Compounds and methods of modulating atxn1

By designing oligonucleotide compounds that are highly complementary to ATXN1 RNA, the lack of effective treatment for SCA1 was addressed, resulting in significant improvement in symptoms and markers and a slowing of disease progression.

CN116096380BActive Publication Date: 2026-05-01IONIS PHARMACEUTICALS INC
View PDF 94 Cites 0 Cited by

Patent Information

Application Number
CN202180032525.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-05-01
Filing Date
2021-04-30
Publication Date
2026-05-01
Estimated Expiration
2041-04-30

AI Technical Summary

Technical Problem

Current technology lacks effective treatments to reduce the symptoms and signs of spinocerebellar ataxia type 1 (SCA1), and current treatments are limited to symptomatic and supportive care.

Method used

We provide oligomeric compounds containing modified oligonucleotides designed to be highly complementary to ATXN1 RNA to reduce the amount or activity of ATXN1 RNA and, in some cases, reduce the expression of ATXN1 protein, thereby improving symptoms of SCA1 such as gait and limb ataxia, cognitive impairment, etc.

Benefits of technology

By reducing the expression of ATXN1 RNA and protein, the symptoms and markers of SCA1 were significantly improved, the disease progression was slowed, and the survival time of patients was prolonged.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure QLYQS_2
    Figure QLYQS_2
  • Figure BDA0003921153200000211
    Figure BDA0003921153200000211
Patent Text Reader

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN1 RNA in a cell or subject and, in certain cases, reducing the amount of ATXN1 in a cell or subject. Such compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or marker of a neurodegenerative disease. Such symptoms and markers include gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years after symptom onset. Such neurodegenerative diseases include spinocerebellar ataxia type 1.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] sequence list

[0002] This application is submitted together with an electronic sequence listing. The sequence listing is provided as a file titled BIOL0355WOSEQ_ST25.txt, created on April 26, 2021, and is 1.32 MB in size. Information from the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0003] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of ATXN1 RNA in cells or subjects and, in some cases, reducing the amount of ATXN1 protein in cells or subjects. Such compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or marker of neurodegenerative diseases. Such symptoms and markers include gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, cerebellar and brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10–15 years of symptom onset. Such neurodegenerative diseases include type 1 spinocerebellar ataxia. Background Technology

[0004] Spinocerebellar ataxia type 1 (SCA1) is a progressive and fatal neurodegenerative disease affecting 1-2 people per 100,000 worldwide. SCA1 is caused by an amplification of the CAG repeat sequence in the coding region of the gene encoding attaxin-1 (ATXN1). Accumulation of mutant attaxin-1 protein leads to the degeneration of Purkinje cells and brainstem nuclei. Symptoms and hallmarks of SCA1 include gait and limb ataxia, cognitive impairment, speech and swallowing difficulties, cerebellar and brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10–15 years of symptom onset (see, for example, Ju, H., Kokubu, H. and Lim, J., Mol. Neurobiol. 50:866–874, 2014; Ortiz, JP, Orr, HT, Polyglutamine Disorders, Nóbrega, C and Almeida, L. eds., Advances in Exp. Med. And Biol., 1049:135–145, 2018).

[0005] There is no specific treatment for SCA1, and current treatment is limited to supportive care for individual symptoms.

[0006] Currently, there is a lack of acceptable options for treating neurodegenerative diseases such as SCA1. Therefore, the objective of this article is to provide compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0007] This document provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN1 RNA in cells or a subject and, in some embodiments, reducing the expression of ATXN1 protein. In some embodiments, the subject has a neurodegenerative disease. In some embodiments, the subject has spinocerebellar ataxia type 1 (SCA1). In some embodiments, the compound that can be used to reduce the amount or activity of ATXN1 RNA is an oligomeric compound. In some embodiments, the compound that can be used to reduce the amount or activity of ATXN1 RNA is a modified oligonucleotide. In some embodiments, the compound that can be used to reduce the expression of ATXN1 protein is an oligomeric compound. In some embodiments, the compound that can be used to reduce the expression of ATXN1 protein is a modified oligonucleotide.

[0008] Methods for improving at least one symptom or marker of a neurodegenerative disease are also provided. In some embodiments, the neurodegenerative disease is type 1 spinocerebellar ataxia. In some embodiments, symptoms or markers include gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, cerebellar and brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10–15 years of symptom onset. Detailed Implementation

[0009] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only, and are not restrictive. In this document, unless otherwise expressly stated, the use of the singular includes the plural. Unless otherwise stated, as used herein, the use of "or" means "and / or". Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. Similarly, unless otherwise expressly stated, terms such as "element" or "component" cover elements and components constituting a unit as well as elements and components constituting more than one subunit.

[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including (but not limited to) patents, patent applications, articles, books, monographs, and GenBank, ENSEMBL, and NCBI reference sequence records, are expressly incorporated herein by reference in their respective sections concerning the documents discussed herein and in their entirety.

[0011] definition

[0012] Unless specifically defined, the nomenclature, procedures, and techniques used in conjunction with the analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, publications, and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0013] Unless otherwise indicated, the following terms have the following meanings:

[0014] definition

[0015] As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H)deoxyfuranosyl sugar moiety. In some embodiments, the 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2’-deoxynucleoside may comprise a modified nucleotide or may comprise an RNA nucleotide (uracil).

[0016] As used herein, “2'-MOE” means the 2'-OCH2CH2OCH3 group replacing the 2'-OH group in the furanyl sugar moiety. “2'-MOE sugar moiety” means the sugar moiety in which the 2'-OCH2CH2OCH3 group replaces the 2'-OH group in the furanyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is β-D-ribosyl. “MOE” means O-methoxyethyl.

[0017] As used in this article, "2'-MOE nucleoside" refers to a nucleoside containing the 2'-MOE sugar moiety.

[0018] As used herein, “2'-OMe” means that the 2'-OCH3 group replaces the 2'-OH group of the furanyl sugar moiety. “2'-O-methyl sugar moiety” or “2'-OMe sugar moiety” means the sugar moiety in which the 2'-OCH3 group replaces the 2'-OH group of the furanyl sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety is β-D-ribosyl.

[0019] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0020] As used herein, “2’-substituted nucleoside” means a nucleoside containing a 2’-substituted sugar moiety. As used herein, “2’-substituted” with respect to the sugar moiety means that the sugar moiety contains at least one 2’-substituent other than H or OH.

[0021] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0022] As used in this article, “administration” means providing a medicine to the subject.

[0023] As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or the protein encoded by said target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0024] As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.

[0025] As used herein, “improvement” in treatment means that at least one symptom is improved relative to the same symptom in the absence of said treatment. In some embodiments, improvement is a reduction in the severity or frequency of symptoms, or a delayed onset of symptoms or a slower progression of their severity or frequency. In some embodiments, symptoms or markers are gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, cerebellar and brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10–15 years of symptom onset.

[0026] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0027] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl moiety. In some embodiments, the furanyl sugar moiety is a ribosyl moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl moiety.

[0028] As used in this article, "cleavable portion" means a bond or group of atoms that can be broken under physiological conditions, such as within a cell, animal, or human body.

[0029] As used herein, “complementary” in the context of oligonucleotides means that, when the oligonucleotide is aligned in a relative orientation with the nucleobase sequence of another nucleic acid, at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof are capable of forming hydrogen bonds with the nucleobases of the other nucleic acid or one or more portions thereof. As used herein, complementary nucleobases mean nucleobases capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleobase complementarity at every nucleoside. Instead, some mismatches are permissible. As used herein, “perfectly complementary” or “100% complementary” in relation to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, complementary at each nucleoside.

[0030] As used herein, a "conjugation group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. A conjugation group includes a conjugation portion and a conjugation linker that attaches the conjugation portion to the oligonucleotide.

[0031] As used in this article, "conjugation linker" means a single bond or a group of atoms containing at least one bond that links the conjugation portion to an oligonucleotide.

[0032] As used in this article, "conjugated portion" refers to a group of atoms that are attached to an oligonucleotide via a conjugated linker.

[0033] As used in this article, “neighboring” in the context of oligonucleotides refers to nucleotides, nucleosides, sugar moieties, or links between nucleotides that are adjacent to each other. For example, “neighboring nucleosides” means nucleosides that are adjacent to each other in the sequence.

[0034] As used herein, “cEt” means a 4' to 2' bridge replacing the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. “cEt sugar moiety” is a bicyclic sugar moiety in which a 4' to 2' bridge replaces the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. “cEt” means constrained ethyl.

[0035] As used herein, “cEt nucleoside” means a nucleoside containing a cEt sugar moiety. As used herein, “chiral-rich cluster” means a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules within the cluster containing a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules within the cluster that would be expected to contain the same specific stereochemical configuration at the same specific chiral center if said specific chiral center were stereorandom. A chiral-rich cluster of molecules having multiple chiral centers per molecule may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is a compound containing a modified oligonucleotide.

[0036] As used in this article, “chiral control” in relation to internucleotide linkages means that chirality is enriched at the linkage site for a particular stereochemical configuration.

[0037] As used herein, "deoxyregion" refers to a region of 5-12 adjacent nucleotides, wherein at least 70% of the nucleotides are 2'-β-D-deoxynucleotides. In some embodiments, each nucleotide is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. In some embodiments, the deoxyregion supports RNase H activity. In some embodiments, the deoxyregion is a gap or internal region of a gapmer.

[0038] As used herein, "interstitial aggregate" means an oligonucleotide modified to include an internal region having multiple nucleosides supporting RNase H cleavage, said internal region being located between an external region having one or more nucleosides, wherein the nucleosides constituting the internal region are chemically different from the one or more nucleosides constituting the external region. The internal region may be referred to as a "interstitial space," and the external region may be referred to as a "wing." The internal region is a deoxygenated region. The location of the internal region or interstitial space refers to the sequence of the nucleosides in the internal region and is counted starting from the 5' end of the internal region. Unless otherwise indicated, "interstitial aggregate" refers to a glycosylation motif. In some embodiments, each nucleoside in the interstitial space is a 2'-β-D-deoxynucleoside. In some embodiments, the interstitial space contains a 2'-substituted nucleoside at positions 1, 2, 3, 4, or 5 of the interstitial space, and the remaining nucleosides in the interstitial space are 2'-β-D-deoxynucleosides. As used herein, the term "MOE interstitial aggregate" refers to an interstitial aggregate having an interstitial space containing a 2'-β-D-deoxynucleoside and wings containing a 2'-MOE nucleoside. As used herein, the term "mixed-wing interstitial polymer" refers to an interstitial polymer having wings comprising modified nucleosides containing at least two different sugar modifications. Unless otherwise indicated, interstitial polymers may contain one or more modified nucleosides linked together and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified interstitial polymer pattern.

[0039] As used in this article, a “hotspot” is a series of nucleobases on a target nucleic acid that are susceptible to a decrease in the amount or activity of the target nucleic acid mediated by oligomers.

[0040] As used in this article, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.

[0041] As used herein, “nucleoside linkage” refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “modified nucleoside linkage” refers to any nucleoside linkage other than a phosphodiester nucleoside linkage. “Thiophosphate nucleoside linkage” is a modified nucleoside linkage in which a non-bridging oxygen atom in the phosphodiester nucleoside linkage is replaced by a sulfur atom.

[0042] As used herein, “linker-nucleoside” refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate. The linker-nucleoside resides within the conjugate linker of the oligomer. The linker-nucleoside is not considered part of the oligonucleotide moiety of the oligomer, even if it is adjacent to the oligonucleotide.

[0043] As used herein, “modified non-bicyclic sugar moiety” means a modified sugar moiety containing modifications (e.g., substituents) that do not form bridges between the two atoms of the sugar to form a second ring.

[0044] As used in this article, “mismatch” or “non-complementary” means that when the first oligonucleotide is aligned with the second oligonucleotide, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid.

[0045] As used in this article, "motif" refers to the pattern of linkages between unmodified and / or modified sugar moieties, nucleobases, and / or nucleosides in an oligonucleotide.

[0046] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein, an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the sequence of adjacent nucleobases in a target nucleic acid or oligonucleotide, the sequence being independent of any sugar or nucleoside linkage modifications.

[0047] As used herein, "nucleoside" means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abase-free nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides linked by adjacent sequences (i.e., no other nucleosides exist between those linked nucleosides).

[0048] As used herein, “oligomeric compound” means oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound complementary to the first oligomeric compound or may not be paired. A “single-chain oligomeric compound” is an unpaired oligomeric compound. The term “oligodimer” refers to a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligodimer may be referred to as a “distranded oligomeric compound.”

[0049] As used herein, “oligonucleotide” means a chain of linked nucleosides connected by inter-nucleoside bonds, wherein each nucleoside and the inter-nucleoside bonds may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8–50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or inter-nucleoside bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside or inter-nucleoside modifications.

[0050] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to a subject. Certain such carriers enable the formulation of pharmaceutical compositions as, for example, tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0051] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart undesirable toxicological effects.

[0052] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In some embodiments, the pharmaceutical composition exhibits activity in a free-uptake assay in certain cell lines.

[0053] As used herein, "prodrug" refers to a therapeutic agent that is converted into a form different from its in vitro form within a subject or its cells. Typically, the conversion of a prodrug within a subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.

[0054] As used herein, “reduction or activity” refers to a reduction or blockage of transcriptional expression or activity relative to untreated or control samples, and does not necessarily indicate complete elimination of transcriptional expression or activity.

[0055] Unless otherwise specified, as used herein, "RNA" means RNA transcript and includes both pre-mRNA and mature mRNA.

[0056] As used herein, "RNAi compound" means an antisense compound that functions at least partially via RISC or Ago2 to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi compounds include (but are not limited to) double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimics. In some embodiments, RNAi compounds regulate the amount, activity, and / or splicing of the target nucleic acid. The term RNAi compound does not include antisense compounds that function via RNase H.

[0057] As used in this article, “self-complementarity” in the context of oligonucleotides means that the oligonucleotide hybridizes with itself at least partially.

[0058] As used herein, “standard in vitro assay” or “standard cell assay” means the assay described in Example 1 and its reasonable variations.

[0059] As used herein, “in vivo assay” means the assay described in Example 6 and its reasonable variations.

[0060] As used herein, "stereochiral center" in the context of a molecular group with the same molecular formula refers to a chiral center with a random stereochemical configuration. For example, in a molecular group containing stereochiral centers, the number of molecules with a stereochiral center (S) configuration may be the same as, but not necessarily the same as, the number of molecules with a stereochiral center (R) configuration. A chiral center can be considered random when its stereochemical configuration is the result of a synthetic method not designed to control stereochemical configuration. In some embodiments, the stereochiral center is a stereochiral phosphate ester nucleoside linker.

[0061] As used in this article, "subject" refers to a human or a non-human animal.

[0062] As used herein, “glycan” means an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” means, for example, the 2'-OH(H)β-D-ribosyl moiety found in RNA (“unmodified RNA sugar moiety”), or the 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, an oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanyl sugar moiety or a sugar substitute.

[0063] As used herein, "sugar substitute" refers to a modified sugar moiety, other than the furanyl group, in which a nucleobase is linked to another group (e.g., an internucleotide linker, conjugation group, or terminal group) within an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.

[0064] As used herein, “symptom or sign” means any physical characteristic or test result that indicates the presence or extent of a disease or ailment. In some embodiments, the symptom is obvious to the subject or to a medical professional examining or testing the subject. In some embodiments, the sign is obvious when performing invasive diagnostic tests, including (but not limited to) post-mortem tests. In some embodiments, the sign is obvious when performing a brain MRI scan.

[0065] As used in this article, “target nucleic acid” and “target RNA” refer to nucleic acids that are designed to be affected by antisense compounds.

[0066] As used in this article, "target region" refers to a portion of the target nucleic acid in which oligomeric compounds are designed to hybridize.

[0067] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.

[0068] As used in this article, "therapeutic effective amount" refers to the amount of a pharmaceutical agent that provides therapeutic benefit to a subject. For example, a therapeutic effective amount improves symptoms or markers of a disease.

[0069] Some implementation schemes

[0070] This disclosure provides the following non-restrictive numbered implementation schemes:

[0071] Implementation Scheme 1. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an isolength portion of an ATXN1 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleosides.

[0072] Implementation Scheme 2. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases comprising any one of SEQ ID NO:22-3624 or 3655.

[0073] Implementation Scheme 3. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 adjacent nucleobases comprising any one of SEQ ID NO: 3625-3654 or 3656-3669.

[0074] Implementation Scheme 4. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleobases, said adjacent nucleobases being complementary to:

[0075] The equal-length portion of nucleobases 5472-5552 of SEQ ID NO:1;

[0076] The equal-length portion of nucleobases 5906-6005 of SEQ ID NO:1;

[0077] The equal-length portion of nucleobases 7868-7911 in SEQ ID NO:1;

[0078] The equal-length portion of nucleobases 8481-8514 of SEQ ID NO:1; or

[0079] The equal-length portion of nucleobases 446679-446706 of SEQ ID NO:2.

