Multivalent subunit vaccine for avian cholera, polyvalent vaccine and preparation method and application thereof
By preparing a multivalent subunit vaccine for fowl cholera containing L1-plpE and L3-plpE proteins, the problems of poor cross-protection and safety of existing vaccines have been solved, achieving effective protection against both types of pathogens and efficient antibody production, making it suitable for large-scale production.
Patent Information
- Application Number
- CN202211127998.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-16
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2042-09-16
AI Technical Summary
Existing fowl cholera vaccines have the risks of poor cross-protection, causing inflammatory reactions and virulence reversion, and cannot effectively prevent fowl cholera caused by A:L1 and A:L3 fowl pasteurellosis.
Develop a multivalent subunit vaccine for fowl cholera containing L1-plpE and L3-plpE proteins and an adjuvant. Express and purify the recombinant protein efficiently through genetic engineering to prepare a multivalent vaccine to simultaneously prevent two types of pathogens. Use oil adjuvant and aluminum gel adjuvant to improve the immunization effect.
It achieves complete protection against A:L1 and A:L3 avian Pasteurella multocida, with no interference after immunization, strong antibody production capacity, reduced endotoxin content and lower production costs, and is suitable for large-scale production.
Smart Images

Figure CN116059334B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of poultry vaccine preparation technology, specifically relating to a multivalent subunit vaccine for fowl cholera, a combination vaccine, its preparation method, and its application. Background Technology
[0002] Pasteurella multocida is a Gram-negative bacterium that can cause disease in a variety of animals. In poultry, the disease it causes is known as fowl cholera or fowl pasteurellosis. Based on the composition of its capsule, Pasteurella multocida can be classified into five serotypes (A, B, D, E, and F) and eight genotypes (L1-L8) based on the lipopolysaccharide gene. In my country, the A:L1 serotype is the primary cause of fowl cholera, followed by the A:L3 serotype.
[0003] Fowl cholera is a highly contagious, contagious disease of poultry and wild birds caused by Pasteurella multocida. It has been reported in many parts of my country and often causes significant economic losses. Currently, the main preventative measure for fowl cholera is vaccination. Two main types of vaccines are available on the market: whole-cell inactivated vaccines and live attenuated vaccines. Whole-cell inactivated vaccines offer no cross-protection; to achieve good protection against the same strain, a large number of inactivated bacteria must be added. Due to the inherent endotoxins in Gram-negative bacteria, vaccination can cause excessive inflammatory responses, often leading to post-immunization stress and poor absorption at the injection site, thus affecting farming efficiency. Live attenuated vaccines carry the risk of virulence reversion and are often unacceptable to farmers. Currently, all vaccines sold in China are for the A:L1 serotype and cannot protect against Pasteurella multocida A:L3 serotypes. In actual breeding practices, Pasteurella multocida A:L3 is also a common bacterium that easily causes fowl cholera. In order to immunize against both Pasteurella multocida A:L1 and Pasteurella multocida A:L3 at the same time, our company has specially developed a multivalent subunit vaccine for fowl cholera that can effectively prevent both Pasteurella multocida A:L1 and Pasteurella multocida A:L3. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a method for preparing a multivalent subunit vaccine and a combination vaccine for fowl cholera, as well as their applications.
[0005] A multivalent subunit vaccine for fowl cholera, comprising L1-plpE protein, L3-plpE protein, and a veterinary-acceptable adjuvant; wherein the amino acid sequence of the L1-plpE protein is SEQ ID NO.3; and the amino acid sequence of the L3-plpE protein is SEQ ID NO.4.
[0006] Preferably, the nucleotide sequence of the gene encoding the L1-plpE protein is SEQ ID NO.1; and the nucleotide sequence of the gene encoding the L3-plpE protein is SEQ ID NO.2.
[0007] A recombinant vector for expressing L1-plpE protein, the recombinant vector comprising the encoding gene of L1-plpE protein as described in claim 1.
[0008] Preferably, the nucleotide sequence of the gene encoding the L1-plpE protein is SEQ ID NO.1.
[0009] A recombinant vector for expressing L3-plpE protein, the recombinant vector comprising the encoding gene of L3-plpE protein as described in claim 1.
[0010] Preferably, the nucleotide sequence of the gene encoding the L3-plpE protein is SEQ ID NO.2.
[0011] Preferably, the adjuvant includes oil adjuvant, aluminum gel adjuvant, water adjuvant, and cytokine adjuvant.
[0012] Preferably, the adjuvant is an oil adjuvant.
[0013] A host cell obtained by transforming a recipient cell with a recombinant vector for expressing L1-plpE protein and a recombinant vector for expressing L3-plpE protein.
[0014] A multivalent vaccine comprising L1-plpE protein, L3-plpE protein and veterinary-acceptable adjuvant, and further comprising one or more pathogen antigens.
[0015] Preferably, the pathogen antigens include Newcastle disease virus antigen, avian influenza virus antigen, infectious bronchitis virus antigen, infectious bursal disease virus antigen, egg drop syndrome virus antigen, avian reovirus antigen, avian adenovirus antigen, Marek's disease virus antigen, avian encephalomyelitis virus antigen, chicken infectious anemia virus antigen, chicken infectious laryngotracheitis virus antigen, mycoplasma synoviae antigen, mycoplasma gallisepticum antigen, Escherichia coli antigen, avian paragalactiae antigen, or Salmonella antigen.
