A genetically engineered strain for producing acetoin, its construction method and application

Abstract

The present invention discloses a genetic engineering strain for producing acetoin, its construction method and application. First, functional genes affecting the stress resistance of Escherichia coli to acetoin are screened and identified, and stress resistance factors are introduced by means of genome genetic modification to improve the tolerance of the strain to the product. Then, by optimizing the copy number of the recombinant plasmid, the expression level of the key genes in the acetoin synthesis pathway is increased to obtain an engineering strain with high synthesis ability and high stress resistance. Then, acetoin is fermented and synthesized using cheap raw materials, and is efficiently converted into tetramethylpyrazine under suitable conditions. Finally, a relatively high-purity tetramethylpyrazine is obtained by converting the decolorized and purified fermentation broth. The process method of the present invention is green and environmentally friendly, and can generate high-value chemicals (R)-acetoin and tetramethylpyrazine, laying an important theoretical and technical foundation for future large-scale industrial production.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a genetically engineered strain for producing acetoin with improved acetoin tolerance and a method for constructing the same, as well as an application of the genetically engineered strain in the fermentation production of acetoin, and an application of the acetoin fermentation broth in the synthesis and production of tetramethylpyrazine. Background Art

[0002] Tetramethylpyrazine (TTMP), also known as ligustrazine, is the main active alkaloid component in the traditional Chinese medicinal plant Ligusticum wallichii, and has pharmacological effects for treating cardiovascular and cerebrovascular diseases. Acetoin (AC), with the chemical name of 3-hydroxy-2-butanone, is a precursor for synthesizing tetramethylpyrazine and is widely used in industries such as food, medicine, chemical engineering, and biofuels. With the rapid development of society, the demand for acetoin and tetramethylpyrazine is increasing. However, the traditional plant extraction method for obtaining tetramethylpyrazine has disadvantages such as low content and high cost. The chemical synthesis process of acetoin or tetramethylpyrazine is complex and causes serious environmental pollution.

[0003] With the rapid development of synthetic biology, constructing a heterologous synthesis pathway of acetoin in microbial cells has become an important research means to improve the yield of acetoin. High-yield and high-concentration acetoin precursors are important factors for improving the synthesis yield of tetramethylpyrazine. More and more microbial cells have been transformed into cell factories, and these engineered strains can often be converted into various target products through fermentation. However, during the production process, microbial cells are often stressed by various adverse factors, resulting in a serious impact or complete loss of their growth and metabolic abilities, and ultimately the production efficiency will also decrease. Therefore, improving the stress resistance of microbial cells is very necessary for increasing the yield of the target product generated by strain fermentation. The traditional methods for enhancing microbial tolerance mainly include tolerance domestication and mutagenesis by physical or chemical methods, but these methods generally have many disadvantages, such as long experimental cycles, heavy work tasks, and easy loss of excellent phenotypes. Compared with traditional methods, introducing or modifying certain stress-resistant factors through molecular biology techniques is a more direct and effective way.

[0004] At present, research on the tolerance of microorganisms to various organic solvents has been reported both at home and abroad. Yongbo et al. found that overexpressing the gene murA2 from Lactobacillus plantarum could improve the tolerance of Escherichia coli to some organic solvents such as ethanol, n-butanol, and isobutanol, and thus improve the ethanol production level of Escherichia coli KO11 fermentation. After heterologously expressing the C-5 sterol desaturase from the edible fungus Flammulina velutipes in Schizosaccharomyces pombe, Kamthan et al. found that it could not only increase the heat resistance of the strain but also improve its growth ability in ethanol and acidic solutions. Through a comparative analysis of the transcriptional expression profiles of wild-type Escherichia coli and butanol-tolerant Escherichia coli strains, Ayushi K et al. found that the expression levels of genes yibT and yghW were significantly downregulated in the wild-type strain. Finally, by knocking out these two genes, the butanol tolerance of the strain was significantly improved. Foo et al. found that the MdlB gene was a key factor for improving the tolerance of Escherichia coli to isopentenol. Then, by overexpressing the MdlB gene, the tolerance of the strain was finally improved, and its ability to ferment and synthesize isopentenol was also increased by 12%. Fisher et al. compared the butanol tolerance of the excellent mutant of Escherichia coli AcrB and the wild-type Escherichia coli MG1655 and found that the tolerance of the mutant strain was significantly enhanced. It can be seen that enhancing the tolerance of the strain to acetoin is very necessary for improving the ability of the strain to ferment and synthesize acetoin, and it also helps to improve the synthesis yield of the subsequent product tetramethylpyrazine. Summary of the Invention

[0005] Based on the exploration of the stress effect of acetoin on Escherichia coli, the present invention provides a method for constructing a genetically engineered strain for producing acetoin by introducing stress-resistant factors, which improves the ability of the strain to ferment and produce acetoin. At the same time, the present invention also provides a process for fermenting and producing acetoin using this bacterium and further synthesizing and producing tetramethylpyrazine from the acetoin fermentation broth. By decolorizing the acetoin fermentation broth and using high-temperature and high-pressure reaction conditions, a conversion solution of tetramethylpyrazine with a relatively high conversion rate and relatively pure quality is finally obtained.

[0006] Specifically, the genetically engineered strain for producing acetoin provided by the present invention is an engineered strain ΔGXASR10 obtained by integrating a single copy of the protein elongation factor EF-Ts gene tsf at the Yibt locus of the fatty acid synthesis gene in the genome of Escherichia coli GXASR10 using the CRISPR / Cas9 gene editing technology.

[0007] The Escherichia coli GXASR10 described in the present invention is a genetically engineered strain for producing acetoin obtained through genetic modification. The genetically engineered strains described in the patents previously applied by the applicant (for example: CN107129959A Construction method and application of a genetically engineered strain for producing (R)-acetoin, CN107177620A A method for producing tetramethylpyrazine using inexpensive raw materials) can be used. The present invention preferably uses the multi-gene deletion mutant E. coli MG1655ΔgldAΔfrdABCDΔackA-ptaΔpoxB.

[0008] The genetically engineered strain for producing acetoin provided by the present invention further includes transforming and expressing the recombinant plasmid pTrc99a-budB-budA-noxE in Escherichia coli GXASR10 and ΔGXASR10 respectively to obtain the engineered strains GXASR10 / pTrc99a-budB-budA-noxE (48#) and ΔGXASR10 / pTrc99a-budB-budA-noxE (Δ48#).

[0009] The genetically engineered strain for producing acetoin provided by the present invention further includes using seamless cloning technology to replace the replicon ori of the recombinant plasmid pTrc99a-budB-budA-noxE with the RSF replicon on the plasmid pRSFDuet to obtain a new recombinant plasmid, and then transforming and expressing the new recombinant plasmid in Escherichia coli GXASR10 and ΔGXASR10 respectively to obtain the engineered strains R48# and RΔ48#.

[0010] In addition, the present invention also provides a construction method for the above-mentioned genetically engineered strain ΔGXASR10 for producing acetoin, including the following steps:

[0011] S21: Design and synthesize the gene fragment N20 according to the gene sequence of the Yibt locus on the genome of Escherichia coli GXASR10; then use the pTarget backbone gene fragment as a template and perform seamless cloning and ligation with the gene fragment N20 to construct the pTarget-N20 recombinant plasmid;

[0012] S22: Use the genomic DNA of Escherichia coli MG1655 as a template to amplify the target gene tsf, the upstream homologous arm and the downstream homologous arm of the insertion site Yibt respectively; at the same time, splice the target gene tsf, the upstream homologous arm and the downstream homologous arm of the insertion site Yibt to obtain a targeting fragment; then electrotransform the targeting fragment into Escherichia coli GXASR10 containing the pCas plasmid and perform PCR verification;

[0013] S23: Use the successfully sequenced bacterial liquid to lose the pTarget-N20 and pCas9 plasmids.

[0014] In addition, the present invention also provides a method for constructing the above-mentioned genetically engineered strains R48# and RΔ48# for producing acetoin, which uses seamless cloning technology to replace the replicon ori of the recombinant plasmid pTrc99a-budB-budA-noxE with the RSF replicon on the plasmid pRSFDuet to obtain a new recombinant plasmid, and then transforms and expresses the new recombinant plasmid in Escherichia coli GXASR10 and ΔGXASR10 respectively. Among them, the step of replacing the replicon ori of the recombinant plasmid pTrc99a-budB-budA-noxE with the RSF replicon on the plasmid pRSFDuet to obtain a new recombinant plasmid includes the following steps:

[0015] S31: Using the plasmid pRSFDuet as a template and RSF-F / R as primers, PCR amplify its replicon RSF together with the kanamycin gene; using the RSF-linked kanamycin gene fragment as a template, and using primers RSF-F1 / R1 containing the homologous sequences at both ends of the ori replicon on the plasmid pTrc99a-budB-budA-noxE for PCR amplification to obtain a high-copy replicon RSF target gene containing homologous sequences;

[0016] S32: Using the plasmid pTrc99a-budB-budA-noxE as a template, design primers pTrc99a(-ori)-F / R to amplify the backbone fragment of the plasmid without ori and the ampicillin gene;

[0017] S33: Seamlessly clone and ligate the target fragment of the RSF-linked kanamycin gene with the plasmid backbone of pTrc99a-budB-budA-noxE to obtain a new recombinant plasmid.