[0080] Implementation Scheme 5. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 adjacent nucleobases selected from the following sequences:

[0081] SEQ ID NO:196, 274, 352, 430, 508, 2578, 2655, 2732, 2809, 2886, 2963, 3121, 3122, 3190, 3191, 3192, 326 2. 3330, 3331, 3332, 3401, 3402, 3575, 3577, 3620, 3624, 3638-3640, 3653-3655, 3662, 3665, 3669;

[0082] SEQ ID NO:42, 120, 198, 276, 509, 587, 2502, 2579, 2656, 2733, 2810, 2887, 2964, 35 85, 3588-3590, 3615, 3618, 3622, 3657, 3660, 3661, 3663, 3664, 3666-3668;

[0083] SEQ ID NO:48, 126, 2044, 2121;

[0084] SEQ ID NO: 128, 206, 284, 1045, 1122, 1199, and 1276; or

[0085] SEQ ID NOs: 2475, 2552, 2629, 2706, 2783, 3627-3630, 3644.

[0086] Implementation Scheme 6. The oligomeric compound as described in any of Implementation Schemes 1-5, wherein, when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0087] Implementation Scheme 7. An oligomeric compound as described in any of Implementation Schemes 1-6, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0088] Implementation Scheme 8. The oligomeric compound of Implementation Scheme 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0089] Implementation Scheme 9. The oligomeric compound as described in Implementation Scheme 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0090] Implementation Scheme 10. The oligomeric compound of Implementation Scheme 9, wherein the modified oligonucleotide comprises at least one modified nucleoside, the at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0091] Implementation Scheme 11. An oligomeric compound as described in any of Implementation Schemes 7-10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified non-bicyclic sugar moiety.

[0092] Implementation Scheme 12. The oligomer compound as described in Implementation Scheme 11, wherein the modified non-bicyclic sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe modified sugar moiety.

[0093] Implementation Scheme 13. An oligomeric compound as described in any of Implementation Schemes 7-8, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute.

[0094] Implementation Scheme 14. The oligomeric compound of Implementation Scheme 13, wherein the modified oligonucleotide comprises at least one modified nucleoside, the at least one modified nucleoside comprising a sugar substitute selected from morpholino and PNA.

[0095] Implementation Scheme 15. An oligomeric compound as described in any of Implementation Schemes 1-8 or 11-14, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0096] Implementation Scheme 16. An oligomeric compound as described in any of Implementation Schemes 1-15, wherein the modified oligonucleotide is an interstitial polymer.

[0097] Implementation Scheme 17. An oligomeric compound as described in any of Implementation Schemes 1-16, wherein the modified oligonucleotide has a glycosyl motif comprising the following:

[0098] The 5' region is composed of 1-6 linked 5' region nucleotides;

[0099] The central region, which consists of 6-10 linked central region nucleosides; and

[0100] The 3' region consists of 1-6 linked 3' region nucleotides; among which

[0101] Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-deoxyfuranosyl sugar moiety.

[0102] Implementation Scheme 18. The oligomeric compound of Implementation Scheme 17, wherein the modified oligonucleotide has a glycosyl motif comprising the following:

[0103] The 5' region is composed of six linked 5' region nucleotides;

[0104] The central region, which consists of 10 linked central region nucleosides; and

[0105] The 3' region consists of four linked 3' region nucleotides; among which

[0106] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0107] Implementation Scheme 19. The oligomeric compound as described in Implementation Scheme 17, wherein the modified oligonucleotide has a glycosyl motif comprising the following:

[0108] The 5' region is composed of five linked 5' region nucleotides;

[0109] The central region, which consists of 10 linked central region nucleosides; and

[0110] The 3' region consists of five linked 3' region nucleotides; among which

[0111] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0112] Implementation Scheme 20. The oligomeric compound as described in Implementation Scheme 17, wherein the modified oligonucleotide has

[0113] The 5' region is composed of five linked 5' region nucleotides;

[0114] The central region, which consists of eight linked central region nucleosides; and

[0115] The 3' region consists of four linked 3' region nucleotides; among which

[0116] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0117] Implementation Scheme 21. The oligomeric compound as described in Implementation Scheme 17, wherein the modified oligonucleotide has

[0118] The 5' region is composed of five linked 5' region nucleotides;

[0119] The central region, which consists of eight linked central region nucleosides; and

[0120] The 3' region consists of four linked 3' region nucleotides; among which

[0121] Each of the 5' region nucleosides contains a 2'-MOE sugar moiety, each of the 3' region nucleosides is selected from 2'-MOE nucleosides and cEt nucleosides, and each of the central region nucleosides contains a 2'-β-D-deoxynucleoside.

[0122] Implementation Scheme 22. An oligomeric compound as described in any of Implementation Schemes 1-16, wherein the modified oligonucleotide has a glycosyl motif comprising the following:

[0123] The 5' region is composed of 1-6 linked 5' region nucleotides;

[0124] The central region, which consists of 6-10 linked central region nucleosides; and

[0125] The 3' region consists of 1-6 linked 3' region nucleotides; among which

[0126] Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety.

[0127] And the central region has the following formula:

[0128] (Nd)(Nx)(Nd)n

[0129] Where Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside;

[0130] And n is between 6 and 8.

[0131] Implementation Scheme 23. An oligomeric compound as described in any of Implementation Schemes 1-16, wherein the modified oligonucleotide has a glycosyl motif comprising the following:

[0132] The 5' region is composed of five linked 5' region nucleotides;

[0133] The central region, which consists of 6-10 linked central region nucleosides; and

[0134] The 3' region consists of four linked 3' region nucleotides; among which

[0135] Each of the 5' region nucleosides and each of the 3' region nucleosides are selected from 2'-MOE nucleosides and cEt nucleosides.

[0136] And the central region has the following formula:

[0137] (Nd)(Nx)(Nd)n

[0138] Where Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside;

[0139] And n is 7.

[0140] Implementation Scheme 24. An oligomeric compound as described in any of Implementation Schemes 1-23, wherein the modified oligonucleotide comprises at least one modified nucleoside linker.

[0141] Implementation Scheme 25. The oligomeric compound as described in Implementation Scheme 24, wherein the internucleotide link of each of the modified oligonucleotides is a modified internucleotide link.

[0142] Implementation Scheme 26. The oligomeric compound as described in Implementation Scheme 24 or 25, wherein the modified nucleoside interlinking is a thiophosphate nucleoside interlinking.

[0143] Implementation Scheme 27. An oligomeric compound as described in Implementation Scheme 24 or 26, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside linker.

[0144] Implementation Scheme 28. An oligomeric compound as described in any of Implementation Schemes 24, 26 or 27, wherein each nucleoside link is independently selected from phosphate diester nucleoside links or thiophosphate nucleoside links.

[0145] Implementation Scheme 29. An oligomeric compound as described in any of Implementation Schemes 1-24 or 26-28, wherein the modified oligonucleotide has a nucleoside-linked motif selected from: soooossssssssssooss, sssossssssssssssss, sssossssssssssss or soooooossssssssssss; wherein,

[0146] s = thiophosphate nucleoside linkage and o = phosphodiester nucleoside linkage.

[0147] Implementation Scheme 30. An oligomeric compound as described in any of Implementation Schemes 1-29, wherein the modified oligonucleotide comprises a modified nucleobase.

[0148] Implementation Scheme 31. The oligomeric compound as described in Implementation Scheme 30, wherein the modified nucleobase is 5-methylcytosine.

[0149] Implementation Scheme 32. An oligomeric compound as described in any of Implementation Schemes 1-31, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 16-18, 14-20, 15-17, 15-25, 16-20, or 17-20 linked nucleosides.

[0150] Implementation Scheme 33. An oligomeric compound as described in any of Implementation Schemes 1-2, 4-19, 22 or 24-31, wherein the modified oligonucleotide is composed of 18-22 or 18-20 linked nucleosides.

[0151] Implementation Scheme 34. An oligomeric compound as described in any of Implementation Schemes 1-17 or 20-32, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0152] Implementation Scheme 35. An oligomeric compound as described in any of Implementation Schemes 1-2, 4-19, 22 or 24-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0153] Implementation Scheme 36. An oligomeric compound as described in any of Implementation Schemes 1-35, comprising the modified oligonucleotide.

[0154] Implementation Scheme 37. An oligomeric compound as described in any of Implementation Schemes 1-35, comprising a conjugating group, the conjugating group comprising a conjugating portion and a conjugating linker.

[0155] Implementation Scheme 38. The oligomeric compound as described in Implementation Scheme 37, wherein the coupling linker is composed of a single bond.

[0156] Implementation Scheme 39. The oligomeric compound as described in Implementation Scheme 37, wherein the coupling linker is cleavable.

[0157] Implementation Scheme 40. The oligomeric compound as described in Implementation Scheme 37, wherein the conjugation linker comprises 1-3 linker-nucleosides.

[0158] Implementation Scheme 41. An oligomeric compound as described in any of Implementation Schemes 37-40, wherein the conjugating group is attached to the 5' end of the modified oligonucleotide.

[0159] Implementation Scheme 42. An oligomeric compound as described in any of Implementation Schemes 37-40, wherein the conjugating group is attached to the 3' end of the modified oligonucleotide.

[0160] Implementation Scheme 43. An oligomeric compound as described in any of Implementation Schemes 1-35 or 37-42, wherein the oligomeric compound comprises a terminal group.

[0161] Implementation Scheme 44. An oligomeric compound as described in any of Implementation Schemes 1-43, wherein the oligomeric compound is a single-chain oligomeric compound.

[0162] Implementation Scheme 45. An oligomeric compound as described in any of Implementation Schemes 1-39 or 41-42, wherein the oligomeric compound does not contain a linker nucleoside.

[0163] Implementation Scheme 46. An oligomeric duplex comprising the oligomeric compound described in any one of Implementation Schemes 1-43 or 45.

[0164] Implementation Scheme 47. An antisense compound comprising the oligomer of any one of embodiments 1-45 or the oligodimer of embodiment 46, or composed of the oligomer of any one of embodiments 1-45 or the oligodimer of embodiment 46.

[0165] Implementation Scheme 48. A pharmaceutical composition comprising the oligomeric compound of any one of Implementation Schemes 1-45 or the oligomeric duplex of Implementation Scheme 46, and a pharmaceutically acceptable carrier or diluent.

[0166] Implementation Scheme 49. The pharmaceutical composition as described in Implementation Scheme 48, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.

[0167] Implementation Scheme 50. The pharmaceutical composition of Implementation Scheme 49, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

[0168] Implementation Scheme 51. A method comprising administering to a subject the pharmaceutical composition described in any of the embodiments of Implementation Schemes 48-50.

[0169] Implementation Scheme 52. A method of treating an ATXN1-related disease, the method comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of Implementation Schemes 48-50 to an individual suffering from an ATXN1-related disease or at risk of developing the disease; and thereby treating the ATXN1-related disease.

[0170] Implementation Scheme 53. The method as described in Implementation Scheme 52, wherein the ATXN1-related disease is type 1 spinocerebellar ataxia.

[0171] Implementation Scheme 54. The method described in any of the embodiments of Implementation Schemes 51-52, wherein at least one symptom or marker of the ATXN1-related disease is improved.

[0172] Implementation Scheme 55. The method as described in Implementation Scheme 54, wherein the symptoms or signs are gait or limb ataxia, cognitive impairment, difficulty speaking or swallowing, cerebellar and / or brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and / or brainstem detected by magnetic resonance spectroscopy (MRS), or death within 10-15 years after the onset of symptoms.

[0173] Implementation Scheme 56. The method described in any of the implementation schemes 51-53, wherein the ATXN1 level in the individual is reduced.

[0174] Implementation Scheme 57. A modified oligonucleotide according to the following chemical structure,

[0175] (SEQ ID NO:126), or its salt.

[0176] Implementation Scheme 58. A modified oligonucleotide according to the following chemical structure,

[0177] (SEQ ID NO:1045), or its salt.

[0178] Implementation Scheme 59. A modified oligonucleotide according to the following chemical structure,

[0179] (SEQ ID NO:2552), or its salt.

[0180] Implementation Scheme 60. A modified oligonucleotide according to the following chemical structure,

[0181] (SEQ ID NO:3190), or its salt.

[0182] Implementation Scheme 61. A modified oligonucleotide based on the following chemical structure,

[0183] (SEQ ID NO:3590), or its salt.

[0184] Implementation Scheme 62. A modified oligonucleotide according to the following chemical structure,

[0185] (SEQ ID NO:3638), or its salt.

[0186] Implementation Scheme 63. A modified oligonucleotide based on the following chemical structure,

[0187] (SEQ ID NO:126).

[0188] Implementation Scheme 64. A modified oligonucleotide based on the following chemical structure,

[0189] (SEQ ID NO:1045).

[0190] Implementation Scheme 65. A modified oligonucleotide according to the following chemical structure,

[0191] (SEQ ID NO:2552).

[0192] Implementation Scheme 66. A modified oligonucleotide based on the following chemical structure,

[0193] (SEQ ID NO:3190).

[0194] Implementation Scheme 67. A modified oligonucleotide according to the following chemical structure,

[0195] (SEQ ID NO:3590).

[0196] Implementation Scheme 68. A modified oligonucleotide according to the following chemical structure,

[0197] (SEQ ID NO:3638).

[0198] Implementation Scheme 69. The modified oligonucleotide as described in any of Implementation Schemes 57-62, wherein the modified oligonucleotide is a sodium or potassium salt.

[0199] Implementation Scheme 70. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0200] Ges m Ceo Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo TeoTes m Ces Ae(SEQ ID NO:126), where,

[0201] A = adenine nucleobase,

[0202] m C = 5-methylcytosine nucleobase,

[0203] G = guanine nucleobase

[0204] T = thymine nucleobase,

[0205] e = 2'-MOE sugar moiety,

[0206] d = 2'-β-D deoxyribosyl sugar moiety,

[0207] s = thiophosphate nucleoside linkage, and

[0208] o = phosphate diester nucleoside linkage.

[0209] Implementation Scheme 71. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0210] Ges m Ceo Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds TeoGeo Tes Aes mCe(SEQ ID NO:1045), where,

[0211] A = adenine nucleobase,

[0212] m C = 5-methylcytosine nucleobase,

[0213] G = guanine nucleobase

[0214] T = thymine nucleobase,

[0215] e = 2'-MOE sugar moiety,

[0216] d = 2'-β-D deoxyribosyl sugar moiety,

[0217] s = thiophosphate nucleoside linkage, and

[0218] o = phosphate diester nucleoside linkage.

[0219] Implementation Scheme 72. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0220] Ges m Ceo m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m CeoTeo Tes Tes m Ce(SEQ ID NO:2552), where,

[0221] A = adenine nucleobase,

[0222] m C = 5-methylcytosine nucleobase,

[0223] G = guanine nucleobase

[0224] T = thymine nucleobase,

[0225] e = 2'-MOE sugar moiety,

[0226] d = 2'-β-D deoxyribosyl sugar moiety,

[0227] s = thiophosphate nucleoside linkage, and

[0228] o = phosphate diester nucleoside linkage.

[0229] Implementation Scheme 73. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0230] Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m Ceo m Ces Aes Te(SEQ ID NO:3190), where,

[0231] A = adenine nucleobase,

[0232] m C = 5-methylcytosine nucleobase,

[0233] G = guanine nucleobase

[0234] T = thymine nucleobase,

[0235] e = 2'-MOE sugar moiety,

[0236] d = 2'-β-D deoxyribosyl sugar moiety,

[0237] s = thiophosphate nucleoside linkage, and

[0238] o = phosphate diester nucleoside linkage.

[0239] Implementation Scheme 74. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0240] m Ces m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m Ceo Aes Tes m Ce(SEQ ID NO:3590), where,

[0241] A = adenine nucleobase,

[0242] m C = 5-methylcytosine nucleobase,

[0243] G = guanine nucleobase

[0244] T = thymine nucleobase,

[0245] e = 2'-MOE sugar moiety,

[0246] d = 2'-β-D deoxyribosyl sugar moiety,

[0247] s = thiophosphate nucleoside linkage, and

[0248] o = phosphate diester nucleoside linkage.

[0249] Implementation Scheme 75. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0250] Tesm Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m Ce(SEQ ID NO:3638), where,

[0251] A = adenine nucleobase,

[0252] m C = 5-methylcytosine nucleobase,

[0253] G = guanine nucleobase

[0254] T = thymine nucleobase,

[0255] e = 2'-MOE sugar moiety,

[0256] d = 2'-β-D deoxyribosyl sugar moiety,

[0257] s = thiophosphate nucleoside linkage, and

[0258] o = phosphate diester nucleoside linkage.

[0259] Implementation Scheme 76. The compound of any of Implementation Schemes 73-78, wherein the compound comprises the modified oligonucleotide covalently linked to the conjugation group.

[0260] Implementation Scheme 77. A chiral enrichment cluster of modified oligonucleotides according to any one of Implementation Schemes 57-68, wherein the enrichment cluster comprises at least one modified oligonucleotide with a specific phosphate ester nucleoside bond having a specific stereochemical configuration.

[0261] Implementation Scheme 78. A chiral enrichment cluster as described in Implementation Scheme 77, wherein the enrichment cluster comprises at least one modified oligonucleotide having a specific thiophosphate nucleoside bond with a (Sp) or (Rp) configuration.

[0262] Implementation Scheme 79. The chiral enriched clusters as described in Implementation Scheme 77, wherein the clusters are enriched in modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside linker.

[0263] Implementation Scheme 80. A chiral enriched cluster as described in Implementation Scheme 77, wherein the cluster is enriched in modified oligonucleotides having an (Rp) configuration at a specific thiophosphate nucleoside linker and an (Sp) configuration at each of the remaining thiophosphate nucleoside linkers.

