker.

[0019] In a second aspect of the present application, a gene encoding the antigenic epitope polypeptide is provided.

[0020] Preferably, the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 8.

[0021] In a third aspect of the present application, a biological material containing the gene encoding the antigenic epitope polypeptide is provided, and the biological material is a recombinant expression vector, an expression cassette, a recombinant bacteria or a host cell.

[0022] In a fourth aspect of the present application, the antigenic epitope polypeptide or the gene encoding the antigenic epitope polypeptide is used in the preparation of a vaccine for preventing GyH1 virus infection.

[0023] Preferably, the vaccine is in the form of an adenovirus vector vaccine, a subunit vaccine or a DNA vaccine; more preferably, the vaccine is in the form of an adenovirus vector vaccine.

[0024] In a fifth aspect of the present application, a single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine is provided, which is constructed by the following method:

[0025] The gene encoding the antigenic epitope polypeptide is inserted into an adenovirus vector to construct a recombinant plasmid, and then the recombinant plasmid is packaged and processed to obtain a recombinant multi-epitope adenovirus vector vaccine with immunogenicity.

[0026] Preferably, the adenovirus vector is a human 5-type replication-defective adenovirus.

[0027] In a sixth aspect of the present application, the single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine is used in the preparation of a medicine for preventing or treating GyH1 infection.

[0028] The present application has the following advantages:

[0029] (1) The present application develops a recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV based on an adenovirus vector for the first time. Since the human 5-type adenovirus is not prevalent in chicken population, the vaccine of the present application will not be affected by pre-existing adenovirus antibodies in the chicken body.

[0030] (2) In the present application, the adenovirus vector vaccine is safe and does not need to add adjuvants, and can be used for muscle immunization or oral immunization, etc., and has good market competitiveness.

[0031] (3) The novel GyH1 preventive vaccine of the present application not only has originality, but also has good immunogenicity and feasibility, and a single muscle injection can induce high levels of specific antibody response and cellular response in the chicken body.

[0032] (4) The GyH1 preventive vaccine is prepared based on a human replication-defective 5 adenovirus vector, and is expected to obtain a vaccine product with simple preparation, low cost, good safety, no need to add an adjuvant and wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 A secondary structure diagram of the antigen polypeptides A, B and C and the polyepitope vaccine GyMEV constructed in the application;

[0034] Figure 2 A tertiary structure diagram of the antigen polypeptide polyepitope vaccine GyMEV constructed in the application;

[0035] Figure 3 A molecular dynamics diagram of the antigen polypeptide polyepitope vaccine GyMEV constructed in the application;

[0036] Figure 4 A fluorescence microscope observation result diagram of HEK 293 cells infected with the recombinant polyepitope adenovirus plasmid for seven days;

[0037] Figure 5 A diagram of rapid titration method for detecting and quantifying the virus titer of the recombinant polyepitope adenovirus vector vaccine candidate strain;

[0038] Figure 6 A diagram of the antibody growth and decline law of each group of chickens in the clinical experiment;

[0039] Figure 7 A diagram of immunogenicity detection of each group of chickens in the clinical experiment;

[0040] Figure 8 A diagram of body weight detection of each group of chickens in the clinical experiment;

[0041] Figure 9 A pathological tissue section diagram of each group of chickens in the clinical experiment. DETAILED DESCRIPTION

[0042] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0043] As described previously, research on the GyH 1 virus vaccine is rarely reported, and the existing research only involves the antigen epitope region of the GyH 1 virus VP1 and VP2 proteins, and thus further research on the GyH 1 virus vaccine is needed.

[0044] Based on this, the application provides a recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV of single-stranded circular DNA virus GyH1 and an application thereof, which can more effectively stimulate the immune protection response of the body to GyH1. The recombinant adenovirus vaccine has the safety of a subunit vaccine and can adopt various immune modes to stimulate the immune response of the body in all directions in a period of time, thereby having a wide development and application prospect.