[0018] A plasmid is a circular DNA molecule that is independent of the host cell chromosome and exists in many bacteria, pathogens, and archaea. The higher the copy number of the plasmid, the more times the foreign gene linked to the plasmid will be replicated as the plasmid replicates continuously, that is, the more proteins obtained from the expression of the foreign gene. Whether a plasmid can stably express a foreign gene during long-term growth depends on the stability of the plasmid. Since the loss of the recombinant plasmid will significantly reduce the productivity of the recombinant bacteria, the less the transformation of the recombinant plasmid affects the growth and metabolism of microbial cells, the easier it is for the plasmid to stably express foreign proteins in the bacterial cells for a long time.

[0019] The target fragment of the RSF-linked kanamycin gene refers to the entire fragment of RSF linked to the Kan gene. Because on the plasmid pRSFDuet, the RSF gene and the Kan gene are adjacent, and the Kan gene is also amplified together for convenient subsequent screening with antibiotics.

[0020] In addition, the present invention also provides the application of the above-mentioned genetically engineered strain in the production of acetoin, mainly using glucose, tapioca flour and / or cottonseed meal hydrolysate as the initial carbon source for fermentative synthesis of acetoin.

[0021] In addition, the present invention also provides the application of the above-mentioned genetically engineered strain in the synthesis of tetramethylpyrazine, including the following steps:

[0022] S51: Take the above-mentioned acetoin fermentation broth for centrifugation, take the supernatant, and measure the acetoin content;

[0023] S52: Add diammonium hydrogen phosphate to the supernatant according to the molar concentration ratio of acetoin to diammonium hydrogen phosphate of 2 - 3:5;

[0024] S53: Under the conditions of a conversion reaction temperature of 150 - 180 °C, a conversion reaction rotation speed of 350 - 450 rpm, a pressure of 2 - 10 Mpa, and an initial pH value of 7 - 8, carry out a conversion reaction for 2 - 4 h to obtain tetramethylpyrazine.

[0025] As a further illustration of the application of the above-mentioned genetically engineered strain in the synthesis of tetramethylpyrazine, it also includes the decolorization treatment of the supernatant of the acetoin fermentation broth. The decolorization treatment includes the following steps:

[0026] S61: Add a chitosan solution to the supernatant of the acetoin fermentation broth for flocculation according to the volume ratio of the supernatant of the acetoin fermentation broth to the chitosan solution of 20:0 - 2, and then filter out the flocs through a filter paper;

[0027] S62: Add 0.5 - 1 g / ml of activated carbon powder to the supernatant of the acetoin fermentation broth, control the rotation speed of the water bath shaker at 100 - 200 rpm, the water bath decolorization time at 30 - 50 min, the water bath decolorization temperature at 60 - 80 °C, and the pH of the acetoin fermentation broth before decolorization at 3.5 - 4.5 to decolorize the supernatant after flocculation treatment.

[0028] The beneficial effects achieved by the present invention are as follows:

[0029] 1. The present invention uses the CRISPR / Cas9 gene editing technology of the dual plasmid system to knock out the fatty acid synthesis gene (Yibt) on the Escherichia coli genome, and at the same time introduce the tsf stress resistance factor, greatly improving the acetoin tolerance of the engineered strain.

[0030] 2. The present invention uses seamless cloning technology to replace the ori replicon in the pTrc99a plasmid with the high-copy replicon RSF in the pRSFDuet plasmid, effectively improving the level of the strain's fermentative synthesis of acetoin.

[0031] 3. Most of the reports on the preparation of acetoin and tetramethylpyrazine by biological methods currently use high - priced yeast powder, peptone, and high - purity sugar as raw materials. The present invention uses inexpensive non - grain cassava powder and cottonseed powder as fermentation substrates, saving production costs and laying a foundation for the high - efficiency and low - cost industrial production of acetoin and tetramethylpyrazine.

[0032] 4. Since there are many impurities in the cassava powder - cottonseed powder hydrolysis solution, the color of the acetoin fermentation broth is relatively dark. Moreover, the temperature and pressure during the conversion process in the reaction kettle are relatively high, which will cause the color of the tetramethylpyrazine conversion solution generated by the reaction to deepen further. The present invention uses medical activated carbon powder and chitosan to decolorize the acetoin fermentation broth, obtaining a relatively pure acetoin fermentation broth, and significantly reducing the impurities in the further - converted tetramethylpyrazine product. Brief Description of the Drawings

[0033] Figure 1 It is the growth curve of the strain under acetoin stress in Example 2 of the present invention.

[0034] Figure 2 It is the working principle diagram of the application of the CRISPR / Cas9 dual - plasmid system in the present invention.

[0035] Figure 3 It is the PCR amplification agarose gel electrophoresis result diagram of the construction process of the recombinant plasmid pTarget - N20 in Example 3 of the present invention. In the figure, M: GenStar D5000 DNA Ladder, 1 - 9: pTarget plasmid backbone (2098bp).

[0036] Figure 4 It is the PCR amplification agarose gel electrophoresis result diagram of the process of obtaining the target fragment in Example 3 of the present invention. In the figure, M: GenStar D2000ⅡDNA Ladder, 1 - 4: Yibt upstream homologous arm (525bp), 5 - 7: tsf gene (852bp), 8: Yibt downstream homologous arm (520bp).

[0037] Figure 5 It is the schematic principle diagram of the application of Overlap to prepare the targeting fragment in the present invention.

[0038] Figure 6 It is the PCR verification result diagram of the process of electro - transferring the target fragment into the recipient cell in Example 3 of the present invention. In the figure, M: GenStar D5000 DNA Ladder, 2, 3, 5: targeting fragment (1897bp).

[0039] Figure 7Agarose gel electrophoresis result map of PCR amplification with primers RSF-F / R in Example 6 of the present invention. In the figure, M: GenStar D5000 DNA Ladder, 1-4: RSF gene fragment (1673bp).

[0040] Figure 8 Agarose gel electrophoresis result map of PCR amplification with primers RSF-F1 / R1 in Example 6 of the present invention. In the figure, M: GenStar D5000 DNA Ladder, 1-4: RSF gene fragment (1737bp).

[0041] Figure 9 Agarose gel electrophoresis result map of PCR amplification with primers pTrc99a(-ori)-F / R in Example 6 of the present invention. In the figure, M: GenStar 1kb plus DNA Ladder, 1-6: pTrc99a-budB-budA-noxE plasmid backbone (7439bp).

[0042] Figure 10 Result map of colony PCR verification in Example 6 of the present invention. In the figure, M: GenStar D5000 DNA Ladder, 1-4: RSF gene fragment (1737bp).

[0043] Figure 11 Fermentation curve graph of acetoin production by genetic engineering strains 48# and Δ48# in shake flasks in Example 7 of the present invention.

[0044] In the figure, A: Sugar consumption curve during fermentation; B: Change in acetoin concentration during fermentation; C: Change in butanediol concentration during fermentation; D: Change in cell density in the fermentation broth during the whole fermentation process.

[0045] Figure 12 Fermentation curve graph of acetoin production by genetic engineering strains 48# and Δ48# in fermentors in Example 8 of the present invention.

[0046] In the figure, A: Change trend of residual sugar concentration in the fermentation broth; B: Change in cell density in the fermentation broth; C: Change in acetoin concentration in the fermentation broth; D: Change in butanediol concentration in the fermentation broth.

[0047] Figure 13 Fermentation curve graph of acetoin production by genetic engineering strains 48#, Δ48#, R48#, and RΔ48# in shake flasks with fed-batch of the initial fermentation medium in Example 9 of the present invention. In the figure, A: Change trend of acetoin concentration during fermentation; B: Residual sugar consumption in the fermentation broth; C: Cell growth trend in the fermentation broth; D: Change in by-product butanediol concentration in the fermentation broth.

[0048] Figure 14 This is the fermentation curve graph of the initial fermentation medium of the genetic engineering strains 48#, Δ48#, R48#, and RΔ48# in Example 9 of the present invention for the production of acetoin by non-fed-batch shake flask fermentation. In the figure, A: the change trend of acetoin concentration during fermentation; B: the consumption of residual sugar in the fermentation broth; C: the growth trend of bacteria in the fermentation broth; D: represents the change of by-product butanediol concentration in the fermentation broth.