[0264] Implementation Scheme 81. The chiral enrichment cluster as described in Implementation Scheme 77, wherein the cluster is enriched with at least three modified oligonucleotides having Sp, Sp, and Rp configurations linked between adjacent phosphate thioester nucleosides along the 5' to 3' direction.

[0265] Implementation Scheme 82. A group of modified oligonucleotides as described in any of Implementation Schemes 57-68, wherein all phosphate thioester nucleoside linkages of the modified oligonucleotides are stereorandom.

[0266] Implementation Scheme 83. A pharmaceutical composition comprising a group of modified oligonucleotides as described in any of the embodiments of Implementation Schemes 77-82 and a pharmaceutically acceptable diluent or carrier.

[0267] Implementation Scheme 84. The pharmaceutical composition as described in any of Implementation Schemes 62-75, and a pharmaceutically acceptable diluent or carrier.

[0268] Implementation Scheme 85. The pharmaceutical composition as described in Implementation Scheme 84, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

[0269] Implementation Scheme 86. The pharmaceutical composition of Implementation Scheme 85, wherein the pharmaceutical composition comprises essentially the modified oligonucleotide and artificial cerebrospinal fluid or phosphate-buffered saline.

[0270] Implementation Scheme 87. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isolength portion of an ATXN1 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleosides.

[0271] Implementation Scheme 88. The oligomeric compound as described in Implementation Scheme 87, wherein the ATXN1 nucleic acid has a nucleobase sequence of any of the following: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0272] Implementation Scheme 89. An oligomeric compound as described in Implementation Scheme 87 or Implementation Scheme 88, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to the isolength portions of the following nucleobases:

[0273] The equal-length portion of nucleobases 5472-5552 of SEQ ID NO:1;

[0274] The equal-length portion of nucleobases 5906-6005 of SEQ ID NO:1;

[0275] The equal-length portion of nucleobases 7868-7911 in SEQ ID NO:1;

[0276] The equal-length portion of nucleobases 8481-8514 of SEQ ID NO:1; or

[0277] The equal-length portion of nucleobases 446679-446706 of SEQ ID NO:2.

[0278] Implementation Scheme 90. An oligomeric compound as described in any of Implementation Schemes 87-89, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to the isolength portions of the following nucleosides:

[0279] The equal-length portion of nucleobases 5489-5508 of SEQ ID NO:1;

[0280] The equal-length portion of nucleobases 5491-5507 of SEQ ID NO:1;

[0281] The equal-length portion of nucleobases 5912-5931 of SEQ ID NO:1;

[0282] The equal-length portion of nucleobases 7892-7911 of SEQ ID NO:1;

[0283] The equal-length portion of nucleobases 8481-8500 of SEQ ID NO:1; or

[0284] The equal-length portion of nucleobases 446680-446699 of SEQ ID NO:2.

[0285] Implementation Scheme 91. An oligomeric compound as described in any of Implementation Schemes 87-90, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the ATXN1 nucleic acid.

[0286] Implementation Scheme 92. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent nucleobases comprising any one of SEQ ID NO: 22-3624 or 3655.

[0287] Implementation Scheme 93. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 adjacent nucleobases comprising any one of SEQ ID NO: 3625-3654 or 3656-3669.

[0288] Implementation Scheme 94. An oligomeric compound as described in Implementation Scheme 92 or 93, wherein the modified oligonucleotide has a nucleobase sequence comprising any of the nucleobase sequences in SEQ ID NO: 22-3669.

[0289] Implementation Scheme 95. The oligomeric compound of Implementation Scheme 94, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NO:22-3669.

[0290] Implementation Scheme 96. An oligomeric compound as described in any of Implementation Schemes 92-95, wherein the modified oligonucleotide has a nucleotide sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 adjacent nucleotides selected from the following sequences:

[0291] SEQ ID NO:196, 274, 352, 430, 508, 2578, 2655, 2732, 2809, 2886, 2963, 3121, 3122, 3190, 3191, 3192, 326 2. 3330, 3331, 3332, 3401, 3402, 3575, 3577, 3620, 3624, 3638-3640, 3653-3655, 3662, 3665, 3669;

[0292] SEQ ID NO:42, 120, 198, 276, 509, 587, 2502, 2579, 2656, 2733, 2810, 2887, 2964, 35 85, 3588-3590, 3615, 3618, 3622, 3657, 3660, 3661, 3663, 3664, 3666-3668;

[0293] SEQ ID NO:48, 126, 2044, 2121;

[0294] SEQ ID NO: 128, 206, 284, 1045, 1122, 1199, and 1276; or

[0295] SEQ ID NOs: 2475, 2552, 2629, 2706, 2783, 3627-3630, 3644.

[0296] Implementation Scheme 97. An oligomeric compound as described in any of Implementation Schemes 92-95, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 or 17 adjacent nucleobases of any of the nucleobase sequences of SEQ ID NO:3638.

[0297] Implementation Scheme 98. An oligomeric compound as described in any of Implementation Schemes 92-95, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleobases.

[0298] Implementation Scheme 99. An oligomeric compound as described in Implementation Scheme 97 or 98, wherein the modified oligonucleotide consists of 17 to 30 linked nucleosides and has a nucleobase sequence comprising any one of 126, 1045, 2552, 3190, 3590 or 3638.

[0299] Implementation Scheme 100. The oligomeric compound of Implementation Scheme 99, wherein the modified oligonucleotide has a nucleobase sequence consisting of a nucleobase sequence of any one of 126, 1045, 2552, 3190, 3590 or 3638.

[0300] Implementation Scheme 101. An oligomeric compound as described in any of Implementation Schemes 92-100, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the ATXN1 nucleic acid, wherein the ATXN1 nucleic acid has a nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0301] Implementation Scheme 102. An oligomeric compound as described in any of the embodiments 87-101, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0302] Implementation Scheme 103. The oligomer compound as described in Implementation Scheme 102, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0303] Implementation Scheme 104. The oligomeric compound as described in Implementation Scheme 103, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0304] Implementation Scheme 105. An oligomeric compound as described in any of Implementation Schemes 102-104, wherein the modified nucleoside comprises a modified non-bicyclic sugar moiety.

[0305] Implementation Scheme 106. The oligomer compound as described in Implementation Scheme 105, wherein the modified non-bicyclic sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe modified sugar moiety.

[0306] Implementation Scheme 107. An oligomeric compound as described in any of Implementation Schemes 102-106, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar substitute.

[0307] Implementation Scheme 108. The oligomeric compound as described in Implementation Scheme 107, wherein the sugar substitute is selected from morpholino and PNA.

[0308] Implementation Scheme 109. An oligomeric compound as described in any of Implementation Schemes 87-102 or 105-108, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0309] Implementation Scheme 110. An oligomeric compound as described in any of Implementation Schemes 87-109, wherein the modified oligonucleotide comprises at least one modified nucleoside linker.

[0310] Implementation Scheme 111. The oligomeric compound as described in Implementation Scheme 110, wherein at least one modified nucleoside link is a thiophosphate nucleoside link.

[0311] Implementation Scheme 112. The oligomeric compound as described in Implementation Scheme 110 or 111, wherein each nucleoside link is a modified nucleoside link.

[0312] Implementation Scheme 113. The oligomeric compound as described in Implementation Scheme 112, wherein the internucleotide linkage is a thiophosphate nucleoside linkage.

[0313] Implementation Scheme 114. An oligomeric compound as described in any of Implementation Schemes 110-111, wherein at least one nucleoside link of the modified oligonucleotide is a phosphodiester nucleoside link.

[0314] Implementation Scheme 115. An oligomeric compound as described in any of Implementation Schemes 87-109, wherein each nucleoside link of the modified oligonucleotide is independently selected from phosphate diester or thiophosphate nucleoside links.

[0315] Implementation Scheme 116. An oligomeric compound as described in any of Implementation Schemes 87-115, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 nucleoside linkages of the modified oligonucleotide are phosphate thioside linkages.

[0316] Implementation Scheme 117. The oligomeric compound as described in Implementation Scheme 116, wherein the modified oligonucleotide has an internucleotide-linking motif selected from soooossssssssssssooss, sssosssssssssssssss, sssosssssssssssss or soooossssssssssss; wherein,

[0317] s = thiophosphate nucleoside linkage and o = phosphodiester nucleoside linkage.

[0318] Implementation Scheme 118. An oligomeric compound as described in any of Implementation Schemes 87-117, wherein the modified oligonucleotide comprises a modified nucleobase.

[0319] Implementation Scheme 119. The oligomeric compound as described in Implementation Scheme 118, wherein the modified nucleobase is 5-methylcytosine.

[0320] Implementation Scheme 120. An oligomeric compound as described in any of Implementation Schemes 1-33, wherein the modified oligonucleotide comprises a deoxygenated region consisting of 5-12 adjacent 2'-deoxynucleotides.

[0321] Implementation Scheme 121. The oligomeric compound as described in Implementation Scheme 120, wherein each nucleoside of the deoxygenated region is a 2'-β-D-deoxynucleoside.

[0322] Implementation Scheme 122. The oligomeric compound as described in Implementation Scheme 120 or 121, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10 or 6-10 linked nucleosides.

[0323] Implementation Scheme 123. An oligomeric compound as described in any of Implementation Schemes 120-122, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

[0324] Implementation Scheme 124. An oligomeric compound as described in any of Implementation Schemes 120-122, wherein the deoxygenated region is side-attached on the 5' side with a 5' region consisting of 1-6 linked 5' region nucleosides and side-attached on the 3' side with a 3' external region consisting of 1-6 linked 3' region nucleosides; wherein

[0325] The 3'-terminal nucleotide of the 5' region contains a modified sugar moiety; and

[0326] The 5'-terminal nucleotide of the 3' region contains a modified sugar moiety.

[0327] Implementation Scheme 125. The oligomeric compound as described in Implementation Scheme 124, wherein each nucleoside in the 3' region comprises a modified sugar moiety.

[0328] Implementation Scheme 126. The oligomeric compound as described in Implementation Scheme 124 or 125, wherein each nucleoside in the 5' region comprises a modified sugar moiety.

[0329] Implementation Scheme 127. The oligomeric compound as described in Implementation Schemes 120-126, wherein the modified oligonucleotide has

[0330] The 5' region consists of 1-6 linked nucleosides;

[0331] The deoxygenated region, which consists of 6-10 linked nucleosides; and

[0332] The 3' region consists of 1-6 linked nucleosides; among which

[0333] Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety.

[0334] Implementation Scheme 128. The oligomeric compound as described in Implementation Scheme 127, wherein the modified oligonucleotide has

[0335] The 5' region consists of 6 linked nucleosides;

[0336] The deoxygenated region, which consists of 10 linked nucleosides; and

[0337] The 3' region consists of four linked nucleosides; among which

[0338] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the deoxy region nucleosides is 2'-β-D-deoxy nucleosides.

[0339] Implementation Scheme 129. The oligomeric compound as described in Implementation Scheme 127, wherein the modified oligonucleotide has

[0340] The 5' region consists of five linked nucleosides;

[0341] The central region, which consists of 10 linked nucleosides; and

[0342] The 3' region consists of five linked nucleosides; among which

[0343] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the deoxy region nucleosides is 2'-β-D-deoxy nucleosides.

[0344] Implementation Scheme 130. The oligomeric compound as described in Implementation Scheme 127, wherein the modified oligonucleotide has

[0345] The 5' region consists of five linked nucleosides;

[0346] The deoxygenated region, which consists of eight linked nucleosides; and

[0347] The 3' region consists of four linked nucleosides; among which

[0348] Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-MOE nucleosides, and each of the deoxy region nucleosides is 2'-β-D-deoxy nucleosides.

[0349] Implementation Scheme 131. The oligomeric compound as described in Implementation Scheme 127, wherein the modified oligonucleotide has

[0350] The 5' region consists of five linked nucleosides;

[0351] The deoxygenated region, which consists of eight linked nucleosides; and

[0352] The 3' region consists of four linked nucleosides; among which

[0353] Each of the 5' region nucleosides is a 2'-MOE nucleoside, each of the 3' region nucleosides is selected from 2'-MOE nucleosides and cEt nucleosides, and each of the deoxy region nucleosides is a 2'-β-D-deoxy nucleoside.

[0354] Implementation Scheme 132. An oligomeric compound as described in any of Implementation Schemes 87-119, wherein the modified oligonucleotide has

[0355] The 5' region consists of 3-7 linked nucleosides;

[0356] The deoxygenated region consists of 6-8 linked nucleosides; and

[0357] The 3' region consists of 3-6 linked nucleosides; among which

[0358] Each of the 3' region nucleosides is selected from 2'-MOE nucleosides and cEt nucleosides, and the 5' region has the following formula:

[0359] (Nk)n(Nd)(Nx)

[0360] Each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside.

[0361] And n is 1-5.

[0362] Implementation Scheme 133. An oligomeric compound as described in any of Implementation Schemes 87-119, wherein the modified oligonucleotide has

[0363] The 5' region consists of 7 linked nucleosides;

[0364] The deoxygenated region, which consists of 6 linked nucleosides; and

[0365] The 3' region consists of four linked nucleosides; among which

[0366] Each of the 3' region nucleosides is selected from 2'-MOE nucleosides and cEt nucleosides, and the 5' region has the following formula:

[0367] (Nk)n(Nd)(Nx)

[0368] Each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside.

[0369] And n is 5.

[0370] Implementation Scheme 134. An oligomeric compound as described in any of Implementation Schemes 87-133, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 16-18, 14-20, 15-17, 15-25, 16-20 or 17-20 linked nucleosides.

[0371] Implementation Scheme 135. An oligomeric compound as described in any of Implementation Schemes 87-132, wherein the modified oligonucleotide is composed of 18-22 or 18-20 linked nucleosides.

[0372] Implementation Scheme 136. An oligomeric compound as described in any of Implementation Schemes 87-133, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0373] Implementation Scheme 137. An oligomeric compound as described in any of Implementation Schemes 87-132, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0374] Implementation Scheme 138. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0375] Ges m Ceo Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo TeoTes m Ces Ae(SEQ ID NO:126), where,

[0376] A = adenine nucleobase,

[0377] m C = 5-methylcytosine nucleobase,

[0378] G = guanine nucleobase

[0379] T = thymine nucleobase,

[0380] e = 2'-MOE sugar moiety,

[0381] d = 2'-β-D deoxyribosyl sugar moiety,

[0382] s = thiophosphate nucleoside linkage, and

[0383] o = phosphate diester nucleoside linkage.

[0384] Implementation Scheme 139. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0385] Ges m Ceo Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds TeoGeo Tes Aes mCe(SEQ ID NO:1045), where,

[0386] A = adenine nucleobase,

[0387] m C = 5-methylcytosine nucleobase,

[0388] G = guanine nucleobase

[0389] T = thymine nucleobase,

[0390] e = 2'-MOE sugar moiety,

[0391] d = 2'-β-D deoxyribosyl sugar moiety,

[0392] s = thiophosphate nucleoside linkage, and

[0393] o = phosphate diester nucleoside linkage.

[0394] Implementation Scheme 140. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0395] Ges m Ceo m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m CeoTeo Tes Tes m Ce(SEQ ID NO:2552), where,

[0396] A = adenine nucleobase,

[0397] m C = 5-methylcytosine nucleobase,

[0398] G = guanine nucleobase

[0399] T = thymine nucleobase,

[0400] e = 2'-MOE sugar moiety,

[0401] d = 2'-β-D deoxyribosyl sugar moiety,

[0402] s = thiophosphate nucleoside linkage, and

[0403] o = phosphate diester nucleoside linkage.

[0404] Implementation Scheme 141. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0405] Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m Ceo m Ces Aes Te(SEQ ID NO:3190), where,

[0406] A = adenine nucleobase,

[0407] m C = 5-methylcytosine nucleobase,

[0408] G = guanine nucleobase

[0409] T = thymine nucleobase,

[0410] e = 2'-MOE sugar moiety,

[0411] d = 2'-β-D deoxyribosyl sugar moiety,

[0412] s = thiophosphate nucleoside linkage, and

[0413] o = phosphate diester nucleoside linkage.

[0414] Implementation Scheme 142. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0415] m Ces m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m Ceo Aes Tes m Ce(SEQ ID NO:3590), where,

[0416] A = adenine nucleobase,

[0417] m C = 5-methylcytosine nucleobase,

[0418] G = guanine nucleobase

[0419] T = thymine nucleobase,

[0420] e = 2'-MOE sugar moiety,

[0421] d = 2'-β-D deoxyribosyl sugar moiety,

[0422] s = thiophosphate nucleoside linkage, and

[0423] o = phosphate diester nucleoside linkage.

[0424] Implementation Scheme 143. A compound comprising a modified oligonucleotide according to the following chemical notation:

[0425] Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m Ce(SEQ ID NO:3638), where,

[0426] A = adenine nucleobase,

[0427] m C = 5-methylcytosine nucleobase,

[0428] G = guanine nucleobase

[0429] T = thymine nucleobase,

[0430] e = 2'-MOE sugar moiety,

[0431] d = 2'-β-D deoxyribosyl sugar moiety,

[0432] s = thiophosphate nucleoside linkage, and

[0433] o = phosphate diester nucleoside linkage.

[0434] Implementation Scheme 144. An oligomeric compound as described in any of Implementation Schemes 87-143, wherein the oligomeric compound comprises the modified oligonucleotide.

[0435] Implementation Scheme 145. An oligomeric compound as described in any of Implementation Schemes 87-144, wherein the oligomeric compound comprises a conjugating group, the conjugating group comprising a conjugating portion and a conjugating connector.

