Directed synthesis of reticular path products
By combining the expression of catalytically specific path component proteins under the yeast chassis, the complexity of the mesh pathway in the directed synthesis of steroid hormones in microorganisms was solved, and efficient directed synthesis of steroid hormone compounds was achieved, improving the conversion efficiency and substrate utilization.
Patent Information
- Application Number
- CN202211741254.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-30
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2042-12-30
AI Technical Summary
In the prior art, the reticular path of microorganisms directed heterologously synthesized steroid hormone drugs is complex, making it difficult to synthesize intermediate node compounds, and traditional biological transformations have problems such as inappropriate substrate modification and difficult path transformation.
The artificial heterologous reticular pathway was reconstructed under the yeast chassis, and the pathway component proteins with different catalytic specificity were combined to achieve directed synthesis of steroid hormone compounds. The combination of proteins such as CYP17A1, POR, CYB5 and 3β-HSD was used to construct efficient microbial synthesis pathways.
It has achieved efficient and directed synthesis of steroid hormone compounds such as androstenedione and testosterone using a simple carbon source as the substrate, which has improved the path conversion efficiency and reduced by-product accumulation and substrate loss.
Smart Images

Figure BDA0004032699190000211 
Figure BDA0004032699190000221 
Figure BDA0004032699190000222
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to the directed synthesis of reticular pathway products. Background Art
[0002] In chordates, the steroid hormone synthesis pathway consists of numerous non-specific catalytic enzymes, which can modify a variety of structurally similar substrates. Therefore, multiple substrates are often shared among the enzymes, and the cross-reactions between the pathways ultimately result in a complex reticular catalysis in the steroid synthesis pathway, which greatly increases the difficulty of the directed heterologous synthesis of intermediate compounds in the reticular pathway by microorganisms.
[0003] Steroid hormones are a class of tetracyclic aliphatic hydrocarbons with a basic structure of cyclopentane polyhydrophenanthrene nucleus. There are many types of such compounds. Currently, more than 400 steroid drugs have been produced worldwide and are widely used for their anti-inflammatory, anti-allergic, endocrine-regulating and other effects. By 2017, the global sales of steroid hormone drugs reached $100 billion, making them the second largest category of chemical drugs. The "pregnenolone-androstenedione" synthesis pathway composed of CYP17-3β-HSD is located at the crossroads of the vertebrate steroid synthesis pathway and contains key precursors (pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, DHEA, androstenedione, testosterone) of many steroid hormone drugs.
[0004] The development of the production process of steroid hormone intermediates has gone through stages such as plant extraction of saponins, chemical total synthesis, semi-synthesis, and new microbial synthesis methods. Plant extraction and microbial transformation are the main methods for producing steroid hormone drugs. However, the plant extraction method has high costs, limited sources, and problems such as environmental pollution. The chemical total synthesis of steroid molecules involves limitations such as long processes, complex reactions, and environmental pollution.
[0005] Compared with the separation of steroids from animal sources, microbial synthesis of steroids has a lower risk of viral / prion contamination. Microbial synthesis of steroids can also avoid the cumbersome reaction steps involved in chemical synthesis. In past studies, Saccharomyces cerevisiae, Escherichia coli, and Yarrowia lipolytica have all been applied to the research of pregnenolone or other steroid syntheses. In the experiments with Saccharomyces cerevisiae, de novo synthesis of pregnenolone and its downstream product hydrocortisone was achieved using glucose as the substrate. Saccharomyces cerevisiae, Escherichia coli, and Yarrowia lipolytica achieved the synthesis of pregnenolone by biotransforming sterol substrates. By introducing the P450scc catalytic system into Saccharomyces cerevisiae or Escherichia coli and adding the direct substrate sterol of the P450scc catalytic system to the culture environment, biotransformation of pregnenolone can be achieved. Feeding sterols in the culture environment of diploid Yarrowia lipolytica chassis cells heterologously expressing the P450scc system and the P450c17 system enables biotransformation with sterols as substrates for the synthesis of pregnenolone or 17α-hydroxypregnenolone. However, the strong hydrophobicity of steroids, the poor robustness of the commonly used microorganism Mycobacterium, and the high sterilization cost result in low microbial transformation efficiency.
[0006] Synthetic biology provides a new method for microbial synthesis. Functioning microorganisms with artificially constructed heterologous synthesis pathways can produce steroid drugs with specific structures in a low-energy-consuming, efficient, and environmentally friendly manner, and can produce specific steroid compounds using only glucose, glycerol, etc. as a single carbon source. In 1998, Catherine Duport et al. achieved the synthesis of campesterol by knocking out the native gene erg5 of Saccharomyces cerevisiae and introducing the exogenous gene DHCR7, providing a precursor for the synthesis of pregnenolone; then, by introducing the bovine-derived P450scc catalytic system and 3β-HSD, de novo synthesis of progesterone using glucose as the substrate was achieved. In 2019, our research group constructed an engineered Yarrowia lipolytica strain for de novo synthesis of pregnenolone based on a high-yield campesterol chassis through enzyme source screening and promoter co-matching. In 2003, Florence Ménard Szczebara et al. knocked out ATF2 and introduced CYP17A1, CYP21A1, and CYP11B1 on the basis of a high-yield progesterone Saccharomyces cerevisiae chassis, and successfully achieved de novo synthesis of hydrocortisone. In 2019, patent US10400261B2 obtained a high-yield hydrocortisone strain by multi-copy integration of hydrocortisone pathway genes based on Saccharomyces cerevisiae.
[0007] Corticosteroids, androgenic, and estrogenic steroids have been widely used in the medical field. The synthesis of these downstream products in the animal steroid hormone synthesis pathway all requires the process of Δ 5 - to Δ 4 - type steroid conversion (Δ 5 - and Δ 4-: vinylic double bonds located at the 5.6 and 4.5 positions respectively), and this process uses pregnenolone (P5) as a substrate and is co-catalyzed by 3β-hydroxysteroid dehydrogenase (3β-hsd) and 17α-hydroxylase / 17,20-lyase (Cyp17). Among them, CYP17 uses Δ 5 - and Δ 4 -steroids as substrates for 17α-hydroxylation modification. At the same time, under the participation of cytochrome b5 (Cyb5), CYP17 will exhibit stronger 17,20-lyase activity (cleavage of the C17-C20 bond). CYP17 can act on; while 3β-HSD has isomerase activity and can convert Δ 5 -steroids into the corresponding Δ 4 -isomers, and realize the migration of metabolic flux from the Δ 5 -pathway to the Δ 4 -pathway. However, in the process of synthesizing Δ 4 -steroids using pregnenolone as a substrate, due to the sharing of multiple substrates between CYP17 and 3β-HSD, 17α-hydroxylation, 17,20-cleavage, and Δ 5 -Δ 4 isomerization do not occur strictly in sequence, which poses a great challenge to the heterologous directed synthesis of the target Δ 4 -steroids.
[0008] Steroid hormones are often toxic to microorganisms. In an environment containing steroid compounds, the endogenous metabolism of microorganisms can modify the exogenous steroid nucleus (such as hydroxylation) to reduce its cytotoxicity. Using this property, people use the endogenous metabolism of microorganisms such as Mycobacterium as a medium to achieve the biosynthesis of target steroids through biotransformation using sterols and steroid intermediates as substrates.
[0009] Traditional biosynthesis of target steroids by biotransforming steroid substrates using the endogenous metabolism of microorganisms has the following disadvantages: ① The strong modification activity of the traditional biotransformation microbial chassis on the steroid nucleus may not be suitable for the synthesis requirements of specific target steroid compounds. At the same time, it may compete with the target synthesis pathway for steroid substrates, resulting in the accumulation of by-products and the loss of substrates. Therefore, it is more advantageous to select the yeast Yarrowia lipolytica chassis with a relatively pure and clear metabolic background. ② In the endogenous steroid modification pathway of traditional biotransformation microorganisms such as Mycobacterium, many genes related to key catalytic reactions are not yet clear, which greatly increases the difficulty of pathway modification for the directed synthesis of intermediate node products in the biotransformation process. Summary of the Invention
[0010] In view of this, the present invention provides the directed synthesis of reticular pathway products.
[0011] The present invention provides the directional synthesis of reticular pathway products. Compared with the transformation of steroid substrates using natural microbial endogenous pathways, the present invention can achieve the directional synthesis of node products by reconstructing artificial heterologous reticular pathways under a yeast chassis and rationally combining pathway component proteins. By combinatorially expressing homologous proteins of pathway components with different catalytic specificities, the further improvement of pathway conversion efficiency can be achieved. At the same time, an artificial pregnenolone synthesis pathway is constructed under a microbial chassis, and by introducing specific downstream androstenedione synthesis pathway components, the pathway node compound of androstenedione can be directionally synthesized using a simple carbon source as a substrate.
[0012] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:
[0013] The present invention provides the application of any of the following expressions in the synthesis of steroid compounds and / or steroid hormone drugs:
[0014] (I), CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or
[0015] (II), CYB5 derived from Equus caballus, Ovis aries, Mesocricetus auratus or Sus scrofa; and / or
[0016] (III), 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation) or Homo sapiens (type II, L236S mutation); and / or
[0017] (IV), mCYP11A1 derived from Sus scrofa.
[0018] In some specific embodiments of the present invention, the CYP17A1, POR, CYB5, 3β-HSD and / or mCYP11A1 are obtained by codon optimization and adding sequence 1 and / or sequence 2;
[0019] The codon optimization is carried out using Yarrowia lipolytica;
[0020] The 5' end is added to the sequence 1, and the sequence 1 includes:
[0021] (I), the nucleotide sequence shown in SEQ ID NO: 1; or
[0022] (II), a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0023] (III), a nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0024] (IV), a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);
[0025] The 3' end is added to the said Sequence 2, and the Sequence 2 includes:
[0026] (I), the nucleotide sequence shown in SEQ ID NO: 2; or
[0027] (II), a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0028] (III), a nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0029] (IV), a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);
[0030] The said steroids include: pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, dehydroepiandrosterone, androstenedione, and / or testosterone;
[0031] In the conversion experiment using the said pregnenolone (P5) as a substrate, Vv_3β-HSD showed the strongest pregnenolone conversion efficiency; the conversion efficiency was 6.8%; those showing the second strongest catalytic efficiency included type I human and mutant 3β-HSD; the catalytic efficiency was 4.6 - 4.8%;
[0032] In the conversion experiment using 17-hydroxypregnenolone (17OHP5) as a substrate, those showing relatively strong conversion efficiency included type I human and mutant 3β-HSD, type II human and mutant 3β-HSD; the highest progesterone conversion rate of type I human 3β-HSD was 3.1%;
[0033] Using the dehydroepiandrosterone (DHEA) as a substrate, those showing strong catalytic activity include human type II, bovine, and Mycobacterium - derived 3β - HSD; the conversion efficiency of the human type II 3β - HSD is 10.5%.
[0034] The present invention also provides modules, including the expression of any of the following:
[0035] (I), CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or
[0036] (II), CYB5 derived from Equus caballus, Ovis aries, Mesocricetus auratus or Sus scrofa; and / or
[0037] (III), 3β - HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation) or Homo sapiens (type II, L236S mutation); and / or
[0038] (IV), mCYP11A1 derived from Sus scrofa.
[0039] Based on the above research, the present invention also provides plasmids, including the above - mentioned expression elements.
[0040] The present invention also provides hosts, including the above - mentioned plasmids.
[0041] In some specific embodiments of the present invention, the host includes one or more of Module 1, Module 2, Module 3, Module 4, Module 5, Module 6, Module 7, Module A, Module B, Module C or Module D:
[0042] Module 1 includes CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; Module 1 includes the IntD integration site and / or the Leu2 tag with LoxP sites at both ends; and / or
[0043] Module 2 includes CYB5 derived from Equus caballus, Ovis aries, Mesocricetus auratus or Sus scrofa; Module 2 includes IntB integration site and / or Ura3 tag; and / or
[0044] Module 3 includes 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation) or Homo sapiens (type II, L236S mutation); The vector connected to Module 3 includes pINA1269-Nat; and / or
[0045] Module 4 includes CYP17A1 and POR derived from Equus caballus; Module 4 includes IntF integration site and / or Leu2 tag with LoxP sites at both ends; and / or
[0046] Module 5 includes CYP17A1 and POR derived from Ovis aries; Module 5 knocks out the Leu2 tag; and / or
[0047] Module 6 includes 3β-HSD derived from Homo sapiens (type II); Module 6 includes IntC integration site and / or Leu2 tag with LoxP sites at both ends; and / or
[0048] Module 7 includes CYP17A1 and POR derived from Mesocricetus auratus, 3β-HSD derived from Homo sapiens (type II) and 3β-HSD derived from Vaccinia virus; The CYP17A1 and POR include IntD integration site and / or Leu2 tag with LoxP sites at both ends; The vector connected to the 3β-HSD derived from Vaccinia virus includes pINA1269-Nat; The vector connected to the 3β-HSD derived from Homo sapiens (type II) includes pUC57-Kan-Simple; and / or
[0049] The module A includes: CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the module A includes the IntD integration site and / or the Leu2 tag with LoxP sites at both ends; and / or
[0050] The module B includes: CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; the module B includes the IntB integration site and / or the Ura3 tag; and / or
[0051] The module C includes: 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II) and mCYP11A1 derived from Sus scrofa; the vector connected to the module C includes pINA1269; and / or
[0052] The module D includes: CYP17A1 and POR derived from Ovis aries and Mesocricetus auratus; the module D includes the IntF integration site and / or the Leu2 tag with LoxP sites at both ends.
[0053] In some specific embodiments of the present invention, the construction of the module one includes: splicing the left arm of the IntD integration site and the terminator 1; splicing the terminal sequence of the terminator 2, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site to obtain IntD-L and IntD-R; connecting CYP17A1 and POR to the expression module digested with BsmBI to obtain the integration plasmid, assembling the CYP17A1 and POR modules with the same species source with pUC18H to obtain the integration plasmid, and obtaining the module one after digestion;
[0054] The terminator 1 is the Saccharomyces cerevisiae GPM1t terminator; the terminator 2 is the Saccharomyces cerevisiae FBA1t;
[0055] The splicing method includes OE-PCR; the expression modules include TEF1inp-LIP2t-GPDt, GPDt-TEF1inp-OCT1t-FBA1t; the sources of the CYP17A1 and POR modules include Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the pUC18H is pUC18H digested with IntD-L, IntD, and HincII; the method used for assembly includes Gibson; the digestion includes digestion with NotI.
[0056] In some specific embodiments of the present invention, the construction of Module 2 includes: ligating the left arm of the IntB integration site, the tag, the right arm of the IntB integration site, the promoter, the terminator, and CYB5 together to obtain an integration plasmid, and then obtaining Module 2 after digestion.
[0057] The tag includes the auxotrophic uracil tag Ura3; the promoter includes TEF1in; the terminator includes ACOt; the source of CYB5 includes Equus caballus, Ovis aries, Mesocricetus auratus or Sus scrofa; the method used for ligation includes Gibson; the digestion includes digestion with NotI.
[0058] In some specific embodiments of the present invention, the construction of Module 3 includes: integrating 3β-HSD into the vector by assembly, introducing sequence 3 at the 5' end of the above gene and sequence 4 at the 3' end of the gene through PCR reaction, and then integrating the recombinant plasmid after linearized vector assembly, which is Module 3.
[0059] The source of 3β-HSD includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation) or Homo sapiens (type II, L236S mutation);
[0060] The vector includes pINA1269-Nat;
[0061] The sequence 3 includes:
[0062] (Ⅰ) The nucleotide sequence shown in SEQ ID NO:3; or
[0063] (II), nucleotide sequences that encode the same protein as the nucleotide sequence shown in (I) but are different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0064] (III), nucleotide sequences obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or
[0065] (IV), nucleotide sequences having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);
[0066] The said sequence 4 includes:
[0067] (I), the nucleotide sequence shown in SEQ ID NO:3; or
[0068] (II), nucleotide sequences that encode the same protein as the nucleotide sequence shown in (I) but are different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0069] (III), nucleotide sequences obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or
[0070] (IV), nucleotide sequences having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);
[0071] The enzymes used for said linearization include BamHI and KpnI;
[0072] The 3β-HSD derived from Homo sapiens (type I) has higher activity and uses DHEA as the main substrate, while the 3β-HSD derived from Homo sapiens (type II) tends to use P5 and 17OHP5 as substrates.
[0073] In some specific embodiments of the present invention, the construction of module four includes: splicing the left arm of the IntF integration site, pUC18H, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, CYP17A1, and POR (the method is the same as the construction of module one) to obtain a fragment containing restriction sites at both ends, and obtaining module four after digestion;
[0074] The said pUC18H is pUC18H digested with HincII;
[0075] The sources of CYP17A1 and POR include Equus caballus;
[0076] The method used for the splicing includes Gibson; the restriction enzyme cleavage site includes NotI; the restriction enzyme cleavage includes using NotI for cleavage.
[0077] In some specific embodiments of the present invention, the construction of Module Five includes: knocking out the Leu2 selection marker of SyBE_Yl2091004 to obtain SyBE_Yl2091004 without the Leu2 tag;
[0078] The method used for the knockout includes the Cre-loxP system.
[0079] In some specific embodiments of the present invention, the construction of Module Six includes: splicing the left arm of the IntC integration site, the artificial promoter hp8d, Hs_3β-HSD2, the Yarrowia lipolytica terminator OCTt, the leucine auxotrophic selection marker Leu2 with LoxP sites at both ends, and the right arm of the IntC integration site by OE-PCR to obtain a fragment containing NotI restriction enzyme cleavage sites at both ends; ligating the above fragment with the plasmid pUC57-Kan-Simple linearized by HindIII to obtain an integration plasmid.
[0080] In some specific embodiments of the present invention, the construction of Module Seven includes: simultaneously integrating Module One expressing CYP17A1-POR from Mesocricetus auratus, Module Six, and Module Three expressing Vv_3β-HSD into ATCC201249.
[0081] In some specific embodiments of the present invention, the construction of Module A includes: splicing the left arm of the IntD integration site and Terminator 1; splicing the terminal sequence of Terminator 2, the leucine auxotrophic selection marker Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site to obtain IntD-L and IntD-R; ligating CYP17A1 and POR with the expression module digested by BsmBI, and assembling the CYP17A1 and POR modules with the same species source with IntD-L, IntD-R, and pUC18H to obtain an integration plasmid, and obtaining Module A after enzyme digestion;
[0082] The Terminator 1 is the Saccharomyces cerevisiae GPM1t terminator; the Terminator 2 is the Saccharomyces cerevisiae FBA1t;
[0083] The splicing method includes OE-PCR; the expression modules include TEF1inp-LIP2t-GPDt, GPDt-TEF1inp-OCT1t-FBA1t; the sources of the CYP17A1 and POR modules include Equus caballus, Ovis aries, Mesocricetus auratus, or Xenopus laevis; the pUC18H is pUC18H digested with IntD-L, IntD, and HincII; the assembly method used includes Gibson; the digestion includes digestion with NotI enzyme.
[0084] The integration plasmids include pIntD-Oa_CYP17-POR, pIntD-Ma_CYP17-POR, pIntD-Ec_CYP17-POR, pIntD-Xl_CYP17-POR.
[0085] In some specific embodiments of the present invention, the construction of module B includes: integrating the left arm of the IntB integration site, the tag, the right arm of the IntB integration site, the promoter, the terminator, and CYB5 by splicing to obtain an integration plasmid, and obtaining module B after digestion.
[0086] The tag includes the auxotrophic uracil tag Ura3; the promoter includes TEF1in; the terminator includes ACOt; the source of CYB5 includes Equus caballus, Ovis aries, or Mesocricetus auratus; the splicing method used includes Gibson; the digestion includes digestion with NotI enzyme.
[0087] In some specific embodiments of the present invention, the construction of module C includes: integrating mCYP11A1 into an expression cassette with promoter 1 and 3β-HSD into an expression cassette with promoter 2, and assembling the mCYP11A1 expression cassette and the 3β-HSD expression cassette into a digested pINA1269 integration plasmid, and finally linearizing the plasmid by digestion with NotI to obtain module C.
[0088] The source of mCYP11A1 includes Sus scrofa; the promoter 1 includes TEF1p; the source of 3β-HSD includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II); the promoter 2 includes EXP1p; the method used for assembly includes Gibson; the enzymes used for digesting pINA1269 include SalI and ClaI.
[0089] In some specific embodiments of the present invention, the construction of module D includes: integrating the left arm of the IntF integration site, pUC18H, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, CYP17A1 and the POR module by splicing to obtain a fragment containing restriction sites at both ends, and obtaining module D after digestion.
[0090] The pUC18H is pUC18H digested with HincII; the sources of the CYP17A1 and POR modules include Ovis aries and Mesocricetus auratus; the method used for splicing includes Gibson; the restriction sites include NotI; the digestion includes digestion with NotI.
[0091] The present invention also provides the use of any of the following in the synthesis of steroid compounds and / or steroid hormone drugs:
[0092] (I), the expression element; and / or
[0093] (II), the plasmid; and / or
[0094] (III), the host.
[0095] In some specific embodiments of the present invention, the steroid compounds and / or steroid hormone drugs include progesterone, pregnenolone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, dehydroepiandrosterone, androstenedione and / or testosterone;
[0096] In some specific embodiments of the present invention, the progesterone is de novo synthesized using a carbon source and / or 3β-HSD in a microbial chassis.
[0097] In some specific embodiments of the present invention, the 17-hydroxyprogesterone is de novo synthesized using a carbon source, 3β-HSD, CYP17A1 and POR in a microbial chassis.
[0098] In some specific embodiments of the present invention, 17 - hydroxy pregnenolone is de novo synthesized in a microbial chassis using a carbon source, CYP17A1, and POR.
[0099] In some specific embodiments of the present invention, dehydroepiandrosterone is de novo synthesized in a microbial chassis using a carbon source, CYP17A1, POR, and / or CYB5.