[0049] Figure 15 This is the fermentation curve graph of the genetic engineering strains 48#, Δ48#, R48#, and RΔ48# in Example 10 of the present invention for the production of acetoin by shake flask fermentation using cassava flour-cottonseed meal hydrolyzate. In the figure, A: the growth trend of bacteria in the fermentation broth; B: the consumption of residual sugar in the fermentation broth; C: the change trend of acetoin concentration during fermentation; D: represents the change of by-product butanediol concentration in the fermentation broth.

[0050] Figure 16 This is the fermentation curve graph of the genetic engineering strain RΔ48# in Example 11 of the present invention for the production of acetoin by fed-batch fermentation in a fermenter.

[0051] Figure 17 This is the result graph of the influence of the activated carbon addition amount on the decolorization effect in Example 12 of the present invention.

[0052] Figure 18 This is the result graph of the influence of the rotation speed of the water bath shaker on the decolorization in Example 12 of the present invention.

[0053] Figure 19 This is the result graph of the influence of the water bath time on the decolorization in Example 12 of the present invention.

[0054] Figure 20 This is the result graph of the influence of the water bath temperature on the decolorization in Example 12 of the present invention.

[0055] Figure 21 This is the result graph of the influence of the pH of the acetoin fermentation broth before decolorization on the decolorization in Example 12 of the present invention.

[0056] Figure 22 This is the result graph of the influence of the addition of chitosan on the decolorization in Example 12 of the present invention. Detailed implementation manners

[0057] The present invention will be further described below in conjunction with the embodiments.

[0058] The culture medium, reaction solution and their preparation methods involved in this embodiment are as follows:

[0059] (1) LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride. For solid medium, an additional 2% agar powder is required. Autoclave at 121 °C for 20 min. Add the corresponding concentration of antibiotics in a sterile environment before use and store at 4 °C for later use. When the solid medium cools to about 60 °C, add the corresponding concentration of antibiotics, mix well to avoid air bubbles, and slowly pour into petri dishes to make solid medium. After air-drying and solidifying, store at 4 °C for later use.

[0060] (2) Initial fermentation medium: 100 g / L glucose, 10 g / L peptone, 7 g / L yeast powder, 0.5 g / L sodium chloride, 0.2 g / L magnesium sulfate, 4 mmol / L betaine, 0.1 g / L vitamin B1. Adjust the pH of the system to 7.0.

[0061] (3) Hydrolysate of cassava flour - cottonseed meal

[0062] The hydrolysis process is divided into the following three stages:

[0063] The first stage of pretreatment: Weigh 56.4 g of cassava flour and 20.1 g of cottonseed meal using an electronic balance, add them all to a 500 mL conical flask, then add 300 mL of tap water, stir evenly, adjust the pH of the system to 6.3, and then add 10 mL of liquefying enzyme. Sterilize and pretreat at 121 °C in an autoclave for 15 min to break the particle structure at high temperature for easy hydrolysis.

[0064] The second stage of liquefaction: Adjust the pH of the mixed solution of cassava flour and cottonseed meal after autoclave treatment to 6.3. Measure 15 mL of liquefying enzyme using a measuring cylinder and add it to the mixed solution. Then shake in a water bath shaker at 95 °C at 160 rpm for 1 h to fully liquefy it.

[0065] The third stage of hydrolysis and saccharification: Take it out from the 95 °C water bath shaker, cool it in cold water, and then adjust the pH of the system in the bottle to 4.3 with 20% (v / v) H 2 SO 4 solution. Then add 25 mL of saccharifying enzyme, and at the same time, add 0.6 g of acidic protease to each bottle of liquid. Saccharify at 55 °C and 160 rpm in a water bath shaker for 24 h.

[0066] After the above three stages are completed, adjust the pH of the system to about 7.0. Use a 500 mL centrifuge bottle and centrifuge at 6000 rpm for 5 min to collect the supernatant. Treat the supernatant in an autoclave at 115 °C for 20 min and use it as the substrate for subsequent strain fermentation.

[0067] (4) Preparation of solutions required for making Escherichia coli competent cells

[0068] Solution A (80 mmol / L MgCl2, 20 mmol / L CaCl 2 ): Weigh 4.07 g of MgCl 2 ·6H 2 O and 0.74 g of CaCl 2 ·2H2O, add ultrapure water and stir to dissolve it. Make up the volume to 250 mL using a volumetric flask. Treat it at 121 °C for 30 min in an autoclave. After sterilization, seal it and store it in a refrigerator at 4 °C.

[0069] Solution B (100 mmol / L CaCl 2 , 15% glycerol): Weigh 0.37 g of CaCl 2 ·2H 2 O and 3.75 g of glycerol, dissolve them together in 25 mL of ultrapure water, filter through a 0.22 μm filter membrane to achieve the purpose of sterilization, seal it and store it in a refrigerator at 4 °C.

[0070] For the raw materials used in the preparation of the above culture medium and reaction solution and those used in the following specific example process, if not specifically stated, they are all commercial products and can be directly purchased from the market.

[0071] Example 1: Preparation of Escherichia coli GXASR10

[0072] Through analysis, it was found that the by-products of the fermentation of strain E. coli MG1655 are 2,3-butanediol, succinic acid, and acetic acid, and the key genes in its synthesis pathway are gldA, frdABCD, ackA-pta, and poxB. Using the principle that the Red recombination system derived from Escherichia coli λ phage can efficiently mediate homologous recombination events in bacteria, first replace the above target genes with antibiotic resistance genes flanked by FRT sites on both sides, and then delete the antibiotic resistance genes by inducing the expression of the exogenous temperature-sensitive plasmid FLP recombinase to achieve the purpose of knocking out the target genes. The specific steps are as follows: Transform the pKD46 plasmid into the host cell to prepare electrocompetent cells; use primers to perform PCR to construct the targeting sequence (containing the chloramphenicol resistance gene), and directly transform it into the host cell containing pKD46; screen the clones that have undergone homologous recombination on a chloramphenicol plate; use sequencing technology to verify and select the clones in which the target gene has been replaced by the chloramphenicol resistance gene, and prepare electrocompetent cells; electrotransform and introduce the pCP20 plasmid to delete the chloramphenicol resistance gene; streak the clones with the chloramphenicol resistance gene deleted three times continuously, and prepare glycerol stocks for storage at -20 °C. Through successive knockout, the mutant strain E. coli MG1655ΔgldAΔfrdABCDΔackA-ptaΔpoxB with multiple gene deletions can be obtained.

[0073] Example 2: Stress effect of acetoin on the growth of the strain

[0074] The acetoin tolerance experiment of Escherichia coli GXASR10 was carried out using LB medium: In this experiment, two acetoin concentrations were set: 20 g / L and 40 g / L, and another group of blank control was set, with three replicates for each concentration. First, pick a single colony of Escherichia coli GXASR10 and activate it in a 5 mL straight flask for 8 - 12 h, then transfer it to a 250 mL conical flask with a transfer amount of 1%, and the liquid loading is 50 mL. After culturing the bacteria for 4 h, a certain amount of acetoin is added. Subsequently, 1 mL of the sample is taken at fixed points, diluted by an appropriate multiple, and then the cell density is detected using a visible light - ultraviolet spectrophotometer to make a growth curve.

[0075] The results are as Figure 1 shown. When there is no acetoin stress, the strain GXASR10 reaches the maximum OD 600 of 4.0 at 8 h; after adding 20 g / L acetoin to the medium, the growth of the bacteria is significantly inhibited, the growth rate of the bacteria slows down, and the highest OD 600 value at 10 h is only 3.16; after adding 40 g / L acetoin to the medium, the growth of the bacteria is severely stressed, and the OD 600 value of the bacteria starts to decline after 2 h. It shows that acetoin has an obvious stress effect on Escherichia coli, and the higher the acetoin concentration, the stronger the stress effect on the growth of the strain.

[0076] Example 3: Construction of engineering strain ΔGXASR10

[0077] In this example, using the CRISPR / Cas9 gene editing technology, the fatty acid synthesis gene Yibt in the genome of the engineering strain GXASR10 was knocked out, and at the same time, a single - copy protein elongation factor EF - Ts gene tsf was inserted at the site of the fatty acid synthesis gene Yibt, and the engineering strain ΔGXASR10 can be obtained. The nucleotide sequence of Yibt is shown as SEQ ID No.1, and the nucleotide sequence of tsf is shown as SEQ ID No.2. The primers used in this example are shown in Table 1.