[0436] Implementation Scheme 146. The oligomeric compound as described in Implementation Scheme 145, wherein the coupling linker is composed of a single bond.

[0437] Implementation Scheme 147. The oligomeric compound as described in Implementation Scheme 145, wherein the coupling linker is cleavable.

[0438] Implementation Scheme 148. The oligomeric compound as described in Implementation Scheme 145, wherein the conjugated linker comprises 1-3 linker nucleosides.

[0439] Implementation Scheme 149. An oligomeric compound as described in any of Implementation Schemes 145-148, wherein the conjugated linker does not contain any linker nucleoside.

[0440] Implementation Scheme 150. An oligomeric compound as described in any of Implementation Schemes 145-148, wherein the conjugating group is attached to the 5' end of the modified oligonucleotide.

[0441] Implementation Scheme 151. An oligomeric compound as described in any of Implementation Schemes 145-148, wherein the conjugating group is attached to the 3' end of the modified oligonucleotide.

[0442] Implementation Scheme 152. An oligomeric compound as described in any of Implementation Schemes 87-143 or 146-148, wherein the oligomeric compound comprises a terminal group.

[0443] Implementation Scheme 153. The oligomer compound as described in Implementation Scheme 152, wherein the terminal group is a non-basic sugar moiety.

[0444] Implementation Scheme 154. An oligomeric compound as described in any of Implementation Schemes 87-153, wherein the oligomeric compound is a single-chain oligomeric compound.

[0445] Implementation Scheme 155. A modified oligonucleotide according to the following chemical structure,

[0446] (SEQ ID NO:126), or its salt.

[0447] Implementation Scheme 156. A modified oligonucleotide according to the following chemical structure,

[0448] (SEQ ID NO:1045), or its salt.

[0449] Implementation Scheme 157. A modified oligonucleotide according to the following chemical structure,

[0450] (SEQ ID NO:2552), or its salt.

[0451] Implementation Scheme 158. A modified oligonucleotide according to the following chemical structure,

[0452] (SEQ ID NO:3190), or its salt.

[0453] Implementation Scheme 159. A modified oligonucleotide according to the following chemical structure,

[0454] (SEQ ID NO:3590), or its salt.

[0455] Implementation Scheme 160. A modified oligonucleotide according to the following chemical structure,

[0456] (SEQ ID NO:3638), or its salt.

[0457] Implementation Scheme 161. The modified oligonucleotide as described in any of Implementation Schemes 155-160, wherein the modified oligonucleotide is a sodium or potassium salt.

[0458] Implementation Scheme 162. A modified oligonucleotide according to the following chemical structure,

[0459] (SEQ ID NO:126).

[0460] Implementation Scheme 163. A modified oligonucleotide according to the following chemical structure,

[0461] (SEQ ID NO:1045).

[0462] Implementation Scheme 164. A modified oligonucleotide according to the following chemical structure,

[0463] (SEQ ID NO:2552).

[0464] Implementation Scheme 165. A modified oligonucleotide according to the following chemical structure,

[0465] (SEQ ID NO:3190).

[0466] Implementation Scheme 166. A modified oligonucleotide according to the following chemical structure,

[0467] (SEQ ID NO:3590).

[0468] Implementation Scheme 167. A modified oligonucleotide according to the following chemical structure,

[0469] (SEQ ID NO:3638).

[0470] Implementation Scheme 168. An oligomer compound of any of the embodiments 87-154 or a chiral enrichment cluster of a modified oligonucleotide of embodiments 155-167, wherein the enrichment comprises at least one modified oligonucleotide having a specific stereochemical configuration linked between specific phosphate ester nucleosides.

[0471] Implementation Scheme 169. A chiral enrichment cluster as described in Implementation Scheme 168, wherein the enrichment cluster comprises at least one modified oligonucleotide having a specific thiophosphate nucleoside linkage having a (Sp) or (Rp) configuration.

[0472] Implementation Scheme 170. The chiral enriched clusters as described in Implementation Scheme 169, wherein the clusters are enriched in modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside linker.

[0473] Implementation Scheme 171. A chiral enriched cluster as described in Implementation Scheme 170, wherein the cluster is enriched in modified oligonucleotides having an (Rp) configuration at a specific thiophosphate nucleoside linker and an (Sp) configuration at each of the remaining thiophosphate nucleoside linkers.

[0474] Implementation Scheme 172. The chiral enrichment cluster as described in Implementation Scheme 171, wherein the cluster is enriched with at least three modified oligonucleotides having Sp, Sp, and Rp configurations in the 5' to 3' direction.

[0475] Implementation Scheme 173. A group of oligomeric compounds comprising modified oligonucleotides as described in any of the embodiments 87-154 or a group of modified oligonucleotides as described in embodiments 155-167, wherein all phosphate thioester nucleoside linkages of the modified oligonucleotides are stereorandom.

[0476] Implementation Scheme 174. An oligoduplex comprising a first oligomer and a second oligomer comprising a second modified oligonucleotide, wherein the first oligomer is the oligomer of any of Implementation Schemes 87-154.

[0477] Implementation Scheme 175. The oligoduplex as described in Implementation Scheme 174, wherein the second oligomer compound comprises a second modified oligonucleotide consisting of 12 to 30 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleosides that is at least 90% complementary to the isolength portion of the first modified oligonucleotide.

[0478] Implementation Scheme 176. The oligoduplex as described in Implementation Scheme 174 or 175, wherein the modified oligonucleotide of the first oligomer compound contains a 5'-stable phosphate group.

[0479] Implementation Scheme 177. The oligomeric duplex as described in Implementation Scheme 176, wherein the stable phosphate group comprises cyclopropylphosphonate or vinylphosphonate.

[0480] Implementation Scheme 178. An oligoduplex as described in any of Implementation Schemes 174-177, wherein the modified oligonucleotide of the first oligomer compound comprises a diol nucleic acid (GNA) sugar substitute.

[0481] Implementation Scheme 179. An oligoduplex as described in any of Implementation Schemes 174-178, wherein the modified oligonucleotide of the first oligomer compound comprises a 2'-NMA sugar moiety.

[0482] Implementation Scheme 180. An oligoduplex as described in any of Implementation Schemes 174-179, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0483] Implementation Scheme 181. The oligoduplex as described in Implementation Scheme 180, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0484] Implementation Scheme 182. The oligoduplex as described in Implementation Scheme 181, wherein the bicyclic sugar portion of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0485] Implementation Scheme 183. The oligoduplex as described in Implementation Scheme 182, wherein the modified sugar moiety of the second modified oligonucleotide comprises a modified non-bicyclic sugar moiety.

[0486] Implementation Scheme 184. The oligoduplex as described in Implementation Scheme 183, wherein the modified non-bicyclic sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0487] Implementation Scheme 185. An oligoduplex as described in any of Implementation Schemes 174-184, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar substitute.

[0488] Implementation Scheme 186. An oligoduplex as described in any of Implementation Schemes 174-185, wherein at least one nucleoside link of the second modified oligonucleotide is a modified nucleoside link.

[0489] Implementation Scheme 187. The oligoduplex as described in Implementation Scheme 186, wherein at least one modified nucleoside link of the second modified oligonucleotide is a phosphate thioside link.

[0490] Implementation Scheme 188. An oligoduplex as described in any of Implementation Schemes 174-187, wherein at least one nucleoside link of the second modified oligonucleotide is a phosphodiester nucleoside link.

[0491] Implementation Scheme 189. An oligomeric duplex as described in any of Implementation Schemes 174-188, wherein each nucleoside link of the second modified oligonucleotide is independently selected from phosphate diester or thiophosphate nucleoside links.

[0492] Implementation Scheme 190. An oligomeric duplex as described in any of Implementation Schemes 174-189, wherein each nucleoside link of the second modified oligonucleotide is independently selected from phosphodiester nucleoside linking, thiophosphate nucleoside linking, or methanesulfonylaminophosphate nucleoside linking.

[0493] Implementation Scheme 191. An oligoduplex as described in any of Implementation Schemes 174-190, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0494] Implementation Scheme 192. The oligoduplex as described in Implementation Scheme 191, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

[0495] Implementation Scheme 193. An oligomeric duplex as described in any of Implementation Schemes 174-192, wherein the second modified oligonucleotide comprises a conjugating group.

[0496] Implementation Scheme 194. The oligomeric duplex as described in Implementation Scheme 193, wherein the conjugating group comprises a conjugating linker and a conjugating portion.

[0497] Implementation Scheme 195. An oligomeric duplex as described in Implementation Scheme 193 or 194, wherein the conjugation group is attached to the 5' end of the second modified oligonucleotide.

[0498] Implementation Scheme 196. An oligomeric duplex as described in Implementation Scheme 193 or 194, wherein the conjugation group is attached to the 3' end of the modified oligonucleotide to the second modified oligonucleotide.

[0499] Implementation Scheme 197. An oligomeric duplex as described in any of Implementation Schemes 193-196, wherein the second modified oligonucleotide comprises a terminal group.

[0500] Implementation Scheme 198. The oligomeric duplex as described in Implementation Scheme 197, wherein the terminal group is a non-basic sugar moiety.

[0501] Implementation Scheme 199. An oligomeric duplex as described in any of Implementation Schemes 174-198, wherein the second modified oligonucleotide comprises 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, or 16 to 20. Composed of 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0502] Implementation Scheme 200. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound as described in any of the embodiments of Implementation Schemes 87-154 or a modified oligonucleotide as described in any of the embodiments of Implementation Schemes 155-167.

[0503] Implementation Scheme 201. The antisense agent as described in Implementation Scheme 200, wherein the antisense agent is an oligomeric duplex as described in any of the embodiments 174-199.

[0504] Implementation Scheme 202. The antisense agent as described in Implementation Scheme 200 or 201, wherein the antisense agent is an RNase H agent capable of reducing the amount of ATXN1 nucleic acid by activating RNase H.

[0505] Implementation scheme 203. The antisense agent as described in any of the embodiments 200-202, wherein the conjugation group comprises a cell-targeting portion.

[0506] Implementation Scheme 204. A pharmaceutical composition comprising an oligomer compound as described in any of the embodiments of Implementation Schemes 87-154, a modified oligonucleotide as described in any of the embodiments of Implementation Schemes 155-167, a group as described in any of the embodiments of Implementation Schemes 168-173, an oligomeric duplex as described in any of the embodiments of Implementation Schemes 174-199, or an antisense agent as described in any of the embodiments of Implementation Schemes 200-203, and a pharmaceutically acceptable carrier or diluent.

[0507] Implementation Scheme 205. The pharmaceutical composition as described in Implementation Scheme 204, wherein the pharmaceutically acceptable diluent is water, phosphate-buffered saline, or artificial cerebrospinal fluid.

[0508] Implementation Scheme 206. The pharmaceutical composition of Implementation Scheme 205, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

[0509] Implementation Scheme 207. A method comprising administering to a subject an oligomeric compound of any of the embodiments of Implementation Schemes 87-154, a modified oligonucleotide of any of the embodiments of Implementation Schemes 155-167, a population of any of the embodiments of Implementation Schemes 168-173, an oligomeric duplex of any of the embodiments of Implementation Schemes 174-199, an antisense agent of any of the embodiments of Implementation Schemes 200-203, or a pharmaceutical composition of any of the embodiments of Implementation Schemes 204-206.

[0510] Implementation Scheme 208. A method of treating an ATXN1-related disease, the method comprising administering to a subject suffering from an ATXN1-related disease a therapeutically effective amount of an oligomeric compound of any of embodiments 87-154, a modified oligonucleotide of any of embodiments 155-167, a population of any of embodiments 168-173, an oligomeric duplex of any of embodiments 174-199, an antisense agent of any of embodiments 200-203, or a pharmaceutical composition of any of embodiments 204-206; thereby treating the ATXN1-related disease.

[0511] Implementation scheme 209. The method as described in implementation scheme 208, wherein the ATXN1-related disease is type 1 spinocerebellar ataxia.

[0512] Implementation Scheme 210. The method described in any of the embodiments of Implementation Schemes 208-209, wherein at least one symptom or marker of the ATXN1-related disease is improved.

[0513] Implementation Scheme 211. The method as described in Implementation Scheme 210, wherein the symptoms or signs are gait or limb ataxia, cognitive impairment, difficulty speaking or swallowing, cerebellar and / or brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and / or brainstem detected by magnetic resonance spectroscopy (MRS), or death within 10-15 years after the onset of symptoms.

[0514] Implementation Scheme 212. The method of any of the implementation schemes 208-211, wherein the ATXN1 level in the subject is reduced.

[0515] Implementation Scheme 213. A method for reducing ATXN1 expression in cells, the method comprising contacting the cells with an oligomer compound of any of the embodiments of Implementation Schemes 87-154, a modified oligonucleotide of any of the embodiments of Implementation Schemes 155-167, a population of any of the embodiments of Implementation Schemes 168-173, an oligomeric duplex of any of the embodiments of Implementation Schemes 174-199, an antisense agent of any of the embodiments of Implementation Schemes 200-203, or a pharmaceutical composition of any of the embodiments of Implementation Schemes 204-206.

[0516] Implementation Scheme 214. The method as described in Implementation Scheme 213, wherein the cell is a CNS cell.

[0517] Implementation Scheme 215. Use of an oligomeric compound according to any of the embodiments 87-154, a modified oligonucleotide according to any of the embodiments 155-167, a group according to any of the embodiments 168-173, an oligomeric duplex according to any of the embodiments 174-199, an antisense agent according to any of the embodiments 200-203, or a pharmaceutical composition according to any of the embodiments 204-206 for the treatment of diseases associated with ATXN1.

[0518] Implementation Scheme 216. Use of an oligomeric compound according to any of the embodiments 87-154, a modified oligonucleotide according to any of the embodiments 155-167, a group according to any of the embodiments 168-173, an oligomeric duplex according to any of the embodiments 174-199, an antisense agent according to any of the embodiments 200-203, or a pharmaceutical composition according to any of the embodiments 204-206, for the manufacture of a medicament for treating diseases associated with ATXN1.

[0519] Implementation scheme 217. Use as described in implementation scheme 215 or 216, wherein the disease associated with ATXN1 is type 1 spinocerebellar ataxia.

[0520] I. certain oligonucleotides

[0521] In some embodiments, this document provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides, relative to unmodified RNA or DNA, comprise at least one modification. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified inter-nucleoside bond.

[0522] A. Some modified nucleosides

[0523] Modified nucleosides contain either a modified sugar moiety or a modified nucleobase, or both.

[0524] 1. Some sugar portions

[0525] In some embodiments, the modified sugar moiety is a modified non-bicyclic sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to those substitutions of other types of modified sugar moieties.

[0526] In some embodiments, the modified sugar moiety is a modified non-bicyclic sugar moiety comprising a furanyl ring having one or more substituents, none of which bridge the two atoms of the furanyl ring to form a bicyclic structure. Such non-bridging substituents can be located at any position on the furanyl ring, including (but not limited to) substituents located at the 2', 4', and / or 5' positions. In some embodiments, one or more non-bridging substituents of the modified non-bicyclic sugar moiety have branched chains. Examples of suitable 2'-substituents for the modified non-bicyclic sugar moiety include (but are not limited to): 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”). In some embodiments, the 2'-substituent is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy group, substituted O-C1-C 10 Alkoxy, O-C1-C 10 Alkyl, substituted O-C1-C10 Alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, Alkyne, Alkylaryl, Arylalkyl, O-Alkylaryl, O-Arylalkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n Independently, it is an H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 Alkyl groups, and 2'-substituents as described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Certain embodiments of the 2'-substituent may be further substituted with one or more substituents independently selected from: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for the modified non-bicyclic sugar moiety include (but are not limited to) alkoxy groups (e.g., methoxy), alkyl groups, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for the modified non-bicyclic sugar moiety include (but are not limited to): 5-methyl (R or S), 5'-vinyl, and 5'-methoxy. In some embodiments, the modified non-bicyclic sugar moiety comprises one or more non-bridging sugar substituents, such as the 2'-F-5'-methyl sugar moiety, as well as the modified sugar moiety and modified nucleoside described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0527] In some embodiments, the 2'-substituted modified non-bicyclic nucleotide comprises a sugar moiety containing a non-bridging 2'-substituent selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n)), where each R m and R n Independently, it is an H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 alkyl.

[0528] In some embodiments, the 2'-substituted modified non-bicyclic nucleotide comprises a sugar moiety containing a non-bridging 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).

[0529] In some embodiments, the 2'-substituted nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent selected from the following: F, OCH3, and OCH2CH2OCH3.

[0530] In some embodiments, the modified furanyl sugar moiety and the nucleotide having such modified furanyl sugar moiety are further defined by isomer configuration. For example, the 2'-deoxyfuranyl sugar moiety can have seven isomer configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has another stereocenter at the 2' position relative to the 2'-deoxyfuranyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomer configurations. Unless otherwise specified, the 2'-modified sugar moiety described herein is in the β-D-ribosyl isomer configuration.

[0531] Some modified sugar moieties contain substituents that bridge two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moieties. In some such embodiments, the bicyclic sugar moieties contain bridges between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include (but are not limited to): 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “restricted ethyl” or “cEt”), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (“restricted MOE” or “cMOE”) and their analogues (see, for example, Seth et al., US7,399,845; Bhat et al., US7,569,686; Swayze et al., US7,741,457; and Swayze et al., US8,022,193), 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, Seth et al., US8,278,283), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, Prakash et al., US8,278,425), 4'-CH2-ON(CH3)-2' (see, for example, Allen et al., US7,696,345 and Allen et al., US8,124,745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou et al., J.Org.Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently, it is H, a protecting group, or C1-C. 12 Alkyl (see, for example, Imanishi et al., US7,427,672).

