A circRNA marker for diagnosing and treating cervical cancer and application thereof
By using hsa_circ_0002828 circular RNA as a biomarker for cervical cancer, an effective means for early diagnosis and treatment of cervical cancer has been realized, solving the problems of difficulty in early detection of cervical cancer and postoperative recurrence and metastasis in existing technologies, and providing new diagnostic and treatment methods.
Patent Information
- Application Number
- CN202210934744.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-04
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2042-08-04
Smart Images

Figure CN116064520B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a cervical cancer circRNA biomarker and its application. Background Technology
[0002] Cervical cancer is the third leading cause of cancer death among women worldwide, after breast cancer and colorectal cancer. Cervical cancer is a malignant tumor originating in the cervix and is one of the most common gynecological malignancies. The peak age for carcinoma in situ is 30-35 years old, while invasive carcinoma occurs between 45-55 years old. In recent years, there has been a trend towards younger onset. The widespread use of cervical cytology screening in recent decades has enabled the early detection and treatment of cervical cancer and precancerous lesions, resulting in a significant decrease in the incidence and mortality rates of cervical cancer. Radical hysterectomy for cervical cancer has undergone more than 100 years of development, and the technique has gradually become standardized and mature. Surgical treatment for early-stage cervical cancer patients has a clear therapeutic effect, with a five-year survival rate as high as 80% or more. However, postoperative recurrence and metastasis still seriously threaten the lives of patients.
[0003] In recent decades, research on cervical cancer RNA molecules has been increasingly popular, especially with the emergence of systems biology, which has led researchers to attempt to interpret and elucidate the occurrence and progression of cervical cancer from the perspective of molecular networks. This is expected to be a future research trend. Circular RNA (circRNA) is a class of endogenous non-coding RNAs widely found in various eukaryotic cells. It lacks a 5' cap and a 3' poly A tail, forming covalently closed circular RNA molecules different from linear RNA through backsplicing. It is unaffected by RNA exonucleases and exhibits evolutionary conservation. circRNAs are generally considered to act as miRNA sponges, participating in alternative splicing and gene transcription regulation, and possessing functions such as interacting with RNA-binding proteins and deriving pseudogenes, potentially contributing to the occurrence and progression of human cancers. Summary of the Invention
[0004] The purpose of this invention is to provide a cervical cancer circRNA marker, namely the hsa_circ_0002828 circular RNA (Circ0002828) gene, and further to provide the application of this marker in the diagnosis and treatment of cervical cancer.
[0005] The inventive concept of this invention:
[0006] Argonaute RISC Catalytic Component 3 (AGO3), also known as Eukaryotic Translation Initiation Factor 2C, 3 or EIF2C3, encodes a member of the Argonaute protein family that plays a role in RNA interference. It contains a PAZ domain and a PIWI domain. Studies have found that AGO3, as a key component of the RNA-induced silencing complex (RISC), negatively regulates gene expression through RNA interference (J Biol Chem). The AGO complex inhibits mRNA targets by binding to complementary microRNAs, thereby destabilizing or degrading mRNA. Increasing research indicates that dysregulation of the AGO subfamily is associated with carcinogenesis; AGO can regulate cell proliferation and / or activity in various tumors. In cervical cancer, the AGO3 protein promotes the malignant potential of cervical cancer by regulating the Wnt / β-catenin signaling pathway (Reprod Biol. 2021), which indicates that the AGO3 (mRNA-translated) protein plays a pro-cancer role in cervical cancer.
[0007] The applicant's experimental results revealed that the circRNA hsa_circ_0002828, derived from the AGO3 gene, is significantly underexpressed in cervical cancer, and overexpression of hsa_circ_0002828 significantly inhibited the malignant phenotype of cervical cancer cells. This indicates that hsa_circ_0002828 can exert an opposite effect to AGO3 protein. Detecting the loss (reduced expression) of hsa_circ_0002828 can also provide early diagnosis (or warning) of cervical cancer, while overexpression (increased expression) of hsa_circ_0002828 has clinical application value in the treatment of cervical cancer.
[0008] This invention is achieved through the following technical solution:
[0009] In a first aspect, the present invention provides a cervical cancer circRNA biomarker, wherein the circRNA biomarker is hsa_circ_0002828, and the nucleotide sequence of hsa_circ_000828 is shown in SEQ ID No. 1.