[0100] In some specific embodiments of the present invention, androstenedione and testosterone are de novo synthesized in a microbial chassis using a carbon source, CYP17A1, POR, CYB5, and / or 3β - HSD.
[0101] In some specific embodiments of the present invention, the carbon source includes glucose; the microbial chassis includes the high - yield ergosterol - producing Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild - type Yarrowia lipolytica strain ATCC201249;
[0102] The source of 3β - HSD includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation), or Homo sapiens (type II, L236S mutation);
[0103] The sources of CYP17A1 and POR include Equus caballus, Ovis aries, Mesocricetus auratus, or Xenopus laevis;
[0104] The source of CYB5 includes Equus caballus, Ovis aries, Mesocricetus auratus, or Sus scrofa.
[0105] In some specific embodiments of the present invention, the directed synthesis of androstenedione includes co - culturing the upstream module expressing 3β - HSD and the downstream module expressing CYP17A1, POR, and / or CYB5.
[0106] In some specific embodiments of the present invention, the source of 3β - HSD includes Bos taurus; the sources of CYP17A1, POR, and / or CYB5 include Mycobacterium tuberculosis and / or Ovis aries;
[0107] In some specific embodiments of the present invention, the upstream module includes module C;
[0108] The downstream module includes one or more of module A, module B, module four, module two, or module five.
[0109] In some specific embodiments of the present invention, the construction of the upstream module includes: mCYP11A1 is expressed under promoter 1, 3β-HSD is expressed under promoter 2, and both are simultaneously integrated into the pBR322 site; promoter 1 includes TEF1p; promoter 2 includes EXP1p;
[0110] The construction of the downstream module includes: CYP17A1 and POR are both expressed under a promoter and integrated into the IntD site of the chassis strain genome; the promoter includes TEF1inp; the chassis strain includes the high-yield ergosterol-producing Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249.
[0111] In some specific embodiments of the present invention, the combination with the highest directed synthesis amount of androstenedione includes co-culturing a host expressing module C with a host expressing module five, module four, and / or module two; module C is selected from Bos taurus origin; module two is selected from Equus caballus origin.
[0112] In some specific embodiments of the present invention, the synthesis of 17-hydroxyprogesterone includes co-culturing an upstream module co-expressing the pregnenolone pathway and / or 3β-HSD with a downstream module expressing only CYP17A1, CYB5, and POR.
[0113] In some specific embodiments of the present invention, the source of 3β-HSD includes Bos taurus; the source of CYP17A1, POR, and / or CYB5 includes Mycobacterium tuberculosis and / or Ovis aries;
[0114] The combination with the highest synthesis of 17-hydroxyprogesterone includes co-culturing a host expressing module C with a host expressing module A and / or module B; module C is selected from Bos taurus origin; module A and / or module B is selected from Ovis aries origin.
[0115] In some specific embodiments of the present invention, the CYP17A1 with high-efficiency 17α-hydroxylation of steroid substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone includes sources from Mesocricetus auratus and / or Ovisaries.
[0116] In some specific embodiments of the present invention, the CYP17A1 with high-efficiency 17,20-lyase activity of steroid substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone includes sources from Mesocricetus auratus and / or Equus caballus.
[0117] In some specific embodiments of the present invention, one or more of P4, 17OHP5, 17OHP4 or DHEA are synthesized using the P5 as a substrate.
[0118] In some specific embodiments of the present invention, the synthesis of P4 using the P5 as a substrate includes the expression of 3β-HSD; the sources of 3β-HSD include one or more of Vaccinia virus, Bos taurus, Mycobacterium tuberculosis, Homosapiens (type I) or Homo sapiens (type II).
[0119] In some specific embodiments of the present invention, the synthesis of 17OHP5 using the P5 as a substrate includes the co-expression of CYP17A1 and POR; the sources of CYP17A1 and POR include Ovis aries and / or Mesocricetus auratus.
[0120] In some specific embodiments of the present invention, the synthesis of 17OHP4 using the P5 as a substrate includes the co-expression of 3β-HSD, CYP17A1 and POR; the source of 3β-HSD includes Homo sapiens (type II) and / or Vaccinia virus; the sources of CYP17A1 and POR include Ovis aries.
[0121] In some specific embodiments of the present invention, the synthesis of DHEA using the P5 as a substrate includes the co-expression of CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries and / or Equus caballus; the source of CYB5 includes Equus caballus.
[0122] In some specific embodiments of the present invention, 17OHP4 is synthesized using the 17OHP5 as a substrate.
[0123] In some specific embodiments of the present invention, the synthesis of 17OHP4 using the 17OHP5 as a substrate includes the expression of 3β-HSD; the sources of the 3β-HSD include Homo sapiens (type I) and / or Homo sapiens (type II).
[0124] In some specific embodiments of the present invention, DHEA is synthesized using the 17OHP5 as a substrate.
[0125] In some specific embodiments of the present invention, the synthesis of DHEA using the 17OHP5 as a substrate includes the co-expression of CYP17A1, POR, and / or CYB5; the sources of the CYP17A1 and POR include Ovis aries; the source of the CYB5 includes Mesocricetus auratus, Equus caballus, or Sus scrofa.
[0126] In some specific embodiments of the present invention, 4AD and TS are synthesized using the DHEA as a substrate.
[0127] In some specific embodiments of the present invention, the synthesis of 17OHP4 using the 17OHP5 as a substrate includes the expression of 3β-HSD; the sources of the 3β-HSD include one or more of Vaccinia virus, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), or Bos taurus;
[0128] In some specific embodiments of the present invention, 4AD and TS are synthesized using the 17OHP4.
[0129] In some specific embodiments of the present invention, the synthesis of 4AD and TS using the 7OHP4 includes the co-expression of CYP17A1, POR, and / or CYB5; the sources of the CYP17A1 and POR include Mesocricetus auratus, Equus caballus, or Ovis aries; the sources of the CYB5 include Equus caballus, Ovis aries, Mesocricetus auratus, or Sus scrofa.
[0130] The present invention provides a method for achieving the directional synthesis of path products at complex reticular path nodes by combinatorial expression of different path modules;
[0131] a) Such as: the directional synthesis of androstenedione (as described in Example 7);
[0132] b) For example, the synthesis of 17-hydroxyprogesterone: Upstream modular bacterium: co-expressing pregnenolone pathway and 3β-HSD; Downstream modular bacterium: only expressing CYP17A1, CYB5 and POR. Co-culturing the upstream module and the downstream module of the mixed bacteria can achieve the synthesis of 17-hydroxyprogesterone from glucose;
[0133] Two CYP17A1s that can efficiently 17α-hydroxylate steroid substrates in heterologous synthesis: Ma_CYP17A1, Oa_CYP17A1;
[0134] Two CYP17A1s that have efficient 17,20-lyase activity on steroid substrates in heterologous synthesis: Ma_CYP17A1, Ec_CYP17A1;
[0135] Directed synthesis of node products is achieved by combinatorial expression of specific reticular pathway products in a yeast chassis;
[0136] a) Synthesis of P4 using P5 as a substrate: Express 3β-HSD;
[0137] b) Synthesis of 17OHP5 using P5 as a substrate: Co-express CYP17A1, POR;
[0138] c) Synthesis of 17OHP4 using P5 as a substrate: Co-express 3β-HSD, CYP17A1, POR;
[0139] d) Synthesis of DHEA using P5 as a substrate: Co-express CYP17A1, POR, CYB5;
[0140] Construct an efficient biotransformation synthesis pathway by combinatorial expression of homologous proteins with complementary catalytic specificities;
[0141] a) For the synthesis of P4 using P5 as a substrate: Single expression of Vv_3β-HSD;
[0142] b) For the synthesis of P4 using P5 as a substrate: Single expression of Bt_3β-HSD;
[0143] c) For the synthesis of P4 using P5 as a substrate: Single expression of Mt_3β-HSD;
[0144] d) For the synthesis of P4 using P5 as a substrate: Single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);
[0145] e) For the synthesis of P4 using P5 as a substrate: Single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);
[0146] f) For the synthesis of P4 using P5 as a substrate: Combinatorial expression of 3β-HSD in a) - e);
[0147] g) For the synthesis of 17OHP4 using 17OHP5 as the substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);
[0148] h) For the synthesis of 17OHP4 using 17OHP5 as the substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);
[0149] i) For the synthesis of 17OHP4 using 17OHP5 as the substrate: co-expression of Hs_3β-HSD1 and Hs_3β-HSD2;
[0150] j) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: single expression of Vv_3β-HSD;
[0151] k) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: single expression of Mt_3β-HSD;
[0152] l) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);
[0153] m) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);
[0154] n) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: single expression of Bt_3β-HSD2;
[0155] o) For the synthesis of 4AD and TS (testosterone) using DHEA as the substrate: co-expression of 3β-HSD in j) - n);
[0156] p) For the synthesis of DHEA using P5 as the substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, Ec_CYB5;
[0157] q) For the synthesis of 17OHP4 using P5 as the substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, Oa_POR;
[0158] r) For the synthesis of 17OHP5 using P5 as the substrate: co-expression of Oa_CYP17A1, Oa_POR;
[0159] s) For the synthesis of 17OHP5 using P5 as the substrate: co-expression of Ma_CYP17A1, Ma_POR;
[0160] t) For synthesizing 17OHP5 using P5 as the substrate: co-express CYP17A1 and POR in r) - s);
[0161] u) For synthesizing DHEA using 17OHP5: co-express Oa_CYP17A1, Ma_CYB5, Oa_POR;
[0162] v) For synthesizing DHEA using 17OHP5: co-express Oa_CYP17A1, Ec_CYB5, Oa_POR;
[0163] w) For synthesizing DHEA using 17OHP5: co-express Oa_CYP17A1, Ss_CYB5, Oa_POR;
[0164] x) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ma_CYP17A1, Ss_CYB5, Ma_POR;
[0165] y) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ec_CYP17A1, Ss_CYB5, Ec_POR;
[0166] z) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Oa_CYP17A1, Ss_CYB5, Oa_POR;
[0167] aa) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ma_CYP17A1, Ec_CYB5, Ma_POR;
[0168] ab) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ec_CYP17A1, Ec_CYB5, Ec_POR;
[0169] ac) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Oa_CYP17A1, Ec_CYB5, Oa_POR;
[0170] ad) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ec_CYP17A1, Oa_CYB5, Ec_POR;
[0171] ae) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ec_CYP17A1, Ma_CYB5, Ec_POR;
[0172] af) For synthesizing 4AD and TS (testosterone) using 17OHP4: co-express Ma_CYP17A1, Oa_CYB5, Ma_POR;
[0173] ag) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ma_CYP17A1, Ma_CYB5, Ma_POR.
[0174] In some specific embodiments of the present invention, the combinations with the highest directed synthesis amount of androstenedione include co-culturing the host expressing module C with the host expressing module five, module four, and / or module two; module C is selected from Bos taurus source; module two is selected from Equus caballus source.
[0175] In some specific embodiments of the present invention, in the conversion experiment using pregnenolone (P5) as the substrate, the one with the strongest pregnenolone conversion efficiency is Vv_3β-HSD; the conversion efficiency is 6.8%; those showing the second strongest catalytic efficiency include type I human and mutant 3β-HSD; the catalytic efficiency is 4.6 - 4.8%;
[0176] In the conversion experiment using 17-hydroxypregnenolone (17OHP5) as the substrate, those showing relatively strong conversion efficiency include type I human and mutant 3β-HSD, type II human and mutant 3β-HSD; the highest progesterone conversion rate of type I human 3β-HSD is 3.1%.
[0177] Using dehydroepiandrosterone (DHEA) as the substrate, those showing relatively strong catalytic activity include type II human, bovine, and mycobacterial 3β-HSD; the conversion efficiency of type II human 3β-HSD is 10.5%.
[0178] In some specific embodiments of the present invention, the host includes those containing module one
[0179] SyBE_Yl2091001 - SyBE_Yl2091004 strains, SyBE_Yl2091005 - SyBE_Yl2091016 and SyBE_Yl2090013 - SyBE_Yl2090016 strains containing module one and module two, SyBE_Yl2091030 strain containing module five, module four, and module two from Equus caballus, and SyBE_Yl2090007 strain containing module seven, module six, and module three from Vaccinia virus.
[0180] In some specific embodiments of the present invention, culturing the SyBE_Yl2091001 - SyBE_Yl2091004 strains and SyBE_Yl2091005 - SyBE_Yl2091016 strains can direct the synthesis of 17-hydroxypregnenolone;
[0181] Cultivate the strain SyBE_Yl2091030 to achieve efficient conversion of P5 to synthesize DHEA or 4AD, and P4 to synthesize DHEA or 4AD; in the biotransformation with P5 as the substrate, the DHEA synthesis amount of the strain SyBE_Yl2091030 reaches 12.6 mg / L, which is 7.32 times higher than that of SyBE_Yl2091016; in the biotransformation with P4 as the substrate, the strain SyBE_Yl2091030 achieves an androstenedione synthesis amount of 13.9 mg / L, which is 86.2 times higher than the yield of the strain SyBE_Yl2091016.
[0182] Cultivate the strain SyBE_Yl2090007 to directionally synthesize 17OHP4 with P5 as the substrate; the synthesis amount of 17OHP4 reaches 3.90 mg / .
[0183] In some specific embodiments of the present invention, the host further includes an upstream module strain and a downstream module strain;
[0184] The upstream module strains include SyBE_Yl2090018, SyBE_Yl2090006, SyBE_Yl2091025 - SyBE_Yl2091028 containing the module three; the downstream module strains include SyBE_Yl2091006 containing the module A and module B, SyBE_Yl2091016 containing the module A and module B, and SyBE_Yl2091030.
[0185] In some specific embodiments of the present invention, cultivate the strains SyBE_Yl2090018, SyBE_Yl2090006, SyBE_Yl2091025 - SyBE_Yl2091028 alone to obtain progesterone.
[0186] In some specific embodiments of the present invention, co - cultivate SyBE_Yl2091025 and SyBE_Yl2091006 in a mixture to synthesize 0.25 mg / L of 17 - hydroxyprogesterone, 0.74 mg / L of 17 - hydroxypregnenolone, and the androstenedione yield is 0.88 mg / L.
[0187] In some specific embodiments of the present invention, in the mixed co - culture system of SyBE_Yl2091025 and SyBE_Yl2091016, 0.91 mg / L of 17 - hydroxyprogesterone, 0.29 mg / L of 17 - hydroxyprogesterone are synthesized, and the androstenedione yield is 1.03 mg / L.
[0188] In some specific embodiments of the present invention, when co-culturing SyBE_Yl2091026 and SyBE_Yl2091006, 2.13 mg / L of dehydroepiandrosterone was synthesized.
[0189] In some specific embodiments of the present invention, when co-culturing SyBE_Yl2091025 and SyBE_Yl2091030, androstenedione was the main product, 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone were synthesized.
[0190] In some specific embodiments of the present invention, module three in SyBE_Yl2091025 is derived from Bostaurus; module three in SyBE_Yl2091026 is derived from Vaccinia virus; module one and module two in SyBE_Yl2091006 are derived from Mesocricetus auratus; module one and module two in SyBE_Yl2091016 are derived from Ovis aries.
[0191] The present invention also provides a drug, comprising any of the following items and pharmaceutically acceptable excipients or adjuvants:
[0192] (I), the expression element; and / or
[0193] (II), the plasmid; and / or
[0194] (III), the host.
[0195] The present invention also provides a drug combination, comprising the drug and any other active ingredient.
[0196] The present invention also provides a method for synthesizing steroid compounds and / or steroid hormone drugs, comprising taking the host, culturing it, and collecting the culture.
[0197] In some specific embodiments of the present invention, the method comprises:
[0198] (I), de novo synthesizing progesterone in a microbial chassis using a carbon source and / or 3β-HSD; and / or
[0199] (II), de novo synthesizing 17-hydroxyprogesterone in a microbial chassis using a carbon source, 3β-HSD, CYP17A1, and POR; and / or
[0200] (III), de novo synthesizing 17-hydroxypregnenolone in a microbial chassis using a carbon source, CYP17A1, and POR; and / or
[0201] (IV), de novo synthesis of dehydroepiandrosterone in a microbial chassis using a carbon source, CYP17A1, POR, and / or CYB5; and / or
[0202] (V), de novo synthesis of androstenedione and testosterone in a microbial chassis using a carbon source, CYP17A1, POR, CYB5, and / or 3β-HSD; and / or
[0203] (VI), directed synthesis of androstenedione: co-culturing a downstream module expressing CYP17A1, POR, and / or CYB5 with an upstream module expressing 3β-HSD; and / or
[0204] (VII), synthesis of 17-hydroxyprogesterone: co-culturing an upstream module co-expressing the pregnenolone pathway and / or 3β-HSD with a downstream module expressing only CYP17A1, CYB5, and POR; and / or
[0205] (VIII), synthesizing one or more of P4, 17OHP5, 17OHP4, or DHEA using P5 as a substrate; and / or
[0206] (IX), synthesizing 17OHP4 using 17OHP5 as a substrate; and / or
[0207] (X), synthesizing DHEA using 17OHP5 as a substrate; and / or
[0208] (XI), synthesizing 4AD and TS using DHEA as a substrate; and / or
[0209] (XII), synthesizing 4AD and TS using 17OHP4.
[0210] In some specific embodiments of the present invention, the carbon source includes glucose; the microbial chassis includes the high-yield ergosterol-producing Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249;
[0211] The sources of 3β-HSD include Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation), or Homo sapiens (type II, L236S mutation);
[0212] The sources of CYP17A1 and POR include Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis;
[0213] The source of CYB5 includes Equus caballus, Ovis aries, Mesocricetus auratus or Sus scrofa;
[0214] In some specific embodiments of the present invention, the source of 3β-HSD includes Bos taurus; the sources of CYP17A1, POR and / or CYB5 include Mycobacterium tuberculosis and / or Ovis aries.
[0215] In some specific embodiments of the present invention, the upstream module includes module C;
[0216] The downstream module includes one or more of module A, module B, module four, module two or module five.
[0217] In some specific embodiments of the present invention, the construction of the upstream module includes: mCYP11A1 is expressed under promoter 1, 3β-HSD is expressed under promoter 2, and both are integrated into the pBR322 site; promoter 1 includes TEF1p; promoter 2 includes EXP1p;
[0218] The construction of the downstream module includes: CYP17A1 and POR are both expressed under a promoter and integrated into the IntD site of the chassis strain genome; the promoter includes TEF1inp; the chassis strain includes the high-yield ergosterol Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249.
[0219] In some specific embodiments of the present invention, the combination with the highest directed synthesis amount of androstenedione includes co-culturing a host expressing module C with a host expressing module five, module four and / or module two; module C is selected from the Bos taurus source; module two is selected from the Equus caballus source.
[0220] In some specific embodiments of the present invention, the source of 3β-HSD includes Bos taurus; the sources of CYP17A1, POR and / or CYB5 include Mycobacterium tuberculosis and / or Ovis aries;
[0221] The combination with the highest synthesis of the 17 - hydroxyprogesterone includes co - culturing a host expressing the module C with a host expressing the module A and / or module B; the module C is selected from Bos taurus source; the module A and / or module B is selected from Ovis aries source.
[0222] In some specific embodiments of the present invention, the CYP17A1 with high - efficiency 17α - hydroxylation of steroid substrates in the directed synthesis of androstenedione and / or the synthesis of 17 - hydroxyprogesterone includes Mesocricetus auratus source and / or Ovis aries source.
[0223] In some specific embodiments of the present invention, the CYP17A1 with high - efficiency 17,20 - cleavage activity of steroid substrates in the directed synthesis of androstenedione and / or the synthesis of 17 - hydroxyprogesterone includes Mesocricetus auratus source and / or Equus caballus source;
[0224] In some specific embodiments of the present invention, the synthesis of P4 using P5 as a substrate includes expressing 3β - HSD; the source of 3β - HSD includes one or more of Vaccinia virus, Bos taurus, Mycobacterium tuberculosis, Homo sapiens (type I) or Homo sapiens (type II).
[0225] In some specific embodiments of the present invention, the synthesis of 17OHP5 using P5 as a substrate includes co - expressing CYP17A1 and POR; the sources of CYP17A1 and POR include Ovis aries and / or Mesocricetus auratus.
[0226] In some specific embodiments of the present invention, the synthesis of 17OHP4 using P5 as a substrate includes co - expressing 3β - HSD, CYP17A1 and POR; the source of 3β - HSD includes Homo sapiens (type II) and / or Vaccinia virus; the sources of CYP17A1 and POR include Ovis aries.
[0227] In some specific embodiments of the present invention, the synthesis of DHEA using P5 as a substrate includes co - expressing CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries and / or Equus caballus; the source of CYB5 includes Equus caballus.
[0228] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the sources of 3β-HSD include Homo sapiens (type I) and / or Homo sapiens (type II).
[0229] In some specific embodiments of the present invention, the synthesis of DHEA using 17OHP5 as a substrate includes co-expressing CYP17A1, POR, and / or CYB5; the sources of CYP17A1 and POR include Ovis aries; the source of CYB5 includes Mesocricetus auratus, Equus caballus, or Sus scrofa.
[0230] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the sources of 3β-HSD include one or more of Vaccinia virus, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), or Bos taurus.
[0231] In some specific embodiments of the present invention, the synthesis of 4AD and TS using 7OHP4 includes co-expressing CYP17A1, POR, and / or CYB5; the sources of CYP17A1 and POR include Mesocricetus auratus, Equus caballus, or Ovisaries; the source of CYB5 includes Equus caballus, Ovis aries, Mesocricetus auratus, or Susscrofa.