[0532] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups independently selected from: -[C(R a (R) b)] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a ) = N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R) a )-;

[0533] in:

[0534] x is 0, 1, or 2;

[0535] n is 1, 2, 3 or 4;

[0536] Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxide (S(=O)-J1); and

[0537] Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C 12 Aminoalkyl, substituted C1-C 12Aminoalkyl groups or protecting groups.

[0538] Other bicyclic sugar moieties are known in the art; see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 836. 2-8379; Wengel et al., US7,053,207; Imanishi et al., US6,268,490; Imanishi et al., US6,770,748; Imanishi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; Ramasamy et al., US6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and Allenson et al., US Patent Publication No. US2008 / 0039618 and Migawa et al., US Patent Publication No. US2015 / 0191727.

[0539] In some embodiments, the bicyclic sugar moiety and the nucleotide having such a bicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleotides (described herein) may be in the α-L configuration or the β-D configuration.

[0540]

[0541] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this document, the general description of bicyclic nucleotides includes two isomer configurations. Unless otherwise specified, when the position of a particular bicyclic nucleotide (e.g., LNA or cEt) is identified in the embodiments exemplified herein, it is in the β-D configuration.

[0542] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugars and 4'-2' bridging sugars).

[0543] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, the modified sugar moiety also contains bridging and / or non-bridging substituents as set forth herein. For example, some sugar substitutes contain a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5' position.

[0544] In some embodiments, the sugar substitute comprises a ring of not more than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include (but are not limited to) hexotol nucleic acids (“HNA”), anitol nucleic acids (“ANA”), mannitol nucleic acids (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0545]

[0546] (“F-HNA”, see, for example, Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropiperanone) and nucleosides containing other modified THP compounds having the following formula:

[0547]

[0548] Specifically, for each modified THP nucleotide:

[0549] Bx is the nucleobase portion;

[0550] T3 and T4 are each independently an internucleotide linker group that links the modified THP nucleoside to the rest of the oligonucleotide, or one of T3 and T4 is an internucleotide linker group that links the modified THP nucleoside to the rest of the oligonucleotide and the other of T3 and T4 is an H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group.

[0551] q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, or substituted C2-C6 ynyl; and

[0552] R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and J1, J2 and J3 are each independently H or C1-C6 alkyl.

[0553] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.

[0554] In some embodiments, the sugar substitute comprises a ring having five or more atoms and one or more heteroatoms. For example, nucleosides comprising a morpholinyl sugar moiety and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholinyl" means a sugar substitute having the following structure:

[0555]

[0556] In some embodiments, the morpholino group can be modified, for example, by adding or changing various substituents compared to the morpholino group structure described above. Such sugar substitutes are referred to herein as "modified morpholino groups".

[0557] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include (but are not limited to): peptide nucleic acids (“PNA”), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0558] Many other bicyclic and tricyclic sugars and sugar substitute ring systems are known in the art for use in modified nucleosides.

[0559] 2. certain modified nucleobases

[0560] In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, referred to as a base-free nucleoside.

[0561] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobase is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil; 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and other 8 -Substituted purines; 5-halogens, especially 5-bromo, 5-trifluoromethyl, 5-halogenuridine and 5-halogencytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluridine, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluridine, universal bases, hydrophobic bases, mixed bases, enlarged bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which purine or pyrimidine bases are replaced by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in Merigan et al., US3,687,808; The Concise Encyclopedia Of Polymer Science and Engineering, Kroschwitz, JI (ed.), John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Antisense Research and Applications, Crooke, ST and Lebleu, B. (eds.), CRC Press, Chapter 15, 1993, 273-288; and Antisense Drug Technology, Crooke ST (ed.), CRC Press, Chapters 6 and 15, 2008, 163-166 and 442-443.

[0562] Disclosures teaching the preparation of certain of the above-mentioned modified nucleosides and other modified nucleosides include (but are not limited to) Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,1 75,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525,7 11; Haralambidis et al., US5,552,540; Cook et al., US5,587,469; Froehler et al., US5,594,121; Switzer et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al. Cook et al., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., 6,166,199; and Matteucci et al., US6,005,096.

[0563] 3. Certain modified nucleoside interlinking

[0564] In some embodiments, any nucleoside linker can be used to connect the nucleosides of modified oligonucleotides together. Two main classes of nucleoside linker groups are defined based on the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleoside linkers include (but are not limited to) phosphodiesters containing a phosphodiester bond (“P(O2)=O”) (also referred to as unmodified linkers or naturally occurring linkers); phosphotriesters; methylphosphonates; aminophosphates; and thiophosphates (“P(O2)=S”) and dithiophosphates (“HS-P=S”). Representative phosphorus-free nucleoside linker groups include (but are not limited to) methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thiocarbonyl carbamates (-OC(=O)(NH)-S-); siloxanes (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside interlinks, compared to naturally occurring phosphodiester nucleoside interlinks, can be used to alter, and typically increase, the nuclease resistance of oligonucleotides. In some embodiments, nucleoside interlinks with chiral atoms can be prepared as racemic mixtures or individual enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside interlinks are well known to those skilled in the art.

[0565] Representative internucleotide links with chiral centers include (but are not limited to) alkylphosphonates and thiophosphates. Modified oligonucleotides containing internucleotide links with chiral centers can be prepared into groups of modified oligonucleotides containing stereorandom internucleotide links, or into groups of modified oligonucleotides containing thiophosphate links exhibiting a specific stereochemical configuration. In some embodiments, the modified oligonucleotide group contains thiophosphate internucleotide links, wherein all of the thiophosphate internucleotide links are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in the random selection of the stereochemical configuration of each thiophosphate link. Nevertheless, as will be fully understood by those skilled in the art, each individual thiophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the modified oligonucleotide group is enriched with modified oligonucleotides containing one or more thiophosphate internucleotide links exhibiting a specific, independently selected stereochemical configuration. In some embodiments, at least 65% of the molecules in the group contain the specific configuration of the specific thiophosphate link. In some embodiments, at least 70% of the molecules in the population contain a specific configuration of a specific thiophosphate bond. In some embodiments, at least 80% of the molecules in the population contain a specific configuration of a specific thiophosphate bond. In some embodiments, at least 90% of the molecules in the population contain a specific configuration of a specific thiophosphate bond. In some embodiments, at least 99% of the molecules in the population contain a specific configuration of a specific thiophosphate bond. Such chiral enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in the following literature: Oka et al., JACS 125, 8307 (2003); Wan et al., Nuc. Acid. Res. 42, 13456 (2014); and WO 2017 / 015555. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides having at least one indicated thiophosphate in the (Sp) configuration. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides having at least one phosphate thioester in the (Rp) configuration. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphate thioesters each contain one or more of the following formulas, wherein "B" indicates a nucleobase:

[0566]

[0567] Unless otherwise indicated, the chiral nucleoside linkages of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration.

[0568] Neutral nucleoside linkages include (but are not limited to) phosphate triesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methyl acetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thiomethyl acetal (3'-S-CH2-O-5'). Other neutral nucleoside linkages include nonionic linkages, which include siloxanes (dialkylsiloxanes), carboxylic esters, carboxamides, sulfides, sulfonates, and amides (see, for example, Carbohydrate Modifications in Antisense Research; edited by YSSang hvi and PDCook, ACS Symposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside linkages include nonionic linkages comprising a mixture of N, O, S, and CH2 components. In some embodiments, the neutral nucleoside linkage is any of those nucleoside linkages set forth in WO 2021 / 030778, which is incorporated herein by reference.

[0569] B. certain motifs

[0570] In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified internucleotide bonds. In such embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or internucleotide bonds of the modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and internucleotide bonds are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or internucleotide bond motif (as used herein, the nucleotide motif describes the modification of the nucleotide and is independent of the sequence of the nucleotide).

[0571] 1. certain glycosylations

[0572] In some embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar motifs arranged in a defined pattern or glycomotif along the oligonucleotide or a portion thereof. In some cases, such glycomotifs include (but are not limited to) any of the sugar modifications discussed herein.

[0573] In some embodiments, the modified oligonucleotide has a gap polymer motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions (5' wing, gap, and 3' wing) of the gap polymer motif form adjacent sequences of nucleotides, wherein at least some sugar moieties of the nucleotide in each wing differ from at least some sugar moieties of the nucleotide in the gap. Specifically, at least some sugar moieties of the nucleotide closest to the gap in each wing (the 3'-thickest nucleotide of the 5' wing and the 5'-thickest nucleotide of the 3' wing) differ from the sugar moieties of the adjacent gap nucleotide, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap comprises one or more nucleotides having sugar moieties different from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the sugar motifs of the two wings are identical to each other (symmetric gap polymer). In some embodiments, the sugar motif of the 5' wing differs from the sugar motif of the 3' wing (asymmetric gap polymer).

[0574] In some embodiments, the wings of the interstitial polymer contain 1-6 nucleosides. In some embodiments, each nucleoside in each wing of the interstitial polymer contains a modified sugar moiety. In some embodiments, at least one nucleoside in each wing of the interstitial polymer contains a modified sugar moiety. In some embodiments, at least two nucleosides in each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least three nucleosides in each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least four nucleosides in each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least five nucleosides in each wing of the interstitial polymer contain a modified sugar moiety.

[0575] In some embodiments, the interstitial space of the interstitial polymer contains 7-12 nucleotides. In some embodiments, each nucleotide in the interstitial space of the interstitial polymer contains a 2'-deoxyribosyl sugar moiety. In some embodiments, each nucleotide in the interstitial space of the interstitial polymer contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide in the interstitial space of the interstitial polymer contains a modified sugar moiety. In some embodiments, at least one nucleotide in the interstitial space of the interstitial polymer contains a 2'-OMe sugar moiety.

[0576] In some embodiments, the interstitial polymer is a deoxyinterstitial polymer. In some embodiments, the nucleoside on the interstitial side of each wing / interstitial junction comprises a 2'-deoxyribosyl sugar moiety, and the nucleoside on the wing side of each wing / interstitial junction comprises a modified sugar moiety. In some embodiments, each nucleoside of the interstitial polymer comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, each nucleoside of each wing of the interstitial polymer comprises a modified sugar moiety. In some embodiments, one nucleoside of the interstitial junction comprises a modified sugar moiety, and each remaining nucleoside of the interstitial junction comprises a 2'-deoxyribosyl sugar moiety.

[0577] In some embodiments, the modified oligonucleotide comprises or is composed of a fully modified glycomolecular motif. In such embodiments, each nucleotide of the fully modified portion of the modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, the modified oligonucleotide comprises or is composed of a fully modified glycomolecular motif, wherein each nucleotide within the fully modified portion comprises the same modified glycomolecular motif, referred herein as a uniformly modified glycomolecular motif. In some embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In some embodiments, each nucleotide of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0578] In this paper, the lengths (number of nucleosides) of the three regions of the interstitial polymer can be provided using the notation [number of nucleosides in the 5' wing] - [number of nucleosides in the interstitial space] - [number of nucleosides in the 3' wing]. Thus, the 5-10-5 interstitial polymer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the interstitial space. If this nomenclature is followed by a specific modification, the modification is a modification in each sugar moiety of each wing and the interstitial nucleosides contain a 2'-β-D-deoxyribosyl sugar moiety. Therefore, the 5-10-5 MOE interstitial polymer consists of 5 linked 2'-MOE nucleosides in the 5' wing, 10 linked 2'-β-D-deoxy nucleosides in the interstitial space, and 5 linked 2'-MOE nucleosides in the 3' wing. The 3-10-3 cEt interstitial polymer consists of 3 linked cEt nucleosides in the 5' wing, 10 linked 2'-β-D-deoxy nucleosides in the interstitial space, and 3 linked cEt nucleosides in the 3' wing. The 5-8-5 interstitial polymer consists of five linked nucleosides containing a modified sugar moiety in the 5' wing, eight linked 2'-β-D-deoxynucleosides in the interstitial space, and five linked nucleosides containing a modified sugar moiety in the 3' wing. The 5-8-5 or 5-8-4 mixed-wing interstitial polymer has at least two different modified sugar moieties in the 5' wing and / or the 3' wing.

[0579] In some embodiments, the modified oligonucleotide is a 5-10-5 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is a 6-10-4 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is a 5-8-4 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is an XYZ MOE interstitial polymer, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides, and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0580] In some embodiments, the modified oligonucleotide has a glycomolecular motif (5' to 3') selected from the following: eeeeeedddddddddkkee or eeeeeedyddddddkkee, where 'd' represents the 2'-deoxyribosyl sugar motif, 'e' represents the 2'-MOE sugar motif, 'k' represents the cEt sugar motif, and 'y' represents the 2'-OMe sugar motif.

[0581] 2. Some nucleobase sequences

[0582] In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each nucleobase is modified. In some embodiments, none of the nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine and all other nucleobases are unmodified.

[0583] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.

[0584] In some embodiments, the oligonucleotide having a gap-mer motif comprises a nucleoside containing a modified nucleotide. In some such embodiments, a nucleoside containing a modified nucleotide is located in the central gap of the oligonucleotide having the gap-mer motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar motif. In some embodiments, the modified nucleotide is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0585] 3. Certain nucleoside interlinking motifs

[0586] In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide links arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each internucleotide linking group is a phosphodiester internucleotide link (P(O2) = O). In some embodiments, each internucleotide linking group of the modified oligonucleotide is a phosphate thioester internucleotide link (P(O2) = S). In some embodiments, each internucleotide link of the modified oligonucleotide is independently selected from phosphate thioester internucleotide links and phosphodiester internucleotide links. In some embodiments, each phosphate thioester internucleotide link is independently selected from stereorandom phosphate thioester, (Sp) phosphate thioester, and (Rp) phosphate thioester. In some embodiments, the glycomolecular motif of the modified oligonucleotide is a spacer polymer and all internucleotide links within the spacer are modified. In some such embodiments, some or all of the internucleotide links in the wing are unmodified phosphodiester internucleotide links. In some embodiments, the terminal nucleoside interlinkings are modified. In some embodiments, the modified oligonucleotide's glycosyl motif is a spacer polymer, and the nucleoside interlinking motif contains at least one phosphodiester nucleoside interlinking in at least one wing, wherein the at least one phosphodiester interlinking is not a terminal nucleoside interlinking, and the remaining nucleoside interlinkings are phosphate thioester nucleoside interlinkings. In some such embodiments, all phosphate thioester interlinkings are stereorandom. In some embodiments, all phosphate thioester interlinkings in the wing are (Sp) phosphate thioesters, and the spacer contains at least one Sp, Sp, Rp motif. In some embodiments, all internucleotide linkages are phosphodiester or phosphate-thioester linkages, and the chiral motifs are (5' to 3'): Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, where each 'Sp' represents a (Sp)phosphate-thioester linkage, each 'Rp' is an Rp linkage, and each 'o' represents a phosphodiester linkage. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides containing such internucleotide linkage motifs.

[0587] In some embodiments, the modified oligonucleotide has an internucleotide linking motif of the order soooossssssssssssooss, where each "s" represents a phosphate thioester nucleoside link and each "o" represents a phosphodiester nucleoside link. In some embodiments, the modified oligonucleotide has an internucleotide linking motif (5' to 3') of the order soooossssssssssss, where each "s" represents a phosphate thioester nucleoside link and each "o" represents a phosphodiester nucleoside link. In some embodiments, the modified oligonucleotide has an internucleotide linking motif (5' to 3') of the order sssosssssssssssss, where each "s" represents a phosphate thioester nucleoside link and each "o" represents a phosphodiester nucleoside link. In some embodiments, the modified oligonucleotide has the following nucleoside-linked motif (5' to 3'): sssosssssssssss, where each "s" represents a thiophosphate nucleoside link and each "o" represents a phosphodiester nucleoside link.

[0588] C. certain length

[0589] The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides with lengths of 13–25 nucleotides to induce target nucleic acid cleavage in an oocyte injection model was tested. Oligonucleotides with a length of 25 nucleotides and 8 or 11 mismatched bases near their ends were able to induce specific cleavage of the target nucleic acid, but to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13-nucleotide oligonucleotides (including those with 1 or 3 mismatches).

[0590] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ≤ Y. For example, in some embodiments, the oligonucleotides are 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23. 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25,20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 2 Composed of 7, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0591] D. Certain modified oligonucleotides

[0592] In some embodiments, the modifications described above (sugars, nucleotides, internucleotide linkages) are incorporated into the modified oligonucleotide. In some embodiments, the modified oligonucleotide is characterized by its modified motif and total length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise indicated, each internucleotide linkage of an oligonucleotide having a spacer-glycan motif may be modified or unmodified, and may or may not follow a spacer modification pattern of sugar modification. For example, internucleotide linkages within the wings of a sugar spacer may be the same or different from each other, and may be the same or different from the internucleotide linkages in the spacer regions of the sugar motif. Similarly, such sugar spacer oligonucleotides may contain one or more modified nucleotides, regardless of the spacer modification pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleotide sequence.