[0045] In the application, the replication-defective adenovirus vector vaccine can be constructed by modifying human adenovirus type 5, and has the following advantages: 1) because the genome of the adenovirus can enter the nucleus after infecting cells, the exogenous antigen carried by the adenovirus vector can stimulate the body to produce stronger T cell and antibody responses through the endogenous protein processing pathway; 2) the modified replication-defective adenovirus has good safety; 3) the adenovirus genome is not integrated into the host genome, and has no genetic carcinogenicity; 4) the adenovirus has infectivity to various types of cells, which is conducive to the expression and presentation of antigen proteins; 5) the adenovirus vector can load a maximum of 8 kb of exogenous genes; 6) the adenovirus vector has a longer time efficiency for expressing exogenous genes in vivo; 7) the amplification and purification process of the adenovirus is mature, and a virus particle with a higher titer can be obtained; 8) the human adenovirus type 5 has no influence of pre-existing immunity to the vector in chicken flocks, which is conducive to maximizing the immune effect of the vaccine.

[0046] In a preferred example, the Linker further comprises AAY, GPGPG and / or KK.

[0047] In a preferred example, the adenovirus vector is a human type 5 replication-defective adenovirus.

[0048] The application provides a preparation method of the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV, which comprises the following steps:

[0049] 1) screening antigen epitopes of GyH1 VP1, VP2 and VP3 proteins through an online bioinformatics analysis server, and constructing GyMEV by connecting the antigen epitopes through a Linker;

[0050] 2) further verifying the rationality and stability of GyMEV through an online protein analysis server, and then obtaining the nucleotide sequence of GyMEV through reverse translation and codon optimization;

[0051] 3) inserting the nucleotide sequence of GyMEV into an adenovirus vector plasmid to construct a recombinant adenovirus plasmid;

[0052] 4) linearizing the recombinant plasmid after enzyme digestion, and then transfecting the linearized recombinant plasmid into adenovirus packaging cells, and then culturing the adenovirus packaging cells to 80% of the cells to have obvious cytopathic effect;

[0053] 5) Collect the cells, break the cells by repeated freezing and thawing, and centrifuge to collect the supernatant;

[0054] 6) Infect the supernatant to adenovirus packaging cells, and culture until the cells change from adherent to suspended state;

[0055] 7) Repeat the culture according to steps 5) and 6), collect the cells, break the cells, and centrifuge to collect the supernatant;

[0056] 8) Take the supernatant to purify the recombinant adenovirus, and obtain the purified virus liquid, which is the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV.

[0057] In a preferred embodiment, the packaging cells are adherent cell lines or suspension cell lines that can support the propagation of replication-defective adenovirus.

[0058] In a preferred embodiment, the adenovirus packaging cells are adherent HEK293 cell lines.

[0059] In a preferred embodiment, the adenovirus purification method is selected from cesium chloride density gradient centrifugation.

[0060] In the embodiments of the present application, the vaccine uses human type 5 replication-defective adenovirus as a carrier and carries codon-optimized GyMEV. The vaccine has good immunogenicity in chickens and can induce strong cellular and humoral immune responses in a short time, and therefore can be used for preparing vaccines.

[0061] The dosage form of the circular virus human source type 1 vaccine of the present application is not particularly limited, and preferably includes injections, nose drops, or sprays. In the embodiments, injections are taken as examples for illustration, but it cannot be recognized as the entire protection scope of the present application.

[0062] In summary, the inventors of the present application, on the basis of the first discovery of the pathogenic mechanism between GyH1 and infectious adenovirus, take GyH1 as the research object, and obtain the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV with good preventive effect. The vaccine has no side effects, can cause high antibody titers, and has good immunization effect on GyH1, and can be widely used in the immunoprophylaxis of GyH1.

[0063] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific embodiments.

[0064] The test materials used in the embodiments and comparative examples of the present application are all conventional test materials in the art, and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out according to conventional test methods or according to the operation instructions recommended by the suppliers.

[0065] wherein: human type 5 replication-deficient adenovirus was purchased from Takara-Bio Co., Ltd.