[0016] The use of the above-mentioned vaccine composition in the preparation of drugs for the prevention and / or treatment of fowl cholera caused by Pasteurella multocida A:L1 and Pasteurella multocida A:L3.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] The fowl cholera multivalent subunit vaccine provided by this invention has a protective effect against both A:L1 and A:L3 fowl cholera bacteria. When the content of recombinant protein L1-plpE and recombinant protein L3-plpE in the vaccine both reach 25 μg / mL, it can completely protect against challenge with lethal doses of A:L1 and A:L3 fowl cholera bacteria. Furthermore, the fowl cholera bacteria and Newcastle disease strain La... of this invention... Lasota bivalent inactivated vaccine also has good protective ability against avian Pasteurella multocida A:L1 and A:L3 strains. When the content of recombinant protein L1-plpE and recombinant protein L3-plpE in the Lasota bivalent inactivated vaccine for avian Pasteurella multocida and Newcastle disease reaches 25 μg / mL, it can also achieve 100% protection against avian Pasteurella multocida A:L1 and A:L3 strains.
[0019] Furthermore, in the fowl cholera multivalent subunit vaccine prepared in this application, there is no immune interference between recombinant protein L1-plpE and recombinant protein L3-plpE. Moreover, it has a better antibody production capacity than vaccines that only have a single recombinant protein L1-plpE or recombinant protein L2-plpE as antigens. In the multivalent vaccine prepared in this application, the Newcastle disease Lasota antigen has no adverse effect on the antibody levels of recombinant protein L1-plpE or recombinant protein L2-plpE. A single immunization can prevent two diseases at the same time.
[0020] Furthermore, this invention also provides a method for preparing the vaccine. This invention utilizes genetic engineering to efficiently express the protein antigen exogenously in *E. coli*, purifying the protein antigen to obtain high purity and low endotoxin content. The purity of the recombinant protein L1-plpE prepared in this application is 70%, and the purity of the recombinant protein L3-plpE is 62%. Endotoxin detection in the obtained recombinant protein L1-plpE and recombinant protein L3-plpE solutions revealed that the endotoxin content in both solutions was between 25-250 EU / mL. Compared to traditional chromatography methods, this method is simpler to operate, significantly reduces costs, and is suitable for large-scale production.
[0021] Furthermore, this application uses full-length gene expression when constructing the recombinant protein. This method preserves the complete linearized antigenic epitopes of the protein, and its protein structure is more similar to that of the natural protein. In addition to the linearized antigenic epitopes, it is more likely to provide structural epitopes of the protein antigen, so that the antibodies produced after immunization can more easily bind to the natural bacterial protein, thereby killing the bacteria. Attached Figure Description
[0022] Figure 1 The image shows an agarose gel electrophoresis diagram of the PCR amplification product of the plpE gene; in the diagram, M: DL2000 DNA Maker, 1: negative control, 2: *Pasteurella multocida* A: L1 type plpE gene amplification product, 3: *Pasteurella multocida* A: L3 type plpE gene amplification product.
[0023] Figure 2 SDS-PAGE images for identifying BL21-L1-plpE and BL21-L3-plpE induced expression; In the images, M: protein marker, 1: BL21-L1-plpE cell supernatant after induction, 2: BL21-L1-plpE precipitate resuspended, 3: BL21-L3-plpE cell supernatant after induction, and 4: BL21-L3-plpE precipitate resuspended.
[0024] Figure 3 SDS-PAGE images of induced empty plasmid bacteria and uninduced recombinant expression strains BL21-L1-plpE and BL21-L3-plpE are shown. In the figures, M: protein marker, 1: induced empty plasmid bacteria, 2: uninduced recombinant expression strain—BL21-L1-plpE obtained in step 2.1, and 3: uninduced recombinant expression strain—BL21-L3-plpE obtained in step 2.1.
[0025] Figure 4 SDS-PAGE images of recombinant protein L1-plpE solution and recombinant protein L3-plpE solution; in the figure, M: protein marker, 1: recombinant protein L1-plpE solution obtained in step 3.1, 2: recombinant protein L3-plpE solution obtained in step 3.1. Detailed Implementation
[0026] The following examples illustrate preferred embodiments of the present invention. However, it should be understood that these embodiments are provided for illustrative purposes only and not for limiting the overall scope of the invention. The methods applied in this invention can employ methods commonly used in the field of vaccine preparation, and are not limited to the specific descriptions in the embodiments of this invention. Those skilled in the art can implement this invention using other conventional methods.
[0027] I. Construction of recombinant plasmids for the L1-plpE and L3-plpE genes of Pasteurella multocida in avian birds
[0028] 1.1 Primer Design
[0029] Based on the plpE gene sequence of Pasteurella multocida A:L1 (GenBank: GU108958.1) and the plpE gene sequence of Pasteurella multocida A:L3 (GenBank: EF219456.1), SignalP was used to predict gene signal peptides, and sequences with the signal peptide removed were selected as pre-expressed gene fragments.