[0232] The present invention provides a method for achieving the directional synthesis of path products at complex network path nodes by combinatorially expressing different path modules:
[0233] a) For example, the directional synthesis of androstenedione (as described in Example 7);
[0234] b) For example, the synthesis of 17-hydroxyprogesterone: Upstream module bacteria: Co-express the pregnenolone pathway and 3β-HSD; Downstream module bacteria: Only express CYP17A1, CYB5, and POR. Co-culturing the upstream module and the downstream module of the mixed bacteria can achieve the synthesis of 17-hydroxyprogesterone from glucose;
[0235] Two CYP17A1s that can efficiently 17α-hydroxylate steroid substrates in heterologous synthesis: Ma_CYP17A1, Oa_CYP17A1;
[0236] Two CYP17A1s with high 17,20-lyase activity towards steroid substrates in heterologous synthesis: Ma_CYP17A1 and Ec_CYP17A1;
[0237] Directed synthesis of node products by combinatorial expression of specific reticular pathway products in yeast chassis;
[0238] a) Synthesis of P4 using P5 as a substrate: Express 3β-HSD;
[0239] b) Synthesis of 17OHP5 using P5 as a substrate: Co-express CYP17A1 and POR;
[0240] c) Synthesis of 17OHP4 using P5 as a substrate: Co-express 3β-HSD, CYP17A1, and POR;
[0241] d) Synthesis of DHEA using P5 as a substrate: Co-express CYP17A1, POR, and CYB5;
[0242] Construct an efficient biotransformation synthesis pathway by combinatorial expression of homologous proteins with complementary catalytic specificities;
[0243] a) For the synthesis of P4 using P5 as a substrate: Express Vv_3β-HSD alone;
[0244] b) For the synthesis of P4 using P5 as a substrate: Express Bt_3β-HSD alone;
[0245] c) For the synthesis of P4 using P5 as a substrate: Express Mt_3β-HSD alone;
[0246] d) For the synthesis of P4 using P5 as a substrate: Express Hs_3β-HSD1 (type I human Hs_3β-HSD) alone;
[0247] e) For the synthesis of P4 using P5 as a substrate: Express Hs_3β-HSD2 (type II human Hs_3β-HSD) alone;
[0248] f) For the synthesis of P4 using P5 as a substrate: Combinatorially express the 3β-HSDs in a) - e);
[0249] g) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Express Hs_3β-HSD1 (type I human Hs_3β-HSD) alone;
[0250] h) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Express Hs_3β-HSD2 (type II human Hs_3β-HSD) alone;
[0251] i) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Combinatorially express Hs_3β-HSD1 and Hs_3β-HSD2;
[0252] j) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: single expression of Vv_3β-HSD;
[0253] k) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: single expression of Mt_3β-HSD;
[0254] l) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);
[0255] m) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);
[0256] n) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: single expression of Bt_3β-HSD2;
[0257] o) For synthesizing 4AD and TS (testosterone) using DHEA as a substrate: co-expression of 3β-HSD in j) - n);
[0258] p) For synthesizing DHEA using P5 as a substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, Ec_CYB5;
[0259] q) For synthesizing 17OHP4 using P5 as a substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, Oa_POR;
[0260] r) For synthesizing 17OHP5 using P5 as a substrate: co-expression of Oa_CYP17A1, Oa_POR;
[0261] s) For synthesizing 17OHP5 using P5 as a substrate: co-expression of Ma_CYP17A1, Ma_POR;
[0262] t) For synthesizing 17OHP5 using P5 as a substrate: co-expression of CYP17A1 and POR in r) - s);
[0263] u) For synthesizing DHEA using 17OHP5 as a substrate: co-expression of Oa_CYP17A1, Ma_CYB5, Oa_POR;
[0264] v) For synthesizing DHEA using 17OHP5 as a substrate: co-expression of Oa_CYP17A1, Ec_CYB5, Oa_POR;
[0265] w) For the synthesis of DHEA from 17OHP5: Co-express Oa_CYP17A1, Ss_CYB5, Oa_POR;
[0266] x) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ma_CYP17A1, Ss_CYB5, Ma_POR;
[0267] y) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ec_CYP17A1, Ss_CYB5, Ec_POR;
[0268] z) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Oa_CYP17A1, Ss_CYB5, Oa_POR;
[0269] aa) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ma_CYP17A1, Ec_CYB5, Ma_POR;
[0270] ab) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ec_CYP17A1, Ec_CYB5, Ec_POR;
[0271] ac) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Oa_CYP17A1, Ec_CYB5, Oa_POR;
[0272] ad) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ec_CYP17A1, Oa_CYB5, Ec_POR;
[0273] ae) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ec_CYP17A1, Ma_CYB5, Ec_POR;
[0274] af) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ma_CYP17A1, Oa_CYB5, Ma_POR;
[0275] ag) For the synthesis of 4AD and TS (testosterone) from 17OHP4: Co-express Ma_CYP17A1, Ma_CYB5, Ma_POR.
[0276] Specifically, the method for synthesizing steroid compounds and / or steroid hormone drugs includes: culturing the host, adding a steroid substrate mother liquor for incubation, and quantifying pregnenolone (P5), progesterone (P4), 17-hydroxy pregnenolone (17OHP5), 17-hydroxy progesterone (17OHP4), dehydroepiandrosterone (DHEA), androstenedione (4AD), or testosterone (TS);
[0277] The cultivation includes cultivation in a seed medium, a biotransformation medium, or a YPD fermentation medium;
[0278] The formulation of the seed medium includes: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder; the temperature for cultivation using the seed medium is 30 °C, the rotation speed is 220 rpm, and the cultivation time is 14 - 16 h;
[0279] The formulation of the biotransformation medium includes: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder; the temperature for cultivation using the biotransformation medium is 28 °C, the rotation speed is 220 rpm, and the cultivation time is 24 h;
[0280] The formulation of the YPD fermentation medium includes: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder; the temperature for cultivation using the YPD fermentation medium is 28 °C, the rotation speed is 220 rpm, and the cultivation time is 8 days;
[0281] The synthesis of the steroid compound includes 3β - HSD isomerization transformation, 17 - hydroxylation transformation, 17,20 - cleavage transformation, DHEA synthesis, and / or 4AD synthesis.
[0282] The steroid substrate mother liquor added for the 3β - HSD isomerization transformation includes P4 and 17OHP4 solutions; the concentration of the P4 and 17OHP4 solutions is 1.75 g / L (50% EtOH - Tween80);
[0283] The steroid substrate mother liquor added for the 17 - hydroxylation transformation includes P4 and P5 solutions; the concentration of the P4 and P5 solutions is 1.75 g / L (50% EtOH - Tween80);
[0284] The steroid substrate mother liquor added for the 17,20 - cleavage transformation includes 17OHP4 and 17OHP5 solutions; the concentration of the 17OHP4 and 17OHP5 solutions is 1.75 g / L (50% EtOH - Tween80);
[0285] The steroid substrate mother liquor added for the DHEA synthesis includes P5 solution; the concentration of the P5 solution is 3.5 g / L (50% EtOH - Tween80);
[0286] The steroid substrate mother liquor added for the 4AD synthesis includes P4 solution; the concentration of the P4 solution is 3.5 g / L (50% EtOH - Tween80);
[0287] The method for quantifying pregnenolone includes: taking the cultured host, centrifuging, resuspending, boiling, adding a saponification reaction solution for reaction, adding an extraction solvent, concentrating, and detecting;
[0288] The centrifugation speed is 12000g and the centrifugation time is 2 min; the solution used for resuspension is hydrochloric acid; the concentration of the hydrochloric acid is 3 mol / L; the boiling temperature is 100 °C; the saponification reaction solution is a potassium hydroxide - methanol solution; the concentration of the potassium hydroxide - methanol solution is 2 mol / L; the extraction solvent is n - hexane; the concentration is carried out using a vacuum centrifugal concentrator; the concentration temperature is 25 °C, the time is 30 min, and the rotation speed is 7000 rpm;
[0289] The method for quantifying progesterone, 17 - hydroxypregnenolone, 17 - hydroxyprogesterone, DHEA or androstenedione includes: taking the cultured host, adding glass beads and an extraction solvent, concentrating, and detecting;
[0290] The extraction solvent is ethyl acetate; the concentration temperature is 25 °C, the time is 1200 min, and the rotation speed is 7000 rpm.
[0291] The present invention provides the directional synthesis of reticular pathway products. Compared with the transformation of steroid substrates using natural microbial endogenous pathways, the present invention, under the yeast chassis, uses a re - constructed artificial heterologous reticular pathway. By rationally combining pathway component proteins, the directional synthesis of node products can be achieved. By combinatorially expressing pathway component homologous proteins with different catalytic specificities, the further improvement of pathway transformation efficiency can be realized. At the same time, an artificial pregnenolone synthesis pathway is constructed under the microbial chassis, and by introducing specific downstream androstenedione synthesis pathway components, the directional synthesis of androstenedione pathway node compounds is achieved using simple carbon sources as substrates. Brief Description of the Drawings
[0292] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art.
[0293] Figure 1 Shows the pathway for synthesizing androstenedione from pregnenolone in Example 1;
[0294] Figure 2 Shows the synthesis of progesterone from pregnenolone in Example 1;
[0295] Figure 3 Shows the synthesis of dehydroepiandrosterone from pregnenolone in Example 1;
[0296] Figure 4 Shows the synthesis of 17 - hydroxyprogesterone from pregnenolone in Example 1;
[0297] Figure 5It shows the synthesis of 17-hydroxy pregnenolone from pregnenolone in Example 1;
[0298] Figure 6 It shows the isomerization efficiency of 3β-HSD from different sources using pregnenolone, 17-hydroxy pregnenolone, and DHEA as substrates in the background of Yarrowia lipolytica in Example 1;
[0299] Figure 7 It shows the 17α-hydroxylation efficiency of CYP17A1 from different sources using pregnenolone and progesterone as substrates in the background of Yarrowia lipolytica in Example 2; among them, the left figure shows the 17α-hydroxylation efficiency of CYP17A1 from different sources using pregnenolone as a substrate in the background of Yarrowia lipolytica; the right figure shows the 17α-hydroxylation efficiency of CYP17A1 from different sources using progesterone as a substrate in the background of Yarrowia lipolytica;
[0300] Figure 8 It shows the 17,20-lyase efficiency of different combinations of CYP17A1 and CYB5 sources using 17-hydroxy pregnenolone and 17-hydroxy progesterone as substrates in the background of Yarrowia lipolytica in Example 2; among them, the left figure shows the 17,20-lyase efficiency of different combinations of CYP17A1 and CYB5 sources using 17-hydroxy pregnenolone as a substrate in the background of Yarrowia lipolytica; the right figure shows the 17,20-lyase efficiency of different combinations of CYP17A1 and CYB5 sources using 17-hydroxy progesterone as a substrate in the background of Yarrowia lipolytica;
[0301] Figure 9 It shows the efficiency of the recombinant strain in synthesizing dehydroepiandrosterone using pregnenolone as a substrate in Example 3;
[0302] Figure 10 It shows the yield of androstenedione synthesized by the recombinant strain using progesterone as a substrate in Example 3; among them, the left figure shows SyBE_Yl2091016; the right figure shows SyBE_Yl2091030;
[0303] Figure 11 It shows that the strain SyBE_Yl2090007 synthesizes 17-hydroxy progesterone using pregnenolone as a substrate in Example 4;
[0304] Figure 12 It shows the test of the effect of 3β-HSD from different sources in synthesizing progesterone in recombinant yeast in Example 5;
[0305] Figure 13 It shows the yield of androstenedione synthesized by the mixed culture system in Example 6 (bar chart); among them, the left figure shows the yield of androstenedione synthesized by the mixed culture of SyBE_Yl2091025 - SyBE_Yl2091016; the right figure shows
[0306] the yield of androstenedione synthesized by the mixed culture of SyBE_Yl2091025 - SyBE_Yl2091006;
[0307] Figure 14 Show the synthesis of dehydroepiandrosterone by mixed bacteria in Example 7;
[0308] Figure 15 Show the catalytic efficiency of 17α-hydroxylation and 17,20-lysis of CYP17A1 and CYB5 components from different sources by biotransformation in Example 8; among them, the left figure shows the efficiency of catalyzing 17α-hydroxylation with P4 as the substrate, and the right figure shows the efficiency of catalyzing 17,20-lysis with 17OHP4 as the substrate;
[0309] Figure 16 Show the yield of de novo synthesis of 4AD in the mixed bacteria system in Example 8 (bar chart); among them, the left figure shows the yield of de novo synthesis of 4AD by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091016; the right figure shows
[0310] The yield of de novo synthesis of 4AD by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091030. Detailed implementation manners
[0311] The present invention discloses the directional synthesis of reticular path products. Those skilled in the art can draw on the content of this article and appropriately improve process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0312] Taking the directional synthesis of androstenedione path node products in Yarrowia lipolytica as an example, the present invention provides a method for decoupling reticular paths in a microbial chassis to achieve the directional synthesis of target compounds. Briefly, the present invention utilizes ① using Yarrowia lipolytica as the chassis, ② using the substrate specificity of enzyme catalysis to construct a steroid hormone synthesis path, ③ according to the synthesis requirements of the target compound, selectively expressing path component proteins to construct a synthesis path, and ④ using the microbial chassis to de novo synthesize steroid hormones. Through the combined optimization of the above methods, the efficient synthesis of specific target steroids in the microbial system is achieved.
[0313] As an unconventional yeast, Yarrowia lipolytica has the following advantages in steroid synthesis: ① Its genomic sequence is known, allowing for genetic manipulation and strong proliferation ability, which is beneficial for metabolic modification and large-scale production. ② Acetyl-CoA, as a precursor for steroid synthesis, has a high metabolic flux in Yarrowia lipolytica, facilitating steroid synthesis. ③ After metabolic modification, this species has a high level of heterologous protein expression. At the same time, post-transcriptional glycosylation modification of cells is closer to mammalian cells compared to Saccharomyces cerevisiae, which is beneficial for the expression of proteins of mammalian origin and thus the synthesis of animal-derived steroids. ④ It has GRAS (generally regarded as safe) level of safety and can be considered as a chassis for drug synthesis. ⑤ Yarrowia lipolytica has a wide substrate spectrum and can utilize oils as substrates in addition to glucose. Therefore, it can use industrial by-products and waste to produce target products. ⑥ When Yarrowia lipolytica uses oil as a carbon source, the accumulation of intracellular lipids will cause lipid droplets to become larger, providing storage space for storing non-polar products (such as steroids) and facilitating the reduction of the burden on cells caused by product accumulation. ⑦ Compared with the traditional host Saccharomyces cerevisiae for heterologous steroid synthesis, Yarrowia lipolytica does not have a homologous gene of ATF2 (alcohol O-acetyltransferase), which can cause steroid esterification in Saccharomyces cerevisiae and hinder the further biotransformation of steroids in cells.
[0314] Under the yeast chassis with a relatively pure and clear metabolic background in the present invention, the exogenous steroid synthesis pathway is orthogonal to the endogenous metabolism of microorganisms, enabling steroid biotransformation to be carried out in a relatively pure background and better realizing the directional synthesis of intermediate node products.
[0315] The exploration of de novo synthesis of steroid hormones using microorganisms is relatively limited. The present invention realizes the directional synthesis of node products of the reticular pathway from simple carbon sources to androstenedione.
[0316] Constructing an artificial synthesis pathway can achieve the directional synthesis of pathway node compounds and the enhancement of pathway flux through the combination of proteins with different catalytic specificities and heterologous expression.
[0317] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for realizing the directional synthesis of target compounds.
[0318] The present invention provides the following:
[0319] 1. Construct an artificial pathway in a microbial chassis to achieve the synthesis of steroid compounds.
[0320] 2. Construct an artificial pathway in the Yarrowia lipolytica chassis to achieve the synthesis of steroid compounds.
[0321] 3. A method for de novo synthesizing 17-hydroxyprogesterone in a microbial chassis by using the combined expression of 9 kinds of 3β-HSD and 4 kinds of CYP17A1 in Example 1.
[0322] 4. Method for de novo synthesis of 17 - hydroxy pregnenolone by 4 CYP17A1s in the microbial chassis as shown in the table of Example 1 using combinatorial expression.
[0323] 5. Method for de novo synthesis of dehydroepiandrosterone by 4 CYP17A1s and 4 CYB5s in the microbial chassis as shown in the table of Example 1 using combinatorial expression.
[0324] 6. Method for de novo synthesis of androstenedione and testosterone by 4 CYP17A1s, 4 CYB5s and 9 3β - HSDs in the microbial chassis as shown in the table of Example 1 using combinatorial expression.
[0325] 7. Method for de novo synthesis of 17 - hydroxyprogesterone by 9 3β - HSDs and 4 CYP17A1s in the Yarrowia lipolytica chassis as shown in the table of Example 1 using combinatorial expression.
[0326] 8. Method for de novo synthesis of 17 - hydroxy pregnenolone by 4 CYP17A1s in the Yarrowia lipolytica chassis as shown in the table of Example 1 using combinatorial expression.
[0327] 9. Method for de novo synthesis of dehydroepiandrosterone by 4 CYP17A1s and 4 CYB5s in the Yarrowia lipolytica chassis as shown in the table of Example 1 using combinatorial expression.
[0328] 10. Method for de novo synthesis of androstenedione and testosterone by 4 CYP17A1s, 4 CYB5s and 9 3β - HSDs in the Yarrowia lipolytica chassis as shown in the table of Example 1 using combinatorial expression.
[0329] 11. Method for constructing an engineered bacterium that can de novo synthesize progesterone using simple carbon sources by using bovine - derived 3β - HSD.
[0330] 12. Method for constructing an engineered bacterium that can de novo synthesize progesterone using simple carbon sources by using human - derived 3β - HSD.
[0331] 13. Method for constructing an engineered bacterium that can de novo synthesize progesterone using simple carbon sources by using vaccinia virus - derived 3β - HSD.
[0332] 14. Method for constructing an engineered bacterium that can de novo synthesize progesterone using simple carbon sources by using mycobacterium - derived 3β - HSD.
[0333] 15. A method for achieving directional synthesis of path products at complex network path nodes by combinatorial expression of different path modules.
[0334] a) For example: directional synthesis of androstenedione (as described in Example 7)
[0335] b) For example, the synthesis of 17-hydroxyprogesterone: Upstream module bacteria: Co-express the pregnenolone pathway and 3β-HSD; Downstream module bacteria: Only express CYP17A1, CYB5, and POR. Co-culturing the upstream and downstream modules of the mixed bacteria can achieve the synthesis of 17-hydroxyprogesterone from glucose.
[0336] 16. Two CYP17A1s that can efficiently 17α-hydroxylate steroid substrates in heterologous synthesis: Ma_CYP17A1, Oa_CYP17A1
[0337] 17. Two CYP17A1s that have efficient 17,20-lyase activity towards steroid substrates in heterologous synthesis: Ma_CYP17A1, Ec_CYP17A1
[0338] 18. Directed synthesis of node products by combinatorial expression of specific reticular pathway products in a yeast chassis.
