Tumor-associated fibroblasts that can be targeted to undergo death and methods of making and using the same

By introducing specific polynucleotide fragments into tumor-associated fibroblasts and treating them with ganciclovir, we constructed CAF cells that can be targeted to induce cell death, solving the problem of the difficulty in targeting and clearing CAFs in existing technologies, and realizing the clear differentiation and study of the functions of different CAF subtypes.

CN116024178BActive Publication Date: 2026-02-10NANJING STOMATOLOGICAL HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211011013.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-23
Publication Date
2026-02-10
Estimated Expiration
2042-08-23

AI Technical Summary

Technical Problem

Current technologies lack effective methods to target and eliminate different subtypes of tumor-associated fibroblasts (CAFs) in order to clarify their function in tumorigenesis and development.

Method used

A tumor-associated fibroblast that can be targeted to induce cell death was constructed by carrying a specific polynucleotide fragment on its chromosome and inducing cell death with ganciclovir (GCV). The specific steps included plasmid construction, lentiviral transfection, and puromycin screening to ensure that the cells specifically died during co-culture.

Benefits of technology

This method is simple to operate and can efficiently target and eliminate 80% of CAFs without affecting the original cells. It helps to distinguish the role of different CAF subtypes in tumors and is suitable for two-dimensional or three-dimensional co-culture models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116024178B_ABST
    Figure CN116024178B_ABST
Patent Text Reader

Abstract

The application discloses tumor-related fibroblasts which can be targeted to die, the tumor-related fibroblasts carry polynucleotide fragments of sequences such as SEQ ID No:1 in chromosomes, and the tumor-related fibroblasts have morphology and in-vitro growth rate comparable to other tumor-related fibroblasts.The tumor-related fibroblasts can be specifically induced to die by drugs when co-cultured with other tumor-related fibroblasts, and the drugs are ganciclovir, and the ganciclovir drug concentration ranges from 1 to 100 μM.The application provides a novel and convenient cell construction method for studying the functions of different subtypes of CAFs and application thereof, and the novel CAFs can be targeted to die under the treatment of ganciclovir, weaken the effect of the CAFs of the type on co-cultured tumor cells, and help effectively distinguish the roles of different subtypes of CAFs in tumor occurrence and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a tumor-associated fibroblast that can be targeted and eliminated, its construction method, and its application. Background Technology

[0002] The occurrence and development of tumors depend on the interaction and dialogue between tumor cells and cells in the tumor microenvironment. Cancer-associated fibroblasts (CAFs) are among the most important cells in the tumor microenvironment. Multiple studies have found that the number of CAFs is closely related to patient prognosis in tumors such as breast cancer, pancreatic cancer, and oral cancer. CAFs can promote tumor cell proliferation and inhibit the tumor immune microenvironment by secreting cytokines such as TGF-β, IL-6, and IL-1. Furthermore, they release matrix metalloproteinases, which participate in extracellular matrix remodeling in tumors and induce drug resistance in tumor cells. CAFs can also provide energy for tumor cell growth by releasing small molecule metabolites such as alanine, aspartic acid, and lactate. Therefore, clarifying the function of CAFs is crucial for tumor treatment research.

[0003] CAFs (Cellular Alternating Follicles) are a class of non-epithelial, non-endothelial, non-tumor, and non-immune cells found within or at the tumor boundary. They can originate from quiescent fibroblasts within the tissue, or differentiate from bone marrow mesenchymal stem cells, endothelial cells, and adipocytes. Due to the diversity of CAF origins, the functions of CAFs vary in different tumors or even within the same tumor. For example, in breast cancer, CD146-CAFs enhance tumor cell resistance to temoxifen, while CD146+CAFs have the opposite function. Currently, numerous studies utilize single-cell sequencing, flow cytometry sorting, and targeted removal of CAFs to investigate the expression profiles and functions of different types of CAFs. Among these, using genetic engineering to induce cells to express suicide genes for targeted removal of CAFs is an experimental method that can clearly define the function of CAFs.