[0030] Based on the pre-expressed gene fragment, a pair of universal primers were designed using Primer 5.0 software. BamH I and Xho I restriction sites and protective bases were introduced at the upstream and downstream 5' ends of the *Pasteurella multocida* A:L1 and A:L3 plpE genes, respectively, to facilitate subsequent amplification of the *Pasteurella multocida* A:L1 and A:L3 plpE gene sequences. The expected gene sequences for *Pasteurella multocida* A:L1 plpE are 951 bp, and for A:L3 plpE are 948 bp. Primer sequences are shown in Table 1. The upstream primer (plpE-F) is SEQ ID NO. 5, and the downstream primer (plpE-R) is SEQ ID NO. 6. Both primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0031] Table 1 Primer Sequences
[0032] Gene Upstream primer (plpE-F) Downstream primer (plpE-R) plpE <![CDATA[CG GGATCC tgtagcggtggggcggt]]> <![CDATA[CCG CTCGAG TTATTGTGCTTGGTGACTTT]]>
[0033] 1.2 Extraction of genomic DNA from Pasteurella multocida in avian birds
[0034] Avian Pasteurella multocida A:L1 type C48-1 strain (purchased from the China Institute of Veterinary Drug Control, No. CVCC44801) and avian Pasteurella multocida A:L3 type P-1662 strain (purchased from the China Institute of Veterinary Drug Control, No. CVCC413) strains were streaked onto modified Martin agar plates and incubated at 37°C for 24 h. Then, a small amount of bacterial growth was scraped off and genomic DNA of avian Pasteurella multocida A:L1 type C48-1 strain and avian Pasteurella multocida A:L3 type P-1662 strain were extracted using a kit.
[0035] 1.3 PCR amplification of the plpE gene
[0036] The genomic DNA of *Pasteurella multocida* strain A:L1 C48-1 and strain A:L3 P-1662 extracted in step 1.2 were amplified by PCR to obtain the amplified products of the *Pasteurella multocida* A:L1 and A:L3 plpE genes, respectively.
[0037] The PCR reaction system consisted of: 25 μL of 2×buffer, 1 μL of high-fidelity enzyme, 1 μL of dNTP, 1 μL of plpE-F (20 μM), 1 μL of plpE-R (20 μM), 2 μL of template genome (i.e., genomic DNA of avian Pasteurella multocida A:L1 strain C48-1 and avian Pasteurella multocida A:L3 strain P-1662 extracted in step 1.2), and then made up to 50 μL with ultrapure water.
[0038] The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 1 min, 72℃ extension for 60 s, for a total of 30 cycles; 72℃ extension for 10 min. Subsequently, the amplified products of the *Pasteurella multocida* A:L1 type plpE gene and the amplified products of the *Pasteurella multocida* A:L3 type plpE gene were detected by 1% gel electrophoresis. The results are shown below. Figure 1 As shown.
[0039] 1.4 Construction of recombinant vectors (i.e., construction of L1-plpE gene recombinant plasmid and L3-plpE gene recombinant plasmid)
[0040] The PCR products obtained in step 1.3 (i.e., the amplified products of the plpE gene of Pasteurella multocida A:L1 and the amplified products of the plpE gene of Pasteurella multocida A:L3) were extracted using a gel extraction kit to obtain the plpE gene of Pasteurella multocida A:L1 and the plpE gene of Pasteurella multocida A:L3.
[0041] The plpE gene of *Pasteurella multocida* A:L1 type and the plpE gene of *Pasteurella multocida* A:L3 type, as well as the pET-28a-sumo plasmid vector (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., in this application, the pET-28a-sumo plasmid vector is a specific basic expression vector), were obtained. Then, they were digested with 40 μL of enzyme digestion system, and the three digestion products were then recovered by gel extraction to obtain the *Pasteurella multocida* A:L1 type plpE gene fragment, the *Pasteurella multocida* A:L3 type plpE gene fragment, and the pET-28a-sμMo plasmid vector fragment. The 40 μL enzyme digestion system is as follows: 33 μL of the digested material, 1.5 μL of BamHI, 1.5 μL of XhoHI, and 4 μL of 10×K buffer; the digestion conditions are: 37℃ for 3 h to obtain the digestion products. The digested material refers to the PCR product and the pET-28a-sumo plasmid vector. The PCR product refers to the amplified products of the plpE gene of *Pasteurella multocida* A:L1 and the plpE gene of *Pasteurella multocida* A:L3.
[0042] Then, the *Pasteurella multocida* A:L1 type plpE gene fragment and the *Pasteurella multocida* A:L3 type plpE gene fragment were ligated with the pET-28a-sumo plasmid vector fragment overnight at 16°C using T4 ligase, yielding overnight ligation products of the *Pasteurella multocida* A:L1 type plpE gene and the *Pasteurella multocida* A:L3 type plpE gene. The molar ratio of the *Pasteurella multocida* A:L1 type plpE gene fragment to the pET-28a-sumo plasmid vector fragment was 3:1; the molar ratio of the *Pasteurella multocida* A:L3 type plpE gene fragment to the pET-28a-sumo plasmid vector fragment was 3:1.
[0043] Then, 5 μL of the overnight ligation products of the *Pasteurella multocida* A:L1 type plpE gene and the *Pasteurella multocida* A:L3 type plpE gene were added to 50 μL of DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and gently mixed. The cells were then placed on ice for 30 min, heat-shocked at 42℃ for 60 s, and incubated on ice for 2 min. 500 μL of LB medium was then added, and the cells were cultured in a shaker at 37℃ for 1 h. Finally, 100 μL of the bacterial culture was added to LB agar medium containing 50 μg / mL kanamycin and cultured overnight at 37℃ to obtain pET-L1-plpE and pET-L3-plpE target colonies.