[0339] a) Synthesis of P4 using P5 as a substrate: Express 3β-HSD
[0340] b) Synthesis of 17OHP5 using P5 as a substrate: Co-express CYP17A1, POR
[0341] c) Synthesis of 17OHP4 using P5 as a substrate: Co-express 3β-HSD, CYP17A1, POR
[0342] d) Synthesis of DHEA using P5 as a substrate: Co-express CYP17A1, POR, CYB5
[0343] 19. Construct an efficient biotransformation synthesis pathway by combinatorial expression of homologous proteins with complementary catalytic specificities
[0344] a) For the synthesis of P4 using P5 as a substrate: Singly express Vv_3β-HSD
[0345] b) For the synthesis of P4 using P5 as a substrate: Singly express Bt_3β-HSD
[0346] c) For the synthesis of P4 using P5 as a substrate: Singly express Mt_3β-HSD
[0347] d) For the synthesis of P4 using P5 as a substrate: Singly express Hs_3β-HSD1 (type I human Hs_3β-HSD)
[0348] e) For the synthesis of P4 using P5 as a substrate: Singly express Hs_3β-HSD2 (type II human Hs_3β-HSD)
[0349] f) For the synthesis of P4 using P5 as a substrate: Combinatorial expression of 3β-HSD in a) - e)
[0350] g) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD)
[0351] h) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD)
[0352] i) For the synthesis of 17OHP4 using 17OHP5 as a substrate: co-expression of Hs_3β-HSD1 and Hs_3β-HSD2
[0353] j) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Vv_3β-HSD
[0354] k) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Mt_3β-HSD
[0355] l) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD)
[0356] m) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD)
[0357] n) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Bt_3β-HSD2
[0358] o) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: co-expression of 3β-HSD in j) - n)
[0359] p) For the synthesis of DHEA using P5 as a substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, Ec_CYB5
[0360] q) For the synthesis of 17OHP4 using P5 as a substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, Oa_POR
[0361] r) For the synthesis of 17OHP5 using P5 as a substrate: co-expression of Oa_CYP17A1, Oa_POR
[0362] s) For the synthesis of 17OHP5 using P5 as a substrate: co-expression of Ma_CYP17A1, Ma_POR
[0363] t) For synthesizing 17OHP5 using P5 as the substrate: co - express CYP17A1 and POR in r) - s)
[0364] u) For synthesizing DHEA using 17OHP5: co - express Oa_CYP17A1, Ma_CYB5, Oa_POR
[0365] v) For synthesizing DHEA using 17OHP5: co - express Oa_CYP17A1, Ec_CYB5, Oa_POR
[0366] w) For synthesizing DHEA using 17OHP5: co - express Oa_CYP17A1, Ss_CYB5, Oa_POR
[0367] x) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ma_CYP17A1, Ss_CYB5, Ma_POR
[0368] y) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ec_CYP17A1, Ss_CYB5, Ec_POR
[0369] z) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Oa_CYP17A1, Ss_CYB5, Oa_PORaa) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ma_CYP17A1, Ec_CYB5, Ma_POR
[0370] ab) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ec_CYP17A1, Ec_CYB5, Ec_PORac) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Oa_CYP17A1, Ec_CYB5, Oa_PORad) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ec_CYP17A1, Oa_CYB5, Ec_PORae) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ec_CYP17A1, Ma_CYB5, Ec_PORaf) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ma_CYP17A1, Oa_CYB5, Ma_POR
[0371] ag) For synthesizing 4AD and TS (testosterone) using 17OHP4: co - express Ma_CYP17A1, Ma_CYB5, Ma_POR
[0372] The recombinant strains and plasmids involved in the present invention are shown in Table 1 and Table 2 as follows:
[0373] Table 1: Recombinant strains involved in the present invention
[0374]
[0375]
[0376]
[0377] Table 2: Plasmids involved in the present invention
[0378]
[0379]
[0380]
[0381]
[0382]
[0383] Optimized sequences involved in the present invention:
[0384] Ss_mCYP11A1 (SEQ NO: 5):
[0385] ATGATCTCTACCAAGACCCCCCGACCCTTCTCTGAGATCCCCTCCCCCGGAGACAAC
[0386] GGTTGGATTAACCTGTACCGATTCTGGAAGGAGAAGGGAACCCAGAAGATCCACTA
[0387] CCACCACGTGCAGAACTTCCAGAAGTACGGCCCCATCTACCGAGAGAAGCTGGGAA
[0388] ACCTGGAGTCCGTCTACATCATTGACCCCGAGGACGTGGCCCTGCTGTTCAAGTTCG
[0389] AGGGCCCCAACCCCGAGCGATACAACATTCCCCCCTGGGTCGCCTACCACCAGCACT
[0390] ACCAGAAGCCCGTGGGTGTCCTGCTGAAGAAGTCTGGCGCTTGGAAGAAGGACCGA
[0391] CTGGTCCTGAACACCGAGGTCATGGCCCCCGAGGCTATCAAGAACTTCATTCCCCTG
[0392] CTGGACACCGTGTCCCAGGACTTCGTGGGCGTCCTGCACCGACGAATCAAGCAGCA
[0393] GGGTTCTGGCAAGTTCTCCGGAGACATTCGAGAGGACCTGTTCCGATTCGCCTTCGA
[0394] GTCTATCACCAACGTCATTTTCGGCGAGCGACTGGGAATGCTGGAGGAGATCGTGG
[0395] ACCCCGAGGCCCAGAAGTTCATTGACGCTGTCTACCAGATGTTCCACACCTCCGTGC
[0396] CTATGCTGAACCTGCCTCCCGACCTGTTCCGACTGTTCCGAACCAAGACCTGGCGAG
[0397] ATCACGTCGCCGCTTGGGACACCATCTTCAACAAGGCCGAGAAGTACACCCAGAAC
[0398] TTCTACTGGGACCTGCGACGAAAGCGAGAGTTCAACAACTACCCCGGAATTCTGTAC
[0399] CGACTGCTGGGTAACGACAAGCTGCTGTCTGAGGACGTCAAGGCCAACGTGACCGA
[0400] GATGCTGGCTGGCGGAGTGGACACCACCTCTATGACCCTGCAGTGGCACCTGTACG
[0401] AGATGGCCCGATCCCTGAACGTCCAGGAGATGCTGCGAGAGGAGGTGCTGAACGCC
[0402] CGACGACAGGCTCAGGGAGACACCTCCAAGATGCTGCAGCTGGTCCCCCTGCTGAA
[0403] GGCTTCTATCAAGGAGACTCTGCGACTGCACCCCATTTCCGTGACCCTGCAGCGATA
[0404] CCTGGTCAACGACCTGGTGCTGCGAGACTACATGATCCCTGCTAAGACCCTGGTGCA
[0405] GGTCGCTGTGTACGCTATGGGTCGAGATCCCGCTTTCTTCTCTAACCCCGGACAGTT
[0406] CGACCCTACCCGATGGCTGGGCAAGGAGCGGGACCTGATCCACTTCCGAAACCTGG
[0407] GATTCGGTTGGGGCGTCCGACAGTGCGTCGGACGACGAATTGCCGAGCTGGAGATG
[0408] ACCCTGTTCCTGATCCACATTCTGGAGAACTTCAAGGTCGAGCTGCAGCACTTCTCC
[0409] GACGTGGACACCATCTTCAACCTGATTCTGATGCCCGACAAGCCCATTTTCCTGGTG
[0410] TTCCGACCCTTCAACCAGGACCCCCTGCAGGCTTAA
[0411] Oa_CYP17A1(SEQ NO: 6):
[0412] ATGTGGGTCCTGCTGGCCGTCTTCCTGCTGACCCTGGCCTACCTGTTCTGGCCCAAG
[0413] ACCAAGCACTCCGGCGCCAAGTACCCCCGATCCCTGCCCTCCCTGCCCCTGGTTGGC
[0414] TCCCTGCCTTTCCTCCCCCGACGAGGCCAGCAGCACGAGAACTTCTTCAAGCTGCAG
[0415] GAGAAGTACGGCCCCATCTACTCCTTCCGACTGGGCTCCAAGACCACCGTCATGATT
[0416] GGTCACCACCAGCTGGCCCGAGAGGTCCTGCTCAAGAAGGGTAAGGAGTTTTCCGG
[0417] CCGACCCAAGGTCGCTACCCTGGACATCCTGTCCGACAACCAGAAGGGCATCGCCTT
[0418] CGCTGACCACGGCGCCCACTGGCAGCTGCACCGAAAGCTGGTCCTCAACGCCTTTGC
[0419] CCTGTTCAAGGACGGCAACCTGAAGCTGGAGAAGATCATTAACCAGGAGGCTAACG
[0420] TCCTGTGCGACTTCCTGGCCACCCAGCACGGCCAGTCCATCGACCTCTCCGAGCCCC
[0421] TGTCCCTCGCCGTGACCAACATCATTTCCTTCATTTGCTTCAACTTCTCCTTTAAGAA
[0422] CGAGGACCCCGCCCTCAAGGCCATCCAGAACGTTAACGACGGCATTCTCGAGGTGC
[0423] TCGGCAAGGAGGTGCTGCTGGACATCTTCCCTGCCCTGAAGATCTTCCCCTCCAAGG
[0424] CCATGGAGAAGATGAAGGGCTGCGTGGAGACTCGAAACGAGCTGCTGTCCGAGATT
[0425] CTGGAGAAGTGCCAGGAGAACTTCACCTCCGACTCTATTACCAACCTGCTGCACATC
[0426] CTGATGCAGGCCAAGGTCAACGCTGACAACAACAACACCGGCCCCGAGCAGGACTC
[0427] CAAGCTGCTGTCCAACCGACACATGCTCGCCACCATCGCCGACATCTTCGGCGCCGG
[0428] CGTCGAGACTACCACCTCCGTCATCAAGTGGATCGTCGCCTACCTGCTGCACCACCC
[0429] CTCCCTGAAGAAGCGAATCCAGGACTCCATCGACCAGAACATCGGATTCAACCGAA
[0430] CCCCCACCATCTCCGACCGAAACCGACTGGTCCTGCTCGAGGCCACCATCCGAGAG
[0431] GTCCTCCGAATCCGACCCGTCGCCCCCATGCTCATCCCCCACAAGGCCATCATCGAC
[0432] TCCTCCATCGGCGACCTGACCATCGACAAGGGCACCGACGTCGTCGTCAACCTGTGG
[0433] GCCCTGCACCACAACGAGAAGGAGTGGCAGCAGCCCGACCTCTTCATGCCCGAGCG
[0434] ATTTCTGGACCCCACCGGAACCCAGCTGATCTCCCCCTCCCTGTCCTACCTCCCCTTC
[0435] GGCGCCGGTCCCCGATCCTGTGTCGGCGAGATGCTCGCCCGACAGGAGCTGTTTCTG
[0436] TTTATGTCTCGACTCCTGCAGCGATTCAACCTGGAGATCCCCGACGACGGCAAGCTC
[0437] CCCTCCCTGGAGGGCAACCCCTCCCTGGTTCTGCAGATCAAGCCCTTCAAGGTCAAG
[0438] ATCGAGGTCCGACAGGCCTGGAAGGAGGCCCAGGCCGAGGGTTCTACCTCCTAA
[0439] Ma_CYP17A1 (SEQ NO: 7):
[0440] ATGTGGGAGCTGGTCGCCCTGCTGCTGCTGACCCTGGCCTACTTCTTCTGGTCCAAG
[0441] TCCAAGACCTGCGGCGCCAAGTCCCCCAAGTCCCTGCCCTTCCTGCCCCTGGTCGGC
[0442] TCCCTGCCTTTTATCCCCCGACACGGCCACCCCCACGTCAACTTCTTCAAGCTGCAG
[0443] GAGAAGTACGGCCCCATCTACTCCCTCCGACTGGGCTCCACCACCACCGTCATCATT
[0444] GGCCAGTACCAGCTCGCCAAGGAGGTCCTGGTCAAGAAGGGTAAGGAGTTCTCCGG
[0445] CCGACCCCACATGGTTACCCTGGGCCTGCTGTCCGACCAGGGCAAGGGCATCGCTTT
[0446] CGCCGACTCCGGCGGATCTTGGCAGCTGCACCGAAAGCTGGCCCTCTCCTCCTTTGC
[0447] TCTGTTCCGAGATGGTAACCAGAAGCTGGAGAAGATCATCTGCCAGAAGGCTTCCTC
[0448] CCTGTGTGACTTTCTGCTGACCCACAACGAGGAGTCCATCGACCTGTCCGAGCCCAT
[0449] CTTCAACTCCATCACCAACATCATCTGCATCATTTGCTTCGGCATCTCCTACGAGAAC
[0450] CGAGATCCTATCCTCGCCACCATCAAGTCCTTTACCGAGGGCATTCTGAACTCCCTC
[0451] GGCAACGACCACCTCGTCGATATCTTCCCCTGGCTGACCATCTTCCCCAACAAGACC
[0452] GTCGATATGATCAAGAAGAACGTCAAGATCCGAGATGAAGTGCTGTCCGGCATCCT
[0453] GGAGAAGTGCAAGGAGAAGTTTAACTCCGACTCCATCTCCTCCCTGATGGACCTGCT
[0454] GATCCAGGCCAAGACCAACGCCGACAACAACAACACCTCCGAGGGCCAGGGCTCCA
[0455] ACGCCTTCTCCGACATGCACATCCTGGCCACCATCGCCGACATCTTCGGCGCCGGAA
[0456] TCGAGACTACCGCCTCCGTCCTGTCTTGGATCATCGCCTTCCTCCTGCACAACCCCGA
[0457] GGTCAAGAAGAAGATCCAGAAGGAGATTGACCAGAACATCGGATTCTCCCGAACCC
[0458] CCACCTTCAACGACCGAAACCACCTGCTGATGCTGGAGGCCACCATCCGAGAGGTC
[0459] CTGCGAATCCGACCCGTCGCCCCCATGCTGATCCCCCACCGAGCCAACTCCGACATG
[0460] TCCATCGGCGAGTTCTCCATCCCCAAGTTCACCCCCGTCATCATCAACCTGTGGGCC
[0461] CTGCACCACTCCGAGAAGGAGTGGGACCAGCCCGACCGATTCATGCCCGAGCGATT
[0462] TCTGGACCCCACCGGATCTCACCTCATCACCCCCTCCCTCTCCTACCTGCCCTTCGGC
[0463] GCCGGCGCTCGATCCTGTATCGGCGAGGTCCTCGCCCGACAGGAGCTGTTCCTGTTT
[0464] ATGGCCCACCTCCTGCAGCGATTCGACCTCGACGTCCCCGACGACGAGCAGCCCCCT
[0465] TGCCTGAAGGGTAACGCCAACGTCGTGTTTCTGATCGACCCCTTCAAGGTCAAGATT
[0466] ACCGTCCGACAGGCCTGGAAGGACGCCCAGGCCGAGGTTAACACCTGGCGACCCTA
[0467] A
[0468] Ec_CYP17A1 (SEQ NO: 8):
[0469] ATGTGGGAGCTGCTGGCCTTCCTGCTGCTGGCCATCGCCTACTTCTTCCGACCCAAG
[0470] GTCAAGTGCCCCGGCGCCAAGTACCCCAAGTCCCTGCCCTACCTGCCCCTGGTCGGC
[0471] TCCCTGCCTTTCCTCCCCCGACACGGCCACCCCCACGTCAACTTCTTCAAGCTCCAGA
[0472] AGAAGTACGGTCCTATCTACTCCCTGCGAATGGGCACCAAGACCACCGTCATGGTCG
[0473] GTCACTACCAGCTGGCCAAGGAGGTCCTGATCAAGAAGGGTAAGGAGTTCTCCGGC
[0474] CGACCCCAGGTCGCCACCCTGAACATCCTCTCCGACAACCAGAAGGGCGTCGCCTTC
[0475] GCTGACCACGGCGCCCCTTGGCAGCTGCACCGAAAGCTGGTCCGAGCCGCCTTCGCC
[0476] CTGTTCAAGGACGGCAACCAGAAGCTGGAGAAGATCATTTGCCACGAGACTTCCCT
[0477] GCTGTGCGACCTCCTGGCCACCCAGAACGGCCAGACCATCGACCTGTCCTCCCCCCT
[0478] CTTCCTGGCCGTGACCAACGTCATCTGCTGGATCTGCTTCAACTCCTCCTACATGAA
[0479] GGGCGACCCCGCCCTCGAGACTATGCAGAACTACCACAAGGGCATTCTCGAGACTC
[0480] TCGAGAAGGACAACGTCGTCGATATTTTCCCCGCCCTGAAGATCTTCCCCAACAAGT
[0481] CCCTGGAGAAGATGCGACACTGTGTGAACATCCGAAACGAGCTGCTGTCCAAGATC
[0482] TTCGAGAAGCACAAGGAGAACTTTAACTCCGACTCCATCACCTCCATGCTCGACCTC
[0483] CTGATCCAGGCCAAGAAGAACTCCGACAACAACAACACCGGCCCCGACCAGGACTC
[0484] CAAGCTCCTGTCCGACAAGCACATCCTCGCCACCATCGGCGACATCTTCGGCGCCGG
[0485] CGTCGAGACTACCACCTCCGTCGTCAAGTGGATCGTCGCCTTCCTGCTCCACGACCC
[0486] CCAGCTGAAGAAGAAGATCCAGGAGGAGATCGACCAGAACGTCGGATTCTCCCGAA
[0487] CCCCCACCCTGTCCGACCGAAACCGACTGCTGCTGCTGGAGGCCACCATCCGAGAG
[0488] GTTCTCCGAATCCGACCCGTCGCCCCCATGCTGATCCCCCACAAGGCCCTCGTCGAT
[0489] TCCTCCATCGGCGAGTTCGCCGTCGATGACGGCACCAACGTCATTATTAACCTGTGG
[0490] GCCCTGCACCACAACGAGAAGGAGTGGCACCAGCCCGACCGATTCATGCCCGAGCG
[0491] ATTTCTGGACCCCACCGGCTCCCAGCTGATCTCCCCCTCCCTGTCCTACCTGCCCTTC
[0492] GGCGCCGGTCCCCGATCCTGTATCGGCGAGCTCCTCGCCCGACAGGAGCTGTTTCTG
[0493] TTCACCGCCTGGCTCCTGCAGCGATTCAACCTGGAGGTCCCCGACGACGGCCAGCTC
[0494] CCTTCCCTGGAGGGCCACCCTACCGCCGTCTTTCTGATTGACTCCTTCAAGGTCAAG
[0495] ATTAACGTCCGACAGGCCTGGCGAGAGGCTCAGGCCGAGGGTTCCACCTAA
[0496] Xl_CYP17A1(SEQ NO:9):
[0497] ATGATCTCCTACGTCGCCGGCGCCCTGCTGCTGGCTTTCGGTCTGGCCCTGATCTCCG
[0498] TCTGGAAGTTCGCTGGTGGCAAGCACCGAGGCGCTAAGTACCCCAACTCCCTGCCCT
[0499] GCCTGCCCTTCATCGGTTCCCTGCTGCACATCGGCAACCACCTGCCCCCCCACATCCT
[0500] GTTTTGCAAGCTCCAGGAGAAGTACGGCTCCCTGTACTCCTTCCGAATGGGCTCCCA
[0501] CTACATCGTCATCGTCAACCACCACGAGCACGCCAAGGAGGTCCTCCTCAAGAAGG
[0502] GCAAGACCTTTGGCGGCCGACCCCGAGCCGTTACCACCGACATCCTCACCCGAAAC
[0503] GCCAAGGACATCGCCTTCGCCAACTACTCCCCCTCCTGGAAGTTCCACCGAAAGGTC
[0504] GTCCACGCCGCCCTCTCCATGTTTGGCGAGGGTACTGTCGCCATCGAGAAGATCATC
[0505] TCCCGAGAGGCCACCTCCCTGTGCCAGTCCCTCATCTCCTTCCAGGACAACCCCCTG
[0506] GACATGGCCCCCGAGCTCACCCGAGCCGTTACCAACGTCGTCTGCGCCCTGTGCTTC
[0507] AACACCCGATACAAGCGATGCGACCCCGAGTTCGAGGAGATGCTGGCCTACTCCAA
[0508] GGGCATCGTCGATACCGTGGCCAAGGACTCTCTGGTCGATATTTTCCCCTGGCTGCA
[0509] GATCTTCCCCAACAAGGACCTGGACATTCTGAAGCGATCCGTGGCCATCCGAGACA
[0510] AGCTGCTGCAGAAGAAGCTCAAGGAGCACAAGGAGGCTTTCTGCAACGAGGAGGTT
[0511] AACGACCTGCTGGACGCCCTGCTGAAGGCCAAGCTGTCCATGGAGAACAACAACTC
[0512] CAACATCTCCCAGGAGGTCGGCCTCACCGACGACCACCTGCTGATGACCGTCGGCG