[0078] Table 1 Primers used in this example

[0079]

[0080]

[0081] The working principle of the above CRISPR / Cas9 dual - plasmid system is as Figure 2As shown, crRNA (CRISPR-derived RNA) forms a tracrRNA / crRNA complex through base complementary pairing with tracrRNA (trans-activating RNA). The nuclease Cas9 protein is guided by this complex to cleave double-stranded DNA at the sequence target site guided by crRNA, achieving the purpose of knocking out or integrating genes. The construction of the engineered strain ΔGXASR10 in this example specifically includes the following steps:

[0082] I. Construction of plasmid pTarget-N20

[0083] 1. Design of N20. In this example, the gene insertion position is the Yibt locus on the genome of strain GXASR10. Search for and download the gene sequence of the target locus Yibt on the NCBI official website. Design N20 on the online website (http: / / crispr.tefor.net / ) according to this gene sequence. From the multiple N20 sequences given by the system, select the N20 sequence with the highest score: ACGGCTTTATCGATAAGAAG. Then add the homologous sequences at both ends of the N20 annotation site on the pTarget plasmid to design forward and reverse primers with a length of 59 bp. The length of the homologous sequences is about 20 - 30 bp. Since the N20 sequence is short, it can be designed into the primers for synthesis so that N20 and the pTarget vector can be ligated by seamless cloning in the subsequent process.

[0084] 2. Annealing and ligation of N20. After synthesizing the primers containing homologous sequences and N20, anneal and ligate them in a PCR instrument to obtain a gene fragment containing homologous sequences and N20. The ligation system and program are shown in Table 2.

[0085] Table 2 PCR amplification system and program

[0086]

[0087] 3. Obtaining of the pTarget vector backbone. Using the pTarget-tdcC plasmid (this plasmid is an inherent plasmid in the CRISPR dual-plasmid system, and the plasmid contains the N20 annotation site, and its nucleotide sequence is shown in SEQ ID No. 3) as a template, design primer pairs to perform PCR amplification on the gene sequence of this plasmid except for the N20 annotation site. The PCR reaction system and program are shown in Table 3, and the PCR reaction program is shown in Table 4, in which three steps of denaturation, annealing, and extension are set for 3 or 4 cycles.

[0088] Table 3 PCR amplification system

[0089]

[0090] Table 4 PCR reaction program

[0091]

[0092] After PCR amplification, agarose gel electrophoresis was performed (the results are as Figure 3 shown, and the size of the amplified band was consistent with the known target gene of 2098 bp), and the target gene was recovered and purified.

[0093] 4. Construction of recombinant plasmid. The above-mentioned N20 and the pTarget backbone fragment obtained by gel recovery were subjected to seamless cloning and ligation. The reaction system is shown in Table 5. After adding the reaction system, incubate at 50 °C for 50 min using a PCR instrument and then it can be used.

[0094] Table 5 Seamless cloning reaction system

[0095]

[0096] 5. Preparation of Escherichia coli DH5α competent cells, and then the recombinant plasmid was transformed into Escherichia coli. The preparation and transformation process of Escherichia coli competent cells in this example are conventional technical means and will not be described in detail here.

[0097] 6. Verification by colony PCR. Pick 5 - 10 transformed Escherichia coli single colonies from the plate and culture them in LB liquid medium containing the corresponding resistance until turbid, and take 1 - 2 μL for colony PCR. The colony PCR verification system is shown in Table 6. After the PCR reaction is completed, agarose gel electrophoresis is performed, and the electrophoresis results are observed and analyzed.

[0098] Table 6 PCR amplification system

[0099]

[0100] 7. Plasmid extraction. After transferring the verified bacterial solution to LB liquid medium and activating it for 8 - 10 h, 1 - 5 mL of the bacterial solution can be used to extract the plasmid. In this example, the plasmid miniprep kit from TIANGEN Biotech (Beijing) Co., Ltd. was used to extract the plasmid. The extraction process is a conventional technical means and will not be described in detail here. After obtaining the recombinant plasmid pTarget - N20, send this plasmid to a sequencing company (GenScript) for sequencing. Store the successfully sequenced recombinant plasmid at -20 °C in the refrigerator for standby. The recombinant plasmid pTarget - N20 can guide the cas protein to complete cleavage at a specific position (yibt gene) in the subsequent steps.

[0101] II. Obtaining of target fragment

[0102] 1. Extraction of genomic DNA of Escherichia coli MG1655. The extraction process of genomic DNA of Escherichia coli MG1655 in this example is a conventional technical means and will not be described in detail here.

[0103] 2. PCR amplification of the target fragment. Using the genomic DNA of Escherichia coli MG1655 as a template, the target genes tsf, the upstream homologous arm of the insertion site Yibt, and the downstream homologous arm of the insertion site Yibt (homologous sequences of about 500 bp) were amplified respectively. The PCR amplification system and amplification program refer to Table 1-3. The results of agarose gel electrophoresis are as Figure 4 shown. The electrophoretic bands of the amplified fragments are consistent with the lengths of the target gene fragments, indicating that the target genes were successfully amplified. Three gene fragments can be obtained by gel extraction and recovery respectively, and then the three fragments are ligated by overlap extension PCR to obtain the targeting fragment.

[0104] 3. Gel extraction and recovery of the target fragment. The gel extraction and recovery method refer to the step "3. Obtaining the pTarget vector backbone".

[0105] III. Preparation of the targeting fragment by Overlap

[0106] By the overlapPCR method (the principle is shown in Figure 5 ), the target gene fragments and the upstream and downstream homologous arms obtained by the above gel extraction and recovery were spliced to obtain the targeting fragment. The specific process and method refer to the step "II. Obtaining the target fragment".

[0107] IV. Electroporation of the target fragment into recipient cells

[0108] 1. Preparation of electrocompetent cells. Before preparing electrocompetent cells, the plasmid pCas was pre-transformed into the strain GXASR10, and then GXASR10 containing the pCas plasmid was prepared into electrocompetent cells.

[0109] 2. Electroporation. The specific preparation process is as follows: (1) Take the electrocompetent cells and let them melt naturally on ice; (2) Pipette about 200 ng of the targeting fragment and add it to the melted competent cells, gently pipette with a pipette gun, and transfer it to a 2 mm electroporation cuvette; (3) Set the parameters of the electroporator to 2.5 kV / 5 ms. Immediately after electroporation, pipette 1 mL of antibiotic-free LB liquid medium preheated at 50 °C into the electroporation cuvette, and then transfer all the bacterial liquid in the electroporation cuvette into a sterile centrifuge tube; (4) Incubate in a shaker at 220 rpm and 37 °C for 40 - 50 min; (5) Spread the revived bacterial liquid on a solid plate supplemented with kanamycin and streptomycin, and culture it in a 37 °C constant temperature incubator for 10 - 12 h; (6) When single colonies grow on the plate, pick 9 single colonies for liquid culture, and use the primers yibt(up)-F / yibt(down)-R for bacterial liquid PCR verification. The results are as Figure 6As shown, the length of the target fragment gene is 1897bp. The positions of the three bands in Lane 2, Lane 3, and Lane 5 correspond to the Marker positions and match the length of the target fragment. The results indicate that the target fragment has been successfully transferred into the bacteria No. 2, No. 3, and No. 5. The bacteria No. 2, No. 3, and No. 5 were sent for sequencing. According to the sequencing results, a few base mutations were found around the genome editing sites of No. 2 and No. 3. Only the sequencing result of the bacteria No. 5 was completely correct. The bacteria No. 5 was continued for the next step of losing the pTarget-N20 and pCas9 plasmids.

[0110] V. Plasmid Loss

[0111] 1. Loss of plasmid pTarget-N20. The specific process is as follows: (1) Use the successfully sequenced bacterial solution and transfer it to an LB liquid medium containing both kanamycin and IPTG for cultivation. IPTG induction can cause the loss of the pTarget-N20 plasmid in the strain. Cultivate it in a constant temperature shaker at 220 rpm and 30 °C for 12 - 15 h; (2) Streak the bacterial solution obtained in the previous step on LB solid plates containing kanamycin and streptomycin respectively, and incubate it upside down in a constant temperature incubator at 30 °C; (3) Pick the monoclonal colonies grown on the kanamycin plate, cultivate them in an LB liquid medium with IPTG, and then streak them on the kanamycin and streptomycin plates again. If no colonies grow on the solid plate containing streptomycin, the single colonies on the kanamycin solid plate can be picked to continue the loss of the plasmid pCas9; if colonies grow on the solid plate containing streptomycin, the bacterial solution in step (1) needs to be transferred again to an LB liquid medium containing IPTG and kanamycin, and the cultured bacterial solution is streaked on LB solid plates containing kanamycin and streptomycin respectively to re-eliminate the pTarget-N20 plasmid until the pTarget-N20 is completely lost.

[0112] 2. Loss of pCas9 plasmid. The specific process is as follows: (1) The pCas9 plasmid is a temperature-sensitive plasmid, and the loss of this plasmid can be carried out under the culture condition of 42 °C. Transfer the bacterial solution that has completely lost the pTarget-N20 plasmid to an LB liquid medium without antibiotics, and place it in a shaker at 220 rpm and 42 °C for cultivation; (2) Streak the cultured bacterial solution on solid plates containing kanamycin and without antibiotics respectively, and incubate it statically in a constant temperature incubator at 30 °C; (3) If no bacteria are found growing on the kanamycin plate, the single colonies on the LB plate without antibiotics can be picked and cultivated in an LB liquid medium without antibiotics in a shaker at 220 rpm and 37 °C to obtain the bacterial solution with the successfully lost plasmid; if there are still strains growing on the LB solid plate containing kanamycin, then the single colonies on the LB plate without antibiotics should be picked and cultivated in a shaker at 220 rpm and 42 °C until the pCas9 plasmid is completely lost.