[0593] E. Certain groups of modified oligonucleotides

[0594] A modified oligonucleotide population in which all modified oligonucleotides have the same molecular formula can be a stereorandom population or a chiral-rich population. In a stereorandom population, all chiral centers of all modified oligonucleotides are stereorandom. In a chiral-rich population, at least one specific chiral center in the modified oligonucleotides of the population is not stereorandom. In some embodiments, the modified oligonucleotides of the chiral-rich population are enriched in the β-D-ribosyl sugar moiety, and all thiophosphate nucleoside linkages are stereorandom. In some embodiments, the modified oligonucleotides of the chiral-rich population are enriched in the β-D-ribosyl sugar moiety and linked to at least one specific thiophosphate nucleoside exhibiting a specific stereochemical configuration.

[0595] F. Nucleobase sequence

[0596] In some embodiments, the oligonucleotide (unmodified or modified) is further described by its nucleotide sequence. In some embodiments, the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In some such embodiments, a portion of the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In some embodiments, the nucleotide sequence of a portion or the entire length of the oligonucleotide is complementary to at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the second oligonucleotide or nucleic acid (e.g., a target nucleic acid).

[0597] II. Some oligomers

[0598] In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide (modified or unmodified) and optionally one or more conjugating groups and / or terminal groups. A conjugating group consists of one or more conjugated moieties and a conjugation linker connecting the conjugated moieties to the oligonucleotide. The conjugating group may be attached to one or both ends of the oligonucleotide and / or to any internal location. In some embodiments, the conjugating group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugating group attached to one or both ends of the oligonucleotide is a terminal group. In some such embodiments, the conjugating group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In some such embodiments, the conjugating group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the conjugating group is attached near the 3' end of the oligonucleotide. In some embodiments, the conjugating group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the conjugating group is attached near the 5' end of the oligonucleotide.

[0599] Examples of terminal groups include (but are not limited to) conjugated groups, capped groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.

[0600] A. certain conjugated groups

[0601] In some embodiments, the oligonucleotide is covalently linked to one or more conjugation groups. In some embodiments, the conjugation groups modify one or more properties of the linked oligonucleotide, including (but not limited to) pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugation groups impart novel properties to the linked oligonucleotide, such as enabling the detection of a fluorophore or reporter group of the oligonucleotide.Certain conjugated groups and conjugated moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); and thioethers, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY). Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); sulfur cholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO). J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate triethyl-ammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973); or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexano-carbonyl-hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc clusters (e.g., WO2014 / 179620).

[0602] 1. Joining part

[0603] The conjugated portion includes (but is not limited to) intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folates, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rose red, coumarin, fluorophores, and dyes.

[0604] In some embodiments, the conjugated portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprafen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiazide, chlorothiazide, diazoxide, indomethacin, barbiturate, cephalosporin, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics.

[0605] 2. splicing joint

[0606] The conjugated portion is linked to the oligonucleotide via a conjugation linker. In some oligomers, the conjugation linker is a single chemical bond (i.e., the conjugated portion is directly linked to the oligonucleotide via a single bond). In some embodiments, the conjugation linker comprises an oligomer of a chain structure, such as a hydrocarbon chain, or a repeating unit, such as an ethylene glycol, nucleoside, or amino acid unit.

[0607] In some embodiments, the coupling connector comprises one or more groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some such embodiments, the coupling connector comprises groups selected from the group consisting of alkyl, amino, oxo, amide, and ether. In some embodiments, the coupling connector comprises groups selected from alkyl and amide. In some embodiments, the coupling connector comprises groups selected from alkyl and ether. In some embodiments, the coupling connector comprises at least one phosphorus moiety. In some embodiments, the coupling connector comprises at least one phosphate group. In some embodiments, the coupling connector includes at least one neutral linker group.

[0608] In some embodiments, the conjugation linker, including the conjugation linkers described above, is a bifunctional linker, such as those known in the art for attaching a conjugating group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linker contains at least two functional groups. One functional group is selected to bind to a specific site on the parent compound, and another functional group is selected to bind to the conjugating group. Examples of functional groups used in a bifunctional linker include (but are not limited to) electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In some embodiments, the bifunctional linker contains one or more groups selected from the group consisting of amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0609] Examples of conjugated joints include (but are not limited to) pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated joints include (but are not limited to) substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl groups, either substituted or unsubstituted, C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0610] In some embodiments, the conjugated linker comprises 1-10 linker-nucleosides. In some embodiments, the conjugated linker comprises 2-5 linker-nucleosides. In some embodiments, the conjugated linker comprises exactly 3 linker-nucleosides. In some embodiments, the conjugated linker comprises a TCA motif. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise optionally protected heterocyclic bases selected from: purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable moiety is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally expected that the linker nucleoside will cleave from the oligomer after it reaches the target tissue. Therefore, linker nucleosides are typically linked to each other via cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0611] In this document, linker-nucleosides are not considered part of the oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linker-nucleosides and / or having a specified percentage of complementarity with a reference nucleic acid, and the oligomer compound also comprises a conjugate group containing a linker (containing a linker-nucleoside), those linker-nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group containing 1-10 linker-nucleosides adjacent to the nucleosides of the modified oligonucleotide. In such an oligomer compound, the total number of adjacent linker-nucleosides is greater than 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. In such an oligomer compound, the total number of adjacent linker-nucleosides is no more than 30. Unless otherwise indicated, the linker-nucleoside contains no more than 10 linker-nucleosides. In some embodiments, the linker-nucleoside contains no more than 5 linker-nucleosides. In some embodiments, the conjugate contains no more than three linker-nucleosides. In some embodiments, the conjugate contains no more than two linker-nucleosides. In some embodiments, the conjugate contains no more than one linker-nucleoside.

[0612] In some embodiments, it is desirable for the conjugated group to cleave from the oligonucleotide. For example, in some cases, an oligomeric compound containing a specific conjugated moiety is preferably taken up by a specific cell type, but once the oligomeric compound has been taken up, it is desirable to cleave the conjugated group to release the unconjugated oligonucleotide or the parent oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moiety is a cleavable bond. In some embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moiety contains a group of atoms having one, two, three, four, or more cleavable bonds. In some embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment (e.g., a lysosome). In some embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (e.g., a nuclease).

[0613] In some embodiments, the cleavable bond is selected from: amides, esters, ethers, one or two esters of a phosphate diester, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of a phosphate diester. In some embodiments, the cleavable moiety comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable moiety is an oligonucleotide linked to a phosphate ester or phosphate diester bond between a conjugated moiety or conjugated group.

[0614] In some embodiments, the cleavable portion comprises or consists of one or more linker-nucleosides. In some such embodiments, the one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via cleavable bonds. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside linked to the 3' or 5' terminal nucleoside of the oligonucleotide via phosphodiester-nucleoside linkage and covalently linked to the remainder of the conjugated linker or conjugated portion via phosphate or thiophosphate bonds. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0615] 3. Cell-targeting component

[0616] In some embodiments, the conjugation group comprises a cell-targeting moiety. In some embodiments, the conjugation group has the following general formula:

[0617]

[0618] Where n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater than 2, j is 1 or 0, and k is 1 or 0.

[0619] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.

[0620] In some embodiments, the conjugation group comprises a cell-targeting portion having at least one tethering ligand. In some embodiments, the cell-targeting portion comprises two tethering ligands covalently linked to the branching group. In some embodiments, the cell-targeting portion comprises three tethering ligands covalently linked to the branching group.

[0621] B. certain terminal groups

[0622] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate ester. The stabilized 5'-phosphate ester includes (but is not limited to) 5'-phosphonates, including (but not limited to) 5'-vinylphosphonates. In some embodiments, the terminal group comprises one or more base-free nucleosides and / or reverse nucleosides. In some embodiments, the terminal group comprises one or more 2'-linked nucleosides. In some such embodiments, the 2'-linked nucleosides are base-free nucleosides.

[0623] III. Oligomeric distreptides

[0624] In some embodiments, the oligomers described herein comprise oligonucleotides having a nucleobase sequence complementary to the nucleobase sequence of the target nucleic acid. In some embodiments, the oligomers are paired with a second oligomer to form an oligoduplex. Such oligoduplexes comprise a first oligomer having a portion complementary to the target nucleic acid and a second oligomer having a portion complementary to the first oligomer. In some embodiments, the first oligomer of the oligoduplex comprises or consists of: (1) a modified or unmodified oligonucleotide and optionally a conjugating group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugating group. Either or both oligomers of the oligoduplex may comprise a conjugating group. The oligonucleotide of each oligomer of the oligoduplex may comprise a non-complementary pendulous nucleoside.

[0625] IV. antisense activity

[0626] In some embodiments, the oligomeric compound and oligoduplex are capable of hybridizing with the target nucleic acid to produce at least one antisense activity; such oligomeric compounds and oligoduplexes are antisense compounds. In some embodiments, an antisense compound has antisense activity when it reduces the amount or activity of the target nucleic acid by 25% or more in a standard cellular assay. In some embodiments, the antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids or does not hybridize with one or more non-target nucleic acids in a manner that results in significantly undesirable antisense activity.

[0627] In some antisense activities, hybridization of the antisense compound with the target nucleic acid leads to the recruitment of proteins that cleave the target nucleic acid. For example, some antisense compounds cause RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds that are sufficiently “DNA-like” to induce RNase H activity are described herein. In some embodiments, the presence of one or more non-DNA-like nucleotides in the gaps of the gap polymer is permitted.

[0628] In some antisense activities, an antisense compound, or a portion thereof, is loaded into the RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, some antisense compounds cause the target nucleic acid to be cleaved by Argonaute. The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0629] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not recruit proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in altered splicing of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in altered translation of the target nucleic acid.

[0630] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves observing or detecting changes in the amount of target nucleic acid or protein encoded by said target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or phenotypic changes in cells or subjects.

[0631] V. certain target nucleic acids

[0632] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide containing a portion complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and premRNA, including introns, exons, and untranslated regions. In some embodiments, the target nucleic acid is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some such embodiments, the target region is entirely located within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is located within an intron.

[0633] A. Complementarity / Mismatch with Target Nucleic Acid

[0634] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that oligonucleotides with 100% complementarity to bcl-2 mRNA and three mismatches with bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, these oligonucleotides exhibited potent in vivo antitumor activity. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides and 28- and 42-nucleotide oligonucleotide sequences containing two or three tandem oligonucleotides to inhibit the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides individually inhibited translation, but at a more moderate level compared to the 28- or 42-nucleotide oligonucleotides.

[0635] In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and includes a portion that is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0636] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, antisense activity against the target is reduced due to the mismatch, but the reduction in activity against non-targets is greater. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved. In some embodiments, the mismatch is specifically located within an oligonucleotide having a spacer motif. In some embodiments, the mismatch is located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 starting from the 5' end of the spacer region. In some embodiments, the mismatch is located at positions 1, 2, 3, 4, 5, or 6 starting from the 5' end of the 5' wing region or 3' wing region.

[0637] B. ATXN1

[0638] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide complementary to or consisting of the target nucleic acid, wherein the target nucleic acid is an ATXN1 nucleic acid. In some embodiments, the ATXN1 nucleic acid has the sequence shown below: SEQ ID NO:1 (GENBANK accession number NM_000332.3), SEQ ID NO:2 (complementary sequence to GENBANK accession number NC_000006.12 truncated from nucleotides 16296001 to 16764000), SEQ ID NO:3 (GENBANK accession number NM_001128164.1), SEQ ID NO:4 (GENBANK accession number BC011026.1), SEQ ID NO:5 (GENBANK accession number BC029401.1), or SEQ ID NO:6 (GENBANK accession number BC047894.1).

[0639] In some embodiments, contacting cells with an oligomeric compound complementary to any of SEQ ID NO:1-6 reduces the amount of ATXN1 RNA in the cells. In some embodiments, contacting cells with an oligomeric compound complementary to any of SEQ ID NO:1-6 reduces the amount of ATXN1 in the cells. In some embodiments, the cells are in vitro. In some embodiments, the cells are in vivo in a subject. In some embodiments, the oligomeric compound consists of modified oligonucleotides. In some embodiments, contacting cells in a subject with an oligomeric compound complementary to any of SEQ ID NO:1-6 improves one or more symptoms or markers of a neurodegenerative disease. In some embodiments, the neurodegenerative disease is SCA1. In some embodiments, the symptoms or markers are selected from gait and limb ataxia, cognitive impairment, speech and swallowing difficulties, cerebellar and brainstem atrophy on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10-15 years after the onset of symptoms.

[0640] In some embodiments, when administered according to standard cell assays, the oligomeric compound complementary to any of SEQ ID NO:1-6 is capable of reducing the detectable amount of ATXN1 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when administered according to standard cell assays, the oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6 is capable of reducing the amount of ATXN1 in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6 is capable of reducing the detectable amount of ATXN1 RNA in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6 is capable of reducing the detectable amount of ATXN1 in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0641] C. Certain target nucleic acids in certain tissues

[0642] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide containing a portion complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In some embodiments, the pharmacologically relevant tissue is the cells and tissues that constitute the central nervous system. Such tissues include the cortex, cerebellum, and brainstem.

[0643] VI. Certain pharmaceutical compositions

[0644] In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomeric compounds. In some embodiments, the one or more oligomeric compounds are each composed of modified oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds or thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water or thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS) or thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid or thereof. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0645] In some embodiments, the pharmaceutical composition comprises modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists essentially of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0646] In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some embodiments, the excipients are selected from water, salt solution, ethanol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0647] In some embodiments, the oligomeric compound may be mixed with a pharmaceutically acceptable active and / or inert substance to prepare a pharmaceutical composition or formulation. The composition and method used to formulate the pharmaceutical composition depend on a variety of criteria, including (but not limited to) the route of administration, the severity of the disease, or the dose to be administered.

[0648] In some embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In some embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more oligonucleotides are capable of providing (directly or indirectly) a bioactive metabolite or its residues when administered to a subject (including humans). Therefore, for example, this disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalent forms. Suitable pharmaceutically acceptable salts include (but are not limited to) sodium and potassium salts. In some embodiments, a prodrug comprises one or more conjugate groups linked to an oligonucleotide, wherein the conjugate groups are cleaved by endogenous nucleases in vivo.

[0649] Lipid moieties have been used in nucleic acid therapy in various methods. In some such methods, nucleic acids (e.g., oligomeric compounds) are introduced into pre-formed liposomes or lipid complexes prepared from a mixture of cationic and neutral lipids. In some methods, DNA complexes with monocationic or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0650] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include (but are not limited to) liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those containing hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0651] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents comprising the oligomeric compounds provided herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0652] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some such cosolvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which comprises 3% w / v benzyl alcohol and 8% w / v nonpolar surfactant polysorbate 80. TMAnd a 65% w / v polyethylene glycol 300 anhydrous ethanol solution. The proportions of such co-solvent systems can be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be modified: for example, other surfactants can be used instead of polysorbate 80. TM The fraction of polyethylene glycol can be varied; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace dextrose.

[0653] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for buccal administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks's solution, Ringer's solution, or saline buffer. In some embodiments, other components are included (e.g., components that aid dissolution or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are presented in unit dosage forms (e.g., in ampoules or in multi-dose containers). Some injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous media and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include (but are not limited to) lipophilic solvents and fatty oils (e.g., sesame oil), synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.

[0654] VII. Certain compositions

[0655] 1. Compound No. 994509

[0656] In some embodiments, compound 994509 is characterized as a 5-10-5 MOE interstitial polymer having (from 5' to 3') GCACGGTATTAGTGTCTTCA (SEQ ID NO: 10000). The sequence of NO:126, wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 2-3, 3-4, 4-5, 16-17 and 17-18 are phosphodiester nucleoside linkages, and the inter-nucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0657] In some embodiments, compound 994509 is represented by the following chemical notation (5' to 3'): Ges m CeoAeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo Teo Tes m Ces Ae(SEQ ID NO:126), where,

[0658] A = adenine nucleobase,

[0659] m C = 5-methylcytosine nucleobase,

[0660] G = guanine nucleobase

[0661] T = thymine nucleobase,

[0662] e = 2'-MOE sugar moiety,

[0663] d = 2'-β-D deoxyribosyl sugar moiety,

[0664] s = thiophosphate nucleoside linkage, and

[0665] o = phosphate diester nucleoside linkage.

[0666] In some embodiments, compound 994509 is represented by the following chemical structure:

[0667] (SEQ ID NO:126).

[0668] Structure 1. Compound No. 994509

[0669] In some embodiments, the sodium salt of compound 994509 is represented by the following chemical structure:

[0670] (SEQ ID NO:126).

[0671] Structure 2. Sodium salt of compound 994509

[0672] 2. Compound No. 1040500

[0673] In some embodiments, compound 1040500 is characterized as a 5-10-5 MOE interstitial polymer having (from 5' to 3') GCTTCTCAAATCAGGTGTAC (SEQ ID NO: 1040500). The sequence of NO:1045, wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 2-3, 3-4, 4-5, 16-17 and 17-18 are phosphodiester nucleoside linkages, and the inter-nucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0674] In some embodiments, compound number 1040500 is represented by the following chemical notation (5' to 3'): Ges m CeoTeo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe(SEQID NO:1045), where,

[0675] A = adenine nucleobase,

[0676] m C = 5-methylcytosine nucleobase,

[0677] G = guanine nucleobase

[0678] T = thymine nucleobase,

[0679] e = 2'-MOE sugar moiety,

[0680] d = 2'-β-D deoxyribosyl sugar moiety,

[0681] s = thiophosphate nucleoside linkage, and

[0682] o = phosphate diester nucleoside linkage.