[0010] Circ0002828 is located within gene AGO3 and consists of exons 3, 4, and 5. The full-length sequence of Circ0002828 is 467 bases: GGAGGTGGTTGACTCAATGGTTCAGCATTTTAAAGTAACTATATTTGGAGACCGTAGACCAGTTTATGATGGAAAAAGAAGTCTTTACACCGCCAATCCACTTCCTGTGGCAACTACAGGGGTAGATTTAGACGTTACTTTACCTGGGGAAGGTGGAAAAGATCGACCTTTCAAGGTGTCAATCAAATTTGTCTCTCGGGTGAGTTGGCACCTACTGCATG AAGTACTGACAGGACGGACCTTGCCTGAGCCACTGGAATTAGACAAGCCAATCAGCACTAACCCTGTCCATGCCGTTGATGTGGTGCTACGACATCTGCCCTCCATGAAATACACACCTGTGGGG CGTTCATTTTTTCCGCTCCAGAAGGATATGACCACCCTCTGGGAGGGGGCAGGGAAGTGTGGTTTGGATTCCATCAGTCTGTTCGGCCTGCCATGTGGAAAATGATGCTTAATATCGATG (SEQ ID No. 1).
[0011] Secondly, the present invention provides the application of a reagent for detecting the above-mentioned cervical cancer circRNA markers in the preparation of a reagent kit for diagnosing cervical cancer.
[0012] Furthermore, in a preferred embodiment of the present invention, the above reagents include a primer set specifically amplifying hsa_circ_0002828.
[0013] Furthermore, in a preferred embodiment of the present invention, the primer set of hsa_circ_0002828 includes a forward primer and a reverse primer;
[0014] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, namely CTACGACATCTGCCCTCCAT (SEQ ID NO.2).
[0015] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, namely TGAGTCAACCACCTCCCATC (SEQ ID NO.3).
[0016] In practical applications, this also includes forward and reverse primers for the internal reference GAPDH:
[0017] Internal reference GAPDH Primer F: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO.4);
[0018] Internal reference GAPDH Primer R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO.5).
[0019] Thirdly, the present invention provides a cervical cancer diagnostic kit, comprising a specific primer set for the above-mentioned hsa_circ_0002828;
[0020] Furthermore, in a preferred embodiment of the present invention, the primer set includes a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.2 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3;
[0021] Preferably, it also includes real-time PCR reagents, RNA extraction reagents, and a reverse transcription reaction system.
[0022] Fourthly, the present invention provides the application of the above-mentioned expression promoter of cervical cancer circRNA marker in the preparation of a drug for treating cervical cancer.
[0023] Furthermore, in a preferred embodiment of the present invention, the expression promoter described above includes at least one of the following: the hsa_circ_0002828 circular RNA gene; a recombinant vector containing the hsa_circ_0002828 circular RNA gene; or a recombinant virus containing the hsa_circ_0002828 circular RNA gene.
[0024] Fifthly, the present invention provides a medicament for treating cervical cancer, the active ingredient of which includes an expression promoter of hsa_circ_000828.
[0025] Compared with the prior art, the present invention has at least the following technical effects:
[0026] The inventors discovered that the expression level of the circular RNA hsa_circ_0002828 in the plasma of cervical cancer patients was significantly lower than that in healthy individuals. This suggests that hsa_circ_0002828 can serve as a diagnostic biomarker for cervical cancer, as its significantly reduced expression in the plasma of cervical cancer patients can effectively predict the occurrence of cervical cancer. Simultaneously, experimental studies showed that overexpression of hsa_circ_0002828 significantly inhibited the proliferation and invasion of cervical cancer cells and strongly induced tumor cell apoptosis. These results indicate that hsa_circ_0002828 can serve as both a biomarker for tumor diagnosis and a potential target for tumor therapy. For example, expression promoters of hsa_circ_0002828 could be used in the preparation of drugs for treating cervical cancer. Attached Figure Description
[0027] Figure 1 This is an identification diagram of the circular RNA Circ_0002828 in Example 1 of the present invention;
[0028] Figure 2 The results of quantitative real-time PCR detection of Circ_0002828 in Example 2 of this invention show that, compared with the normal group, the expression of Circ0002828 in the serum of cervical cancer patients is reduced.