[0113] The strain with successful sequencing and successful plasmid loss was named ΔGXASR10 (E. coli MG1655ΔgldAΔfrdAB CDΔackA-ptaΔpoxBΔYibt::tsf).

[0114] Example 4: Construction of engineering strain GXASR10 / pTrc99a-budB-budA-noxE (48#)

[0115] The recombinant plasmid pTrc99a-budB-budA-noxE of Example 2 (for the detailed preparation of this recombinant plasmid, see the patents previously applied by the applicant (for example: CN107129959A Construction method and application of (R)-acetoin genetic engineering strain, CN107177620A Method for producing tetramethylpyrazine using inexpensive raw materials)) was electrotransformed into Escherichia coli GXASR10 of Example 1 to obtain the engineering strain GXASR10 / pTrc99a-budB-budA-noxE (abbreviation 48#).

[0116] Example 5: Construction of engineering strain ΔGXASR10 / pTrc99a-budB-budA-noxE (Δ48#)

[0117] The recombinant plasmid pTrc99a-budB-budA-noxE of Example 2 was electrotransformed into Escherichia coli ΔGXASR10 of Example 4 to obtain the engineering strain ΔGXASR10 / pTrc99a-budB-budA-noxE (abbreviation Δ48#).

[0118] Example 6: Construction of engineering strains R48# and RΔ48#

[0119] In this example, using seamless cloning technology, the RSF replicon on plasmid pRSFDuet was used to replace the replicon ori of the recombinant plasmid pTrc99a-budB-budA-noxE to obtain a new recombinant plasmid, and then this new recombinant plasmid was transformed and expressed in Escherichia coli GX ASR10 and ΔGXASR10 respectively to obtain the engineering strains R48# and RΔ48#. The primers used in this example are shown in Table 7.

[0120] Table 7 Primers used in this example

[0121]

[0122] The construction of the engineering strains R48# and RΔ48# in this example specifically includes the following steps (including the PCR amplification system, amplification procedure, electrophoresis method and gel recovery process, as well as competent cell preparation, transformation, plasmid extraction, etc., refer to "Example 4: Construction of the engineering strain ΔGXASR10", which will not be described in detail here):

[0123] 1. Obtaining high-copy replicon RSF. Using plasmid pRSFDuet as a template, first use primers RSF-F / R without homologous sequences to PCR amplify the RSF replicon on the plasmid with kanamycin resistance gene. The agarose gel electrophoresis results are as follows: Figure 7 The target fragment can be recovered by gel recovery kit, and then RSF with kanamycin resistance gene is used as template, and primers RSF-F1 / R1 containing homologous sequence are used for PCR amplification. After agarose gel electrophoresis, the results show that the size of the electrophoresis band is consistent with the fragment length of the known target gene, indicating that the fragment amplification is successful, as shown in FIG. Figure 8 The target gene containing the homologous sequence can be obtained by gel recovery, which is convenient for the subsequent fusion expression and construction of recombinant plasmid.

[0124] 2. Cloning of pTrc99a-budB-budA-noxE plasmid backbone. Using the recombinant plasmid pTrc99a-budB-budA-noxE as a template, primers pTrc99a(-ori)-F / R were designed to amplify the plasmid except for ori and ampicillin resistance gene. The results of agarose gel electrophoresis are shown in Figure 9 The results showed that the size of the amplified band was consistent with the known length of the target gene fragment (7439 bp). The target fragment was recovered using a gel recovery kit. After the concentration of the recovered gene fragment was determined, it was stored in a -20°C refrigerator.

[0125] 3. Seamless cloning to construct recombinant plasmid. The recovered pTrc99a-budB-budA-noxE plasmid backbone fragment and RSF with kanamycin resistance gene fragment were seamlessly connected using a seamless cloning kit, and the seamless cloning connection product was transformed into E. coli DH5α competent state, coated on LB solid plate containing kanamycin (50μg / mL), and cultured in a 37℃ incubator for about 8-12h. From the single colonies grown, 4 were selected for liquid culture and PCR verification of the bacterial liquid. The verification results were as follows: Figure 10 As shown, the verified bacterial solution was sequenced, and the sequencing result was correctly aligned with the target gene sequence. The correctly sequenced bacterial solution was stored in a glycerol tube at -80°C, and the pTrc99a-budB-budA-nox E plasmid containing the RSF replicon was extracted and stored in a -20°C refrigerator for later use.

[0126] IV. Transformation. The plasmids with correct sequencing were respectively transformed into the competent cells of GXASR10 and ΔGXASR10, and cultured at a constant temperature of 37°C for about 12 h. The monoclonal colonies grown on the solid plate were respectively the acetoin-producing strains R48# and RΔ48# containing the high-copy plasmid pTrc99a-budB-budA-noxE.

[0127] Example 7: Shake-flask fermentation of genetically engineered strains 48# and Δ48# to produce acetoin

[0128] The strains 48# and Δ48# were respectively subjected to shake-flask comparative fermentation using the cassava flour-cottonseed meal hydrolysate and the initial fermentation medium. Three replicate groups were set up. The pH of the cassava flour-cottonseed meal hydrolysate and the initial fermentation medium was adjusted to 7.0, the shaking speed of the shaker was set at 250 rpm, the temperature was 37°C, and inoculated into a 250 mL Erlenmeyer flask containing 50 mL of the medium at an inoculum size of 10%.

[0129] During the fermentation process, the OD of the strains was detected at fixed points 600 , the residual glucose concentration, acetoin concentration and the concentration of the main by-product 2,3-butanediol in the fermentation supernatant were used to make a fermentation curve to compare and investigate the fermentation performance of the two strains. Among them, the method for measuring the OD of the strains 600 was as follows: Samples were taken at fixed points during the fermentation process. After diluting a certain amount of the fermentation broth with double-distilled water by an appropriate multiple, the absorbance at a wavelength of 600 nm was detected using a visible-ultraviolet spectrophotometer; the method for measuring the residual sugar in the fermentation broth was as follows: An appropriate amount of the fermentation broth was centrifuged at 12500 rpm for 3 min, the supernatant was diluted 100 times with ultrapure water and mixed evenly, and 25 μL was taken for determination using a biosensor analyzer SBA-40D, and the residual glucose concentration value in the fermentation broth sample was recorded; the acetoin and butanediol in the fermentation broth were determined by gas chromatography.

[0130] The results are as Figure 11 shown. The by-product butanediol was always at a low level during the fermentation process of the strains. When the cassava flour-cottonseed meal hydrolysate was used as the medium, the yield of butanediol was slightly higher. When the initial fermentation medium was used for fermentation, the OD of both Δ48# and 48# 600The trends of the values changing with the fermentation time are basically the same. However, strain Δ48# consumes the substrate glucose faster, and the yield of acetoin synthesized by fermentation is also relatively high, reaching 37.33 g / L, which is 20.92% higher than that of 48#. When using the hydrolyzate of cassava flour-cottonseed meal for fermentation, Δ48# consumes the substrate glucose faster, and the yield of acetoin produced by fermentation is also relatively high, reaching 44.25 g / L, which is 18.94% higher than that of strain 48#. In summary, it shows that the strain has a better fermentation effect in the hydrolyzate of cassava flour-cottonseed meal. At the same time, it shows that integrating a single copy of the protein elongation factor EF-Ts gene tsf at the fatty acid synthesis gene Yibt locus on the GXASR10 genome improves the tolerance of the strain to acetoin and the yield of acetoin synthesized by fermentation.

[0131] Example 8: Batch-fed production of acetoin by the genetically engineered strains 48# and Δ48# in a fermenter

[0132] The hydrolyzate of cassava flour-cottonseed meal was used to conduct batch-fed fermentation of strains 48# and Δ48# in a 3-L fermenter. The initial liquid filling volume was set at 1.5 L. During the fermentation process, the initial sugar concentration was controlled at about 110 g / L. The feeding strategy was that when the sugar concentration dropped from 110 g / L to about 40 g / L, the concentrated solution of the hydrolyzate of cassava flour-cottonseed meal was used to feed it until the glucose concentration in the fermentation broth was about 100 g / L. When it dropped to about 60 g / L, it was fed until the sugar concentration was about 100 g / L. The inoculation amount was 10%. During the fermentation process, ammonia water and 50% (v / v) phosphoric acid were used to control the pH at 6.5. The rotation speed was set at 400 rpm and adjusted to 500 rpm after the first feeding. The temperature was kept constant at 37 °C, and the aeration rate was 1.5 vvm.