[0044] 1.5 Identification of L1-plpE and L3-plpE recombinant plasmids
[0045] Pick 2-3 target colonies of pET-L1-plpE and pET-L3-plpE respectively, and transfer them to culture medium containing the corresponding antibiotics. When the bacterial culture becomes turbid, perform bacterial culture PCR identification using the primers for amplifying the target gene (i.e., upstream and downstream primers). Send 0.5 mL of the positive bacterial culture to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The recombinant plasmids with correct sequences identified by sequencing are named pET-L1-plpE recombinant plasmid and pET-L3-plpE recombinant plasmid, respectively.
[0046] II. Construction of strains expressing L1-plpE and L3-plpE proteins of Pasteurella multocida in avian birds
[0047] 2.1 Transformation of recombinant plasmid into BL21(DE3) strain
[0048] Take the pET-L1-plpE recombinant plasmid and pET-L3-plpE recombinant plasmid with correct sequencing sequences identified in step 1.5), respectively, and transform them into BL21(DE3) strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The transformation method is the same as in step 1.4), and recombinant expression strains BL21-L1-plpE and BL21-L3-plpE are obtained respectively.
[0049] 2.2 Identification of positive expression strains
[0050] PCR identification: Colonies of the recombinant expression strain BL21-L1-plpE and the recombinant expression strain BL21-L3-plpE prepared in step 2.1 were picked and shaken, and then bacterial PCR identification was performed. The PCR reaction system and reaction procedure were the same as those in step 1.3, and the bacterial PCR identification was the same as those in step 1.5.
[0051] Induced Expression Identification: Take the BL21-L1-plpE and BL21-L3-plpE bacterial suspensions that were positive for PCR identification in step 2.2, and transfer them to 200 mL of LB medium containing 50 μg / mL kanamycin. When the bacterial suspensions grow to the OD value... 600 When the concentration was 0.4-0.6, 0.1 mM IPTG solution was added to induce the cells at 37℃ for 4-6 h. The cells were then collected by centrifugation to obtain the induced BL21-L1-plpE expression strain and BL21-L3-plpE expression strain. Then, the induced BL21-L1-plpE cells and the induced BL21-L3-plpE cells were resuspended in 20 mL of purified water, respectively. After ultrasonic lysis, they were centrifuged at 12000 rpm for 30 min. Then, all the supernatant and precipitate of the induced BL21-L1-plpE cells and the induced BL21-L3-plpE cells were collected. The precipitates of the induced BL21-L1-plpE cells and the induced BL21-L3-plpE cells were then resuspended in 20 mL of purified water to obtain BL21-L1-plpE precipitate resuspension and BL21-L3-plpE precipitate resuspension, respectively.
[0052] Then, 40 μL each of the induced BL21-L1-plpE cell supernatant and BL21-L1-plpE precipitate resuspension, and the induced BL21-L3-plpE cell supernatant and BL21-L3-plpE precipitate resuspension were added to 10 μL of 5×SDS Loading Buffer, mixed thoroughly, and boiled in boiling water for 5-10 min. SDS-PAGE electrophoresis was then performed. The SDS-PAGE electrophoresis results are shown below. Figure 2 As shown.
[0053] from Figure 2 As can be seen, both the induced BL21-L1-plpE and BL21-L3-plpE expression strains showed bands around 50 kDa, which is basically consistent with the expected protein size. Moreover, the expression products were found in the supernatant after lysis, indicating that they were soluble expression products.
[0054] In addition, this application also induced the expression of the empty plasmid bacteria, using the same induction method as the positive expression strain in step 2.2. Subsequently, SDS-PAGE electrophoresis was performed on both the uninduced recombinant expression strains (i.e., the recombinant expression strains BL21-L1-plpE and BL21-L3-plpE obtained in step 2.1) and the induced empty plasmid bacteria. The test results are as follows: Figure 3 As shown, from Figure 3 As can be seen, neither the uninduced recombinant expression strain nor the induced empty plasmid strain showed the target band.
[0055] III. Purification of recombinant proteins L1-plpE and L3-plpE
[0056] 3.1 Purification of recombinant proteins L1-plpE and L3-plpE
[0057] Based on the sensitivity of L1-plpE and L3-plpE proteins to salt ion concentration, the purification method was optimized, as follows:
[0058] Take 500 mL each of the induced expression BL21-L1-plpE and BL21-L3-plpE bacterial cultures obtained after induction at 37℃ for 4-6 h in step 2.2, centrifuge to collect the bacterial cells, and then resuspend them in 50 mL of purified water. After ultrasonic lysis, centrifuge at 12000 rpm for 10 min, and then collect all the supernatant. Add 0.8% (M / V) sodium chloride. At this time, the protein solution becomes turbid, and both L1-plpE and L3-plpE proteins precipitate. Then centrifuge at 12000 rpm for 10 min, collect all the precipitates, and then dissolve them in purified water to obtain the preliminary purified protein solutions (i.e., preliminary purified L1-plpE protein solution and preliminary purified L3-plpE protein solution).