[0004] Numerous studies have demonstrated that targeted clearance of cancer cell fibroblasts (CAFs) helps clarify their origin and role in tumor progression. LeBleu et al. previously demonstrated that the Tgfbr2 signaling pathway affects myofibroblast recruitment by targeting the removal of Tgfbr2+αSMA+ cells. Mertens et al. showed that in vivo targeted induction of CAF apoptosis can inhibit tumor cell growth and prolong mouse survival. One commonly used method for targeted CAF clearance is herpes simplex virus thymidine kinase (HSVtk)-mediated cell death. HSVtk can induce phosphorylation of ganciclovir (GCV) to form deoxythymidine triphosphate (DTP). When cells proliferate rapidly, DTP integrates into synthesized DNA, inhibiting DNA synthesis and inducing cell death. Although the HSVtk suicide system has been used in transgenic mouse models to study CAF function, evaluation of the effects of HSVtk suicide system on targeted CAF clearance in co-cultured tumor cells is still lacking. Therefore, this study aims to construct CAFs-HSVtk cells and compare the effects of GCV-induced CAFs-HSVtk death on tumor cell proliferation and migration using in vitro co-culture and migration models. This will clarify the feasibility of using the HSVtk suicide system to target and eliminate CAFs in studies of the function of different CAF subtypes. This is the problem this invention aims to solve. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing a tumor-associated fibroblast that can be targeted and eliminated, as well as its construction method and application, and to provide a new method for clarifying the functions of different subtypes of CAFs.

[0006] To address the aforementioned technical problems, this invention discloses a tumor-associated fibroblast that can be targeted and induced to die, wherein the tumor-associated fibroblast chromosome carries a polynucleotide fragment with a sequence such as SEQ ID NO:1.

[0007] The tumor-associated fibroblasts described herein have morphology and in vitro growth rate comparable to other tumor-associated fibroblasts.

[0008] When the tumor-associated fibroblasts are co-cultured with other tumor-associated fibroblasts, they can be specifically induced to die by a drug, namely ganciclovir, with a concentration range of 1-100 μM.

[0009] This invention further proposes a method for constructing the above-mentioned tumor-associated fibroblasts, comprising the following steps:

[0010] (1) Construction of a plasmid expressing the polynucleotide fragment SEQ ID NO:1 under the regulation of the CMV promoter: Based on the pCDH plasmid vector, after digestion with Xba I and BamH I restriction endonucleases, the vector was ligated with the polynucleotide fragment containing SEQ ID NO:1 to obtain a ligation vector, which was then transformed into Stbl3 glycerol bacteria. The resulting clone was sequenced and identified to obtain a plasmid expressing the polynucleotide fragment SEQ ID NO:1 under the regulation of the CMV promoter; the sense strand fragment (SEQ ID NO:2) containing the polynucleotide fragment of SEQ ID NO:1 was formed by adding CTAGA to the 5' end and G to the 3' end, and the antisense strand (SEQ ID NO:3) was formed by adding GATCC to the 5' end and T to the 3' end, thus obtaining the ligation vector;

[0011] (2) The plasmid obtained in step (1) is mixed with the packaging plasmid and transfection reagent and transfected into 293T cells to obtain a lentivirus containing a plasmid expressing the polynucleotide fragment SEQ ID NO:1 regulated by the CMV promoter. Then, tumor-associated fibroblasts are used as the starting cells, and the constructed plasmid is transfected into tumor-associated fibroblasts using the lentivirus. Among them, the packaging plasmids are psPAX2 and pMD2.G plasmids, and the transfection reagent can be Polyjet or Lipo3000. The amount can be adjusted according to the usual amount.

[0012] (3) After screening the tumor-associated fibroblasts obtained in step (2) with 1 μg / ml puromycin, they were observed by fluorescence microscopy and identified by Q-PCR.

[0013] This invention further proposes the use of the above-mentioned tumor-associated fibroblasts in the preparation of human tumor-associated fibroblast models.

[0014] Specifically, the use includes: co-culturing the tumor-associated fibroblasts with other tumor cells to construct a co-cultured tumor cell proliferation model.

[0015] In this application, the tumor-associated fibroblasts were co-cultured with tumor cells at a volume ratio of 1:0.5 to 2, and then treated with ganciclovir. The effect of tumor-associated fibroblasts on the proliferation of co-cultured tumor cells was observed.

[0016] As another application, tumor-associated fibroblasts are seeded in the lower chamber of a transwell, and tumor cells are seeded in the upper chamber of a transwell to construct a tumor cell migration model.

[0017] In this application, ganciclovir was used to induce the death of new tumor-associated fibroblasts, thereby weakening the role of tumor-associated fibroblasts in the migration of co-cultured tumor cells and clarifying the role of tumor-associated fibroblasts in the migration of co-cultured tumor cells.

[0018] Beneficial effects: This invention provides a novel and convenient cell construction method for studying the functions of different CAF subtypes and its application. When treated with ganciclovir, the novel CAFs will target death, weakening the effect of this type of CAFs on co-cultured tumor cells, and can help to effectively distinguish the roles of different CAF subtypes in tumor development and progression.