[0133] Referring to Example 8, samples were taken at fixed points during the fermentation process to detect the OD 600 , residual sugar, acetoin, and butanediol concentrations in the fermentation broth, and a fermentation curve was made to compare and investigate the fermentation performance of the two strains. The results are as Figure 12 shown. It can be seen that strain Δ48# has a fermentation advantage. The ability of Δ48# to utilize the substrate and the ability to synthesize acetoin by fermentation are both stronger than those of 48#. The OD 600 value is also always higher than that of strain 48#. When the fermentation reaches 50 h, the yield of acetoin reaches the highest. Among them, the yield of acetoin produced by Δ48# fermentation reaches 74.61 g / L, which is 14.80% higher than the acetoin production ability of 48#. It shows that integrating a single copy of the protein elongation factor EF-Ts gene tsf at the fatty acid synthesis gene Yibt locus on the GXASR10 genome improves the tolerance of the strain to acetoin and the yield of acetoin synthesized by fermentation.

[0134] Example 9: Shake-flask fermentation of strains 48#, Δ48#, R48#, and RΔ48# in the initial fermentation medium to produce acetoin

[0135] Using a 500 mL shake flask (liquid volume: 80 mL), ferment the four strains 48#, Δ48#, R48#, and RΔ48# simultaneously. Use the initial fermentation medium for both fed-batch and non-fed-batch fermentations. The fermentation inoculation amount is 10% (v / v). Set three replicates for each group of experiments. The fermentation process is carried out in a shaker at a rotation speed of 250 rpm and a temperature of 37°C. When the glucose concentration in the fermentation broth of the fed-batch group drops to 40 g / L, feed it with a 1 g / mL glucose aqueous solution, and the glucose aqueous solution needs to be treated at 115°C for 20 min in an autoclave in advance.

[0136] Refer to Example 8, and take samples at fixed points during the fermentation process to detect the OD of the fermentation broth 600 , residual sugar, acetoin, and butanediol concentrations, and make a fermentation curve to compare and investigate the fermentation performance of the four strains. The results of shake flask fed-batch fermentation are as Figure 13 shown, and the results of shake flask non-fed-batch fermentation are as Figure 14 shown. It can be seen from the curves in the figure that during the fermentation of the four strains, in both fed-batch and non-fed-batch cases, the strain with the highest acetoin yield and the most sugar consumption is RΔ48#, and its acetoin yield is higher in the non-fed-batch case. During the non-fed-batch fermentation of the strains, the butanediol concentration, a by-product synthesized by the four strains during fermentation, is at a relatively low level. However, RΔ48# shows good advantages in terms of cell growth, sugar consumption, and acetoin synthesis. After 50 h of fermentation, the acetoin concentration in its fermentation broth reaches the highest at 49.88 g / L, and the glucose concentration in the fermentation broth at the end of fermentation is only 15.47 g / L. By comparing the fermentation conditions of strains RΔ48# and Δ48#, it is found that RΔ48# has a stronger growth and metabolic ability during fermentation. Its sugar consumption ability is 14.09% higher than that of Δ48#, and its acetoin production ability is 13.54% higher than that of Δ48#. The better acetoin production level of strain RΔ48# than that of R48# can be attributed to the modification of the acetoin tolerance of the strain.

[0137] Example 10: Shake flask fermentation of strains 48#, Δ48#, R48#, and RΔ48# using cassava flour-cottonseed meal hydrolyzate to produce acetoin

[0138] Based on the fermentation results of the four strains in the initial fermentation medium in Example 10, it is found that the acetoin yield synthesized by the strains during non-fed-batch fermentation is relatively high. Therefore, use cassava flour-cottonseed meal hydrolyzate as the substrate for non-fed-batch fermentation of the four strains 48#, Δ48#, R48#, and RΔ48#.

[0139] Refer to Example 8, and take samples at fixed points during the fermentation process to detect the OD of the fermentation broth 600 , residual sugar, acetoin, and butanediol concentrations, and make a fermentation curve to compare and investigate the fermentation performance of the four strains. The results are as Figure 15As shown, the concentrations of butanediol synthesized during the fermentation process of the four strains were basically at a relatively low level. The OD values of the two strains RΔ48# and R48# increased rapidly in the middle and late stages of fermentation, indicating that the growth and metabolic activities of the strains were relatively strong at this time. This was mainly because the recombinant plasmids with appropriately increased copy numbers were more conducive to the growth of the strains. Moreover, the two strains RΔ48# and R48# consumed glucose relatively quickly, but the acetoin production of the R48# strain during fermentation synthesis was not as high as that of RΔ48#. In addition, the OD value of the strain Δ48# was always lower than that of the other three strains throughout the fermentation process, but the acetoin concentration synthesized by its fermentation was second only to RΔ48#. Among the four strains, the fermentation performance of RΔ48# was the best, synthesizing 66.50 g / L of acetoin during the 60-hour fermentation process, which was 14.36% higher than that of Δ48#. This shows that replacing the ori replicon on the plasmid pTrc99a-budB-budA-noxE with the RSF replicon can improve the ability of the strain to ferment and synthesize acetoin. 600 rose rapidly, indicating that the growth and metabolic activities of the strains were relatively strong at this time. This was mainly because the recombinant plasmids with appropriately increased copy numbers were more conducive to the growth of the strains. Moreover, the two strains RΔ48# and R48# consumed glucose relatively quickly, but the acetoin production of the R48# strain during fermentation synthesis was not as high as that of RΔ48#. In addition, the OD value of the strain Δ48# was always lower than that of the other three strains throughout the fermentation process, but the acetoin concentration synthesized by its fermentation was second only to RΔ48#. Among the four strains, the fermentation performance of RΔ48# was the best, synthesizing 66.50 g / L of acetoin during the 60-hour fermentation process, which was 14.36% higher than that of Δ48#. This shows that replacing the ori replicon on the plasmid pTrc99a-budB-budA-noxE with the RSF replicon can improve the ability of the strain to ferment and synthesize acetoin. 600 value was always lower than that of the other three strains throughout the fermentation process, but the acetoin concentration synthesized by its fermentation was second only to RΔ48#. Among the four strains, the fermentation performance of RΔ48# was the best, synthesizing 66.50 g / L of acetoin during the 60-hour fermentation process, which was 14.36% higher than that of Δ48#. This shows that replacing the ori replicon on the plasmid pTrc99a-budB-budA-noxE with the RSF replicon can improve the ability of the strain to ferment and synthesize acetoin.

[0140] Example 11: Batch-fed production of acetoin by strain RΔ48# in a fermenter

[0141] According to the shake-flask fermentation results, it can be concluded that the strain RΔ48# has a relatively strong ability to ferment and synthesize acetoin. Therefore, the strain RΔ48# was used for batch-fed fermentation in a 3-L fermenter, with a hydrolysate of cassava flour-cottonseed meal as the fermentation medium, and two feedings were carried out during the fermentation process. The initial liquid volume was set at 1.5 L, and the initial sugar concentration during the fermentation process was controlled at about 110 g / L. The feeding strategy was that when the sugar concentration decreased from 110 g / L to about 40 g / L, the hydrolysate concentrate of cassava flour-cottonseed meal was used to feed it to about 100 g / L, and when it decreased to about 20 g / L again, it was fed again to 60 g / L. During the fermentation process, the pH was controlled at 6.5, the fermentation rotation speed was set at 400 rpm, the temperature was controlled at 37 °C, and the inoculum size was 10% (v / v).

[0142] Referring to Example 8, samples were taken at fixed points during the fermentation process to detect the OD600, residual sugar, acetoin, and butanediol concentrations in the fermentation broth, and a fermentation curve was made. The results are as Figure 16 shown. It can be seen that the sugar consumption was complete throughout the fermentation process, and the fermentation basically stopped at 40 h. Among them, the by-product butanediol production was always at a relatively low level, and the concentration reached a maximum of only 17.51 g / L at 40 h of fermentation. In the first 30 h of the fermentation process of the strain RΔ48#, the substrate was sufficient and the metabolic activity of the bacterial cells was strong. Therefore, the OD 600The numerical growth rate is relatively fast. After 30 h, its growth rate slows down, and the cell density in the fermentation broth begins to decrease until 40 h. Within the first 35 h of the fermentation process, the concentration of acetoin in the fermentation broth increases relatively fast, and then increases slowly. The concentration reaches the maximum at 40 h, and at this time, the substrate is basically exhausted. The strain RΔ48# was subjected to fed-batch fermentation using a 3-L fermenter. Within 40 h, the maximum concentration of acetoin in the fermentation broth can reach 81.62 g / L, which is 9.4% higher than the maximum yield of acetoin in the fed-batch fermentation of the strain Δ48# using a 3-L fermenter, further indicating that replacing the ori replicon on the plasmid pTrc99a-budB-budA-noxE with the RSF replicon can improve the ability of the strain to ferment and synthesize acetoin. In addition, the residual sugar in the fermentation broth is basically exhausted, which is beneficial to the subsequent reaction of the acetoin fermentation broth with diammonium hydrogen phosphate to produce tetramethylpyrazine and the purification of the later product.