[0513] ACATTTTCGTCGCCGGCGTGGAGACTACCACCACCGTCCTGAAGTGGACCATGGCCT
[0514] ACCTCCTGCACTACCCCGAGGTCCAGACCAAGATTCAGGAGGAGCTGGACTTCAAG
[0515] GTTGGCTTCGGCCGACACCCCGTCCTGTCCGACCGACGAATTCTGCCCTACCTCGAC
[0516] GCCACCATCTCCGAGGTCCTCCGAATCCGACCCGTCGCCCCCCTGCTGATCCCCCAC
[0517] GTTGCCCTGCAGGAGTCCTCCATCGCCGAGTACACCATCCCCCAGGACGCCCGAGTC
[0518] GTGATTAACCTGTGGTCCCTGCACCACGACCCCAACGAGTGGGAGAACCCCGAGGA
[0519] GTTCAACCCCGAGCGATTTCTCGACGAGAACGGAAACCACGTCTACTCCCCCTCTCA
[0520] GTCTTACCTGCCCTTCGGCGCCGGCATCCGAGTCTGCCTGGGCGAGGCTCTGGCCAA
[0521] GATGGAGGTCTTTCTGTTCCTGTCCTGGATTCTGCAGCGATTCACCCTGGAGCTGCCC
[0522] GCCGGCGACTCTCTCCCTGACCTGGACGGCAAGTTTGGCGTGGTTCTGCAGGTCAAG
[0523] AAGTTTCGAGTTACCACCAAGCTGCGAGAGGCCTGGAAGAACATCGACCTCACCAC
[0524] CTAA
[0525] Oa_POR (SEQ NO: 10):
[0526] ATGAACATGGGCGACTCCAACATGGACGCTGGCACCACCACCCCCGAGACTGTGGC
[0527] CGAGGAGGTCAGCTTATTTTCCACCACCGACATGATCCTGTTCTCCCTGATCGTCGG
[0528] CGTCATGACCTACTGGTTCCTCTTCCGAAAGAAGAAGGAGGAGGTCCCCGAGTTCAC
[0529] CAAGATTCAGACCACCACCTCCTCCGTCAAGGACCGATCCTTCGTGGAGAAGATGA
[0530] AGAAGACCGGCCGAAACATCATCGTCTTTTACGGCTCCCAGACCGGTACTGCCGAG
[0531] GAGTTCGCCAACCGACTCTCCAAGGACGCCCACCGATACGGCATGCGAGGCATGGC
[0532] CGCCGACCCCGAGGAGTACGACCTCGCTGACCTCTCCTCCCTCCCCGAGATCGAGAA
[0533] GGCCCTGGCTGTTTTCTGCATGGCCACCTACGGTGAGGGCGACCCCACCGACAACGC
[0534] CCAGGACTTTTACGACTGGCTGCAGGAGACTGACGTCGATCTCTCCGGCGTCAAGTA
[0535] CGCCGTTTTCGCCCTGGGTAACAAGACCTACGAGCACTTCAACGCTATGGGCAAGTA
[0536] CGTCGATAAGCGACTGGAGCAGCTGGGCGCCCAGCGAATTTTTGACCTGGGTCTGG
[0537] GCGACGACGACGGCAACCTGGAGGAGGACTTCATCACCTGGCGAGAGCAGTTCTGG
[0538] CCCGCCGTCTGCGAGCACTTTGGAGTCGAGGCTACCGGCGAGGAGTCTTCCATTCGA
[0539] CAGTACGAGCTGATGGTGCACACCGACATGGACATGGCCAAGGTCTACACCGGCGA
[0540] GATGGGCCGACTGAAGTCCTACGAGAACCAGAAGCCCCCCTTCGACGCCAAGAACC
[0541] CCTTCCTGGCCGTGGTCACCACCAACCGAAAGCTGAACCAGGGTACTGAGCGACAC
[0542] CTGATGCACCTGGAGCTGGACATCTCCGACTCCAAGATCCGATACGAGTCCGGCGA
[0543] CCACGTCGCCGTCTACCCTGCCAACGACTCCGCCCTGGTCAACCAGCTGGGCGAGAT
[0544] CCTCGGCGCCGACCTCGACGTCATCATGTCCCTGAACAACCTCGACGAGGAGTCCAA
[0545] CAAGAAGCACCCCTTCCCCTGCCCCACCTCCTACCGAACCGCCCTGACCTACTACCT
[0546] GGACATCACCAACCCCCCCCGAACCAACGTCCTCTACGAGCTGGCCCAGTACGCCTC
[0547] CGAGCCCGCTGAGCAGGAGCAGCTCCGAAAGATGGCCTCCTCCTCCGGCGAGGGCA
[0548] AGGAGCTGTACCTCCGATGGGTCCTGGAGGCCCGACGACACATTCTCGCCATTCTGC
[0549] AGGACTACCCCTCCCTGCGACCCCCCATCGACCACCTGTGCGAGCTCCTGCCCCGAC
[0550] TCCAGGCCCGATACTACTCCATTGCCTCTTCCTCCAAGGTTCACCCCAACTCCGTTCA
[0551] CATCTGCGCCGTCGCCGTCGAGTACGAGACTAAGACCGGTCGAATCAACAAGGGCG
[0552] TCGCCACCTCCTGGCTGCGAGCCAAGGAGCCCGCCTCCGAGAACGGCGGTCGAGCT
[0553] CTGGTCCCCATGTACGTGCGAAAGTCCCAGTTCCGACTGCCCTTCAAGGCCACCACC
[0554] CCCGTCATCATGGTTGGCCCCGGCACCGGCGTGGCCCCTTTTATCGGCTTCATCCAG
[0555] GAGCGAGCCTGGCTGCGACAGCAGGGCAAGGAGGTTGGCGAGACTCTCCTGTACTA
[0556] CGGCTGCCGACGATCCGACGAGGACTACCTGTACCGAGAGGAGCTGGCCGGCTTCC
[0557] ACAAGGACGGCACCCTGACCCAGCTCAACGTTGCCTTCTCTCGAGAGCAGCCCCAG
[0558] AAGGTCTACGTCCAGCACCTGCTCAAGAAGGACAAGGAGCACCTGTGGAAGCTGAT
[0559] TCACGAGGGAGGCGCTCACATCTACGTCTGCGGCGACGCCCGAAACATGGCCCGAG
[0560] ATGTTCAGAACACCTTCTACGACATCGTCGCCGAGCAGGGAGCCATGGAGCAGGCC
[0561] CAGGCCGTCGATTACGTGAAGAAGCTGATGACCAAGGGACGATACTCCCTGGACGT
[0562] CTGGTCCTAA
[0563] Ma_POR (SEQ NO: 11):
[0564] ATGACCGAGGCCGTGGCCGAGGAGGTCAGCTTATTTTCCACCACCGACGTCGTCCTG
[0565] TTCTCCCTGATCGTCGGCGTCCTGACCTACTGGTTCATCTTCCGAAAGAAGAAGGAG
[0566] GAGGTCCCCGAGTTTTCTAAGATTCAGACCGCCACCCCCTCCGTCAAGGAGTCCTCT
[0567] TTCGTTGAGAAGATGAAGAAGACCGGCCGAAACATCATCGTGTTCTACGGATCTCA
[0568] GACCGGTACTGCCGAGGAGTTTGCCAACCGACTCTCCAAGGACGCCCACCGATACG
[0569] GCATGCGAGGCATGTCCGCCGACCCCGAGGAGTACGACCTCGCCGACCTCTCCTCTC
[0570] TGCCCGAGATTGACAAGTCCCTGGTCGTTTTCTGCATGGCCACCTACGGAGAGGGCG
[0571] ACCCCACCGACAACGCCCAGGACTTCTACGACTGGCTGCAGGAGACTGACGTCGAT
[0572] CTGACCGGCGTGAAGTTCGCCGTCTTCGGCCTGGGCAACAAGACCTACGAGCACTTT
[0573] AACGCCATGGGCAAGTACGTCGATCAGCGACTGGAGCAGCTGGGCGCCCAGCGAAT
[0574] CTTCGAGCTGGGTCTGGGCGACGACGACGGCAACCTCGAGGAGGACTTCATCACCT
[0575] GGCGAGAGCAGTTCTGGCCCGCCGTCTGCGAGTTCTTTGGAGTCGAGGCTACCGGCG
[0576] AGGAGTCTTCCATCCGACAGTACGAGCTGCTGGTCCACGAGGACATCGACGCCGCC
[0577] AAGGTCTACACCGGCGAGATGGGCCGACTGAAGTCCTACGAGAACCAGAAGCCCCC
[0578] CTTTGACGCCAAGAACCCCTTCCTCGCCGCCGTCACCACCAACCGAAAGCTGAACCA
[0579] GGGTACTGAGCGACACCTGATGCACCTGGAGCTGGACATCTCCGACTCCAAGATCC
[0580] GATACGAGTCCGGTGACCACGTCGCCGTCTACCCCGCCAACGACTCCACCCTGGTCA
[0581] ACCAGATCGGCGAGATTCTCGGCGCCGACCTCGACGTCGTGATGTCCCTGAACAACC
[0582] TGGACGAGGAGTCCAACAAGAAGCACCCCTTCCCCTGCCCCACCACCTACCGAACC
[0583] GCTCTCACCTACTACCTGGACATCACCAACCCCCCCCGAACCAACGTCCTCTACGAG
[0584] CTGGCCCAGTACGCCTCCGAGCCCTCCGAGCAGGAGCAGCTCCACAAGATGGCCTC
[0585] CTCCTCCGGCGAGGGCAAGGAGCTGTACCTCTCCTGGGTCGTCGAGGCCCGACGAC
[0586] ACATTCTCGCCATCCTCCAGGACTACCCCTCCCTGCGACCCCCCATCGACCACCTGT
[0587] GTGAGCTCCTCCCTCGACTGCAGGCCCGATACTACTCCATCGCCTCCTCCTCTAAGG
[0588] TCCACCCCAACTCCGTCCACATCTGCGCCGTCGCCGTCGAGTACGAGGCCAAGTCCG
[0589] GCCGAGTGAACAAGGGCGTTGCCACCTCCTGGCTGCGAGCCAAGGAGCCCGCCGGT
[0590] GAGAACGGCCGACGAGCTCTGGTCCCCATGTTTGTCCGAAAGTCCCAGTTTCGACTG
[0591] CCCTTCAAGTCTGTCACCCCCGTTATTATGGTTGGTCCCGGCACCGGCATTGCCCCCT
[0592] TCATGGGCTTCATTCAGGAGCGAGCCTGGCTGCGAGAGCAGGGCAAGGAGGTCGGC
[0593] GAGACTCTCCTGTACTACGGCTGCCGACGATCCGACGAGGACTACCTGTACCGAGA
[0594] GGAGCTGGCCCGATTCCACAAGGACGGTGCCCTGACCCAGCTGAACGTGGCCTTTTC
[0595] CCGAGAGCAGGCCCACAAGGTCTACGTCCAGCACCTGCTGAAGCGAGACAGAGAGC
[0596] ACCTGTGGAAGCTGATCCACGAGGGCGGAGCTCACATCTACGTCTGCGGCGACGCC
[0597] CGAAACATGGCCAAGGACGTCCAGAACACCTTCTACGACATTGTCGCCGAGTTTGG
[0598] CCCCATGGAGCACGCCCAGGCCGTCGATTACGTGAAGAAGCTGATGACCAAGGGTC
[0599] GATACTCCCTGGACGTCTGGTCCTAA
[0600] Ec_POR(SEQ NO: 12):
[0601] ATGGGCGACTCCAACATGGACGCCTCCGCCCCCACCTCCGAGACTGTCGCTGAGGA
[0602] GGTCAGCTTATTTTCCATGATGGACATGTTCCTGTTCTCCCTGATCGTCGGCCTGCTG
[0603] ACCTACTGGTTCCTCTTCCGAAAGAAGAAGGACGAGATCCCCGAGTTCACCAAGAT
[0604] CCAGACCACCACCACCTCCGTCAAGGACTCCTCCTTCGTCGAGAAGATGAAGAAGA
[0605] CCGGCCGAAACATCATCGTCTTCTACGGCTCCCAGACCGGAACCGCCGAGGAGTTC
[0606] GCCAACCGACTCTCCAAGGACGCCCACCGATACGGCATGCGAGGTATGGCCGCCGA
[0607] CCCCGAGGAGTACGACCTCGCTGACCTCGGCTCCCTCTCCGAGATCGAGAACTCCCT
[0608] GGCCGTCTTCTGCATGGCCACCTACGGAGAGGGTGACCCCACCGACAACGCCCAGG
[0609] ACTTCTACGACTGGCTGCAGGAGGCCGACGTCGATCTGTCCGGCGTCAAGTACGCCG
[0610] TCTTCGGTCTGGGCAACAAGACCTACGAGCACTTTAACGCCATGGGCAAGTACGTCG
[0611] ATAAGCGACTGGAGCAGCTCGGTGCCCAGCGAATCTTCGAGCTGGGTCTGGGCGAC
[0612] GACGACGGTAACCTGGAGGAGGACTTCATCACCTGGCGAGAGCAGTTCTGGCCCGC
[0613] CGTGTGCGAGCACTTTGGAGTCGAGGCTACCGGCGAGGAGTCCTCCATTCGACAGT
[0614] ACGAGCTGCTGGTGCACACCGACATTGACGCCGCCAAGGTCTACGTGGGCGAGATG
[0615] GGCCGACTGAAGTCCTACGAGACTCAGAAGCCCCCCTTTGACGCCAAGAACCCCTTC
[0616] CTGGCCGTTGTCACCACCAACCGAAAGCTGAACCAGGGTACTGAGCGACACCTGAT
[0617] GCACCTGGAGCTGGACATCTCCGACTCCAAGATCCGATACGAGTCCGGCGACCACG
[0618] TCGCCGTCTACCCCGCTAACGACTCCGCCCTGGTCAACCAGCTGGGCGAGATCCTCG
[0619] GCGCCGACCTCGACGTCATCATGTCCCTGAACAACCTCGACGAGGAGTCCAACAAG
[0620] AAGCACCCCTTCCCCTGCCCCACCTCCTACCGAACCGCCCTGACCTACTACCTGGAC
[0621] ATCACCAACCCCCCCCGAACCAACGTCCTCTACGAGCTGGCCCAGTACGCCTCCGAG
[0622] CCCTTCGAGCAGGAGCAGCTGCGAAAGATGGCCTCCTCCTCCGGCGAGGGCAAGGA
[0623] GCTGTACCTCACCTGGGTCGTCGAGGCCCGACGACACATTCTCGCCATCCTGCAGGA
[0624] CTACCCCTCCCTGCGACCCCCCATCGACCACCTGTGCGAGCTCCTGCCCCGACTGCA
[0625] GGCCCGATACTACTCCATCGCCTCCTCCTCTAAGGTCCACCCCAACTCCGTCCACAT
[0626] CTGCGCCGTCGCCGTCGAGTACGAGACTAAGACCGGCCGAATTAACAAGGGCGTTG
[0627] CCACCACCTGGCTGCGAGCCAAGGAGCCCGCCAAGGAGAACGGCCGACGAGCCCTC
[0628] GTCCCCATGTTCGTGCGAAAGTCCCAGTTTCGACTGCCCTTCAAGGCCACCACCCCC
[0629] GTCATCATGGTCGGCCCCGGCACCGGAATCGCCCCTTTCATTGGCTTCATCCAGGAG
[0630] CGAGCCTGGCTGCAGCAGCAGGGCAAGGAGGTTGGCGAGACTCTCCTGTACTACGG
[0631] CTGCCGACGATCCGACGAGGACTACCTGTACCGAGATGAACTGGCCCAGTTCCACC
[0632] GAGATGGTTCTCTGACCCAGCTCAACGTGGCCTTCTCTCGAGAGCAGGCCCACAAGG
[0633] TCTACGTCCAGCACCTGCTGAAGCGAGACAAGGAGCACCTGTGGAAGCTGATCCAC
[0634] GAGGGCGGCGCCCACATTTACGTCTGCGGCGACGCCCGAAACATGGCCCGAGATGT
[0635] TCAGAACACCTTCTACGACATCGTCGCCGAGCTGGGAACCATGGAGCACGCCCAGG
[0636] CCGTCGATTACATTAAGAAGCTGATGACCAAGGGTCGATACTCCCTGGACGTCTGGT
[0637] CCTAA
[0638] Xl_POR(SEQ NO: 13):
[0639] ATGGGCGAGTCCTGCACCGAGCAGGACATGTGCACCTCCGAGCAGGGCAACGGCTC
[0640] CCCCGAGGAGGCTTTCTTCTCCATGGCCGACATGTTCCTGCTGTCCCTGATCGTCGGC
[0641] CTGCTGACCTACTGGTTTTTCTTTCGAAAGAAGAAGGAGGAGACTATCGAGTTCACC
[0642] AAGATCCAGCCCACCGTGAACAACTCCGTTCGAGAGTCCTCCTTTATCGAGAAGATG
[0643] AAGAAGACCGGCAAGAACATCGTCGTCTTCTACGGCTCCCAGACCGGCACCGGCGA
[0644] GGAGTTCGCCAACCGACTGGCCAAGGACGCCCACCGATACGGCGTCCGAGGAATGG
[0645] CCGCCGACCCCGAGGAGTTCGAGATGGCCGACCTGTCCCGACTGACCGAGATTGAG
[0646] AACGCCCTGGCTGTCTTCTGCATGGCCACCTACGGCGAGGGCGACCCCACCGACAA
[0647] CGCCCAGGACTTTTACGACTGGCTGCAGGAGACTGACATCGACCTGACCGGCCTGA
[0648] AGTACGCCGTTTTCGGACTGGGCAACAAGACCTACGAGCACTTTAACGCCATGGGC
[0649] AAGTACGTCGATAAGCGACTGGAGGAGCTGGGCGCCGAGCGAATCTTTGAGCTGGG
[0650] TATGGGCGACGACGACGGCAACCTGGAGGAGGACTTCATCACCTGGCGAGAGCAGT
[0651] TCTGGCCCGCCGTGTGCGAGCACTTTGGTGTGGAGGCTACCGGAGAGGACTCCTCCA
[0652] TTCGACAGTACGAGCTGGTGGTGCACACCGACGAGAACATGAACAAGGTCTACACC
[0653] GGAGAGATGGGCCGACTGAAGTCCTACGAGACTCAGAAGCCCCCCTTCGACGCCAA
[0654] GAACCCCTTCCTGGCCAACGTCACCGTCAACCGAAAGCTGAACGAGGGCGGCGACC
[0655] GACACCTGATGCACCTGGAGCTGGACGTTACCGGCTCTAAGATCCGATACGAGTCC
[0656] GGAGATCATGTCGCCGTCTACCCCGCCAACGACACCGCCCTGGTCAACAAGCTGGG
[0657] AGAGATTCTGGGCGCCGACCTGGACACCGTGATTTCCCTGAACAACCTGGACGAGG
[0658] AGTCCAACAAGAAGCACCCCTTCCCCTGCCCCACCACCTACCGAACCGCCCTGACCT
[0659] ACTACCTGGACATCACCAACCCCCCCCGAACCAACGTCCTCTACGAGCTGGCCCAGT
[0660] ACGCCACCGACTCCAAGGAGCAGGAGAACCTGCGAAAGATGGCCTCCTCCGCCCAG
[0661] GACGGCAAGGGCCTGTACCTCTCCTGGGTCGTCGAGTCCCGACGAAACATTCTGGCC
[0662] ATCCTGGAGGACGTGCCCTCCCTGCGACCCCCTCTGGACCACCTGTGCGAGCTGCTG
[0663] CCCCGACTGCAGGCTCGATACTACTCTATCGCCTCCTCCTCCAAGGTCCACCCCTCCT
[0664] CCATCCACGTGTGCGCCGTCCTCGTCGAGTACGAGACTAAGACCGGCCGAGAGAAC
[0665] AAGGGCGTTGCCACCAACTGGCTCAAGAACAAGCAGCCCTCCGACAACGGCCACAA
[0666] GTCCTCCGTCCCCATGTACGTTCGAAAGTCTCAGTTCCGACTCCCCTTCAAGCCCTCC
[0667] ACCCCCGTCATCATGATCGGCCCCGGCACCGGCATCGCCCCTTTCATCGGCTTTATC
[0668] CAGGAGCGAGAGTGGCTCAAGCAGCAGGGCAAGGACGTTGGCGAGACTGTCCTGTA
[0669] CTACGGCTGCCGACACGAGCACGAGGACTTTCTGTACAAGGACGAGCTGAAGCGAT
[0670] ACCACAAGGACGGCGTCCTGACCCAGCTCAACGTCGCCTTCTCCCGAGATCAAGAC
[0671] CGAAAGGTGTACGTCCAGCACCTGCTCAAGGACAACAAGGAGATGGTGTGGAAGCT
[0672] GATTCACGAGGACAACGCTCACATTTACGTCTGCGGCGACGCCCGAAACATGGCTC
[0673] GAGATGTTCAGAACACCTTCTACGACATCGTGGCCGAGTACGGCAAGATCGACCAC
[0674] GCCCAGGCCGTCGATTACATCAAGAAGCTGATGACCAAGGGACGATACTCCCAGGA
[0675] CGTTTGGTCCTAA
[0676] Oa_CYB5 (SEQ NO: 14):
[0677] ATGGCCGAGGAGTCTAGTAAACCAGTCAAGTACTACACCCTAGAGGAAATCCAGAA
[0678] GCACAACCACAGCAAATCGACCTGGCTGATTCTGCACTACAAGGTCTACGACCTCAC
[0679] AAAGTTCCTGGAAGAGCACCCGGGAGGAGAGGAGGTGCTTAGAGAGCAGGCTGGT
[0680] GGTGATGCAACTGAGAACTTTGAGGACGTTGGCCATTCAACGGATGCCCGAGAACT
[0681] TAGCAAGACCTTCATCATTGGCGAGCTGCATCCCGACGACCGGTCCAAGATCACCA
[0682] AGCCCTCTGAGTCCATCATCACAACTATTGACTCCAACTCGTCGTGGTGGACCAACT
[0683] GGCTCATTCCTGCCATTTCTGCTCTGGTGGTTGCGCTCATGTACCATTTGTATACTTC
[0684] TGAAAATTAA
[0685] Ma_CYB5 (SEQ NO: 15):
[0686] ATGGCCGGCCAGGCAGACAAGGATGTCAAATACTATACGTTGGAAGAAATCCAGAA
[0687] GCACAAAGACTCCAAGTCTACGTGGGTCATTCTTCACCACAAGGTCTACGACCTGAC
[0688] CAAGTTTCTGGAGGAACATCCCGGTGGCGAGGAGGTACTTCGGGAGCAGGCTGGAG
[0689] GAGATGCCACCGAGAACTTTGAGGATGTGGGCCACTCGACCGACGCTCGAGAGCTC
[0690] TCAAAGACATTCATCATTGGAGAGCTGCATCCTGACGACCGCAGCAAGATTGCCAA
[0691] GCCCAGCGAGAGTCTCATCACCACTGTGGAGTCCAACTCCTCTTGGTGGACCAACTG
[0692] GGTTATTCCGGCAGTTTCTGCGCTGGCCGTGGCTCTGATGTACCGACTCTACATGGG
[0693] CAGACGACTGACCTGTTTCTCGAAACCTGGAACAGGGGAGGGTCTGCCCCAACGAC
[0694] GAGGTGAAAAGAAGCCTGTGTTGATCACTTCGGCCGATAGAAATCTACCACTTAAG
[0695] GGCAAGTAA
[0696] Ec_CYB5(SEQ NO:16):
[0697] ATGGCCGAGCAGAGCGACAAGGCAGTCAAGTACTACACCCTCGAAGAGATCAAGA
[0698] AGCACAACCACTCGAAATCTACCTGGCTGATTCTGCACCACAAGGTCTATGACCTCA
[0699] CCAAGTTCCTGGAGGATCATCCAGGAGGAGAGGAGGTGCTTCGAGAACAGGCTGGT
[0700] GGTGATGCCACAGAGAACTTTGAGGATATTGGCCATTCTACAGACGCGAGAGAACT
[0701] TAGTAAAACGTTCATCATCGGCGAGCTGCATCCCGACGACCGGTCCAAGATTGCCA
[0702] AGCCCGTGGAGACTTTGATCACCACTGTGGACTCCAATTCATCGTGGTGGACCAACT
[0703] GGGTCATTCCTGCCATTTCTGCTGTAGTTGTTGCTCTCATGTACCGAATCTACACTGC
[0704] AGAAGATTAA
[0705] Ss_CYB(SEQ NO: 17):
[0706] ATGGCCGAGCAGTCCGACAAGGCCGTCAAGTACTACACCCTGGAGGAGATCCAGAA