[0019] Specifically, it has the following advantages:

[0020] (1) Compared with the Cre-LOXP knockout system, this method is simple, convenient and economical, requiring only one cloning and one transfection step to obtain the target cells;

[0021] (2) This method is highly targeted. After treatment with high concentrations of ganciclovir, 80% of new CAFs cells died, while the survival of original CAFs cells was unaffected.

[0022] (3) This method has wide applications and can be applied to two-dimensional or 3D co-culture models to help clarify the role of CAFs in tumor development. Attached Figure Description

[0023] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0024] Figure 1 A graph showing the transcriptional expression level of the HSVtk gene in new CAF cells;

[0025] Figure 2 GCV induces cell death in new CAFs;

[0026] Figure 3 For the application of novel CAFs cells in co-cultured tumor cell models;

[0027] Figure 4 To investigate the role of tumor-associated fibroblasts in the migration of co-cultured tumor cells. Detailed Implementation

[0028] Example 1: Construction of novel tumor-associated fibroblasts.

[0029] Unless otherwise specified, the reagents used in the following examples are all commonly used reagents.

[0030] (1) Plasmid construction:

[0031] A polynucleotide fragment containing SEQ ID NO:1 was synthesized, wherein the sense strand of the polynucleotide sequence was formed by adding CTAGA to the 5' end and G to the 3' end of the SEQ ID NO:1 polynucleotide fragment, and the antisense strand was formed by adding GATCC to the 5' end and T to the 3' end of the SEQ ID NO:1 polynucleotide fragment.

[0032] pCDH-CMV was double-digested with Xba I and BamHI, and the reaction system is shown in Table 1:

[0033] Table 1

[0034]

[0035] The above reaction mixture was placed in a 37°C water bath for 6 hours, followed by agarose gel electrophoresis. The target fragment was recovered using a gel recovery kit, and the enzyme ligation system shown in Table 2 was established.

[0036] Table 2

[0037]

[0038]

[0039] After reacting the above enzyme ligation system in a 16°C water bath for 12 hours, the enzyme ligation product was transformed into *E. coli* Stbl3 competent cells using a heat shock method. After transformation, the cells were thawed at 37°C for 1 hour and then plated onto LB agar plates containing 50 μg / ml ampicillin. After incubation at 37°C upside down for 16 hours, single clones were picked for DNA sequencing analysis. Plasmids were extracted from correctly sequenced clones for subsequent use; the plasmid sequences are shown in SEQ ID NO:4.

[0040] (2) Lentiviral packaging:

[0041] The day before transfection, 3x10 6 293T cells were evenly seeded in 10cm dishes to achieve a cell density of 90%. The next day, 6 μg of the plasmid constructed in the previous step, 4 μg of psPAX2, and 2 μg of pMD2.G plasmid were mixed with 40 μl of polyjet and then added to the 293T cells. Forty-eight hours after transfection, the cell supernatant was collected, filtered through a 0.45 μm filter, and frozen. This yielded a lentivirus containing the nucleotide sequence SEQ ID NO: 1 in the sequence listing.

[0042] (3) Identification of positive cells:

[0043] A new type of CAF was obtained by transfecting a vector containing the nucleotide sequence SEQ ID NO: 1 (as listed in the sequence listing) into CAF cells using lentivirus, followed by puromycin screening, which yielded CAFs that carried an additional sequence SEQ ID NO: 1 on their chromosomes. The specific method for constructing the new CAF cells is as follows:

[0044] 1) Infect CAF cells with lentivirus containing the pCDH vector of SEQ ID NO: 1 at an MOI of 1:50;

[0045] 2) Three days later, new CAFs were obtained by screening with 1ug / ml puromycin.

[0046] 3) RNA was extracted from normal CAFs and new CAFs cells according to the RNA extraction reagent instructions, and then reverse transcribed into cDNA using a reverse transcription reagent. The expression levels of relevant genes were then detected using a qPCR kit. The primer design is as follows:

[0047] HSVtk-F: GGAGGACAGACACATCGACCG,

[0048] HSVtk-R: GCAGATACCGCACCGTATTGGC;

[0049] GAPDH-F:TGTGGGCATCAATGGATTTGG,

[0050] GAPDH-R:ACACCATGTATTCCGGGTCAAT.

[0051] Application 2 -△△Ct The method calculates the relative expression level of genes.

[0052] This invention discloses a novel CAF cell, whose morphology, observed under a microscope, is not significantly different from other CAFs. Furthermore, qPCR analysis clearly shows that the transcriptional expression level of the HSVtk gene in this novel CAF cell is significantly increased. Figure 1 (4) GCV effectively induces the death of new CAFs.