[0066] Construction of antigen polypeptides A, B, C and polyepitope vaccine GyMEV

[0067] 1. Screening of GyH1 antigen epitopes

[0068] According to the GyH1 sequence disclosed in GenBank accession number MG366592, the VP1, VP2 and VP3 amino acid sequences of GyH1 virus were obtained. Using the NetCTL v1.2 server to predict the nonamer of the conserved sequence of VP1 and, VP2 and VP3 proteins, the nonamer with a threshold higher than 0.5 was generated for the IEDB server to predict CD8 + T cell epitopes and MHC-I binding alleles. CD4 + T cell epitopes and MHC-II binding alleles were predicted using the IEDB server. B cell epitopes were predicted using the ABpred server. Further screening was performed by Vaxijen v1.2 and IEDB server to evaluate antigenicity and immunogenicity (antigenicity score greater than 0.5, and immunogenicity greater than 0.01, considered to be effective antigen epitopes). A total of 8 CD8 + T cell epitopes, 8 CD4 + T cell epitopes and 12 B cell epitopes, as follows:

[0069] Table 1: CD8 + T cell epitopes and MHC-I binding alleles

[0070]

[0071] Table 2: CD4 + T cell epitopes and MHC-II binding alleles

[0072]

[0073] Table 3: B cell epitopes

[0074]

[0075] 2. Construction of antigen epitope polypeptides A, B and C and polyepitope vaccine GyMEV

[0076] Eight CD8 + T cell epitopes were connected by Linker1 to obtain antigen epitope polypeptide A, and the amino acid sequence thereof is SEQ ID NO. 1.

[0077] Eight CD4 +T cell epitope, obtain antigen epitope polypeptide B, its amino acid sequence is SEQ ID NO. 2.

[0078] Adopt Linker 3 to connect 12 B cell epitopes, obtain antigen epitope polypeptide C, its amino acid sequence is SEQ ID NO. 3.

[0079] Link antigen epitope polypeptide A, B and C, obtain multi-epitope vaccine GyMEV, its amino acid sequence is SEQ ID NO. 4.

[0080] Specifically, the sequence of Linker 1 is AAY, the sequence of Linker 2 is GPGPG, and the sequence of Linker 3 is KK.

[0081] 3. Antigenicity, allergenicity and physicochemical property detection

[0082] Verify antigenicity using Vaxijen server, verify allergenicity using Allertop v2.0 server. Predict physicochemical properties using Protparam server, wherein antigen polypeptide A may be allergen, antigen polypeptide B has relatively low antigenicity, antigen polypeptide C has too short half-life, and multi-epitope vaccine GyMEV has excellent indicators, and the results are shown in Table 4

[0083] Table 4: Allergenicity and physicochemical property detection of antigen epitope polypeptides A, B, C and multi-epitope vaccine GyMEV

[0084]

[0085] Note: Antigenicity greater than 0.5 meets the requirements, instability index less than 40 is stable protein, otherwise is unstable protein. Average water is less than 0, indicating hydrophilicity, and greater than 0, indicating hydrophobicity.

[0086] 4. Secondary and tertiary structure prediction

[0087] Predict secondary structure using PSIPRED server, and predict tertiary structure using trRosetta server, and the results are shown in Figure 1 .

[0088] Figure 1 A is the secondary structure of antigen polypeptide A, mainly random coil (41 / 93, 44.08%), followed by alpha-helix (38 / 93, 40.86%) and beta-sheet (14 / 93, 15.06%).

[0089] Figure 1B is the secondary structure of antigen polypeptide B, mainly random coil (93 / 155, 60%), followed by β-sheet (50 / 155, 32.25%) and α-helix (12 / 155, 7.75%).

[0090] Figure 1 C is the secondary structure of antigen polypeptide C, mainly random coil (134 / 214, 62.62%), followed by β-sheet (72 / 214, 33.64%) and α-helix (8 / 214, 3.74%).

[0091] Figure 1 D is the secondary structure of multi-epitope vaccine GyMEV, mainly random coil (288 / 469, 61.41%), followed by β-sheet (119 / 469, 25.38%) and α-helix (62 / 469, 13.21%),

[0092] The tertiary structure prediction results are shown in Figure 2 The secondary and tertiary structures of antigen polypeptides A, B, C and GyMEV can match each other, and the model has high rationality.