[0059] Then, 1% (V / V) of Triton X-114 was added to each of the preliminary purified protein solutions (i.e., L1-plpE preliminary purified protein solution and L3-plpE preliminary purified protein solution), and the solutions were thoroughly mixed and incubated at 4°C for 2 hours. After that, the solutions were warmed to 30°C and centrifuged at 12000 rpm for 10 minutes. The supernatant was collected and this process was repeated three times to obtain the secondary purified protein solutions (i.e., L1-plpE secondary purified protein solution and L3-plpE secondary purified protein solution). The secondary purified protein solutions (i.e., L1-plpE secondary purified protein solution and L3-plpE secondary purified protein solution) were then filtered through a 0.22 μm filter to remove bacteria, resulting in recombinant protein L1-plpE solution and recombinant protein L3-plpE solution.
[0060] 3.2 Quantitative analysis of recombinant proteins L1-plpE and L3-plpE
[0061] The recombinant protein L1-plpE solution and recombinant protein L3-plpE solution obtained in step 3.1 were subjected to SDS-PAGE analysis, and the purity of the recombinant protein was analyzed using TanonGIS software. The analysis results are as follows: Figure 4 As shown, from Figure 4 It can be seen that the purity of recombinant protein L1-plpE (i.e., L1-plpE protein) is 70%, and the purity of recombinant protein L3-plpE (i.e., L3-plpE protein) is 62%, both of which have a purity of over 60%.
[0062] In addition, this application also used a BCA kit to determine the protein concentration. The concentration of the recombinant protein L1-plpE secondary purification solution was 1.5 mg / mL, and the concentration of the recombinant protein L3-plpE secondary purification solution was 2.4 mg / mL. Analysis showed that the L1-plpE protein concentration in the recombinant protein L1-plpE solution was 1.05 mg / mL, and the L3-plpE protein concentration in the recombinant protein L3-plpE solution was 1.49 mg / mL.
[0063] 3.3 Endotoxin assay of recombinant proteins L1-plpE and L3-plpE
[0064] Take the recombinant protein L1-plpE solution and recombinant protein L3-plpE solution obtained in step 3.1 respectively, and use the endotoxin detection kit (gel method) to determine their endotoxin content. The endotoxin content is between 25-250 EU / mL.
[0065] IV. Preparation and efficacy testing of fowl cholera multivalent subunit vaccine
[0066] 4.1 Preparation of multivalent subunit vaccine for fowl cholera
[0067] A recombinant protein L1-plpE solution, recombinant protein L3-plpE solution, Tween-80, and PBS buffer were mixed in a volume ratio of (1-10): (1-10): (1-6.5): (20-30) to prepare an aqueous phase. This aqueous phase was then emulsified with imported white oil in a volume ratio of (1-2): (2-4) to prepare fowl cholera multivalent subunit vaccines with different antigen contents. Furthermore, to compare the immunogenicity of the bivalent fowl cholera subunit vaccine with vaccines containing only recombinant protein L1-plpE or recombinant protein L2-plpE as antigens, this application also specifically prepared vaccines 1-4. Vaccines 1-4 were used as a comparison for the bivalent fowl cholera subunit vaccines, i.e., vaccines 5-6. The different antigenic components in vaccines 1-6 are shown in Table 2.
[0068] Table 2. Antigen components and their contents in different vaccines
[0069]
[0070] 4.2 Testing of multivalent subunit fowl cholera vaccine
[0071] 4.2.1 Safety Inspection
[0072] Seventy 4-week-old SPF chickens were divided into 7 groups of 10 chickens each. Six groups were injected with the fowl cholera multivalent subunit vaccines 1-6 prepared in step four as immunization groups, while the other group served as the control group. Each immunized group received a subcutaneous injection of 1.0 mL of vaccine per chicken in the neck and was observed for 14 consecutive days. Results showed that no adverse reactions were observed in the SPF chickens immunized with vaccines 1-6 during the 14-day observation period. The chickens maintained good mental condition, normal feed and water intake, and no deaths occurred. Autopsy after 14 days revealed some vaccine residue at the injection site, but no induration, abscess, or ulceration was observed. This demonstrates that the fowl cholera multivalent subunit vaccine prepared in this application has good safety for SPF chickens.
[0073] 4.2.2 Validity Verification
[0074] 4.2.2.1 Virus challenge protection test
[0075] Ten 4-week-old SPF chickens were divided into 10 groups of 10 birds each, and immunized with the fowl cholera multivalent subunit vaccine prepared in Example 4. Group 1 was immunized with vaccine 1, Group 2 with vaccine 2, Group 3 with vaccine 3, Group 4 with vaccine 4, Groups 5-6 with vaccine 5, Groups 7-8 with vaccine 6, and Groups 9-10 served as the control group and were not immunized. All immunized groups received 0.5 mL of vaccine subcutaneously in the neck, and were challenged 21 days post-immunization. Groups 1, 2, 5, 7, and 9 received an intramuscular injection of strain A: L1 Pasteurella multocida C48-1, 10 CFU / bird, in the leg; Groups 3, 4, 6, 8, and 10 received an intramuscular injection of strain A: L3 Pasteurella multocida P-1662, 5 × 10⁻⁶ CFU / bird, in the leg. 9 CFU / feather. Animals were observed for 14 consecutive days after challenge, and morbidity and mortality were recorded. The results of protection against challenge are shown in Table 4. The results showed that vaccines 1, 5, and 6 provided 100% protection against A:L1 avian Pasteurella multocida C48-1 strain, while vaccine 2 provided 60% protection. Against A:L3 avian Pasteurella multocida P-1662 strain, vaccines 3, 5, and 6 provided 100% protection, while vaccine 4 provided 50% protection.