[0053] 3000 new CAF cells were seeded into 96-well plates. On the second day, 0, 1, 50, and 100 μM GCV were added, respectively. Cell viability was assessed using CCK-8 and crystal violet assays on the third day. 1 μM, 10 μM, and 100 μM GCV effectively induced CAF-HSVtk cell death. However, treatment of normal CAF cells with the same concentration of GCV did not significantly change the cell number compared to the control group. Figure 2 ).

[0054] Example 2: Application of novel CAFs in a co-cultured tumor cell model.

[0055] 500, 1000, or 2000 new CAFs were mixed with 1000 HSC-3-Luciferase cells, respectively, and evenly seeded into 12-well plates. The next day, 100 μM GCV was added to the GCV group to induce CAF death. After 6 days of GCV treatment in the drug-treated groups, cells were lysed using a luciferase reporter gene assay, and fluorescence signals were read using a microplate reader. Co-culturing new CAFs with tumor cells, ganciclovir induced the death of new tumor-associated fibroblasts, weakening the tumor cell proliferation-promoting ability of CAFs, thus clarifying the role of CAFs in the proliferation of co-cultured tumor cells. Figure 3 ).

[0056] Example 3: Application of novel CAFs in a tumor migration model.

[0057] Adjust the normal CAFs or the new CAFs to 2.5*10. 4 / ml, add 200μl of cell suspension to the lower chamber of a 24-well plate, treat the cells in the lower chamber with GCV for 6 days, and then seed 5*10 cells in the upper chamber. 4 HSC-3 cells were cultured in an incubator for 24 hours, then removed from the chambers, fixed with methanol, stained with crystal violet, and three fields of view were randomly photographed and analyzed under a microscope. Ganciclovir can induce the death of new tumor-associated fibroblasts, weakening the tumor cell migration-promoting ability of CAFs. The role of tumor-associated fibroblasts in the migration of co-cultured tumor cells was clarified. Figure 4 )

[0058] This invention provides tumor-associated fibroblasts that can be targeted and induced to die, and a method for constructing the same. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. The application of tumor-associated fibroblasts that can be targeted and induced to die in studying the function of different subtypes of tumor-associated fibroblasts, characterized in that, The tumor-associated fibroblast chromosome carries a polynucleotide fragment such as SEQ ID No:1, which is constructed by the following steps: (1) Constructing a plasmid expressing the SEQ ID NO:1 polynucleotide fragment under the regulation of the CMV promoter: Based on the pCDH plasmid vector, after being digested by Xba I and BamH I restriction endonucleases, the vector is ligated with the polynucleotide fragment containing SEQ ID NO:1 to obtain a ligation vector, which is then transformed into Stbl3 glycerol bacteria. The resulting clone is sequenced and identified to obtain a plasmid expressing the SEQ ID NO:1 polynucleotide fragment under the regulation of the CMV promoter; the sense strand of the polynucleotide fragment containing SEQ ID NO:1 is the sequence of the polynucleotide fragment with CTAGA added to the 5' end and G added to the 3' end, and the antisense strand is the sequence of the polynucleotide fragment with GATCC added to the 5' end and T added to the 3' end, and the ligation vector is obtained; (2) The plasmid obtained in step (1) was mixed with the packaging plasmid and transfection reagent and transfected into 293T cells to obtain a lentivirus containing a plasmid expressing the SEQ ID NO:1 polynucleotide fragment regulated by the CMV promoter. Then, using tumor-associated fibroblasts as the starting cells, the lentivirus was used to transfect the constructed plasmid into tumor-associated fibroblasts. (3) After screening the tumor-associated fibroblasts obtained in step (2) with 1 μg / ml puromycin, they were observed by fluorescence microscopy and identified by Q-PCR. The tumor-associated fibroblasts have morphology and in vitro growth rate comparable to other tumor-associated fibroblasts; when co-cultured with other tumor-associated fibroblasts, the tumor-associated fibroblasts can be specifically induced to die by a drug, namely ganciclovir, with a concentration range of 1-100 μM. In application, a co-culture tumor cell proliferation model is constructed by co-culturing the tumor-associated fibroblasts with other tumor cells. The tumor-associated fibroblasts and tumor cells are co-cultured at a volume ratio of 1:0.5~2, and then treated with ganciclovir. The effect of tumor-associated fibroblasts on the proliferation of co-cultured tumor cells is observed. The concentration of ganciclovir ranges from 1 to 100 μM. Ganciclovir can induce the death of new tumor-associated fibroblasts, weakening the effect of tumor-associated fibroblasts on the migration of co-cultured tumor cells, thus clarifying the role of tumor-associated fibroblasts in the migration of co-cultured tumor cells.

Citation Information

Patent Citations

  • 3D co-culture model based on tumor cell and tumor-associated fibroblast

    CN108060132A