[0143] Example 12: Decolorization and purification of acetoin fermentation broth

[0144] Take the acetoin fermentation broth with a concentration of 81.62 g / L obtained by fermentation in Example 12, and collect the supernatant containing acetoin by centrifugation for subsequent decolorization optimization. The entire decolorization process uses a 100-mL airtight blue-capped bottle. The acetoin fermentation broth after each decolorization is filtered by an 80-mm Buchner funnel, and the yield of acetoin before and after decolorization is detected by gas chromatography and the acetoin retention rate is calculated. The decolorization rate is first obtained by performing a full-wavelength scan of the acetoin fermentation broth using a visible light-ultraviolet spectrophotometer. The results show that the acetoin fermentation broth has a maximum absorption peak at a wavelength of 280 nm. Finally, the decolorization rate of each sample is calculated based on the absorbance of the acetoin fermentation broth before and after decolorization: Decolorization rate (%) = (A 1 -A 2 ) / A 1 , where A 1 is the absorbance of the original solution, and A 2 is the absorbance of the solution after decolorization.

[0145] I. Optimize the addition amount of activated carbon powder during the decolorization of acetoin fermentation broth. Set a fixed 20 mL of acetoin fermentation broth in a 100-mL blue-capped bottle, and at the same time set 9 gradients to optimize the addition amount of activated carbon powder: 0.2 g, 0.4 g, 0.6 g, 0.8 g, 1.0 g, 2.0 g, 3.0 g, 4.0 g, 5.0 g. Each gradient is set with three replicates. When optimizing the addition amount of activated carbon powder, the pH of the acetoin fermentation broth is not adjusted. The temperature of the water bath shaker is set at 50 °C, the rotation speed of the water bath shaker is 100 rpm, and the decolorization time is set at 10 min.

[0146] The results are as Figure 17As shown in the figure, with the increase of the addition amount of activated carbon powder, the decolorization rate becomes higher and higher. However, the retention rate of acetoin first increases and then continuously decreases with the increase of the activated carbon powder. The reason is that the activated carbon preferentially adsorbs pigment molecules. With the increase of the activated carbon, more and more pigment molecules are adsorbed until equilibrium. Therefore, the decolorization rate shows an increasing trend until it stabilizes at about 70%. When the addition amount of activated carbon is 0.4 g, the retention rate of acetoin reaches the highest of 99.1%, but the decolorization rate is relatively low at this time. When the addition amount of activated carbon powder is between 0.6 - 0.8 g, the retention rate of acetoin is at a relatively high level. In this range, with the gradual increase of the addition amount of activated carbon powder, the change of the retention rate of acetoin is not significant, but the increase of the decolorization rate is more obvious. Therefore, when considering both the retention rate of acetoin and the decolorization rate, it is selected to add 0.8 g of medical activated carbon powder to 20 mL of fermentation broth. At this time, the retention rate of acetoin is 92.77% and the decolorization rate is 52.87%.

[0147] Second, optimize the rotation speed of the water bath shaker during the decolorization of acetoin fermentation broth. Set five gradients of 0 rpm, 50 rpm, 100 rpm, 150 rpm, and 200 rpm, and set three replicates for each gradient. Among them, the pH of the acetoin fermentation broth is not adjusted and the optimal addition amount of activated carbon powder is used. The temperature of the water bath shaker is set at 50 °C, and the decolorization time is set at 10 min.

[0148] The results are as Figure 18 shown. It can be seen that when the addition amount of activated carbon powder is fixed at 0.8 g, the rotation speed has no significant effect on the retention rate and decolorization rate of acetoin. With the increase of the rotation speed of the water bath shaker, the decolorization rate slowly increases. In the range of 0 - 150 rpm, the retention rate of acetoin shows a slow increasing trend. The reason is that with the increase of the rotation speed, the adsorption of activated carbon on pigment molecules becomes more sufficient. When the rotation speed of the water bath shaker reaches 200 rpm, the retention rate of acetoin begins to decrease. Therefore, the optimal rotation speed of the water bath shaker during the decolorization of acetoin fermentation broth is 150 rpm. At this time, the retention rate of acetoin is 94.79% and the decolorization rate is 57.23%.

[0149] Third, optimize the decolorization time during the decolorization of acetoin fermentation broth. Set five gradients of 10 min, 20 min, 30 min, 40 min, and 50 min, and set three replicates for each gradient. Among them, the pH of the acetoin fermentation broth is not adjusted and the optimal addition amount of activated carbon powder and the optimal rotation speed of the water bath shaker during the decolorization process are used. The temperature of the water bath shaker is set at 50 °C.

[0150] The results are as Figure 19As shown, under the conditions of a fixed activated carbon addition of 0.8 g and a water bath shaker speed of 150 rpm, the effects of decolorization time on the retention rate and decolorization rate of acetoin were studied. It can be seen from the figure that as the water bath time in the decolorization process increases, the decolorization rate first decreases slowly and then gradually increases, while the acetoin retention rate shows a trend of first increasing slowly and then decreasing. In the range of 10 - 30 min, as the water bath time prolongs, the adsorption amount of activated carbon on acetoin molecules gradually decreases. As the water bath decolorization time continues to extend, the adsorption of activated carbon on acetoin molecules reaches a dynamic equilibrium. When the water bath decolorization time is 40 min, the acetoin retention rate reaches the highest, and the decolorization rate is also relatively high at this time. Therefore, the optimal water bath time in the decolorization process of acetoin fermentation broth is 40 min. At this time, the retention rate of acetoin in the fermentation broth is 97.62%, and the decolorization rate is 62.04%.

[0151] IV. Optimize the temperature of the water bath shaker during the decolorization of acetoin fermentation broth. Set five gradients of 50 °C, 60 °C, 70 °C, 80 °C, and 90 °C, and set three replicates for each gradient. For the pH of the acetoin fermentation broth, no adjustment is made, and the optimal activated carbon powder addition amount, the optimal water bath shaker speed, and the decolorization time during the decolorization process are used.

[0152] The results are as Figure 20 shown. Under the conditions of a fixed activated carbon powder addition of 0.8 g, a water bath shaker speed of 150 rpm, and a water bath decolorization time of 40 min, the effects of the decolorization water bath temperature on the acetoin retention rate in the fermentation broth and the decolorization rate of the fermentation broth were studied. It can be seen from the figure that as the decolorization water bath temperature gradually increases, the decolorization rate of the fermentation broth shows a trend of first decreasing slowly and then gradually increasing, while the acetoin retention rate shows a trend of first increasing, then decreasing, and then stabilizing. In the range of 50 - 70 °C, as the water bath temperature in the decolorization process increases, the acetoin retention rate gradually increases, and the decolorization rate of the fermentation broth is almost in a stable state. When the temperature rises to 80 °C, both the acetoin retention rate and the decolorization rate of the fermentation broth start to decrease. Therefore, the optimal water bath temperature in the decolorization process of acetoin fermentation broth is 70 °C. At this time, the acetoin retention rate is 96.24%, and the decolorization rate of the fermentation broth is 60.85%.

[0153] V. Optimize the pH of the acetoin fermentation broth before decolorization. Before adding activated carbon powder to the fermentation broth for decolorization, adjust its pH to 3.0, 4.0, 5.0, 6.0, and 7.0 using phosphoric acid or ammonia water respectively, and set three replicates at the same time. During the decolorization process, use the optimal activated carbon powder addition amount, the optimal water bath shaker speed, decolorization time, and temperature.

[0154] The results are as Figure 21As shown in the figure, with the gradual increase of the initial pH of the fermentation broth, the decolorization effect gradually decreases, and the retention rate of acetoin shows a trend of first increasing and then decreasing. When the initial pH of the fermentation broth is 3.0, the decolorization rate of the fermentation broth is the highest, but the retention rate of acetoin is the lowest at this time. When the initial pH of the fermentation broth is 4.0, the maximum retention rate of acetoin exists, and the decolorization rate is also at a relatively high level at this time. Therefore, the optimal pH before decolorization of the acetoin fermentation broth is 4.0. The corresponding retention rate of acetoin is 95.77%, and the decolorization rate of the fermentation broth is 74.00%.

[0155] VI. Optimize the addition amount of chitosan during the decolorization process of acetoin fermentation. Pretreatment of chitosan: Weigh 0.5 g, 1 g, 1.5 g, 2 g, and 2.5 g of chitosan respectively and dissolve them in 100 mL of acetic acid solution containing 1% (v / v). Let it stand in a 4°C refrigerator for 6 h before use, and it needs to be used up within one week. Pipette 1 mL of 5 different concentrations of chitosan solutions into 20 mL of acetoin fermentation broth respectively, shake well to make the flocculation complete, filter out the flocs through filter paper, and then use the filtered acetoin solution for decolorization with activated carbon powder. Adjust the pH of the solution to the optimal pH before decolorization, and use the optimal addition amount of activated carbon powder, the optimal rotation speed of the water bath shaker, decolorization time, and temperature. At the same time, set three replicates.