[0076] Therefore, the fowl cholera multivalent subunit vaccine provided by this invention has a protective effect against both A:L1 and A:L3 fowl cholera bacteria. In particular, vaccines 5 and 6 can completely protect against challenge with lethal doses of A:L1 and A:L3 fowl cholera bacteria. Furthermore, vaccine 6 can still completely protect against challenge with lethal doses of A:L1 and A:L3 fowl cholera bacteria even when the antigen content is half of the effective antigen content.
[0077] Table 3. Results of protection against challenge with fowl cholera multivalent subunit vaccine.
[0078]
[0079] 4.2.2.2 Antibody testing
[0080] Animals from groups 1, 2, 3, 4, 5, 7, and 9 in section 4.2.2.1 were sampled, and blood was collected from the wing veins of all animals 21 days after immunization. Serum was then separated for antibody level determination.
[0081] Antibody levels were determined using an indirect ELISA method. Specifically, the recombinant protein L1-plpE and recombinant protein L3-plpE solutions prepared in section 3.2 were used to coat the microplate with 5 μg / well of either L1-plpE or L3-plpE protein. Blocking was performed overnight at 4°C using 5% bovine serum albumin blocking buffer. The serum to be tested was diluted 100-fold and added to the microplate at 100 μL / well. The plate was incubated at 37°C for 1 hour. Rabbit anti-chicken IgG-HRP was used as the secondary antibody, and OD was detected via TMB substrate visualization. 450 The levels of anti-L1-plpE protein antibodies in the serum of animals in groups 1, 2, 5, 7, and 9 were measured using ELISA plates coated with L1-plpE protein. The levels of anti-L3-plpE protein antibodies in the serum of animals in groups 3, 4, 5, 7, and 9 were measured using ELISA plates coated with L3-plpE protein. The results are shown in Table 4.
[0082] Table 4 shows that in Group 1, which was immunized with vaccine 1 (containing only recombinant protein L1-plpE, with a component concentration of 50 μg / mL in vaccine 1), the OD of L1-plpE antibodies produced in the serum of the animals was... 450 It is 1.045 ± 0.088 b The OD of L3-plpE antibodies produced in the serum of the third group of animals immunized with vaccine 3 (containing only recombinant protein L3-plpE, with a component concentration of 50 μg / mL in vaccine 3) was... 450 It is 1.158 ± 0.128 b The fifth group of animals immunized with vaccine 5 (containing recombinant proteins L1-plpE and L3-plpE, with each component of vaccine 5 containing recombinant proteins L1-plpE at a concentration of 50 μg / mL) showed that the OD of L1-plpE antibodies produced in the serum of these animals was [not specified]. 450 It is 1.225 ± 0.107 a (Greater than the OD of the first group of L1-plpE antibodies) 450 —1.045±0.088 b ), OD of L3-plpE antibody produced in the serum of the fifth group of animals 450 1.359±0.151 a (Greater than the OD of the L3-plpE antibody in the third group) 450 —1.158±0.128 b );
[0083] Similarly, in the second group of animals immunized with vaccine 2 (containing only recombinant protein L1-plpE, and the concentration of recombinant protein L1-plpE in vaccine 1 was 25 μg / mL), the OD of L1-plpE antibodies produced in the serum of the animals was...450 It is 0.724 ± 0.152 c The fourth group of animals immunized with vaccine 4 (containing only recombinant protein L3-plpE, with a component concentration of 25 μg / mL in vaccine 3) showed that the OD of L3-plpE antibodies produced in the serum of these animals was... 450 It is 0.713±0.208 c The seventh group, immunized with vaccine 6 (containing recombinant proteins L1-plpE and L3-plpE, with both L1-plpE and L3-plpE having a component concentration of 25 μg / mL in vaccine 5), showed that the OD of L1-plpE antibodies produced in the serum of the animals was... 450 It is 1.007 ± 0.096 b (Greater than the second group's 0.724±0.152) c ), the OD of the L3-plpE antibody produced 450 It is 1.019 ± 0.123 b (Greater than 0.713±0.208 in the fourth group) c ).
[0084] In summary, the multivalent fowl cholera vaccine containing both recombinant proteins L1-plpE and L3-plpE exhibits superior expression levels of L1-plpE and L3-plpE antibodies compared to vaccines containing only recombinant proteins L1-plpE or L3-plpE at the same antigen concentration. This demonstrates that the recombinant proteins L1-plpE and L3-plpE in the bivalent vaccine prepared in this application not only do not interfere with each other during immunization but also enhance each other's immune effects.
[0085] Table 4. Antibody Level Measurement Results
[0086]
[0087] (1) Data are mean ± standard deviation; (2) Different lowercase letters on the superscript indicate significant differences (P<0.05), and the same letter indicates no significant differences (P>0.05).
[0088] V. Preparation and efficacy testing of a bivalent inactivated vaccine against Pasteurella multocida and Newcastle disease (Lasota).