[0029] Figure 3 This is an illustration of the good biomarker performance of Circ_0002828 in cervical cancer serum in Embodiment 2 of the present invention;
[0030] Figure 4 The results of quantitative real-time PCR detection of Circ_0002828 in multiple cell lines in Example 3 of this invention;
[0031] Figure 5 The figure shows the results of the experiment on the inhibition of cell proliferation of cervical cancer cells HeLa and HT-3 by Circ_0002828 in Example 4 of the present invention. In the figure, Figure A is cervical cancer cells HeLa and Figure B is cervical cancer cells HT-3.
[0032] Figure 6 The figure shows the experimental results of Circ_0002828 inhibiting the cell migration ability of cervical cancer cells HeLa and HT-3 in Example 5 of the present invention. In Figure A, cervical cancer cells HeLa are shown, and in Figure B, cervical cancer cells HT-3 are shown. Detailed Implementation
[0033] The embodiments of the present invention will be described in detail below with reference to the examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Specific conditions not specified in the examples shall be carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0034] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.
[0035] Example 1
[0036] Identification of hsa_circ_0002828
[0037] 1. RNA extraction (Trizol method)
[0038] (1) Add 1 ml of trizol to the plasma of cervical cancer patients and healthy individuals;
[0039] (2) Add 200 μL of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 10 min;
[0040] (3) Centrifuge at 12,000g for 10 min at 4℃. The solution will separate into three layers. The RNA will dissolve in the aqueous phase. Transfer the aqueous phase to another new RNase-free EP tube.
[0041] (4) Add 1 volume of isopropanol and vortex to mix thoroughly;
[0042] (5) Centrifuge at 12,000g for 15 min at 4℃. RNA precipitate will appear at the bottom of the tube after centrifugation. Discard the supernatant.
[0043] (6) Add 1 ml of 75% ethanol, gently invert by hand, centrifuge at 12,000 g for 5 min, and discard the supernatant;
[0044] (7) Air dry at room temperature, then add 20 μL of DEPC water to dissolve the precipitate.
[0045] 2. Genomic DNA removal
[0046] To remove residual genomic DNA from total RNA, DNA digestion enzymes were used. The specific reaction system and conditions are as follows: the total reaction volume was 10 μL, and the components were as follows:
[0047]
[0048] The DNA digestion enzymes were inactivated by digestion at 37°C for 40 min in the reaction solution, followed by inactivation at 85°C for 3 min.
[0049] 3. RNA is reverse transcribed into cDNA
[0050] The reaction system and conditions for reverse transcription of RNA into cDNA are as follows:
[0051]
[0052] The reaction conditions were: 37℃ for 10 min, 42℃ for 20 min, 85℃ for 5 min, and 4℃ for 2 min.
[0053] 4. Design reverse amplification PCR primers to amplify the circ-ERBB2 interface and verify the flanking DNA sequences by sequencing.
[0054] Based on partial reference sequences provided in the Circbase database, primers for identifying reverse PCR amplification sequences were designed. The primer sequences for amplifying the interface and flanking sequences of hsa_circ_0002828 are as follows:
[0055]
[0056] Primers amplified a 467bp partial sequence of the circular RNA hsa_circ_0002828. Circ0002828 is located within gene AGO3, consisting of exons 3, 4, and 5, with a full length of 467nt. After amplification, the circular sequence of Circ0002828 was confirmed by first-generation Sanger sequencing. Figure 1 As shown. Circ0002828 has a full length of 467 bases, and its full-length sequence is as follows:
[0057] GGAGGTGGTTGACTCAATGGGTTCAGCATTTTAAAGTAACTATATTTGGAGACCGTAGACCAGTTTATGATGGAAAAAGAAGTCTTTACACCGCCAATCCACTTCCTGTGGCAACTACAGGGGTAGATTTAGACGTTACTTTACCTGGGGAAGGTGGAAAAGATCGACCTTTCAAGGTGTCAATCAAATTTGTCTCTCGGGTGAGTTGGCACCTACTGCATGAAGTACTGACAGGA CGGACCTTGCCTGAGCCACTGGAATTAGACAAGCCAATCAGCACTAACCCTGTCCATGCCGTTGATGTGGTGCTACGACATCTGCCCTCCATGAAATACACACCTGTGGGGCGTTCATTTTTCTCCGCTCCAGAAGGATATGACCACCCTCTGGGAGGGGGCAGGGAAGTGTGGTTTGGATTCCATCAGTCTGTTCGGCCTGCCATGTGGAAAATGATGCTTAATATCGATG (SEQ ID NO.1).