[0683] In some embodiments, compound 1040500 is represented by the following chemical structure:

[0684] (SEQ ID NO:1045).

[0685] Structure 3. Compound No. 1040500

[0686] In some embodiments, the sodium salt of compound 1040500 is represented by the following chemical structure:

[0687] (SEQ ID NO:1045).

[0688] Structure 4. Sodium salt of compound number 1040500

[0689] 3. Compound No. 1041927

[0690] In some embodiments, compound 1041927 is characterized as a 5-10-5 MOE interstitial polymer having (from 5' to 3') GCCTTTATAACTTTTCTTTC (SEQ ID NO: 1041927). The sequence of NO:2552, wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 2-3, 3-4, 4-5, 16-17 and 17-18 are phosphodiester nucleoside linkages and the inter-nucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0691] In some embodiments, compound 1041927 is represented by the following chemical notation (5' to 3'): Ges m Ceo m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes mCe(SEQ ID NO:2552), where,

[0692] A = adenine nucleobase,

[0693] m C = 5-methylcytosine nucleobase,

[0694] G = guanine nucleobase

[0695] T = thymine nucleobase,

[0696] e = 2'-MOE sugar moiety,

[0697] d = 2'-β-D deoxyribosyl sugar moiety,

[0698] s = thiophosphate nucleoside linkage, and

[0699] o = phosphate diester nucleoside linkage.

[0700] In some embodiments, compound 1041927 is represented by the following chemical structure:

[0701] (SEQ ID NO:2552).

[0702] Structure 5. Compound No. 1041927

[0703] In some embodiments, the sodium salt of compound 1041927 is represented by the following chemical structure:

[0704] (SEQ ID NO:2552).

[0705] Structure 6. Sodium salt of compound 1041927

[0706] 4. Compound No. 1055001

[0707] In some embodiments, compound 1055001 is characterized as a 5-10-5 MOE interstitial polymer having (from 5' to 3')TTCAGTTTAGTTGCAGCCAT (SEQ ID NO: 1055001). The sequence of NO:3190, wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 2-3, 3-4, 4-5, 16-17 and 17-18 are phosphodiester nucleoside linkages, and the inter-nucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0708] In some embodiments, compound number 1055001 is represented by the following chemical notation (5' to 3'): Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m Ceo m Ces Aes Te(SEQ ID NO:3190), where,

[0709] A = adenine nucleobase,

[0710] m C = 5-methylcytosine nucleobase,

[0711] G = guanine nucleobase

[0712] T = thymine nucleobase,

[0713] e = 2'-MOE sugar moiety,

[0714] d = 2'-β-D deoxyribosyl sugar moiety,

[0715] s = thiophosphate nucleoside linkage, and

[0716] o = phosphate diester nucleoside linkage.

[0717] In some embodiments, compound 1055001 is represented by the following chemical structure:

[0718] (SEQ ID NO:3190).

[0719] Structure 7. Compound No. 1055001

[0720] In some embodiments, the sodium salt of compound 1055001 is represented by the following chemical structure:

[0721] (SEQ ID NO:3190).

[0722] Structure 8. Sodium salt of compound 1055001

[0723] 5. Compound No. 1371311

[0724] In some embodiments, compound 1371311 is characterized as a 5-10-5 MOE interstitial polymer having (from 5' to 3') CCCGTATTCCTCTTACCATC (SEQ ID NO: 1371311). The sequence of NO:3590, wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 2-3, 3-4, 4-5, 16-17 and 17-18 are phosphodiester nucleoside linkages, and the inter-nucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19 and 19-20 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0725] In some embodiments, compound 1371311 is represented by the following chemical notation (5' to 3'): m Ces m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m Ceo Aes Tes m Ce(SEQ ID NO:3590), where,

[0726] A = adenine nucleobase,

[0727] m C = 5-methylcytosine nucleobase,

[0728] G = guanine nucleobase

[0729] T = thymine nucleobase,

[0730] e = 2'-MOE sugar moiety,

[0731] d = 2'-β-D deoxyribosyl sugar moiety,

[0732] s = thiophosphate nucleoside linkage, and

[0733] o = phosphate diester nucleoside linkage.

[0734] In some embodiments, compound 1371311 is represented by the following chemical structure:

[0735] (SEQ ID NO:3590).

[0736] Structure 9. Compound No. 1371311

[0737] In some embodiments, the sodium salt of compound 1371311 is represented by the following chemical structure:

[0738] (SEQ ID NO:3590).

[0739] Sodium salt of compound 1371311 (structure 10)

[0740] 6. Compound No. 1385293

[0741] In some embodiments, compound 1385293 is characterized as a 5-8-4MOE interstitial polymer having the sequence (from 5' to 3')TCAGTTTAGTTGCAGCC (SEQ ID NO: 3638), wherein each of nucleosides 1-5 and 14-17 (from 5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-13 is a 2'-β-D-deoxy nucleoside, wherein the inter-nucleoside linkages between nucleosides 4-5 and 14-15 are phosphodiester inter-nucleoside linkages, and the inter-nucleoside linkages between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 15-16, and 16-17 are thiophosphate inter-nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0742] In some embodiments, compound 1385293 is represented by the following chemical notation (5' to 3'): Tes m CesAes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Gesm Ces m Ce(SEQ ID NO:3638), where,

[0743] A = adenine nucleobase,

[0744] m C = 5-methylcytosine nucleobase,

[0745] G = guanine nucleobase

[0746] T = thymine nucleobase,

[0747] e = 2'-MOE sugar moiety,

[0748] d = 2'-β-D deoxyribosyl sugar moiety,

[0749] s = thiophosphate nucleoside linkage, and

[0750] o = phosphate diester nucleoside linkage.

[0751] In some embodiments, compound 1385293 is represented by the following chemical structure:

[0752] (SEQ ID NO:3638).

[0753] Structure 11. Compound No. 1385293

[0754] In some embodiments, the sodium salt of compound 1385293 is represented by the following chemical structure:

[0755] (SEQ ID NO:3638).

[0756] Structure 12. Sodium salt of compound 1385293

[0757] VIII. Some hotspot areas

[0758] In some embodiments, the nucleobases within the range specified below comprise the hotspot region of the ATXN1 nucleic acid. In some embodiments, modified oligonucleotides complementary to the hotspot region of the ATXN1 nucleic acid achieve an average in vitro ATXN1 RNA reduction of more than 75% in standard cellular assays. In some embodiments, modified oligonucleotides complementary to the hotspot region of the ATXN1 nucleic acid achieve an average in vivo ATXN1 RNA reduction of 24% or greater in standard in vivo assays. In some embodiments, modified oligonucleotides complementary to the hotspot region of the ATXN1 nucleic acid achieve an average in vivo ATXN1 RNA reduction of 45% or greater in standard in vivo assays.

[0759] 1. Nucleotides 5472-5552 of SEQ ID NO:1 or 459725-459805 of SEQ ID NO:2

[0760] In some embodiments, nucleotides 5472-5552 of SEQ ID NO:1 or nucleotides 459725-459805 of SEQ ID NO:2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to nucleotides 5472-5552 of SEQ ID NO:1 or nucleotides 459725-459805 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is a spacer polymer. In some embodiments, the modified oligonucleotide is a mixed-wing spacer polymer.

[0761] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 5-8-4 MOE interstitial polymer or a 5-8-4 mixed MOE / cEt interstitial polymer. In some embodiments, the mixed-wing interstitial polymer has a glycosyl inscription in the order 5' to 3'; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the interstitial polymer contains a 2'-substituted nucleoside in the interstitial space. In some embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at the 2 position (5' to 3') of the interstitial space. In some embodiments, the interstitial polymer has a glycosyl sequence in the order from 5' to 3': eeeeedyddddddddeeeee or eeeeedyddddddkkee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, 'e' represents the 2'-MOE sugar moiety, and "y" represents the 2'-OMe sugar moiety.

[0762] In some embodiments, the nucleoside linkages of the modified oligonucleotide are phosphate thioester nucleoside linkages and phosphodiester nucleoside linkages. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) nucleoside linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotide has a nucleoside linkage motif of soooossssssssssssoos, sssosssssssssssssss, sssosssssssssssss or soooooossssssssssss, where each “s” represents a phosphate thioester nucleoside linkage and each “o” represents a phosphodiester nucleoside linkage.

[0763] The nucleobase sequences of SEQ ID NO:196, 274, 352, 430, 508, 2578, 2655, 2732, 2809, 2886, 2963, 3121, 3122, 3190, 3191, 3192, 3262, 3330, 3331, 3332, 3401, 3402, 3575, 3577, 3620, 3624, 3638-3640, 3653-3655, 3662, 3665, and 3669 are complementary to nucleobases 5472-5552 of SEQ ID NO:1 or nucleobases 459725-459805 of SEQ ID NO:2.

[0764] Compound numbers 994446-994450, 1040296-1040301, 1055001-1055011, 1342062, 1342063, 1342067, 1342068, 1365271, 1365272, 1365274, 1365294, 1365299, 1365300, 1371818, 1371821, 1371827, 137 The nucleobase sequences of 1829, 1371837, 1371843, 1371866, 1371869, 1371871, 1371876, 1385293, 1394156-1394160, 1394162, 1394164, 1394166-1394168, 1394533, 1394544, 1394546, 1394549 and 1394553 are complementary to nucleobases 5472-5552 of SEQ ID NO:1 or nucleobases 459725-459805 of SEQ ID NO:2.

[0765] In some embodiments, modified oligonucleotides complementary to nucleotides 5472-5552 of SEQ ID NO:1 or nucleotides 459725-459805 of SEQ ID NO:2 achieve at least 58% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 5472-5552 of SEQ ID NO:1 or nucleotides 459725-459805 of SEQ ID NO:2 achieve an average reduction of 90% in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 5472-5552 of SEQ ID NO:1 or nucleotides 459725-459805 of SEQ ID NO:2 achieve an average reduction of 52% in vivo ATXN1 RNA in standard in vivo assays.

[0766] 2. Nucleotides 5906-6005 of SEQ ID NO:1 or 460159-460258 of SEQ ID NO:2

[0767] In some embodiments, nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleobases in length. In some embodiments, the modified oligonucleotide is 17 nucleobases in length. In some embodiments, the modified oligonucleotide is a mixed-wing interstitial polymer.

[0768] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 5-8-4 MOE interstitial polymer or a 5-8-4 mixed MOE / cEt interstitial polymer. In some embodiments, the mixed-wing interstitial polymer has a glycosyl sequence eeeeeddddddddkkee in a 5' to 3' order; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, and 'e' represents the 2'-MOE sugar moiety.

[0769] In some embodiments, the nucleoside linkages of the modified oligonucleotide are phosphate thioester nucleoside linkages and phosphodiester nucleoside linkages. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) nucleoside linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotide has a nucleoside linkage motif of soooossssssssssssoos, sssosssssssssssssss, sssosssssssssssss or soooooossssssssssss, where each “s” represents a phosphate thioester nucleoside linkage and each “o” represents a phosphodiester nucleoside linkage.

[0770] The nucleobase sequences of SEQ ID NO:42, 120, 198, 276, 509, 587, 2502, 2579, 2656, 2733, 2810, 2887, 2964, 3585, 3588-3590, 3615, 3618, 3622, 3657, 3660, 3661, 3663, 3664 and 3666-3668 are complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2.

[0771] Compound numbers 994458-994463, 1040327-1040333, 1367569, 1367580-1367581, 1367589-1367591, 1371311, 1371820, 1371823, 1371825, 1371842, 1371865, 1371868 The nucleobase sequences of 1371870, 1371873, 1371875, 1371877, 1394161, 1394163, 1394165, 1394524, 1394538, 1394541, 1394543, 1394545, 1394548 and 1394550-1394552 are complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2.

[0772] In some embodiments, the modified oligonucleotides complementary to nucleotides 5906-6005 of SEQ ID NO:1 or nucleotides 460159-460258 of SEQ ID NO:2 achieve at least a 26% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, the modified oligonucleotides complementary to nucleotides 5906-6005 of SEQ ID NO:1 or nucleotides 460159-460258 of SEQ ID NO:2 achieve an average 78% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, the modified oligonucleotides complementary to nucleotides 5906-6005 of SEQ ID NO:1 or nucleotides 460159-460258 of SEQ ID NO:2 achieve an average 51% reduction in in vivo ATXN1 RNA in standard in vivo assays.

[0773] 3. Nucleotides 7868-7911 of SEQ ID NO:1 or 462121-462164 of SEQ ID NO:2

[0774] In some embodiments, nucleotides 7868-7911 of SEQ ID NO:1 or nucleotides 462121-462164 of SEQ ID NO:2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to nucleotides 7868-7911 of SEQ ID NO:1 or nucleotides 462121-462164 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleotides in length. In some embodiments, the modified oligonucleotide is an interstitial polymer.

[0775] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer.

[0776] In some embodiments, the nucleoside linkages of the modified oligonucleotide are phosphate thioester nucleoside linkages and phosphodiester nucleoside linkages. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) nucleoside linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotide has a nucleoside linkage motif of soooossssssssssssooss, sssosssssssssssssss or soooooossssssssssss, where each “s” represents a phosphate thioester nucleoside linkage and each “o” represents a phosphodiester nucleoside linkage.

[0777] The nucleobase sequences of SEQ ID NO:48, 126, 2044 and 2121 are complementary to the nucleobases 7868-7911 of SEQ ID NO:1 or the nucleobases 462121-462164 of SEQ ID NO:2.

[0778] The nucleobase sequences of compounds numbered 994508, 994509, 1040499, 1040450, 1394513 and 1394529 are complementary to nucleobases 7868-7911 of SEQ ID NO:1 or nucleobases 462121-462164 of SEQ ID NO:2.

[0779] In some embodiments, modified oligonucleotides complementary to nucleotides 7868-7911 of SEQ ID NO:1 or nucleotides 462121-462145 of SEQ ID NO:2 achieve at least 61% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 7868-7911 of SEQ ID NO:1 or nucleotides 462121-462145 of SEQ ID NO:2 achieve an average reduction of 79% in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 7868-7911 of SEQ ID NO:1 or nucleotides 462121-462164 of SEQ ID NO:2 achieve an average reduction of 53% in vivo ATXN1 RNA in standard in vivo assays.

[0780] 4. Nucleotides 8481-8514 of SEQ ID NO:1 or 462734-462767 of SEQ ID NO:2

[0781] In some embodiments, nucleotides 8481-8514 of SEQ ID NO:1 or nucleotides 462734-462767 of SEQ ID NO:2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to nucleotides 8481-8514 of SEQ ID NO:1 or nucleotides 462734-462767 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleotides in length. In some embodiments, the modified oligonucleotide is an interstitial polymer.

[0782] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer.

[0783] In some embodiments, the nucleoside linkages of the modified oligonucleotide are phosphate thioester nucleoside linkages and phosphodiester nucleoside linkages. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) nucleoside linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotide has a nucleoside linkage motif of soooossssssssssssooss, sssosssssssssssssss or soooooossssssssssss, where each “s” represents a phosphate thioester nucleoside linkage and each “o” represents a phosphodiester nucleoside linkage.

[0784] The nucleobase sequences of SEQ ID NO:128, 206, 284, 1045, 1122, 1199 and 1276 are complementary to nucleobases 8481-8514 of SEQ ID NO:1 or nucleobases 462734-462767 of SEQ ID NO:2.

[0785] The nucleobase sequences of compounds numbered 994525-994527, 1040500-1040503, 1394514 and 1394525 are complementary to nucleobases 8481-8514 of SEQ ID NO:1 or nucleobases 462734-462767 of SEQ ID NO:2.

[0786] In some embodiments, modified oligonucleotides complementary to nucleotides 8481-8514 of SEQ ID NO:1 or nucleotides 462734-462767 of SEQ ID NO:2 achieve at least 54% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 8481-8514 of SEQ ID NO:1 or nucleotides 462734-462767 of SEQ ID NO:2 achieve an average reduction of 79% in in vitro ATXN1 RNA in standard cell assays. In some embodiments, modified oligonucleotides complementary to nucleotides 8481-8514 of SEQ ID NO:1 or nucleotides 462734-462767 of SEQ ID NO:2 achieve an average reduction of 48% in vivo ATXN1 RNA in standard in vivo assays.

[0787] 5. Nucleobases 446679-446706 of SEQ ID NO: 2

[0788] In some embodiments, nucleotides 446679-446706 of SEQ ID NO:2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to nucleotides 446679-446706 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleotides in length. In some embodiments, the modified oligonucleotide is an interstitial polymer.

[0789] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer.

[0790] In some embodiments, nucleotides 446679-446706 of SEQ ID NO:2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to nucleotides 446679-446706 of SEQ ID NO:2. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is a spacer polymer. In some embodiments, the spacer polymer is an MOE spacer polymer. In some embodiments, the internucleotide linkages of the modified oligonucleotide are phosphate thioester internucleotide linkages and phosphate diester internucleotide linkages. In some embodiments, the phosphate diester (“o”) and phosphate thioester (“s”) internucleotide linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotides have nucleoside-linked motifs of soooosssssssssssooss, sssosssssssssssssss or soooosssssssssssss, where each "s" represents a thiophosphate nucleoside link and each "o" represents a phosphodiester nucleoside link.