[0089] 5.1 Preparation of Newcastle disease Lasota strain antigen
[0090] Newcastle disease strain Lasota (purchased from the China Institute of Veterinary Drug Control, product number CVCC AV1615) was diluted 10,000 times with sterile physiological saline. 0.1 mL / embryo was inoculated into the allantoic cavity of 20 10-day-old SPF chicken embryos. After sealing with wax, the embryos were incubated at 37°C. Embryos that died at 96-120 hours and live embryos at 120 hours were removed. After cooling for 12-18 hours, the embryo fluid was collected and mixed thoroughly. The HA and EID50 of the Newcastle disease antigen were measured to be 9.5 / 0.1 mL and 10, respectively. -6.6 / 0.1mL. Then, the chicken embryo fluid with good titer was added to formaldehyde at a final concentration of 0.1%, mixed thoroughly, and inactivated at 37℃ for 16h to obtain Newcastle disease Lasota strain antigen.
[0091] 5.2 Preparation of a bivalent inactivated vaccine against Pasteurella multocida and Newcastle disease (Lasota)
[0092] A bivalent inactivated vaccine against Pasteurella multocida and Newcastle disease Lasota was prepared using the recombinant protein L1-plpE solution and recombinant protein L3-plpE solution prepared in step 3.1 and the Newcastle disease Lasota strain antigen prepared in step 5.1. The preparation method of vaccine 7 is as follows: The recombinant protein L1-plpE solution, recombinant protein L3-plpE solution, Newcastle disease Lasota strain antigen, Tween-80, and PBS buffer solution were mixed in a volume ratio of (1-10): (1-10): (20-35): (1-6): (20-30) to prepare an aqueous phase. Then, the aqueous phase was emulsified with imported white oil in a volume ratio of (1-2): (2-4) to prepare the bivalent inactivated vaccine against Pasteurella multocida and Newcastle disease Lasota.
[0093] To verify the interference of recombinant proteins L1-plpE and L3-plpE in vaccine 7 on Newcastle disease Lasota antigen immunity, this application specifically prepared vaccine 8. Vaccine 8 does not contain the recombinant protein L1-plpE solution and recombinant protein L3-plpE solution prepared in step 3.1, but only contains Newcastle disease Lasota strain antigen, and the content of Newcastle disease Lasota strain antigen in vaccine 8 is the same as that in vaccine 7. The different antigenic components in vaccine 7 and vaccine 8 are shown in Table 5.
[0094] Table 5. Vaccine antigen components and their content
[0095]
[0096] 5.3.1 Safety Inspection
[0097] Twenty 4-week-old SPF chickens were divided into two groups of 10 each and immunized with the Lasota bivalent inactivated vaccine for Pasteurella multocida and Newcastle disease prepared in step 5.2. Each group received a subcutaneous injection of 1.0 mL of vaccine per chicken in the neck and were observed for 14 consecutive days. Results showed that no adverse reactions were observed in the SPF chickens immunized with the above vaccines after 14 days of observation; the chickens maintained good mental condition, normal feed and water intake, and no deaths occurred. Autopsy after 14 days revealed some vaccine residue at the injection site, but no induration, abscess, or ulceration was observed. This demonstrates that vaccines 7 and 8 prepared in this application have good safety for SPF chickens.
[0098] 5.3.2 Newcastle disease efficacy test
[0099] Thirty 4-week-old SPF chickens were divided into three groups of 10 each. Group 11 was immunized with vaccine 7, group 12 with vaccine 8, and group 13 served as a control group without immunization. The immunized groups received the vaccine prepared in step 5.2, specifically by subcutaneous injection of 0.5 mL / chicken into the neck of each of the 10 SPF chickens in this group. Twenty-one days post-immunization, blood samples were collected from all experimental chickens, serum was separated, and Newcastle disease (Newcastle disease) HI titers were determined. The results are shown in Table 6. The arithmetic mean of the HI antibody titers in chickens immunized with vaccine 7 was 8.5 ± 1.0 log2, the arithmetic mean of the HI antibody titers in chickens immunized with vaccine 8 was 8.2 ± 0.5 log2, and the arithmetic mean of the HI antibody titers in the control chickens was ≤2 log2, meeting the efficacy test criteria. Furthermore, according to national standards, SPF chickens can achieve 100% protection when the HI antibody test result is greater than or equal to 4log2. Clearly, the arithmetic mean of the HI antibody titer in chickens immunized with vaccine 7 prepared in this application is 8.5±1.0 log2, and the arithmetic mean of the HI antibody titer in chickens immunized with vaccine 8 is 8.2±0.5 log2, both significantly greater than 4log2. This indicates that vaccines 7 and 8 prepared in this application have very good immunizing effects on SPF chickens. The HI antibody titers in chickens immunized with vaccines 7 and 8 prepared in this application are close and show no significant difference, indicating that recombinant proteins L1-plpE and L3-plpE do not interfere with the Newcastle disease Lasota antigen.
[0100] Table 6. Results of Newcastle Disease Potency Tests for the Bivalent Inactivated Vaccine Against Pasteurella Malignantsis and Newcastle Disease.
[0101]
[0102] Note: The HI antibody assay is the arithmetic mean of antibodies in immunized chickens, denoted as X±SD, where X represents the mean and SD represents the standard deviation.