[0058] Example 2
[0059] Quantitative PCR detection of hsa_circ_0002828
[0060] The method for detecting the expression of circular RNA hsa_circ_0002828 in the plasma of cervical cancer patients and healthy individuals by quantitative real-time PCR is as follows:
[0061] Total RNA was extracted according to the method described in Example 1, and residual genomic DNA in the extracted RNA was removed using DNase. The RNA was then reverse transcribed into cDNA. Finally, quantitative real-time PCR was used for detection. The reaction system and reaction conditions for quantitative real-time PCR amplification to detect the expression of circular RNA hsa_circ_0002828 in the plasma of cervical cancer patients and healthy individuals are as follows:
[0062]
[0063] The reaction conditions for real-time PCR were: denaturation at 95℃ for 5 minutes; 95℃ for 10 seconds, 60℃ for 35 seconds; 40 cycles.
[0064] The expression of circular RNA hsa_circ_0002828 in the plasma of cervical cancer patients and healthy individuals was detected by quantitative real-time PCR. The results are as follows: Figure 2 and Figure 3 As shown:
[0065] Depend on Figure 2 It can be seen that the average expression level of circ_0002828 in the plasma of cervical cancer patients was 3.2, while the average expression level of circ_0002828 in the plasma of healthy patients was 4.9. Compared with healthy patients, the expression level of circ_0002828 in the plasma of cervical cancer patients was significantly reduced.
[0066] Depend on Figure 3 As can be seen, the area under the ROC curve (AUC) is greater than 50%, and the ROC curve shows that the AUC of cervical cancer is 0.7388, indicating that circ_0002828 can effectively predict the occurrence of cervical cancer and can be used as a diagnostic marker for cervical cancer. It can be applied to the preparation of cervical cancer diagnostic reagents and is expected to provide new technical support for the diagnosis of cervical cancer.
[0067] Meanwhile, the fluorescence quantitative PCR detection method of the present invention can ideally detect the expression of circular RNA hsa_circ_0002828 in organisms.
[0068] Example 3
[0069] hsa_circ_0002828 was significantly downexpressed only in cervical cancer cell lines.
[0070] To investigate the expression of hsa_circ_0002828 in various cell lines, we used quantitative real-time PCR to detect the expression of the circular RNA hsa_circ_0002828 in 293T cells, lung, liver, pancreas, cervical, and gastric tumor cells. Figure 4 As shown.
[0071] The results showed that hsa_circ_0002828 expression was significantly reduced only in cervical cancer cells, compared to normal HCrEpic cells, but hsa_circ_0002828 expression in HeLa was 41.91%. However, this reduced expression phenomenon was not observed in other tumors, therefore hsa_circ_0002828 can serve as a specific diagnostic marker for cervical cancer.
[0072] Example 4
[0073] CCK8 assay to detect the effect of circ_0002828 on cell proliferation
[0074] (1) HeLa and HT-3 cells transfected in the logarithmic growth phase were digested with 0.25% trypsin solution and centrifuged to obtain cell pellet. The cells were resuspended in culture medium and counted by cell counting chamber.
[0075] (2) Based on the cell count results, the concentration of the cell suspension was diluted to approximately 5000 cells / 100 μL, and then the diluted cell suspension was added to each well in a 96-well plate.
[0076] (3) An overexpression vector for circ_0002828 was constructed to effectively upregulate the expression of this circular RNA in cervical cancer cell lines HeLa and HT-3. The control group was transfected with an empty vector.
[0077] (4) Incubate the 96-well plate in a constant temperature incubator at 37°C for an appropriate period of time (0, 24, 48 and 72 hours).
[0078] (5) Add 100 μL of 10% CCK8 solution (i.e., 90 μL of basal culture medium to 10 μL of CCK8 solution) to each well of the 96-well plate.
[0079] (6) Place the 96-well plate in a constant temperature incubator at 37°C and continue to incubate for 1-4 hours;
[0080] (7) Finally, adjust the SPECTRmaxPLUS34 continuous spectrum spectrophotometer to a wavelength of 450 nm, measure and record the absorbance value of each well, and perform comparative analysis.