[0093] 5. Molecular dynamics detection

[0094] The molecular dynamics of antigen polypeptide GyMEV was analyzed using the iMODS server, and the deformation analysis showed that there was minimal deformation in the complex structure, as shown in Figure 3 A; the b-factor is proportional to the root mean square (RMS), which shows the stability of the antigen polypeptide complex, as shown in Figure 3 B; Figure 3 C shows the covariance matrix between residue pairs, where red, white and blue represent correlated motion, uncorrelated motion and anti-correlated motion, respectively; Figure 3 D shows the elastic network model of the antigen polypeptide, with dark gray indicating higher protein hardness in certain areas.

[0095] 6. Reverse translation and codon optimization

[0096] Reverse translation and codon optimization were performed using the JCAT server, and antigen polypeptide A obtained a nucleotide sequence of 279 bp in length, which is SEQ ID NO. 5. Antigen polypeptide B obtained a nucleotide sequence of 465 bp in length, which is SEQ ID NO. 6. Antigen polypeptide C obtained a nucleotide sequence of 642 bp in length, which is SEQ ID NO. 7. Multi-epitope vaccine GyMEV obtained a nucleotide sequence of 1407 bp in length, which is SEQ ID NO. 8.

[0097] Preparation of recombinant adenovirus vector vaccine rAd5-A, rAd5-B, rAd5-C and rAd5-GyMEV of Example 2

[0098] 1. Artificial synthesis of the target fragment

[0099] According to the antigen polypeptide A, B, C and GyMEV nucleotide sequences obtained in Example 1, artificial synthesis into plasmid pMD19-T, respectively, to construct plasmid pMD19-A, pMD19-B, pMD19-C and pMD19-GyMEV.

[0100] 2. Construction of recombinant adenovirus plasmid

[0101] Using In-Fusion technology, the cloning plasmid containing the antigen polypeptide A, B, C and GyMEV nucleotide sequence, directional insertion into adenovirus vector (as shown in Table 5), co-transforming competent E. coli cells, screening positive colonies, picking bacteria, shaking bacteria, plasmid large extraction, obtain recombinant adenovirus plasmid rAd5-A, rAd5-B, rAd5-C and rAd5-GyMEV.

[0102] Table 5: In-Fusion system

[0103]

[0104]

[0105] 3. Preparation of recombinant polyepitope adenovirus vector vaccine

[0106] Digestion of recombinant adenovirus plasmid rAd5-A, rAd5-B, rAd5-C and rAd5-GyMEV

[0107] Before the recombinant adenovirus is packaged, the recombinant plasmid must be digested by PacI (as shown in Table 6), exposing the inverted terminal repeat sequence (ITRs) at both ends of the adenovirus genome, and releasing the adenovirus genome from the plasmid backbone.

[0108] Table 6: 50 μL PacI digestion system

[0109]

[0110] 1). In a sterile 1.5 milliliter microcentrifuge tube, mix the following reagents;

[0111] 2). Blow the contents and centrifuge in a microcentrifuge for a short time;

[0112] 3). Incubate at 37°C for 10 min. Confirm the completion of PacI digestion by analysis on 1% agarose gel. The plasmid part of the recombined pAdeno5 vector will migrate at ~3 kb, while the adenoviral genome will not enter the gel but will stay at the top of the lane;

[0113] 4). Add 60ul of IX TE Buffer and 100ul of phenol:chloroform:isoamyl alcohol (25:24:1) mixture, gently spin;

[0114] 5). Centrifuge at -4°C, 14000 rmp for 5 min in a high speed centrifuge;

[0115] 6). Carefully transfer the top aqueous layer to a clean sterile 1.5ml microcentrifuge tube;

[0116] 7). Add 400μl of 95% ethanol, 25μl of ammonium acetate and 1μl of sucrose (20mg / ml) and gently spin;

[0117] 8). Centrifuge at -4°C, 14000 rmp for 5 min in a high speed centrifuge;

[0118] 9). Remove and discard the supernatant, add 300μl of 70% ethanol wash;

[0119] 10). Centrifuge at -4°C, 14000 rmp for 2 min in a high speed centrifuge, carefully aspirate the supernatant;

[0120] 11). Air dry the pellet at room temperature for about 15 min, add 10μl of TE Buffer to dissolve the DNA, store at -20°C.