[0156] The results are as Figure 22 shown. It can be found that with the increase of the concentration of the added chitosan solution, the decolorization rate of the fermentation broth shows a trend of first decreasing and then balancing, and the retention rate of acetoin shows a trend of first increasing, then decreasing, and finally stabilizing. When the concentration of the added chitosan solution is 5 g / L, the chitosan in the system has a strong adsorption ability for both acetoin molecules and pigment molecules. Therefore, the retention rate of acetoin is relatively low at this time, while the decolorization rate of the fermentation broth is relatively high. When the chitosan concentration increases to 10 g / L, the adsorption ability of chitosan for both acetoin molecules and pigment molecules decreases. Therefore, the retention rate of acetoin is relatively high at this time, and the decolorization rate of the fermentation broth decreases slightly. As the addition amount of chitosan continues to increase, its adsorption ability for acetoin molecules becomes stronger and stronger, and the adsorption ability for pigment molecules reaches a dynamic balance. Therefore, considering comprehensively, it is optimal to add 1 mL of chitosan solution with a concentration of 10 g / L to 20 mL of acetoin fermentation broth. The corresponding retention rate of acetoin is 92.18%, and the decolorization rate is 81.62%.

[0157] Example 13: Application of genetically engineered strains in the synthesis of tetramethylpyrazine

[0158] The acetoin fermentation broth with a concentration of 81.62 g / L obtained by fermentation in Example 12 was centrifuged, and the supernatant containing acetoin was taken. Activated carbon and chitosan were used to decolorize and purify the supernatant of the acetoin fermentation broth. 0.8 g of activated carbon powder was added to 20 mL of the acetoin fermentation broth, the rotation speed of the water bath shaker was 150 rpm, the time was 40 min, the temperature was 70 °C, the initial pH value was 4.0, and 1 mL of 10 g / L chitosan solution was added, resulting in an acetoin retention rate of 92.18% and a decolorization rate of 81.62%, providing guarantee for the subsequent production of relatively pure tetramethylpyrazine.

[0159] The supernatant of the acetoin fermentation broth decolorized and purified above was put into a micro high-temperature and high-pressure reaction kettle. At the same time, diammonium hydrogen phosphate was added to the supernatant according to the molar concentration ratio of acetoin to diammonium hydrogen phosphate of 2.5:5. Under the conditions of a conversion reaction temperature of 180 °C, a conversion reaction rotation speed of 400 rpm, a pressure of 5 Mpa, and an initial pH value of 7.5, the conversion reaction was carried out for 3 h, and the yield of tetramethylpyrazine was 53.81 g / L, and the conversion rate was 85.30%.

[0160] The above embodiments are only exemplary embodiments of the present invention and are not used to limit the present invention. The protection scope of the present invention is defined by the claims. Those skilled in the art can make various modifications or equivalent replacements within the essence and protection scope of the present invention, and such modifications or equivalent replacements should also be regarded as falling within the protection scope of the present invention.

Claims

1. A genetically engineered strain for producing acetoin, characterized in that, comprising: (1) Using the CRISPR / Cas9 gene editing technology, integrate a single copy of the protein elongation factor EF-Ts gene at the fatty acid synthesis gene locus in the Escherichia coli GXASR10 genome Yibt to obtain the engineered strain ΔGXASR10; the nucleotide sequence of the gene tsf is as shown in SEQ ID No. 1, and the nucleotide sequence of the gene Yibt is as shown in SEQ ID No. 2; tsf ​ (2) Recombinant plasmid pTrc99a-budB-budA-noxE was transformed and expressed in Escherichia coli GXASR10 and ΔGXASR10 respectively, and the engineered strains GXASR10 / pTrc99a-budB-budA-noxE and ΔGXASR10 / pTrc99a-budB-budA-noxE were obtained; (3) Using seamless cloning technology, the replicon on plasmid pRSFDuet RSF was used to replace the replicon of recombinant plasmid pTrc99a-budB-budA-noxE ori to obtain a new recombinant plasmid, which was then transformed and expressed in Escherichia coli GXASR10 and ΔGXASR10 respectively to obtain engineered strains R-GXASR10 / pTrc99a-budB-budA-noxE and R-ΔGXASR10 / pTrc99a-budB-budA-noxE; the RSF replicon was obtained by first performing PCR amplification of the RSF replicon on plasmid pRSFDuet together with the kanamycin resistance gene using primers RSF-F / R without homologous sequences as a template, and then performing PCR amplification using primers RSF-F1 / R1 with homologous sequences as a template with the RSF together with the kanamycin resistance gene as the template.

2. The construction method of the genetically engineered strain for producing acetoin as described in claim 1, characterized in that, the construction of the engineered strain ΔGXASR10 includes the following steps: S21. According to the gene sequence at the Yibt site on the genome of Escherichia coli GXASR10, design and synthesize the gene fragment N20; then use the pTarget backbone gene fragment as a template and perform seamless cloning and ligation with the gene fragment N20 to construct the pTarget-N20 recombinant plasmid; the nucleotide sequence of the gene fragment N20 is ACGGCTTTATCGATAAGAAG; S22. Using the genomic DNA of Escherichia coli MG1655 as a template, amplify the target gene respectively tsf , the upstream homologous arm and the downstream homologous arm of the insertion site Yibt ; at the same time, splice the upstream homologous arm and the downstream homologous arm of the target gene tsf , the insertion site Yibt to obtain a targeting fragment; then electrotransform the targeting fragment into Escherichia coli GXASR10 containing the pCas plasmid and perform PCR verification; S23. Use the successfully sequenced bacterial liquid to lose the pTarget-N20 and pCas9 plasmids.

3. The construction method of the genetically engineered strain for producing acetoin as described in claim 1, characterized in that, Replacing the replicon on plasmid pRSFDuet with the replicon of recombinant plasmid pTrc99a-budB-budA-noxE RSF to obtain a new recombinant plasmid, comprising the following steps: ori to obtain a new recombinant plasmid, including the following steps: S31. Using plasmid pRSFDuet as a template and RSF-F / R as primers, PCR amplify its replicon RSF along with the kanamycin gene; using RSF the fragment of the kanamycin gene as a template, and using primers RSF-F1 / R1 containing the homologous sequences at both ends of the replicon on ori plasmid pTrc99a-budB-budA-noxE for PCR amplification to obtain a high-copy replicon containing homologous sequences RSF the target gene; S32. Using plasmid pTrc99a-budB-budA-noxE as a template, design primers pTrc99a(-ori)-F / R to amplify the backbone fragment of this plasmid without ori and the ampicillin gene; S33. Link RSF the target fragment carrying the kanamycin gene with the pTrc99a-budB-budA-noxE plasmid backbone by seamless cloning to obtain a new recombinant plasmid.

4. The application of the genetically engineered strain as described in claim 1 in the production of acetoin, characterized in that, comprising the following steps: Using glucose, tapioca flour and / or cottonseed meal hydrolysate as the initial carbon source, fermenting and synthesizing acetoin.

5. The application of the genetically engineered strain as described in claim 1 in the synthesis of tetramethylpyrazine, characterized in that, comprising the following steps: S51. Take the above acetoin fermentation broth for centrifugation, take the supernatant, and measure the acetoin content; S52. Add diammonium hydrogen phosphate to the supernatant according to the molar concentration ratio of acetoin to diammonium hydrogen phosphate of 2-3:5; S53. Under the conditions of a conversion reaction temperature of 150-180 °C, a conversion reaction rotation speed of 350-450 rpm, a pressure of 2-10 Mpa and an initial pH value of 7-8, carry out a conversion reaction for 2-4 h to obtain tetramethylpyrazine.

6. The application of the genetically engineered strain as described in claim 5 in the synthesis of tetramethylpyrazine, characterized in that, it further includes the decolorization treatment of the supernatant of the acetoin fermentation broth, and the decolorization treatment includes the following steps: S61. Add chitosan solution to the supernatant of the acetoin fermentation broth for flocculation according to the volume ratio of the supernatant of the acetoin fermentation broth to the chitosan solution of 20:0-2, and then filter out the flocs through a filter paper; S62. Add 0.5-1 g / ml of activated carbon powder to the supernatant of the acetoin fermentation broth, control the rotation speed of the water bath shaker to be 100-200 rpm, the water bath decolorization time to be 30-50 min, the water bath decolorization temperature to be 60-80 °C and the pH of the acetoin fermentation broth before decolorization to be 3.5-4.5, and carry out decolorization on the supernatant after flocculation treatment.

Images