[0707] GCACAACAACTCCAAGTCCACCTGGCTGATCCTGCACCACAAGGTCTACGACCTGAC
[0708] CAAGTTCCTGGAGGAGCACCCCGGCGGTGAGGAGGTCCTGCGAGAGCAGGCCGGCG
[0709] GTGACGCTACCGAGAACTTCGAGGACGTCGGCCACTCCACCGACGCCCGAGAGCTG
[0710] TCCAAGACCTTTATCATTGGCGAGCTCCACCCCGACGACCGATCCAAGATCGCCAAG
[0711] CCCTCCGAGACTCTGATCACCACCGTCGAGTCCAACTCCTCCTGGTGGACCAACTGG
[0712] GTCATCCCCGCCATCTCCGCCCTGGTTGTCTCCCTGATGTACCACTTCTACACCTCCG
[0713] AGAACTAA
[0714] Hs_3β-HSD2(L236S)(SEQ NO: 18):
[0715] ATGGGTTGGTCCTGTCTGGTGACCGGAGCTGGTGGACTGCTGGGTCAGCGAATCGTG
[0716] CGACTGCTGGTCGAGGAGAAGGAGCTGAAGGAGATTCGAGCCCTGGACAAGGCTTT
[0717] CCGACCCGAGCTGCGAGAGGAGTTCTCTAAGCTGCAGAACCGAACCAAGCTGACCG
[0718] TGCTGGAGGGAGACATCCTGGACGAGCCCTTCCTGAAGCGAGCCTGTCAGGACGTC
[0719] TCCGTGGTCATTCACACCGATTGCATCATTGACGTGTTCGGCGTCACCCACCGAGAG
[0720] TCTATCATGAACGTGAACGTCAAGGGAACCCAGCTGCTGCTGGAGGCCTGTGTGCA
[0721] GGCTTCCGTGCCCGTCTTCATCTACACCTCTTCCATTGAGGTCGCCGGACCCAACTCT
[0722] TACAAGGAGATCATTCAGAACGGTCACGAGGAGGAGCCTCTGGAGAACACCTGGCC
[0723] TACCCCCTACCCCTACTCCAAGAAGCTGGCCGAGAAGGCTGTCCTGGCCGCTAACGG
[0724] CTGGAACCTGAAGAACGGAGACACCCTGTACACCTGCGCTCTGCGACCCACCTACA
[0725] TCTACGGAGAGGGTGGCCCCTTCCTGTCTGCCTCCATCAACGAGGCTCTGAACAACA
[0726] ACGGTATTCTGTCTTCCGTGGGCAAGTTCTCTACCGTCAACCCCGTGTACGTCGGAA
[0727] ACGTGGCTTGGGCTCACATCCTGGCTTCGCGAGCTCTGCGAGATCCCAAGAAGGCCC
[0728] CCTCCGTCCGAGGACAGTTCTACTACATCTCCGACGACACCCCCCACCAGTCTTACG
[0729] ACAACCTGAACTACATTCTGTCTAAGGAGTTCGGTCTGCGACTGGACTCTCGATGGT
[0730] CCCTGCCCCTGACCCTGATGTACTGGATCGGCTTCCTGCTGGAGGTGGTGTCTTTCCT
[0731] GCTGTCCCCCATCTACTCTTACCAGCCCCCCTTCAACCGACACACCGTGACCCTGTCT
[0732] AACTCCGTCTTCACCTTCTCCTACAAGAAGGCCCAGCGGGACCTGGCTTACAAGCCC
[0733] CTGTACTCTTGGGAGGAGGCTAAGCAGAAGACCGTGGAGTGGGTCGGATCCCTGGT
[0734] GGACCGACACAAGGAGACTCTGAAGTCTAAGACCCAGTAA
[0735] Hs_3β-HSD2 (SEQ NO: 19):
[0736] ATGGGTTGGTCCTGTCTGGTGACCGGAGCTGGTGGACTGCTGGGTCAGCGAATCGTG
[0737] CGACTGCTGGTCGAGGAGAAGGAGCTGAAGGAGATTCGAGCCCTGGACAAGGCTTT
[0738] CCGACCCGAGCTGCGAGAGGAGTTCTCTAAGCTGCAGAACCGAACCAAGCTGACCG
[0739] TGCTGGAGGGAGACATCCTGGACGAGCCCTTCCTGAAGCGAGCCTGTCAGGACGTC
[0740] TCCGTGGTCATTCACACCGCTTGCATCATTGACGTGTTCGGCGTCACCCACCGAGAG
[0741] TCTATCATGAACGTGAACGTCAAGGGAACCCAGCTGCTGCTGGAGGCCTGTGTGCA
[0742] GGCTTCCGTGCCCGTCTTCATCTACACCTCTTCCATTGAGGTCGCCGGACCCAACTCT
[0743] TACAAGGAGATCATTCAGAACGGTCACGAGGAGGAGCCTCTGGAGAACACCTGGCC
[0744] TACCCCCTACCCCTACTCCAAGAAGCTGGCCGAGAAGGCTGTCCTGGCCGCTAACGG
[0745] CTGGAACCTGAAGAACGGAGACACCCTGTACACCTGCGCTCTGCGACCCACCTACA
[0746] TCTACGGAGAGGGTGGCCCCTTCCTGTCTGCCTCCATCAACGAGGCTCTGAACAACA
[0747] ACGGTATTCTGTCTTCCGTGGGCAAGTTCTCTACCGTCAACCCCGTGTACGTCGGAA
[0748] ACGTGGCTTGGGCTCACATCCTGGCTCTGCGAGCTCTGCGAGATCCCAAGAAGGCCC
[0749] CCTCCGTCCGAGGACAGTTCTACTACATCTCCGACGACACCCCCCACCAGTCTTACG
[0750] ACAACCTGAACTACATTCTGTCTAAGGAGTTCGGTCTGCGACTGGACTCTCGATGGT
[0751] CCCTGCCCCTGACCCTGATGTACTGGATCGGCTTCCTGCTGGAGGTGGTGTCTTTCCT
[0752] GCTGTCCCCCATCTACTCTTACCAGCCCCCCTTCAACCGACACACCGTGACCCTGTCT
[0753] AACTCCGTCTTCACCTTCTCCTACAAGAAGGCCCAGCGGGACCTGGCTTACAAGCCC
[0754] CTGTACTCTTGGGAGGAGGCTAAGCAGAAGACCGTGGAGTGGGTCGGATCCCTGGT
[0755] GGACCGACACAAGGAGACTCTGAAGTCTAAGACCCAGTAA
[0756] Hs_3β-HSD1 (SEQ NO: 20):
[0757] ATGACCGGCTGGTCCTGCCTGGTGACCGGTGCTGGTGGCTTCCTGGGCCAGCGAATC
[0758] ATCCGACTGCTGGTCAAGGAGAAGGAGCTGAAGGAGATCCGAGTGCTGGACAAGGC
[0759] CTTCGGCCCCGAGCTGCGAGAGGAGTTTTCCAAGCTGCAGAACAAGACCAAGCTGA
[0760] CCGTCCTGGAGGGCGACATCCTGGACGAGCCCTTTCTGAAGCGAGCCTGCCAGGAC
[0761] GTCAGCGTTATTATCCACACCGCCTGTATTATCGACGTCTTCGGCGTCACCCACCGA
[0762] GAGTCCATTATGAACGTCAACGTCAAGGGAACCCAGCTGCTGCTGGAGGCCTGCGT
[0763] CCAGGCTTCCGTCCCTGTCTTCATCTACACCTCCTCCATCGAGGTCGCTGGCCCCAAC
[0764] TCCTACAAGGAGATCATCCAGAACGGCCACGAGGAGGAGCCCCTGGAGAACACCTG
[0765] GCCCGCTCCTTACCCCCACTCCAAGAAGCTCGCCGAGAAGGCCGTGCTGGCCGCTAA
[0766] CGGTTGGAACCTGAAGAACGGCGGCACCCTCTACACCTGTGCCCTGCGACCCATGTA
[0767] CATCTACGGTGAGGGCTCCCGATTCCTGTCCGCCTCCATTAACGAGGCTCTCAACAA
[0768] CAACGGCATCCTGTCCTCCGTCGGCAAGTTCTCCACCGTCAACCCCGTCTACGTCGG
[0769] CAACGTCGCCTGGGCTCACATCCTCGCCCTCCGAGCTCTGCAGGACCCTAAGAAGGC
[0770] CCCCTCCATTCGAGGTCAGTTCTACTACATCTCCGACGACACCCCCCACCAGTCCTA
[0771] CGACAACCTCAACTACACCCTCTCCAAGGAGTTCGGCCTGCGACTCGACTCCCGATG
[0772] GTCCTTCCCCCTGTCCCTGATGTACTGGATCGGCTTCCTGCTGGAGATCGTCAGCTTT
[0773] TTACTGCGACCCATCTACACCTACCGACCCCCCTTCAACCGACACATCGTGACCCTC
[0774] TCTAACTCCGTCTTCACCTTCTCCTACAAGAAGGCTCAGCGAGACTTGGCCTACAAG
[0775] CCCCTGTACTCCTGGGAGGAGGCCAAGCAGAAGACCGTCGAGTGGGTCGGCTCTCT
[0776] GGTCGATCGACACAAGGAGACTCTGAAGTCCAAGACCCAGTAA
[0777] Hs_3β-HSD1(L237S)(SEQ NO:21):
[0778] ATGACCGGCTGGTCCTGCCTGGTGACCGGTGCTGGTGGCTTCCTGGGCCAGCGAATC
[0779] ATCCGACTGCTGGTCAAGGAGAAGGAGCTGAAGGAGATCCGAGTGCTGGACAAGGC
[0780] CTTCGGCCCCGAGCTGCGAGAGGAGTTTTCCAAGCTGCAGAACAAGACCAAGCTGA
[0781] CCGTCCTGGAGGGCGACATCCTGGACGAGCCCTTTCTGAAGCGAGCCTGCCAGGAC
[0782] GTCAGCGTTATTATCCACACCGCCTGTATTATCGACGTCTTCGGCGTCACCCACCGA
[0783] GAGTCCATTATGAACGTCAACGTCAAGGGAACCCAGCTGCTGCTGGAGGCCTGCGT
[0784] CCAGGCTTCCGTCCCTGTCTTCATCTACACCTCCTCCATCGAGGTCGCTGGCCCCAAC
[0785] TCCTACAAGGAGATCATCCAGAACGGCCACGAGGAGGAGCCCCTGGAGAACACCTG
[0786] GCCCGCTCCTTACCCCCACTCCAAGAAGCTCGCCGAGAAGGCCGTGCTGGCCGCTAA
[0787] CGGTTGGAACCTGAAGAACGGCGGCACCCTCTACACCTGTGCCCTGCGACCCATGTA
[0788] CATCTACGGTGAGGGCTCCCGATTCCTGTCCGCCTCCATTAACGAGGCTCTCAACAA
[0789] CAACGGCATCCTGTCCTCCGTCGGCAAGTTCTCCACCGTCAACCCCGTCTACGTCGG
[0790] CAACGTCGCCTGGGCTCACATCCTCGCCTCCCGAGCTCTGCAGGACCCTAAGAAGGC
[0791] CCCCTCCATTCGAGGTCAGTTCTACTACATCTCCGACGACACCCCCCACCAGTCCTA
[0792] CGACAACCTCAACTACACCCTCTCCAAGGAGTTCGGCCTGCGACTCGACTCCCGATG
[0793] GTCCTTCCCCCTGTCCCTGATGTACTGGATCGGCTTCCTGCTGGAGATCGTCAGCTTT
[0794] TTACTGCGACCCATCTACACCTACCGACCCCCCTTCAACCGACACATCGTGACCCTC
[0795] TCTAACTCCGTCTTCACCTTCTCCTACAAGAAGGCTCAGCGAGACTTGGCCTACAAG
[0796] CCCCTGTACTCCTGGGAGGAGGCCAAGCAGAAGACCGTCGAGTGGGTCGGCTCTCT
[0797] GGTCGATCGACACAAGGAGACTCTGAAGTCCAAGACCCAGTAA
[0798] Mm_3β-HSD (SEQ NO: 22):
[0799] ATGCCCGGATGGTCCTGTCTGGTGACCGGAGCTGGCGGATTCCTGGGTCAGCGAATC
[0800] ATTCAGCTGCTGGTGCAGGAGGAGGACCTGGAGGAGATTCGAGTGCTGGACAAGGT
[0801] CTTCCGACCCGAGACTCGAAAGGAGTTCTTCAACCTGGAGACTTCCATTAAGGTGAC
[0802] CGTCCTGGAGGGAGACATCCTGGACACCCAGTACCTGCGACGAGCCTGCCAGGGTA
[0803] TTTCTGTGGTCATCCACACCGCCGCTATCATTGACGTGACCGGCGTCATTCCCCGAC
[0804] AGACCATCCTGGACGTGAACCTGAAGGGAACCCAGAACCTGCTGGAGGCCTGTATT
[0805] CAGGCTTCCGTCCCCGCCTTCATCTTCTCTTCCTCTGTGGACGTCGCTGGTCCCAACT
[0806] CTTACAAGGAGATCGTGCTGAACGGCCACGAGGAGGAGTGCCACGAGTCCACCTGG
[0807] TCTGACCCCTACCCCTACTCCAAGAAGATGGCCGAGAAGGCTGTCCTGGCCGCTAAC
[0808] GGATCTATGCTGAAGAACGGTGGTACCCTGCAGACCTGTGCTCTGCGACCCATGTGC
[0809] ATCTACGGAGAGCGATCCCCCCTGATCTCTAACATCATTATCATGGCTCTGAAGCAC
[0810] AAGGGCATTCTGCGATCCTTCGGAAAGTTCAACACCGCCAACCCCGTGTACGTCGGA
[0811] AACGTGGCTTGGGCTCACATCCTGGCTGCTCGAGGTCTGCGAGATCCCAAGAAGTCT
[0812] CCCAACATTCAGGGCGAGTTCTACTACATCTCCGACGACACCCCCCACCAGTCTTTC
[0813] GACGACATTTCCTACACCCTGTCTAAGGAGTGGGGATTCTGTCTGGACTCCTCTTGG
[0814] TCCCTGCCTGTGCCTCTGCTGTACTGGCTGGCCTTCCTGCTGGAGACTGTGTCTTTCC
[0815] TGCTGTCTCCCATCTACCGATACATCCCCCCCTTCAACCGACACCTGGTGACCCTGTC
[0816] CGGTTCTACCTTCACCTTCTCCTACAAGAAGGCTCAGCGGGACCTGGGTTACGAGCC
[0817] TCTGGTGTCCTGGGAGGAGGCCAAGCAGAAGACCTCTGAGTGGATCGGCACCCTGG
[0818] TCGAGCAGCACCGAGAGACTCTGGACACCAAGTCTCAGTAA
[0819] At_3β-HSD(SEQ NO:23):
[0820] ATGGCCGCTCCCGACTCTTCCATCAACAACCACCAGCTGCAGTACTCTGTGAACGTC
[0821] CAGGGAACCCAGAACGTCATCGACGCTTGTGTGGACGTCGGTGTGAAGCGACTGAT
[0822] CTACACCTCTTCCCCCTCTGTGGTCTTCGACGGCGTGCACGGAATCCTGAACGGCAC
[0823] CGAGTCCATGGCTTACCCCATTAAGCACAACGACTCTTACTCCGCTACCAAGGCCGA
[0824] GGGAGAGGAGCTGATTATGAAGGCCAACGGTCGAAACGGCCTGCTGACCTGTTGCA
[0825] TCCGACCCTCTTCCATTTTCGGTCCTGGCGACCGACTGCTGGTCCCTTCTCTGGTGGC
[0826] CGCTGCCCGAGCTGGCAAGTCCAAGTTCATCATTGGAGACGGTAACAACCTGTACG
[0827] ACTTCACCTACGTCGAGAACGTGGCTCACGCTCACGTCTGCGCTGAGCGAGCTCTGG
[0828] CTTCTGGAGGAGACGTGTCCACCAAGGCTGCCGGACAGGTGTTCGCCTTCTCCTAABt_3β-HSD(SEQNO:24):
[0829] ATGGCCGGATGGTCTTGTCTGGTGACCGGTGGAGGTGGCTTCCTGGGTCAGCGAATC
[0830] ATTTGCCTGCTGGTCGAGGAGAAGGACCTGCAGGAGATCCGAGTGCTGGACAAGGT
[0831] CTTCCGACCCGAGGTGCGAGAGGAGTTCTCTAAGCTGCAGTCCAAGATCAAGCTGA
[0832] CCCTGCTGGAGGGCGACATTCTGGACGAGCAGTGTCTGAAGGGAGCTTGCCAGGGT
[0833] ACCTCTGTGGTCATCCACACCGCCTCCGTGATTGACGTCCGAAACGCTGTCCCCCGA
[0834] GAGACTATTATGAACGTGAACGTCAAGGGAACCCAGCTGCTGCTGGAGGCCTGTGT
[0835] GCAGGCTTCTGTGCCCGTCTTCATCCACACCTCCACCATTGAGGTCGCCGGTCCCAA
[0836] CTCTTACCGAGAGATCATTCAGGACGGCCGAGAGGAGGAGCACCACGAGTCTGCTT
[0837] GGTCTTCCCCCTACCCCTACTCCAAGAAGCTGGCCGAGAAGGCTGTGCTGGGTGCCA
[0838] ACGGCTGGGCTCTGAAGAACGGAGGTACCCTGTACACCTGTGCCCTGCGACCCATGT
[0839] ACATCTACGGCGAGGGATCTCCCTTCCTGTCCGCCTACATGCACGGCGCTCTGAACA
[0840] ACAACGGAATTCTGACCAACCACTGCAAGTTCTCCCGAGTGAACCCCGTGTACGTCG
[0841] GTAACGTCGCTTGGGCTCACATCCTGGCTCTGCGAGCTCTGCGAGATCCCAAGAAGG
[0842] TGCCCAACATCCAGGGACAGTTCTACTACATTTCTGACGACACCCCCCACCAGTCCT
[0843] ACGACGACCTGAACTACACCCTGTCTAAGGAGTGGGGCTTCTGTCTGGACTCTCGAA
[0844] TGTCCCTGCCCATTTCCCTGCAGTACTGGCTGGCCTTCCTGCTGGAGATCGTCTCTTT
[0845] CCTGCTGTCCCCCATCTACAAGTACAACCCCTGCTTCAACCGACACCTGGTGACCCT
[0846] GTCTAACTCCGTCTTCACCTTCTCTTACAAGAAGGCTCAGCGGGACCTGGGTTACGA
[0847] GCCTCTGTACACCTGGGAGGAGGCTAAGCAGAAGACCAAGGAGTGGATCGGATCCC
[0848] TGGTGAAGCAGCACAAGGAGACTCTGAAGACCAAGATTCACTAA
[0849] Mt_3β-HSD (SEQ NO: 25):
[0850] ATGCTGCGACGAATGGGAGACGCCTCTCTGACCACCGAGCTGGGTCGAGTGCTGGT
[0851] CACCGGTGGAGCTGGTTTCGTCGGAGCTAACCTGGTGACCACCCTGCTGGACCGAG
[0852] GACACTGGGTCCGATCTTTCGACCGAGCTCCTTCCCTGCTGCCTGCTCACCCTCAGCT
[0853] GGAGGTGCTGCAGGGCGACATCACCGACGCTGACGTCTGTGCCGCTGCCGTGGACG
[0854] GAATCGACACCATTTTCCACACCGCTGCCATCATTGAGCTGATGGGTGGCGCCTCTG
[0855] TCACCGACGAGTACCGACAGCGATCCTTCGCTGTGAACGTCGGAGGTACCGAGAAC
[0856] CTGCTGCACGCTGGACAGCGAGCTGGTGTCCAGCGATTCGTGTACACCTCTTCCAAC
[0857] TCCGTGGTCATGGGCGGACAGAACATTGCCGGTGGCGACGAGACTCTGCCCTACAC
[0858] CGACCGATTCAACGACCTGTACACCGAGACTAAGGTGGTCGCCGAGCGATTCGTCCT
[0859] GGCTCAGAACGGTGTGGACGGCATGCTGACCTGCGCCATCCGACCCTCTGGAATTTG
[0860] GGGAAACGGTGACCAGACCATGTTCCGAAAGCTGTTCGAGTCCGTGCTGAAGGGTC
[0861] ACGTGAAGGTCCTGGTGGGCCGAAAGTCTGCTCGACTGGACAACTCCTACGTCCAC
[0862] AACCTGATCCACGGTTTCATTCTGGCTGCCGCTCACCTGGTGCCTGACGGTACCGCT
[0863] CCTGGACAGGCTTACTTCATCAACGACGCCGAGCCCATTAACATGTTCGAGTTCGCC
[0864] CGACCCGTCCTGGAGGCTTGTGGTCAGCGATGGCCCAAGATGCGAATCTCTGGCCCC
[0865] GCTGTCCGATGGGTCATGACCGGATGGCAGCGACTGCACTTCCGATTCGGTTTCCCT
[0866] GCTCCTCTGCTGGAGCCTCTGGCTGTGGAGCGACTGTACCTGGACAACTACTTCTCT
[0867] ATTGCCAAGGCTCGACGGGACCTGGGTTACGAGCCTCTGTTCACCACCCAGCAGGCT
[0868] CTGACCGAGTGCCTGCCCTACTACGTCTCCCTGTTCGAGCAGATGAAGAACGAGGCC
[0869] CGAGCTGAGAAGACCGCCGCTACCGTGAAGCCCTAA
[0870] Vv_3β-HSD (SEQ NO: 26):
[0871] ATGGCTGTGTACGCTGTCACCGGTGGAGCTGGATTCCTGGGTCGATACATCGTGAAG
[0872] CTGCTGATTTCCGCTGACGACGTCCAGGAGATCCGAGTGATCGACATTGTCGAGGAC
[0873] CCCCAGCCCATTACCTCTAAGGTGAAGGTCATCAACTACATTCAGTGTGACATCAAC
[0874] GACTTCGACAAGGTGCGAGAGGCCCTGGACGGTGTCAACCTGATCATTCACACCGC
[0875] CGCTCTGGTGGACGTCTTCGGCAAGTACACCGACAACGAGATCATGAAGGTGAACT
[0876] ACTACGGAACCCAGACCATTCTGGCCGCTTGCGTCGACCTGGGTATCAAGTACCTGA
[0877] TCTACACCTCTTCCATGGAGGCCATTGGTCCCAACAAGCACGGCGACCCCTTCATCG
[0878] GACACGAGCACACCCTGTACGACATTTCCCCCGGACACGTGTACGCCAAGTCTAAG
[0879] CGAATGGCTGAGCAGCTGGTCATGAAGGCCAACAACTCCGTCATCATGAACGGCGC
[0880] TAAGCTGTACACCTGTTGCCTGCGACCCACCGGAATCTACGGAGAGGGCGACAAGC
[0881] TGACCAAGGTCTTCTACGAGCAGTGTAAGCAGCACGGAAACATCATGTACCGAACC
[0882] GTGGACGACGACGCTGTCCACTCCCGAGTGTACGTCGGTAACGTGGCTTGGATGCAC
[0883] GTCCTGGCCGCTAAGTACATCCAGTACCCCGGTTCTGAGATTAAGGGCAACGCCTAC
[0884] TTCTGTTACGACTACTCTCCCTCCTGCTCTTACGACATGTTCAACCTGCTGCTGATGA
[0885] AGCCCCTGGGCATCGAGCAGGGATCTCGAATTCCCCGATGGATGCTGAAGATGTAC
[0886] GCTTGCAAGAACGACATGAAGCGAATCCTGTTCCGAAAGCCCTCCCTGCTGAACAA
[0887] CTACACCCTGAAGATTTCTAACACCACCTTCGAGGTGCGAACCAACAACGCCGAGCT
[0888] GGACTTCAACTACTCCCCCATTTTCAACGTGGACGTCGCTTTCGAGCGAACCCGAAA
[0889] GTGGCTGGAGGAGTCTGAGTAA
[0890] 3β - HSD of Homo sapiens (type I, L237S mutation), the mutation site is at the underlined AA (SEQ NO: 27):
[0891]
[0892]
[0893] 3β - HSD of Homo sapiens (type II, L236S mutation), the mutation site is at the underlined AA (SEQ NO: 28):
[0894]
[0895] The raw materials and reagents used in the directional synthesis of the reticular path products provided by the present invention can all be purchased from the market.