[0121] Linearized recombined adenoviral plasmid transfection into HEK 293 cells

[0122] Twelve to twenty-four hours before transfection, plate HEK 293 cells at a density of 12 X 10 6 cells per 60 mm plate (about 100 cells / square mm). For best results, the cells should be 50-70% confluent, flat in appearance, and well adhered to the plate prior to transfection.

[0123] Transfect each 60 mm plate with 15μl of the Pca1 digested rAd5-X DNA. Transfect the large plasmid into HEK 293 cells using the calcium phosphate transfection method (as in Table 7) using the calcium phosphate mammalian transfection kit (Cat).

[0124] Table 7: 600μL calcium phosphate transfection system

[0125]

[0126] 1). Incubate the mixture at room temperature for 5-15 min;

[0127] 2). Slowly drop 600 μl of the mixture into the culture medium;

[0128] 3). Move the cell flask back and forth to distribute the transfection mixture evenly;

[0129] 4). Incubate at 37 °C in a 5% CO2 incubator for 8-10 h;

[0130] 5). Remove the calcium phosphate-containing medium mixture and wash the cells with medium;

[0131] 6). Add 5 ml of fresh medium and incubate at 37 °C in a 5% CO2 incubator for one week;

[0132] 7). Observe the intensity of the fluorescent signal 24-72 h after transfection (e.g. Figure 4 ) and wait for cytopathic effect (CPE) to appear after one week, then blow the cells and transfer the suspension to a sterile 15 ml conical centrifuge tube;

[0133] 8). Centrifuge at 3000 rpm for 5 min to collect the cells, discard the supernatant, and resuspend the cells with 2 ml of PBS;

[0134] 9). Place the cells at -80 °C for 40 min, then take them out and place them in a 37 °C water bath for 5 min, and repeat the freeze-thawing 3 times;

[0135] 10). Centrifuge at 12000 rpm for 2 min to collect the supernatant, and store it at -80 °C.

[0136] Example 3: Identification and titer determination of recombinant adenovirus vector vaccines rAd5-A, rAd5-B, rAd5-C, and rAd5-GyMEV

[0137] 1. Identification and virus titer determination of recombinant epitope adenovirus vector vaccines

[0138] 1). Cells with a growth density of more than 80% are plated in a 12-well plate

[0139] 2). Use PBS as a diluent to dilute the P2 virus by 10 -2 —10 -6 .

[0140] 3). Add 100 μl of the virus dilution to each well.

[0141] 4). Incubate at 37 °C in a 5% CO2 incubator for 48 h.

[0142] 5). Add 1 ml ice-cold 100% methanol, -20°C for 10 min.

[0143] 6). Discard methanol, add PBS + 1% BSA 1 ml, 3 min, wash three times.

[0144] 7). Dilute primary antibody (Mouse Anti-Hexon) with PBS 1: 1000.

[0145] 8). Add 500 μl primary antibody per well, incubate at 37°C for 1 h.

[0146] 9). Discard primary antibody, add PBS + 1% BSA 1 ml, 3 min, wash three times.

[0147] 10). Dilute secondary antibody (Rat Anti-Mouse) with PBS 1: 1500.

[0148] 11). Discard secondary antibody, add PBS + 1% BSA 1 ml, 3 min, wash three times.

[0149] 12). Add 500 ul DAB working solution (10X DAB: 1X stable Perosidase = 1:10), incubate at room temperature for 10 min.

[0150] 13). Under microscope, count the number of positive cells (black / brown) per well, results as shown, Figure 5 Figure 5 A is recombinant adenovirus vector vaccine rAd5-A, Figure 5 B is recombinant adenovirus vector vaccine rAd5-B, Figure 5 C is recombinant adenovirus vector vaccine rAd5-C, Figure 5 D is recombinant adenovirus vector vaccine rAd5-GyMEV.