[0081] (8) Plot cell growth curves to evaluate the effect of circ_0002828 overexpression on the proliferation of HeLa and HT-3 cells.
[0082] The results are as follows Figure 5 As shown, the growth of cervical cancer cells was significantly inhibited, with inhibition rates of 26% for the HeLa cervical cancer cell line and 20% for the HT-3 cervical cancer cell line. This indicates that overexpression of circ_0002828 can inhibit the proliferation of HeLa and HT-3 cells.
[0083] Experimental Example 5
[0084] Cell scratch-heal assay to detect the effect of circ_0002828 on cell migration ability
[0085] (1) 1×106 HeLa and HT-3 cells were seeded into 60mm culture dishes, 3mL of 1640 complete culture medium was added to each dish, and the dishes were incubated in a 37°C, 5% CO2 air incubator.
[0086] (2) After 24 hours, observe under a microscope that the cell confluence reaches more than 95%. Use a 200 μL yellow pipette tip to make a horizontal scribbling line on the back of a 6-well plate, 0.5-1 cm apart. At least 5 lines should be made through each well. Then, tumor cells infected with circ_0002828 overexpressing lentivirus are seeded into the 6-well plate. The next day, use the pipette tip as a guide, perpendicular to the horizontal scribbling line on the back of the plate. The pipette tip should be vertical and not tilted.
[0087] (3) Discard the culture medium, add 2 mL of sterile PBS to wash away residual cell debris, and then add 3 mL of 1640 complete culture medium containing 0.5% FBS.
[0088] (4) Observe and photograph the initial position of the cells under a microscope and record it as the 0h time point.
[0089] (5) Take another photo after 48 hours to record the location of cell migration.
[0090] (6) Samples were taken at 0 and 48 hours, and the cell migration area was calculated and plotted using ImageJ software. The cell migration rate was calculated as (scratch area at 1-48h / scratch area at 0h) × 100%.
[0091] (7) Study changes in cell invasion ability using a microscope.
[0092] The results are as follows Figure 6 As shown, the migration ability of cervical cancer cells was significantly inhibited, with inhibition rates of 25% for HeLa cell line and 50% for HT-3 cell line.
[0093] In summary, this invention provides a circ-RNA biomarker for the diagnosis and treatment of cervical cancer, namely the hsa_circ_0002828 circular RNA gene. The inventors, through quantitative real-time PCR, detected that the expression level of this circular RNA gene in the serum of cervical cancer patients was significantly lower than that in healthy individuals, indicating that this circRNA biomarker can predict the occurrence of cervical cancer and can be used as a diagnostic biomarker for cervical cancer. Furthermore, the effect of circ_0002828 on cell proliferation was studied using a CCK8 assay. The results showed that overexpression of circ_0002828 in cervical cancer cell lines HeLa and HT-3 significantly inhibited the growth of cervical cancer cells. The effect of circ_0002828 on cell migration ability was studied using a cell scratch-healing assay. The results showed that overexpression of circ_0002828 in cervical cancer cell lines HeLa and HT-3 significantly inhibited cell migration ability. This demonstrates that circ_0002828 can serve as both a biomarker for cervical cancer diagnosis and a potential target for cervical cancer treatment. Reagents used to detect circ_0002828 can be used in products for diagnosing or treating cancer, such as microarrays, kits, or nucleic acid membrane strips. Conversely, circ_0002828 expression promoters can be used in the preparation of drugs for treating cervical cancer.
[0094] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of a reagent for detecting cervical cancer circRNA biomarkers in the preparation of a diagnostic kit for cervical cancer, characterized in that, The circRNA marker is hsa_circ_0002828, and the nucleotide sequence of hsa_circ_0002828 is shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, The reagents include a set of primers specifically for amplifying hsa_circ_0002828.
3. The application according to claim 2, characterized in that, The primer set of hsa_circ_0002828 includes forward primers and reverse primers; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.
3.
4. The use of an expression promoter for cervical cancer circRNA markers as described in claim 1 in the preparation of a medicament for treating cervical cancer, characterized in that, The expression promoter is a recombinant vector containing the hsa_circ_0002828 circular RNA gene.