[0896] The present invention will be further described below in conjunction with embodiments:
[0897] Example 1: Substrate - specific heterologous characterization (3β - HSD) of key components of the 4AD path and directional synthesis of progesterone
[0898] 1. Obtaining of chassis strains
[0899] The wild-type Yarrowia lipolytica strain numbered ATCC201249 was provided by the research group of Yuan Yingjin and is mentioned in the literature Multiplex gene editing of the Yarrowia lipolytica genome using the CRISPR-Cas9 system.
[0900] 2. Obtaining of exogenous functional gene elements
[0901] The sources of the genes CYP17A1 (17-alpha-hydroxylase / 17,20-lyase), POR (NADPH-cytochrome P450 reductase), 3β-HSD (3β-hydroxysteroid dehydrogenase), CYB5 (Cytochrome b5), and mCYP11A1 (mature P450scc) involved in the present invention are shown in Table 3.
[0902] Table 3 Sources of the genes involved in the present invention
[0903]
[0904] All of the above four component genes used in the present invention were obtained by artificial synthesis after codon optimization of Yarrowia lipolytica and appropriate avoidance of common restriction enzyme cleavage sites, with 5’-end gcggccgcggtctcca (as shown in SEQ NO: 1) and 3’-taaaggagaccgcggccgc (as shown in SEQ NO: 2) added additionally at both ends of the gene. The pregnenolone-to-androstenedione synthesis pathway is as Figure 1 shown, and the synthesis pathway includes the synthesis of pregnenolone to progesterone ( Figure 2 ), pregnenolone to dehydroepiandrosterone ( Figure 3 ), pregnenolone to 17-hydroxyprogesterone ( Figure 4 ), pregnenolone to 17-hydroxypregnenolone ( Figure 5 ), etc.
[0905] 3. Test method:
[0906] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0907] Bioconversion medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[0908] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) P4 solution, 1.75 g / L (50%
[0909] EtOH-Tween80) 17OHP4 solution
[0910] 3β-HSD isomerization conversion experiment: Inoculate the recombinant strains RS3B-1 to RS3B-9 (see the construction part of the modular integration plasmid below) into 5 mL of seed medium, culture at 30 °C and 220 rpm for 14-16 h, and inoculate into 5 mL of biotransformation medium at an initial cell concentration OD 600 = 0.2, culture at 28 °C and 220 rpm for 24 h, add 150 μL of P4 solution and 17OHP4 solution respectively, continue to incubate for 40 h to obtain the fermentation broth, and quantify the steroid products by the following method.
[0911] Pregnenolone quantification method: Take 1 mL of the fermentation broth, centrifuge at 12000 g for 2 min to collect the cells, and wash twice with water. Add 1 mL of 3 mol / L hydrochloric acid to resuspend the cells, place in a boiling water bath at 100 °C for 5 min, centrifuge at 12000 rpm for 1 min to collect the cell precipitate. Wash the cell precipitate 3 times with 1 mL of distilled water. Add 420 μL of 2 mol / L potassium hydroxide-methanol solution to the broken cell precipitate, and react in a constant temperature incubator at 37 °C for 2 h. Take out the saponification reaction centrifuge tube, cool to room temperature (25 °C ± 5 °C), add an equal volume of n-hexane, vortex for 10 min, centrifuge at 12000 rpm for 1 min, and take the upper n-hexane phase to a new centrifuge tube. Repeat the extraction of the lower layer with n-hexane once, and combine the two n-hexane phases. Concentrate the n-hexane phase with a vacuum centrifugal concentrator (when the sample solvent is n-hexane: 25 °C, 30 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. Add 100 μL of MSTFA and react at 37 °C for 2 h, add 100 μL of n-hexane, filter, and detect by gas chromatography-mass spectrometry.
[0912] Progesterone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, DHEA, androstenedione quantification method: Take 1 mL of the fermentation broth, add glass beads and 700 μL of ethyl acetate, shake and extract for 10 min, collect the upper organic phase, and re-extract the aqueous phase with fresh ethyl acetate once. Combine the two extraction organic phases and concentrate the liquid with a vacuum centrifugal concentrator (when the sample solvent is ethyl acetate: 25 °C, 1200 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. Add 100 μL of MSTFA and react at 37 °C for 2 h, add 100 μL of n-hexane and filter. P5, P4, DHEA, 4AD, 17OHP4, and 17OHP5 are detected by GC-MS. (The yields of 17OHP4 and 17OHP5 are relatively quantified by the P5 standard curve)
[0913] 4. Construction of modular integration plasmid
[0914] Construction of Module 3: There are two 3β-HSDs with different catalytic specificities in the human body: type I 3β-HSD has higher activity and uses DHEA as the main substrate, while type II 3β-HSD tends to use P5 and 17OHP5 as substrates. After codon optimization, the above two human 3β-HSDs are abbreviated as Hs_3β-HSD1 and Hs_3β-HSD2 in sequence. In 1999, Moisan et al. pointed out that the L236S mutation of Hs_3β-HSD2 can increase the maximum reaction rate of this protein, and this mutant protein is abbreviated as Hs_3β-HSD2mut. After homologous sequence comparison, the present invention also introduced the corresponding mutation L237S into Hs_3β-HSD1 and named it Hs_3β-HSD1mut. Five 3β-HSDs from different sources with species representativeness were also selected in this example, namely Mm_3β-HSD from Mus musculus, 3β-HSD2 from Bos taurus, 3β-HSD from Vaccinia virus, 3β-HSD from Mycobacterium tuberculosis, and At_3β-HSD from Arabidopsis thaliana. After codon optimization, they are abbreviated as Mm_3β-HSD, Bt_3β-HSD, Vv_3β-HSD, Mt_3β-HSD, and At_3β-HSD in sequence. To facilitate integration into the vector pINA1269-Nat (a vector plasmid obtained by replacing the LEU2 marker between the BglII and ClaI restriction sites of the commercial vector plasmid pINA1269 with the natamycin resistance marker Nat) through Gibson assembly, a 21-bp homologous arm sequence gggaacccgaaactaaggatc upstream of the BamHI site of the vector (as shown in SEQ NO: 3) was introduced at the 5' end of the above genes by PCR reaction, and a 21-bp homologous arm sequence gtacctccatggcctgtcccc downstream of the KpnI site of the vector (as shown in SEQ NO: 4) was introduced at the 3' end of the genes.After assembly with the BamHI- and KpnI-linearized vector, nine corresponding pINA1269-Nat-3β-HSD integration recombinant plasmids pRS3B-1 to pRS3B-9 (i.e., pINA1269-Nat-Mm_3β-HSD, pINA1269-Nat-Bt_3β-HSD, pINA1269-Nat-Vv_3β-HSD, pINA1269-Nat-At_3β-HSD, pINA1269-Nat-Mt_3β-HSD, pINA1269-Nat-Hs_3β-HSD1, pINA1269-Nat-Hs_3β-HSD2, pINA1269-Nat-Hs_3β-HSD1mut, pINA1269-Nat-Hs_3β-HSD2mut) were obtained, which is Module 3. The plasmids constructed above were separately transformed into competent Escherichia coli DH5α, and colonies were screened by PCR. The plasmids were extracted for single- and double-enzyme digestion verification and sequencing verification to ensure that the target fragment was correctly ligated and the base sequence did not mutate. pINA1269 is the name of the integration plasmid. After being linearized by NotI digestion, this plasmid can be used for integration at the pBR322 site of the yeast genome, where pBR322 is the name of the integration site.
[0915] 5. Experimental Results
[0916] The conversion efficiency of steroid substrates was characterized by the synthesis amount of the corresponding isomers. The whole-cell catalysis results of 3β-HSD are as Figure 6 shown.
[0917] It can be seen from the whole-cell conversion results of the three substrates that: (1) In the conversion experiment with pregnenolone (P5) as the substrate, Vv_3β-HSD showed the strongest pregnenolone conversion efficiency, reaching 6.8%. Type I human and mutant 3β-HSD showed the second-strongest catalytic efficiency, reaching 4.6 - 4.8%. (2) For the conversion experiment with 17-hydroxy pregnenolone (17OHP5) as the substrate, all four human 3β-HSD and mutants showed relatively strong conversion efficiency. Among them, the progesterone conversion rate of type I human 3β-HSD was the highest, reaching 3.1%. (3) When using dehydroepiandrosterone (DHEA) as the substrate, type II human, bovine, and mycobacterial sources all showed relatively strong catalytic activity. Among them, the conversion efficiency of type II human 3β-HSD was as high as 10.5%.
[0918] By separately expressing heterologous 3β-HSD in the wild-type yeast chassis, the present invention realizes the synthesis of the 4AD pathway node product: P4 using P5 as the substrate. In addition, the whole-cell catalytic efficiency of 3β-HSD from different sources shows strong substrate preference differences: (1) Several 3β-HSDs except those from humans and Arabidopsis thaliana with low catalytic activity show strong substrate preference for pregnenolone, while their conversion ability for 17OHP5 is relatively low; (2) Different from the substrate preference of 3β-HSD in human cells, human 3β-HSD in the Yarrowia lipolytica system generally shows a relatively balanced catalytic ability for three steroid substrates. In particular, wild-type type II human 3β-HSD shows higher DHEA conversion ability than type I human 3β-HSD.
[0919] Example 2: Heterologous characterization of substrate specificity of key components in the 4AD pathway (CYP17A1) and directed synthesis of 17-hydroxy pregnenolone
[0920] 1. Obtaining experimental materials
[0921] CYP17 hydroxylase is at a key node in the steroid synthesis and metabolism pathway, catalyzing 17α-hydroxylation and 17,20-lyase reactions with C21 steroids as substrates. The participation of cytochrome b5 (CYB5) promotes the 17,20-lyase activity of CYP17. The catalytic activity of CYP17A1 has strong species specificity. According to the substrate catalytic specificity, CYP17A1 is usually divided into △ 4,5 type, △ 5 type and △ 4 type. The selection of CYP17 in this study is based on the in vitro catalytic activity parameters of CYP17 from multiple sources sorted out by Gilep and his colleagues. Since the reported catalytic activity of the only △ 4 type CYP17 is weak, based on the in vitro enzyme activity parameters and protein evolutionary relationships, the present invention only selects ovine (Ovis aries) △ 5 type CYP17A1 and △ 4,5 from Mesocricetus auratus, Equus caballus, and Xenopus laevis.Type CYP17A1, and after codon optimization, they are abbreviated as Oa_CYP17A1, Ma_CYP17A1, Ec_CYP17A1, and Xl_CYP17A1 in sequence. Similarly, the original ligand of the above CYP17A1, NADPH-cytochrome P450 reductase (POR), is also abbreviated as Oa_POR, Ma_POR, Ec_POR, and Xl_POR after codon optimization. Considering that the 17,20-lyase activity of CYP17 is affected by CYB5, CYB5 from sheep, golden hamster, horse, and pig (Sus scrofa) sources was introduced for testing, and the 4 CYB5s were abbreviated as Oa_CYB5, Ma_CYB5, Ec_CYB5, and Ss_CYB5 after codon optimization.
[0922] The acquisition of wild-type Yarrowia lipolytica was the same as described in Example 1.
[0923] Construction of Module 1: The left arm of the IntD integration site and the terminator of Saccharomyces cerevisiae GPM1t were spliced together by OE-PCR; the 40bp terminal sequence of the terminator of Saccharomyces cerevisiae FBA1t, the leucine nutritional selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site were spliced together by OE-PCR to obtain a fragment containing NotI restriction sites at both ends, named IntD-L and IntD-R respectively; then the 4 artificially synthesized CYP17A1 and POR from different sources were respectively ligated with the expression modules TEF1inp-LIP2t-GPDt and GPDt-TEF1inp-OCT1t-FBA1t digested by BsmBI to obtain integration plasmids. The CYP17A1 and POR modules with the same species source were assembled with IntD-L, IntD, and pUC18H digested by HincII by Gibson to obtain integration plasmids, and after digestion with NotI, Module 1 was obtained. Construction of Module 2: The left arm of the IntB integration site, the auxotrophic uracil tag Ura3, the right arm of the IntB integration site, the promoter TEF1in, and the terminator ACOt were respectively spliced with the 4-source CYB5 by Gibson method to obtain integration plasmids, and after digestion with NotI, Module 2 was obtained. The above constructed module integration plasmids were respectively transformed into Escherichia coli competent DH5α, screened by colony PCR, and the plasmids were extracted for single and double enzyme digestion verification and sequencing verification to ensure that the target fragments were ligated correctly and the base sequences did not mutate.
[0924] Construction of Module 4: The left arm of the IntF integration site, pUC18H digested with HincII, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, CYP17A1 and POR from Equus caballus (constructed in the same method as Module 1) were spliced together by the Gibson method to obtain a fragment containing NotI restriction sites at both ends. After digestion with NotI, Module 4 was obtained.
[0925] Construction of strains for verifying 17-hydroxylation transformation: Four Modules 1 containing genes from different sources were respectively integrated into ATCC201249 to obtain strains SyBE_Yl2091001~SyBE_Yl2091004.
[0926] Construction of strains for verifying 17,20-lyase transformation: Four Modules 2 containing genes from different sources were respectively integrated into the above-constructed strains SyBE_Yl2091001~SyBE_Yl2091004 to obtain strains SyBE_Yl2091005~SyBE_Yl2091016 and SyBE_Yl2090013~SyBE_Yl2090016.
[0927] 2. Experimental methods
[0928] Bioconversion medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0929] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0930] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[0931] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) P5 solution, 1.75 g / L (50%
[0932] EtOH-Tween80) P4 solution, 1.75 g / L (50% EtOH-Tween80) 17OHP5 solution, 1.75 g / L (50%
[0933] EtOH-Tween80) 17OHP4 solution
[0934] 17-Hydroxylation transformation experiment: Inoculate SyBE_Yl2091001~SyBE_Yl2091004 into 5 mL of seed medium and culture at 30 °C and 220 rpm for 14 - 16 h, with the initial cell concentration OD 600Inoculate them at an initial cell concentration of OD = 0.2 into 5 mL of biotransformation medium respectively, culture at 28 °C and 220 rpm for 24 h, add 150 μL of P4 and P5 substrate mother liquors respectively and continue to incubate for 16 h, take 1 mL of the sample and detect the 17OHP4 content according to the method in Example 1.
[0935] 17,20-lyase conversion experiment: Inoculate SyBE_Yl2091005 to SyBE_Yl2091016 into 5 mL of seed medium, culture at 30 °C and 220 rpm for 14 - 16 h, with an initial cell concentration of OD 600 Inoculate them at an initial cell concentration of OD = 0.2 into 5 mL of biotransformation medium respectively, culture at 28 °C and 220 rpm for 24 h, add 150 μL of 17OHP4 and 17OHP5 substrate mother liquors respectively and continue to incubate for 144 h, take 1 mL of the sample and detect the DHEA or 4AD content according to the method in Example 1.
[0936] 3. Experimental results
[0937] 17-hydroxylation conversion experiment: By separately expressing heterologous 3β-HSD in the wild-type yeast chassis, the present invention realized the synthesis of the 4AD pathway node product: 17OHP5 using P5 as the substrate. It can be seen from the experimental results that ( Figure 7 ), the 17α-hydroxylation activities of CYP17A1 from sheep, golden hamster, and African clawed frog towards progesterone are 1.2 - 14.5 times that of pregnenolone as the substrate. Among the tested △ 4,5 -type CYP17A1, although the CYP17A1 from golden hamster showed the strongest 17α-hydroxylation activity under the conditions of using pregnenolone and progesterone as substrates respectively, it was only 39.2% and 13.8% of the activity of the △ 5 -type CYP17A1 from sheep. CYP17A1 from horse and African clawed frog showed very weak catalytic activities towards both substrates.
[0938] 17,20-lyase conversion experiment: It can be seen from the experimental results that ( Figure 8 ), all the tested strains showed 17,20-lyase activity towards both substrates. (1) For the 3 tested △ 4,5 -type CYP17A1: The engineered bacteria containing CYP17A1 from African clawed frog showed low 17,20-lyase activity, indicating that the CYP17 from this source could not be effectively functionally expressed in the current system; for CYP17A1 from golden hamster and horse, the participation of CYB5 could significantly enhance the 17,20-lyase activity. (2) For △ 5Type sheep-derived CYP17A1: This source protein has a stronger substrate preference and biotransformation ability for 17-hydroxy pregnenolone than for 17-hydroxy progesterone; the 17,20-lyase activity of this source protein for 17α-hydroxy progesterone has a strong CYB5 source dependence. (3) For CYB5: In most cases, CYB5 can promote the 17,20-lyase activity of CYP17A1; CYB5 from pigs and horses, as highly effective ligands, can often promote the conversion efficiency of the latter for 17α-hydroxy progesterone to a greater extent when adapted to CYP17A1 from multiple sources.
[0939] For the selection of enzyme sources for the reconstruction of the heterologous 4AD pathway in Yarrowia lipolytica, the present invention summarizes as follows: (1) For the isomerization (dehydrogenation) reaction, Vv_3β-HSD is the preferred protein for catalyzing the reaction with P5 as the substrate; (wild-type) type I and type II Hs_3β-HSD are the preferred proteins for catalyzing the reaction with 7OHP5 and DHEA as the substrates. (2) When using P5 and P4 as the substrates, Oa_CYP17A1 is the most preferred source for catalyzing the 17α-hydroxylation reaction. (3) For the 17,20-lyase reaction with 17α-hydroxy pregnenolone as the substrate, although the sheep-derived protein has high catalytic activity, △ 4,5 Type golden hamster-derived CYP17A1 is also a reliable alternative source; for the 17,20-lyase reaction with 17α-hydroxy progesterone as the substrate, horse-derived CYP17A1 can achieve highly efficient catalysis regulated by CYB5; at the same time, CYB5 from pigs, golden hamsters, and horses can all be used as highly effective ligands for pathway construction.
[0940] Example 3: Synthesis of DHEA using P5 as the substrate and synthesis of 4AD using P4 as the substrate
[0941] 1. Obtaining of experimental materials
[0942] The strains SyBE_Yl2091005 to SyBE_Yl2091016 were obtained as described in Example 2.
[0943] Module four was obtained as described in Example 2.
[0944] Construction of module five: Use the Cre-loxP system to knockout the Leu2 selection marker of SyBE_Yl2091004 to obtain SyBE_Yl2091004 without the Leu2 tag. Linearize module four with NotI and module two containing horse-derived Ec_CYB5 through yeast transformation and integrate them into the genome of SyBE_Yl2091004 without the Leu2 tag to obtain the strain SyBE_Yl2091030.
[0945] 2. Experimental methods
[0946] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0947] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[0948] Steroid substrate stock solution: 3.5 g / L (50% EtOH-Tween80) P5 solution, 3.5 g / L (50% EtOH-Tween80) P4 solution
[0949] DHEA synthesis experiment: Inoculate SyBE_Yl2091030 (experimental group) and SyBE_Yl2091016 (control) into 5 mL of seed medium, culture at 30 °C and 220 rpm for 14 - 16 h, and inoculate into 5 mL of biotransformation medium at an initial cell concentration OD 600 = 0.2, culture at 28 °C and 220 rpm for 24 h, add 150 μL of P5 substrate stock solution respectively and continue to incubate for 120 h, take 1 mL of the sample and detect the DHEA content according to the method in Example 1.
[0950] 4AD synthesis experiment: Inoculate SyBE_Yl2091030 (experimental group) and SyBE_Yl2091016 (control) into 5 mL of seed medium respectively, culture at 30 °C and 220 rpm for 14 - 16 h, and inoculate into 5 mL of biotransformation medium at an initial cell concentration OD 600 = 0.2, culture at 28 °C and 220 rpm for 24 h, add 150 μL of P4 substrate stock solution respectively and continue to incubate for 120 h, take 1 mL of the sample and detect the 4AD content according to the method in Example 1.
[0951] 3. Experimental results
[0952] In this example, by combinatorially characterizing Oa_CYP17A1 (strong 17α-hydroxylation activity), Ec_CYP17A1 (strong 17,20-lyase activity), and Ec_CYB5 (which has a strong promoting effect on the 17,20-lyase activity of both Oa_CYP17A1 and Ec_CYP17A1) in the strain SyBE_Yl2091030, efficient conversion of P5 / P4 to synthesize DHEA / 4AD is achieved.
[0953] DHEA synthesis experiment: In the biotransformation with P5 as the substrate, the DHEA synthesis amount of SyBE_Yl2091030 reached 12.6 mg / L, which was 7.32 times higher than that of the control group SyBE_Yl2091016 ( Figure 9 ).
[0954] 4AD synthesis experiment: In the biotransformation with P4 as the substrate, the strain SyBE_Yl2091030 achieved a synthesis amount of androstenedione of 13.9 mg / L, which was 86.2 times higher than that of the control strain SyBE_Yl2091016( Figure 10 ).