[0103] 5.3.3 Efficacy test of Pasteurella multocida in avian birds
[0104] 5.3.3.1 Virus challenge protection test
[0105] Eighty 4-week-old SPF chickens were divided into 8 groups of 10 birds each, and immunized with vaccines 7 and 8 prepared in step 5.2, and vaccine 6 prepared in step 4.1. Groups 14 and 15 were immunized with vaccine 7, groups 16 and 17 with vaccine 6, groups 18 and 19 with vaccine 8, and groups 20 and 21 served as the control group and were not immunized. All immunized groups received 0.5 mL of vaccine subcutaneously in the neck, and were challenged 21 days post-immunization. Groups 14, 16, 18, and 20 received an intramuscular injection of strain A:L1 Pasteurella multocida C48-1, 10 CFU / bird, in the leg; groups 15, 17, 19, and 21 received an intramuscular injection of strain A:L3 Pasteurella multocida P-1662, 5 × 10⁻⁶ CFU / bird, in the leg. 9 CFU / feather. Animals were observed continuously for 14 days after challenge, and morbidity and mortality were recorded. The results of challenge protection are shown in Table 8. The results showed that the avian Pasteurella multocida bivalent inactivated vaccine prepared in step 5.2 of this invention could achieve 100% protection against both A:L1 and A:L3 avian Pasteurella multocida strains. The Newcastle disease Lasota antigen did not adversely interfere with the immunogenicity of the recombinant proteins L1-plpE and L3-plpE prepared in this application.
[0106] Table 8. Results of partial efficacy tests of Pasteurella multocida and Newcastle disease bivalent inactivated vaccines against Pasteurella multocida in avian disease.
[0107]
[0108] 5.3.3.2 Antibody Level Testing
[0109] Animals in groups 14, 16, 18, and 20 of section 5.3.3.1 were sampled, and blood was collected from the wing veins of all animals 21 days after immunization. Serum was then separated for antibody level determination.
[0110] The antibody detection method was consistent with that in 5.2.2.2. Antibody levels against recombinant proteins L1-plpE and L3-plpE were measured in groups 14, 16, 18, and 20, respectively. The results are shown in Table 9. Table 9 shows that after immunization with vaccine 7 (containing 25 μg / mL recombinant protein L1-plpE, 25 μg / mL recombinant protein L3-plpE, and 10% Newcastle disease Lasota antigen by volume), the OD of L1-plpE antibody produced in group 16 was... 450 It is 1.106 ± 0.167 a The OD of the L3-plpE antibody produced 450 It is 1.218 ± 0.113 aAfter immunization with vaccine 6 (containing only 25 μg / mL recombinant protein L1-plpE, 25 μg / mL recombinant protein, and 10% L3-plpE volume percentage Newcastle disease Lasota antigen), the OD of L1-plpE antibodies produced in group 14 was... 450 It is 1.155 ± 0.108 a The OD of the L3-plpE antibody produced 450 It is 1.184 ± 0.113 a Clearly, the antibody production levels of vaccine 7 against A:L1 and A:L3 avian Pasteurella multocida strains are basically the same as those of vaccine 6 against the same strains. This indirectly indicates that the Newcastle disease Lasota antigen in vaccine 7 does not interfere with the immune response to recombinant proteins L1-plpE and L3-plpE in the bivalent vaccine.
[0111] Table 9. Results of Antibody Level Measurement
[0112]
[0113] (1) Data are mean ± standard deviation; (2) Different lowercase letters on the superscript indicate significant differences (P<0.05), and the same letter indicates no significant differences (P>0.05).
[0114] Therefore, the above results demonstrate that the bivalent inactivated vaccine against Pasteurella multocida and Newcastle disease prepared in this invention has good safety and efficacy. Furthermore, there is no adverse immune interference between the Newcastle disease Lasota antigen and the recombinant protein L1-plpE and recombinant protein L3-plpE prepared in this application. A single immunization can prevent two diseases simultaneously, reducing immunization costs while improving the convenience of preventing different diseases.
Claims
1. A multivalent subunit vaccine for fowl cholera, characterized in that: The avian cholera multivalent subunit vaccine is composed of L1-plpE protein, L3-plpE protein and a veterinary acceptable adjuvant; wherein the amino acid sequence of the L1-plpE protein is SEQ ID NO. 3; the amino acid sequence of the L3-plpE protein is SEQ ID NO. 4; the component content of the L1-plpE protein and the L3-plpE protein is 25 μg / mL.
2. The multivalent subunit vaccine for fowl cholera according to claim 1, characterized in that: The nucleotide sequence of the coding gene of the L1-plpE protein is SEQ ID NO. 1; the nucleotide sequence of the coding gene of the L3-plpE protein is SEQ ID NO.
2.
3. A vaccine, characterized by: The vaccine is composed of the L1-plpE protein in claim 1, the L3-plpE protein in claim 1, one pathogen antigen and a veterinary acceptable adjuvant; the one pathogen antigen is a Newcastle disease virus antigen.
4. Use of the avian cholera multivalent subunit vaccine according to any one of claims 1-2 or the vaccine according to claim 3 in the preparation of a medicament for preventing avian Pasteurella multocida A:L1 and avian Pasteurella multocida A:L3 avian cholera.
Citation Information
Patent Citations
Subunit vaccine of pasteurella multocida in veterinary uses
US20090246229A1