[0151] 14). Calculate virus titer

[0152] Formula: ifu = (number of positive cells x cell culture plate bottom area (cm 2 )) / (virus volume (ml) x dilution factor)

[0153] According to the formula, the virus titers of rAd5-A, rAd5-B, rAd5-C and rAd5-GyMEV are 1.08 x 10 8 ifu / ml, 1.27 x 10 8 ifu / ml, 1.15 x 10 8 ifu / ml and 1.29 x 10 8 ifu / ml, respectively.

[0154] ​Clinical application of recombinant adenovirus vector vaccine rAd5-A, rAd5-B, rAd5-C and rAd5-GyMEV of Example 4

[0155] 1. Challenge protection of GyH1

[0156] SPF 1-day-old chicks were purchased from Jinan Saish Poultry Technology Co., Ltd. and were divided into 5 groups according to categories. The first immunization was performed at 7 days of age and the second immunization was performed at 14 days of age. Thirty chickens in the vaccine group were vaccinated by leg muscle and challenged by intraperitoneal injection at 15 days of age. Details are shown in Table 8.

[0157] Table 8: Animal experiment design of recombinant adenovirus vector vaccine

[0158]

[0159] 2. Immunogenicity detection

[0160] Immune factor detection: After the first immunization at 7 days of age, blood was collected at 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks and 6 weeks after immunization, and serum was separated. The antibody growth and decline rules were detected by using the GyH1 ELISA antibody detection method established in the laboratory (“Establishment and application of GyH1 ELISA antibody / antigen detection method”, Master's degree thesis of Shandong Agricultural University). The detection results showed that the antibody levels of all vaccines began to rise at two weeks after the first immunization, vaccine C began to decline at the fourth week, and the other vaccines began to decline at the fifth week. The antibody level of the chicken group inoculated with the multi-epitope vaccine GyMEV was the highest. Figure 6 ) The IL-4 and IFN-γ detection was performed by using chicken IL-4 and IFN-γ ELISA detection kits. The detection results showed that the IL-4 and IFN-γ expression levels of the chicken group inoculated with the multi-epitope vaccine GyMEV were the highest, indicating that the multi-epitope vaccine GyMEV had the best immunogenicity Figure 7 A and 7B; the horizontal coordinate time in the figure represents the 1-4 weeks after the first immunization at 7 days of age). Taking the fourth week after the first immunization at 7 days of age as an example, the IFN-γ expression level of the vaccine group GyMEV was 180.4 pg / ml, and the IL-4 expression level was 210.07 pg / ml; the IFN-γ expression level of the vaccine group A was 69.19 pg / ml, and the IL-4 expression level was 103.33 pg / ml; the IFN-γ expression level of the vaccine group B was 89.86 pg / ml, and the IL-4 expression level was 99.0 pg / ml; the IFN-γ expression level of the vaccine group C was 76.53 pg / ml, and the IL-4 expression level was 77.33 pg / ml; the IFN-γ expression level of the control group G was 57.45 pg / ml, and the IL-4 expression level was 60.86 pg / ml. Compared with the vaccine groups A-C, the vaccine group GyMEV screened out 8 CD8+ T cell epitopes, 8 CD4 + The combination of T cell epitopes and 12 B cell epitopes has a significant synergistic effect in improving the immunogenicity of the vaccine.

[0161] 3. Protective detection

[0162] Body weight detection: After 15 days of inoculation, the feeding and drinking conditions of the chicken population were observed daily, the body weight was weighed and recorded, and the growth condition of the chicken population was monitored to prepare a broken line graph. The results show that compared with the control group G, the vaccine group GyMEV can more effectively slow down the early growth inhibition symptoms of the virus, indicating that the multi-epitope vaccine GyMEV has the best protection. Figure 8 The horizontal coordinate in the table is 15 days of inoculation as 0 days.

[0163] GyHl antigen detection: After 15 days of inoculation, blood was collected every week, DNA was extracted from the blood, and GyHl identification primers (F: GACACAGACTGCGACGAAGA; R: ATGCTCCTGGCTGTCTAGAT) were used for GyHl PCR identification. Calculate the GyHl infection rate, mortality rate and protection rate of each group (Table 9).