[0955] In this example, the present invention achieved the directional synthesis of DHEA using P5 as the substrate and the directional synthesis of 4AD using P4 as the substrate, and improved the catalytic efficiency by combinatorial expression of high-efficiency pathway component proteins.
[0956] Example 4: Synthesis of 17OHP4 using P5 as the substrate
[0957] The synthesis of 17OHP4 from P5 involves two types of reactions: 17α-hydroxylation reaction using P4 or P5 as the substrate, and isomerization reaction using P5 or 17OHP5 as the substrate. The present invention selected Ma_CYP17A1 to catalyze the two 17α-hydroxylation reactions, and selected Hs_3β-HSD2 with strong catalytic specificity for the two intermediates (P5, 17OHP5), and Vv_3β-HSD with strong catalytic specificity for P5. And the above three highly catalytic proteins were jointly used for the construction of the 17OHP4 pathway.
[0958] 1. Obtaining of experimental materials
[0959] The construction of Modules 1, 2, 3, and 4 was the same as described in Examples 1 and 2.
[0960] Construction of Module 6: The left arm of the IntC integration site, the artificial promoter hp8d, Hs_3β-HSD2, the Yarrowia lipolytica terminator OCTt, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntC integration site were spliced together by OE-PCR to obtain a fragment containing NotI restriction sites at both ends; the above fragment was ligated with the plasmid pUC57-Kan-Simple linearized by HindIII to obtain the integration plasmid, that is, Module 6. The above constructed module integration plasmids were respectively transformed into Escherichia coli competent DH5α, screened by colony PCR, and the plasmids were extracted for single and double enzyme digestion verification and sequencing verification to ensure that the target fragment was correctly ligated and the base sequence did not mutate.
[0961] Construction of Module 7: The module 1 (pIntD-Ma_CYP17-POR) expressing CYP17A1-POR from Mesocricetus auratus, Module 6, and Module 3 expressing Vv_3β-HSD were simultaneously integrated into ATCC201249 to obtain the Yarrowia lipolytica recombinant strain SyBE_Yl2090007.
[0962] 2. Experimental methods
[0963] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0964] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[0965] Steroid substrate stock solution: 3.5 g / L (50% EtOH-Tween80) P5 solution.
[0966] 4AD synthesis experiment: Inoculate SyBE_Yl2090007 into 5 mL of seed culture medium respectively, culture at 30 °C and 220 rpm for 14 - 16 h, and inoculate into 5 mL of biotransformation medium respectively with the initial cell concentration OD 600 = 0.2, culture at 28 °C and 220 rpm for 24 h, add 150 μL of P5 substrate stock solution and continue to incubate for 120 h, take 1 mL of the sample and detect the 17OHP4 content according to the method in Example 1. (17OHP4 is relatively quantified with the P5 standard curve)
[0967] 3. Experimental results
[0968] The synthesis amount of 17OHP4 in strain module seven reached 3.90 mg / L ( Figure 11 ). In this example, the present invention realizes the directional synthesis of 17OHP4 using P5 as the substrate, and improves the catalytic efficiency by combinatorial expression of high-efficiency pathway component proteins.
[0969] Example 5: De novo synthesis of progesterone using glucose
[0970] 1. Obtaining of chassis strain
[0971] Provided by the group of Yuan Yingjin, the high-yield campesterol Yarrowia lipolytica chassis strain numbered SyBE_Yl2060077, and the wild-type Yarrowia lipolytica strain numbered ATCC201249. The strain SyBE_Yl2060077 is mentioned in the literature Pregnenolone Overproduction in Yarrowia lipolyticaby Integrative ComponentsPairing ofthe Cytochrome P450scc System.
[0972] 2. Obtaining of exogenous functional gene elements
[0973] The genes CYP17A1 (17-alpha-hydroxylase / 17,20-lyase), POR (NADPH-cytochrome P450 reductase), 3β-HSD (3β-hydroxysteroid dehydrogenase), CYB5 (Cytochrome b5), and mCYP11A1 (mature P450scc) involved in the present invention are shown in Table 4 for their sources.
[0974] Table 4 Sources of the genes involved in the present invention
[0975]
[0976] The above four component genes used in the present invention are all obtained by artificial synthesis after codon optimization in Yarrowia lipolytica and appropriate avoidance of common restriction enzyme cutting sites, with 5’-end gcggccgcggtctcca (as shown in SEQ NO: 1) and 3’-taaaggagaccgcggccgc (as shown in SEQ NO: 2) additionally added at both ends of the gene.
[0977] 3. Test method:
[0978] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[0979] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[0980] Quantification methods for pregnenolone (P5) and campsterol: Take 1 mL of the fermentation broth, centrifuge at 12000 g for 2 min to collect the bacterial cells, and wash twice with water. Add 1 mL of 3 mol / L hydrochloric acid to resuspend the bacterial cells, place in a boiling water bath at 100 °C for 5 min, and centrifuge at 12000 rpm for 1 min to collect the cell precipitate. Wash the cell precipitate 3 times with 1 mL of distilled water. Add 420 μL of 2 mol / L potassium hydroxide-methanol solution to the disrupted cell precipitate, and react in a constant temperature incubator at 37 °C for 2 h. Take out the saponification reaction centrifuge tube, cool to room temperature (25 °C ± 5 °C), add an equal volume of n-hexane, vortex for 10 min, centrifuge at 12000 rpm for 1 min, and transfer the upper n-hexane phase to a new centrifuge tube. Repeat the extraction of the lower layer with n-hexane once, and combine the two n-hexane phases. Concentrate the n-hexane phase with a vacuum centrifugal concentrator (when the sample solvent is n-hexane: 25 °C, 30 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. Add 100 μL of MSTFA and react at 37 °C for 2 h, add 100 μL of n-hexane, filter, and detect by gas chromatography-mass spectrometry.
[0981] Quantitative methods for progesterone, 17-hydroxypregnenolone (17OHP5), 17-hydroxyprogesterone (17OHP4), dehydroepiandrosterone, androstenedione, and testosterone: Take 1 mL of the fermentation broth, add glass beads and 700 μL of ethyl acetate, shake and extract for 10 min. Collect the upper organic phase and re-extract the aqueous phase with fresh ethyl acetate once. Combine the organic phases from the two extractions, and concentrate the liquid using a vacuum centrifugal concentrator (when the sample solvent is ethyl acetate: 25 °C, 1200 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. For samples of progesterone (P4), dehydroepiandrosterone (DHEA), androstenedione (4AD), and testosterone (TS), add 100 μL of MSTFA and react at 37 °C for 2 h. Add 100 μL of n-hexane, filter, and then detect by gas chromatography-mass spectrometry. Samples of 17-hydroxypregnenolone and 17-hydroxyprogesterone are dissolved in 200 μL of absolute ethanol, filtered, and then detected by ultra-high performance liquid chromatography.
[0982] 4. Construction of modular integration plasmids
[0983] For the construction of the upstream module strain; mCYP11A1 is expressed under the TEF1p promoter, and 3β-HSD is expressed under the EXP1p promoter. Both are integrated into the pBR322 site simultaneously. For the construction of the downstream module strain, CYP17A1 and POR are both expressed under the TEF1inp promoter and integrated into the IntD site of the chassis strain genome.
[0984] Construction of Module A: The left arm of the IntD integration site and the terminator of Saccharomyces cerevisiae GPM1t were spliced together by OE-PCR; the 40-bp terminal sequence of the terminator of Saccharomyces cerevisiae FBA1t, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site were spliced together by OE-PCR to obtain a fragment containing NotI restriction sites at both ends, named IntD-L and IntD-R respectively; then, the artificially synthesized CYP17A1 and POR from 4 different sources were respectively ligated with the expression modules TEF1inp-LIP2t-GPDt and GPDt-TEF1inp-OCT1t-FBA1t digested by BsmBI to obtain integration plasmids. The CYP17A1 and POR modules with the same species source were assembled with IntD-L, IntD, and pUC18H digested by HincII through Gibson assembly to obtain integration plasmids, and module A was obtained after digestion with NotI. Construction of Module B: The left arm of the IntB integration site, the defective uracil tag Ura3, the right arm of the IntB integration site, the promoter TEF1in, and the terminator ACOt were respectively spliced with CYB5 from 3 sources by Gibson method to obtain integration plasmids, and module B was obtained after digestion with NotI. Construction of Module C: Porcine-derived mCYP11A1 was respectively integrated into the expression cassette with the TEF1p promoter, and 3β-HSD from 6 different sources was respectively integrated into the expression cassette with the EXP1p promoter. The mCYP11A1 expression cassette and the 6 different 3β-HSD expression cassettes were assembled into the pINA1269 integration plasmid digested by SalI and ClaI through Gibson assembly. Finally, the plasmid was linearized after digestion with NotI to obtain module C. The integration plasmids of the above-mentioned constructed modules A - C were respectively transformed into Escherichia coli competent DH5α, screened by colony PCR, and the plasmids were extracted for single and double enzyme digestion verification and sequencing verification to ensure that the target fragments were ligated correctly and the base sequences did not mutate.
[0985] 5. Experimental Results
[0986] Upstream modules: By integrating 6 different module Cs into yeast SyBE_Yl2060077, the upstream modules SyBE_Yl2090018, SyBE_Yl2090006, SyBE_Yl2091025 - SyBE_Yl2091028 were obtained
[0987] First, progesterone was obtained by culturing the upstream module strains alone in this invention. The upstream module strains were inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h, with the initial cell concentration OD 600= 0.1 was separately inoculated into 50 mL of YPD fermentation medium and cultured at 28 °C and 220 rpm, and the cell density (OD 600 ) and progesterone production during fermentation were monitored. The upstream module strains with Vaccinia virus origin, type II Homo sapiens origin, and Bos taurus origin were cultured in YPD fermentation medium containing 50 g / L glucose at 28 °C and 220 rpm for 8 days, and progesterone yields of 9.56 mg / L, 9.12 mg / L, and 5.53 mg / L could be obtained respectively ( Figure 12 ). In this example, the de novo synthesis ability of progesterone by 3β-HSD from each source species was not completely consistent with the results of the biotransformation experiment in Example 1, indicating that the catalytic efficiency of 3β-HSD is affected by different reaction conditions and host genotypes. Among them, type II human 3β-HSD (Hs_3β-HSD) showed catalytic advantages in the de novo synthesis and whole-cell catalytic synthesis of progesterone experiments.
[0988] Example 6: De novo synthesis of 17-hydroxyprogesterone and 17-hydroxypregnenolone using glucose
[0989] 1. Obtaining of strains
[0990] Module A, Module B, SyBE_Yl2091025, SyBE_Yl2091006, and SyBE_Yl2091016 were as described in Example 5.
[0991] 2. Experimental method
[0992] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract
[0993] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract
[0994] 3. Experimental results
[0995] In the present invention, Module A and Module B containing genes from the same species source were first integrated into the wild-type Yarrowia lipolytica strain ATCC201249 to obtain strains SyBE_Yl2091006 (containing Mesocricetus auratus genes) and SyBE_Yl2091016 (containing Ovis aries genes) as downstream module strains. Module C described in Example 5 containing genes from different species sources was respectively integrated into the high-yield campesterol Yarrowia lipolytica chassis strain SyBE_Yl2060077 to obtain strains SyBE_Yl2091025 - SyBE_Yl2091028, SyBE_Yl2090006, and SyBE_Yl2090018 as upstream module strains.
[0996] The target steroid is obtained by the mixed culture fermentation of combined modules. The upstream module strain SyBE_Yl2091025 derived from Bos taurus and two downstream module strains SyBE_Yl2091006 and SyBE_Yl2091016 are respectively inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. The strain SyBE_Yl2091025 is respectively mixed with SyBE_Yl2091006 and SyBE_Yl2091016 at an OD 600 ratio, and inoculated into 50 mL of YPD fermentation medium at a final OD 600 = 0.1, and cultured at 28 °C and 220 rpm for 8 days. Monitor the cell density (OD 600 ) and steroid production during the fermentation process.
[0997] In the SyBE_Yl2091025 - SyBE_Yl2091006 mixed culture system, 0.25 mg / L of 17 - hydroxyprogesterone, 0.74 mg / L of 17 - hydroxypregnenolone, and 0.88 mg / L of androstenedione are synthesized. In the SyBE_Yl2091025 - SyBE_Yl2091016 mixed culture system, 0.91 mg / L of 17 - hydroxyprogesterone, 0.29 mg / L of 17 - hydroxyprogesterone, and 1.03 mg / L of androstenedione are synthesized ( Figure 13 ). Thus, the present invention realizes the de novo synthesis of 17 - hydroxypregnenolone and 17 - hydroxyprogesterone using a mixed culture system. The proportion of Δ 4 steroids (P4, 17OHP4, 4AD) synthesized by the mixed culture system in the total steroid products reaches 56.5 - 83.1%. The proportion of the difficult - to - convert intermediate 17OHP5 is only 12.2% - 37.3% of the total steroid amount, which is much higher than the proportion of 17OHP5 in the single - strain system (90.4 - 99.1%). These results indicate that the design of the co - culture system successfully alleviates the substrate competition between 3β - HSD and CYP17A1 by forcing the substrate P5 to be preferentially utilized by 3β - HSD, enabling more steroid flux to be used for △ 4 - steroid synthesis.
[0998] Example 7: De novo synthesis of dehydroepiandrosterone using glucose
[0999] 1. Obtaining of strains
[1000] SyBE_Yl2091026 and SyBE_Yl2091006 are as described in Example 5.
[1001] 2. Experimental method
[1002] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[1003] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[1004] 3. Experimental results
[1005] Inoculate the upstream module strain SyBE_Yl2091026 and the downstream module strain SyBE_Yl2091006 into 5 mL of seed medium respectively, and culture at 30 °C and 220 rpm for 14 - 16 h. Mix the strains SyBE_Yl2091026 and SyBE_Yl2091006 at a ratio of 10:1 OD 600 ratio, and inoculate into 50 mL of YPD fermentation medium at a final OD 600 = 0.1 respectively, and culture at 28 °C and 220 rpm for 8 days, and monitor the cell density (OD 600 ) and steroid production during fermentation.
[1006] In the mixed culture system of SyBE_Yl2091026 - SyBE_Yl2091006, 2.13 mg / L of dehydroepiandrosterone was synthesized ( Figure 14 ). Compared with the mixed culture system using bovine 3β - HSD - expressing engineered bacteria as the upstream module and tending to synthesize 4AD in Example 6, the steroid synthesis in the current mixed culture system tends to accumulate DHEA, proving that different 3β - HSD - derived strains have a great influence on the system steroid synthesis and metabolic flux direction.
[1007] Example 8: De novo synthesis of androstenedione and testosterone using glucose
[1008] 1. Obtaining of experimental materials
[1009] The obtaining of wild - type Yarrowia lipolytica for alcoholysis, the construction of modular integration plasmids (modules A - C) and the obtaining of exogenous functional gene elements are the same as those described in Example 5.
[1010] Construction of module D: Ligate the left arm of the IntF integration site, pUC18H digested with HincII, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, and the CYP17A1 and POR modules with the same species origin (Ovis aries and Mesocricetus auratus) in Example 5 by the Gibson method to obtain a fragment containing NotI restriction sites at both ends, and obtain module D after digestion with NotI.
[1011] The obtaining of SyBE_Yl2091030 is the same as that described in Example 3
[1012] Construction of the strain for verifying 17-hydroxylation transformation: Four modules A containing genes from different sources were respectively integrated into ATCC201249 to obtain strains SyBE_Yl2091001 - SyBE_Yl2091004.
[1013] Construction of the strain for verifying 17,20-lyase transformation: Three modules B containing genes from different sources were respectively integrated into the above-constructed strains SyBE_Yl2091001 - SyBE_Yl2091004 to obtain strains SyBE_Yl2091005 - SyBE_Yl2091016.
[1014] 2. Experimental methods
[1015] Bioconversion medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[1016] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;
[1017] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.
[1018] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) progesterone, 1.75 g / L (50% EtOH-Tween80) 17-hydroxyprogesterone solution
[1019] 17-Hydroxylation transformation experiment: SyBE_Yl2091001 - SyBE_Yl2091004 were inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. With an initial cell concentration of OD 600 = 0.1, they were respectively inoculated into 5 mL of bioconversion medium and cultured at 28 °C and 220 rpm for 24 h. 150 μL of progesterone substrate stock solution was added and incubated for another 16 h. 1 mL of the sample was taken and the 17OHP4 content was detected according to the method in Example 1.
[1020] 17,20-Lyase transformation experiment: SyBE_Yl2091005 - SyBE_Yl2091016 were inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. With an initial cell concentration of OD 600 = 0.1, they were respectively inoculated into 5 mL of bioconversion medium and cultured at 28 °C and 220 rpm for 24 h. 150 μL of 17-hydroxyprogesterone substrate stock solution was added and incubated for 120 h. 1 mL of the sample was taken and the androstenedione content was detected according to the method in Example 1.
[1021] Experiment on mixed bacteria synthesis of androstenedione: The upstream module strain SyBE_Yl2091025 and two downstream module strains SyBE_Yl2091016 and SyBE_Yl2091030 were separately inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. The upstream module strain and the two downstream module strains were respectively inoculated into 50 mL of YPD fermentation medium at a ratio of 10:1 of OD 600 ratio, with the final OD 600 = 0.1, and cultured at 28 °C and 220 rpm for 8 days to measure the steroid yield.
[1022] 3. Experimental results
[1023] In the biotransformation experiment, the strain containing CYP17A1 from Ovis aries showed the strongest 17-hydroxylation ability towards progesterone.
[1024] As can be seen from Figure 15 (left), Ec_CYP17A1 and Xl_CYP17A1 had weak catalytic activities for 17α-hydroxylation of P4. Ma_CYP17A1 and Oa_CYP17A1 had stronger 17α-hydroxylation activities for P4. Among the tested △ 4,5 type CYP17A1, Ma_CYP17A1 had the strongest 17α-hydroxylation activity for P4, but it was only 13.8% of the corresponding activity of the △ 5 type CYP17A1 from sheep.
[1025] As can be seen from Figure 15 (right), Ma_CYP17A1 and Ec_CYP17A1 had the strongest 17,20-lyase activities when using 17OHP4 as the substrate. The 17,20-lyase activity of Oa_CYP17A1 towards 17OHP4 depended on the choice of CYB5 source. Among them, when Oa_CYB5 and Ec_CYB5 were matched with the above three sources of CYP17A1, CYP17A1 could show stronger 17,20-lyase activities.
[1026] As can be seen from Figure 16 It can be known that in the 17,20-lyase conversion experiment, among the current CYP17A1 - CYB5 combinations, CYP17A1 and CYB5 from Equus caballus showed general 17,20-lyase ability. Therefore, in the reconstruction of the downstream strain, using the Cre-loxp method, the Leu2 tag of SyBE_Yl2091004 was removed, and module two and module four with genes from Equus caballus were introduced to obtain the strain SyBE_Yl2091030. In
[1027] In the mixed culture fermentation experiment of SyBE_Yl2091025-SyBE_Yl2091030, androstenedione was the main product, and 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone were obtained. In the mixed culture fermentation experiment of SyBE_Yl2091025-SyBE_Yl2091030, the production of androstenedione increased by 3.9 times compared with the co-culture system before optimization. The above results indicate that by introducing Ec_CYP17A1 from Equus caballus with strong 17,20-lyase activity, Oa_CYP17A1 from sheep with strong 17α-hydroxylase activity, and Ec_CYB5 from horse that can simultaneously promote the 17,20-lyase activity of Ec_CYP17A1 and Oa_CYP17A1, the substrate conversion efficiency of the downstream pathway can be effectively improved, and the conversion of steroid intermediates to 4AD can be effectively promoted.
[1028] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. Application of the recombinant strain SyBE_Y12091004 constructed by co - heterologously expressing Oa_CYP17A1 and Oa_POR in the wild - type Yarrowia lipolytica strain ( Yarrowia lipolytica ) ATCC201249 in the synthesis of 17OHP5 using pregnenolone as a substrate and 17OHP4 using progesterone as a substrate: The sequence of the nucleic acid molecule encoding the CYP17A1 is shown as SEQ ID No. 6; The sequence of the nucleic acid molecule encoding the POR is shown as SEQ ID No.
10.
2. Module, characterized in that, Comprising a nucleic acid molecule encoding CYP17A1 and POR; The sequence of the nucleic acid molecule encoding the CYP17A1 is shown as SEQ ID No. 6; The sequence of the nucleic acid molecule encoding the POR is shown as SEQ ID No.
10.
3. A plasmid, characterized in that, Comprising the module according to claim 2.
4. A host, characterized in that, Comprising the plasmid according to claim 3.
5. The host according to claim 4, characterized in that, Comprising Module 1; Module 1 comprises a nucleic acid molecule encoding CYP17A1 and POR; Module 1 comprises an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; The sequence of the nucleic acid molecule encoding the CYP17A1 is shown as SEQ ID No. 6; The sequence of the nucleic acid molecule encoding the POR is shown as SEQ ID No.
10.
6. Use of any of the following in the recombinant strain SyBE_Y12091004 constructed by co - heterologously expressing Oa_CYP17A1 and Oa_POR in the wild - type Yarrowia lipolytica strain ATCC201249 for synthesizing 17OHP5 using pregnenolone as a substrate and 17OHP4 using progesterone as a substrate: (I), the module according to claim 2; and / or (II), the plasmid according to claim 3; and / or (III), the host according to claim 4 or 5.
7. A drug, characterized in that, Comprising any of the following and a pharmaceutically acceptable excipient or adjuvant: (I), the module according to claim 2; and / or (II), the plasmid according to claim 3; and / or (III), the host according to claim 4 or 5.
Citation Information
Patent Citations
Genetically transformed yeasts capable of producing a molecule of interest at a high titre
US10400261B2
Strain for biosynthesis of 16beta-hydroxy-19-normethyl-4-androstenedione and application thereof
CN108753626A
Method for integrating yarrowia lipolytica genome based on non-homologous end-linking mechanism
CN112251458A