[0164] Table 9: GyHl infection rate, mortality rate and protection rate of each group in animal experiment

[0165]

[0166] Note: Infection rate = (number of chickens with positive GyHl antigen detection / 30) x 100%;

[0167] Mortality rate = (number of dead chickens / 30) x 100%;

[0168] Protection rate = 1 - infection rate.

[0169] The results in Table 9 are counted to the 5th week after 15 days of inoculation.

[0170] Pathological observation: Each group of test animals was killed for observation of gross lesions at 5 weeks after 15 days of inoculation (after the end of body weight detection and GyHl antigen detection). Spleen, kidney, glandular stomach, bursa of Fabricius, bone marrow, thymus and other tissues were taken, and the tissues of each group of animals were fixed in 4% formalin to prepare paraffin tissue sections. The pathological histological lesions were observed under a microscope (Table 10). Figure 9 The results show that each vaccine group can protect the tissue damage to a certain extent, and the vaccine group GyMEV has the best effect.

[0171] Table 10: Evaluation of pathological histological lesions

[0172]

[0173] Note: "+" indicates the severity of the lesion, "+++" indicates severe lesion, "++" indicates moderate lesion, "+" indicates mild lesion, and "-" indicates no obvious lesion.

[0174] In summary, the recombinant multi-epitope adenovirus vector vaccine rAd5-GyMEV of the present invention is based on screening eight CD8+ vectors. + T cell epitopes, 8 CD4 + T-cell epitopes and 12 B-cell epitopes are combined to form an antigenic epitope polypeptide. The encoding gene of this antigenic epitope polypeptide is then inserted into an adenovirus vector to construct a recombinant plasmid. Following packaging and processing, an immunogenic recombinant multi-epitope adenovirus vector vaccine is obtained. This is different from using 8 CD8+ epitopes alone. + T cell epitopes, using 8 CD4 alone + Compared with recombinant multi-epitope adenovirus vector vaccines constructed using only 12 B-cell epitopes, T-cell epitopes have a synergistic effect in improving the immunogenicity and protective performance of vaccines.

[0175] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. An antigenic epitope polypeptide of a single-stranded circular DNA virus GyHl, characterized in that, The amino acid sequence of the antigen epitope polypeptide is shown as SEQ ID NO.

4.

2. A gene encoding the antigen epitope polypeptide of claim 1.

3. The genetic code according to claim 2, wherein, The nucleotide sequence of the encoding gene is shown as SEQ ID NO.

8.

4. A biological material containing a gene encoding the antigenic epitope polypeptide according to claim 2 or 3, characterized in that, The biological material is a recombinant expression vector, an expression cassette, a recombinant bacteria or a host cell.

5. Use of the antigen epitope polypeptide of claim 1 or the encoding gene of claim 2 or 3 in the preparation of a vaccine for preventing GyH1 virus infection.

6. Use according to claim 5, characterized in that, The form of the vaccine is an adenovirus vector vaccine, a subunit vaccine or a DNA vaccine.

7. Use according to claim 6, characterized in that, The form of the vaccine is an adenovirus vector vaccine.

8. A single stranded circular DNA virus GyHl recombinant polyepitope adenoviral vector vaccine, characterized in that, It is constructed by the following method: The encoding gene of the antigen epitope polypeptide of claim 2 or 3 is inserted into an adenovirus vector to construct a recombinant plasmid, and then packaged and processed to obtain a recombinant multi-epitope adenovirus vector vaccine with immunogenicity.

9. The single stranded circular DNA virus GyHl recombinant polyepitope adenoviral vector vaccine according to claim 8, characterized in that, The adenovirus vector is a human 5 type replication-defective adenovirus.

10. Use of the single-stranded circular DNA virus GyH1 recombinant multi-epitope adenovirus vector vaccine of claim 8 or 9 in the preparation of a drug for preventing or treating GyH1 infection.

Citation Information

Patent Citations

  • Engineering yeast strain for preventing porcine circovirus disease

    CN105779320A

  • Single-stranded circular DNA virus GyV3 subunit vaccine and preparation thereof

    CN109200281A