[0791] The nucleobase sequences of SEQ ID NO:2475, 2552, 2629, 2706, 2783, 3627-3630 and 3644 are complementary to the nucleobase sequences of SEQ ID NO:2, 446679-446706.

[0792] The nucleobase sequences of compounds numbered 1041926-1041930, 1364282, 1365258-1365261, 1365282-1365284, 1365287 and 1394522 are complementary to nucleobases 446679-446706 of SEQ ID NO:2.

[0793] In some embodiments, the modified oligonucleotides complementary to nucleotides 446679-446706 of SEQ ID NO:2 achieve at least 67% reduction in in vitro ATXN1 RNA in standard cell assays. In some embodiments, the modified oligonucleotides complementary to nucleotides 446679-446706 of SEQ ID NO:2 achieve an average reduction of 81% in in vitro ATXN1 RNA in standard cell assays.

[0794] 6. Other hotspot areas

[0795] In some embodiments, the ranges described in the table below encompass hotspot regions. Each hotspot region begins with the nucleus of SEQ ID NO:1 identified in the "Start Site, SEQ ID NO:1" column and ends with the nucleus of SEQ ID NO:1 identified in the "Termination Site, SEQ ID NO:1" column. In some embodiments, as defined in the table below, the modified oligonucleotide is complementary to any of the hotspot regions 1-53. In some embodiments, the modified oligonucleotide is 17 nucleosides long. In some embodiments, the modified oligonucleotide is 20 nucleosides long.

[0796] In some embodiments, the interstitial polymer is a 5-10-5 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 6-10-4 MOE interstitial polymer. In some embodiments, the interstitial polymer is a 5-8-4 MOE interstitial polymer or a 5-8-4 mixed MOE / cEt interstitial polymer. In some embodiments, the mixed-wing interstitial polymer has a glycosyl inscription in the order 5' to 3'; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, and 'e' represents the 2'-MOE sugar moiety. In some embodiments, the interstitial polymer contains a 2'-substituted nucleoside in the interstitial space. In some embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In some embodiments, the 2'-substituted nucleoside is located at the 2 position (5' to 3') of the interstitial space. In some embodiments, the interstitial polymer has a glycosyl sequence in the order from 5' to 3': eeeeedyddddddddeeeee or eeeeedyddddddkkee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, 'e' represents the 2'-MOE sugar moiety, and "y" represents the 2'-OMe sugar moiety.

[0797] In some embodiments, the nucleoside linkages of the modified oligonucleotide are phosphate thioester nucleoside linkages and phosphodiester nucleoside linkages. In some embodiments, the phosphodiester (“o”) and phosphate thioester (“s”) nucleoside linkages are arranged in a 5' to 3' sequence. In some embodiments, the modified nucleotide has a nucleoside linkage motif of soooossssssssssssoos, sssosssssssssssssss, sssosssssssssssss or soooooossssssssssss, where each “s” represents a phosphate thioester nucleoside linkage and each “o” represents a phosphodiester nucleoside linkage.

[0798] The nucleobase sequences of the compounds listed in the “Compound Number, Range” column of the table below are complementary to SEQ ID NO:2 within the specified hotspot region. The nucleobase sequences of the oligonucleotides listed in the “SEQ ID NO:, Range” column of the table below are complementary to the target sequence SEQ ID NO:2 within the specified hotspot region.

[0799] In some embodiments, as indicated in the table below, the modified oligonucleotides complementary to the nucleotides within the hotspot region achieve at least “Min.%Red., in vitro” (minimum reduction %, relative to untreated control cells) of in vitro ATXN1 RNA in standard cell assays. In some embodiments, as indicated in the table below, the modified oligonucleotides complementary to the nucleotides within the hotspot region achieve the average “Avg.%Red., in vitro” (average reduction %, relative to untreated control cells) of in vitro ATXN1 RNA in standard cell assays. In some embodiments, as indicated in the table below, the modified oligonucleotides complementary to the nucleotides within the hotspot region achieve the maximum “Max.%Red., in vitro” (maximum reduction %, relative to untreated control cells) of in vitro ATXN1 RNA in standard cell assays. In some embodiments, as indicated in the table below, the modified oligonucleotides complementary to the nucleotides within the hotspot region achieve the average “Avg.%Red., in vivo” (average reduction %, relative to PBS-treated animals) of in vivo ATXN1 RNA in standard in vivo assays in cortical tissue. Note that, due to the use of transgenic mouse models, only compounds targeting nucleosides 435531-464889 of SEQ ID NO:2 were tested in vivo; "nd" indicates that there are no in vivo data for compounds within the stated range. In other cases, the in vivo average is reduced to a subset of compounds included in any given hotspot because not all compounds are tested in vivo.

[0800] Table 1 ATXN1 Hotspots

[0801]

[0802]

[0803]

[0804]

[0805]

[0806]

[0807]

[0808] *Only one compound was tested in vitro; see the in vivo section for average reduction percentage.

[0809] Non-restricted public information and incorporated by reference

[0810] Each document and patent publication listed herein is incorporated herein by reference in its entirety.

[0811] While certain compounds, compositions, and methods described herein have been specifically illustrated with reference to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the scope of the compounds described herein. Every reference, GenBank accession number, etc., listed in this application is incorporated herein by reference in its entirety.

[0812] Although the sequence listing accompanying this application identifies each sequence as “RNA” or “DNA” as needed, in practice, those sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that, in some cases, the names of modified oligonucleotides, such as “RNA” or “DNA,” are arbitrary. For example, an oligonucleotide containing a nucleotide with a 2'-OH sugar moiety and a thymine base may be described as DNA with a modified sugar (2'-OH replacing a 2'-H in DNA) or as RNA with a modified base (thymine (methylated uracil) replacing uracil in RNA). Therefore, the nucleic acid sequences provided herein (including, but not limited to, those nucleic acid sequences in the sequence listing) are intended to cover nucleic acids containing any combination of native or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. As another example, but without limitation, oligomers having the nucleobase sequence “ATCGATCG” encompass any oligomer having this nucleobase sequence, whether modified or unmodified, including (but not limited to) such compounds containing RNA bases, such as those having the sequence “AUCGAUCG”; and those having some DNA bases and some RNA bases (e.g., “AUCGATCG”); and those having other modified nucleobases (e.g., “AT”).m "CGAUCG", among which m C indicates an oligomeric compound containing a cytosine base with a methyl group at the 5-position.

[0813] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, resulting in enantiomers, diastereomers, and other stereoisomers that can be defined, in absolute stereochemistry, as (R) or (S), α or β (e.g., for glycomutomers), or (D) or (L) (e.g., for amino acids, etc.). The compounds drawn or described herein as having certain stereoisomers include only those indicated. Unless otherwise specified, the compounds drawn or described herein in undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, unless otherwise indicated, tautomerism of the compounds described herein is also included. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0814] The compounds described herein include variations in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the indicated element. For example, the compounds in this article containing hydrogen atoms cover variations for each... 1 All possible deuterium substitutions for the hydrogen atom. The isotopic substitutions covered in the compounds described herein include (but are not limited to): 2 H or 3 H replaces 1 H, 13 C or 14 C replaces 12 C, 15 N replaces 14 N, 17 O or 18 O replaces 16 O, and 33 S, 34 S, 35 S or 36 S replaces 32 S. In some embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound, which are beneficial for use as a therapeutic or research tool. In some embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging.

[0815] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds can be drawn or described in protonated (free acid) form or ionized and associated with cations (salt) form, aqueous solutions of such compounds exist in equilibrium in these forms. For example, the phosphodiester bonds of oligonucleotides in aqueous solution exist in equilibrium in free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have several such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in a series of forms at multiple positions, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures necessarily depict a single form. However, unless otherwise indicated, such figures are also intended to include corresponding forms. In this document, the term "or its salt" following the structure of a compound as a free acid explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with cations. In some cases, one or more specific cations are identified. In some embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In some embodiments, the modified oligonucleotide or oligomer is in a potassium-containing aqueous solution. In some embodiments, the modified oligonucleotide or oligomer is in PBS. In some embodiments, the modified oligonucleotide or oligomer is in water. In some such embodiments, the pH of the solution is adjusted to achieve a desired pH using NaOH and / or HCl.

[0816] In this document, specific dosages are described. Dosages may be expressed in units of dosage. For clarity, the dosage (or unit of dosage) (in milligrams) of a modified oligonucleotide or oligomer indicates the mass of the free acid form of the modified oligonucleotide or oligomer. As explained above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purposes of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists in a solvent-free, sodium acetate-free, and anhydrous free acid form. For example, if the modified oligonucleotide or oligomer is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still included in the weight of the dosage, while the mass of the Na+ ions is not included in the weight of the dosage. Thus, for example, the dosage or unit of dosage of 10 mg of compound 1371311 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, and anhydrous sodium ionized compound 1371311. When the oligomer contains a conjugated group, the mass of the conjugated group is included when calculating the dosage of this oligomer. If the conjugated group is also acidic, it is also assumed that the conjugated group is fully protonated for dosage calculation purposes.

[0817] Example

[0818] Example 1: Effects of 5-10-5 MOE interstitial polymer-modified oligonucleotides on human ATXN1 RNA in vitro, single dose

[0819] Modified oligonucleotides complementary to human ATXN1 nucleic acid were designed and their effects on ATXN1 mRNA at single doses were tested in vitro. The modified oligonucleotides were tested in a series of experiments under similar culture conditions.

[0820] The modified oligonucleotides in the following tables are 5-10-5 MOE interstitial polymers with mixed PO / PS nucleoside linkages. The interstitial polymer is 20 nucleosides in length, with the central interstitial region consisting of ten 2'-β-D-deoxynucleosides and the 3' and 5' wings each consisting of five 2'-MOE-modified nucleosides. The motif of the interstitial polymer is (from 5' to 3'): eeeeddddddddddeeeee; where "d" represents the 2'-β-D-deoxyribosyl sugar and "e" represents the 2'-MOE-modified ribosyl sugar. The interstitial linkage motif of the interstitial polymer is (from 5' to 3'): soooosssssssssssooss; where "o" represents the phosphodiester nucleoside linkage and "s" represents the thiophosphate nucleoside linkage. Each cytosine residue is 5-methylcytosine.

[0821] “Start site” indicates the 5' end nucleotide of the human gene sequence that is complementary to the modified oligonucleotide. “Termination site” indicates the 3' end nucleotide of the human gene sequence that is complementary to the modified oligonucleotide. Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO:1 (GENBANK accession number NM_000332.3) or SEQ ID NO:2 (the complementary sequence of GENBANK accession number NC_000006.12, truncated from nucleotides 16296001 to 16764000). 'N / A' indicates that the modified oligonucleotide is not 100% complementary to the specific gene sequence.

[0822] A-431 cells were cultured at a density of 10,000 cells / well under free uptake and treated with a modified oligonucleotide at a concentration of 4,000 nM for 48 hours. At the end of the cell treatment period, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT-PCR. ATXN1 RNA levels were measured using the human ATXN1 primer-probe set RTS37573 (forward sequence CATCCAGAGTGCAGAGATAAGC, designated as SEQ ID NO:11; reverse sequence ACTCTACCAAAACTTCAACGCT, designated as SEQ ID NO:12; probe sequence AGAGGATTGAAGACAGCCATAGCCC, designated as SEQ ID NO:13). This was compared to methods such as... Total RNA levels measured were normalized to ATXN1 RNA levels. Results are presented in the following tables as a percentage of ATXN1 RNA levels relative to untreated control cells (control %). Each table represents results from an individual assay plate. Compound numbers marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Other assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0823] Table 2 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0824]

[0825]

[0826]

[0827] Table 3. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0828]

[0829]

[0830]

[0831] Table 4. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0832]

[0833]

[0834]

[0835] Table 5. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0836]

[0837]

[0838]

[0839] Table 6. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0840]

[0841]

[0842]

[0843] Table 7. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0844]

[0845]

[0846]

[0847]

[0848] Table 8. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0849]

[0850]

[0851]

[0852]

[0853] Table 9. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0854]

[0855]

[0856]

[0857] Example 2: Effects of 5-10-5 MOE interstitial polymer-modified oligonucleotides on human ATXN1 RNA in vitro, single dose

[0858] Modified oligonucleotides complementary to human ATXN1 nucleic acid were designed and their effects on ATXN1 mRNA at single doses were tested in vitro. The modified oligonucleotides were tested in a series of experiments under similar culture conditions.

[0859] The modified oligonucleotides in the following tables are 5-10-5 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymer is 20 nucleosides in length, with the central interstitial region consisting of ten 2'-β-D-deoxynucleosides and the 3' and 5' wings each consisting of five 2'-MOE-modified nucleosides. The motif of the interstitial polymer is (from 5' to 3'): eeeeeeddddddddddeeeee; where "d" represents the 2'-β-D-deoxyribosyl sugar and "e" represents the 2'-MOE-modified ribosyl sugar. The nucleoside linkage motif of the interstitial polymer is (from 5' to 3'): soooosssssssssssooss; where "o" represents the phosphodiester nucleoside linkage and "s" represents the thiophosphate nucleoside linkage. Each cytosine residue is 5-methylcytosine.

[0860] “Start site” indicates the 5' end nucleotide of the human gene sequence that is complementary to the modified oligonucleotide. “Termination site” indicates the 3' end nucleotide of the human gene sequence that is complementary to the modified oligonucleotide. Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 (GENBANK accession number NM_001128164.1). 'N / A' indicates that the modified oligonucleotide is not 100% complementary to the specific gene sequence.

[0861] A-431 cells were cultured at a density of 10,000 cells / well and treated with a modified oligonucleotide at a concentration of 4,000 nM for 48 hours under free uptake. At the end of the cell treatment period, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT-PCR. ATXN1 RNA levels were measured using the human ATXN1 primer-probe set RTS37575 (forward sequence GTATAGGCTGAGGCTACCTGT, designated as SEQ ID NO:14; reverse sequence GATCCAGGCTCTTCATGAGG, designated as SEQ ID NO:15; probe sequence ACAGCAGCTCTGGATGAACATTCACT, designated as SEQ ID NO:16). This was compared to methods such as... Total RNA levels measured were normalized to ATXN1 RNA levels. Results are presented in the following tables as a percentage of ATXN1 RNA levels relative to untreated control cells (control %). Compounds marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer / probe set. Other analyses may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

[0862] Table 10. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0863]

[0864]

[0865]

[0866]

[0867] Table 11. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0868]

[0869]

[0870]

[0871]

[0872] Table 12. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0873]

[0874]

[0875]

[0876]

[0877] Table 13. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0878]

[0879]

[0880]

[0881]

[0882] Table 14. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0883]

[0884]

[0885]

[0886] Table 15. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0887]

[0888]

[0889]

[0890] Table 16. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0891]

[0892]

[0893]

[0894] Table 17. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0895]

[0896]

[0897]

[0898] Table 18. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0899]

[0900]

[0901]

[0902] Table 19. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0903]

[0904]

[0905]

[0906] Table 20. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0907]

[0908]

[0909]

[0910] Table 21. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0911]

[0912]

[0913]

[0914] Table 22. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0915]

[0916]

[0917]

[0918] Table 23 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0919]

[0920]

[0921]

[0922] Table 24. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0923]

[0924]

[0925]

[0926] Table 25. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0927]

[0928]

[0929]

[0930] Table 26. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0931]

[0932]

[0933]

[0934] Table 27. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0935]

[0936]

[0937]

[0938] Table 28. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0939]

[0940]

[0941]

[0942] Table 29. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0943]

[0944]

[0945]

[0946] Table 30. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0947]

[0948]

[0949]

[0950] Table 31. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0951]

[0952]

[0953]

[0954] Table 32 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0955]

[0956]

[0957]

[0958] Table 33 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0959]

[0960]

[0961]

[0962] Table 34. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0963]

[0964]

[0965]

[0966] Table 35. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0967]

[0968]

[0969]

[0970] Table 36. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0971]

[0972]

[0973]

[0974] Table 37. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0975]

[0976]

[0977]

[0978] Table 38. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0979]

[0980]

[0981]

[0982] Table 39. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0983]

[0984]

[0985]

[0986] Table 40. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0987]

[0988]

[0989]

[0990] Table 41. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0991]

[0992]

[0993]

[0994] Table 42 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0995]

[0996]

[0997]

[0998] Table 43 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[0999]

[1000]

[1001]

[1002]

[1003] Table 44. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[1004]

[1005]

[1006]

[1007]

[1008] Table 45 shows the reduction in ATXN1 RNA in A-431 cells caused by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[1009]

[1010]

[1011]

[1012] Table 46. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[1013]

[1014]

[1015]

[1016]

[1017] Table 47. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[1018]

[1019]

[1020]

[1021]

[1022] Table 48. ATXN1 RNA reduction in A-431 cells induced by 5-10-5 MOE interstitial polymers with mixed PO / PS bonds.

[1023]

[1024] Example 3: Effects of modified oligonucleotides on human ATXN1 RNA in vitro, multiple doses

[1025] Modified oligonucleotides selected from the above embodiments were tested in A-431 cells at various doses. Cultured A-431 cells at a density of 10,000 cells / well were treated with modified oligonucleotides at various concentrations specified in the tables below using free uptake. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT-PCR. RNA levels were measured using the human ATXN1 primer and probe set RTS37573 as described above. The total RNA content measured was adjusted for ATXN1 levels. Results are presented in the following tables as the percentage reduction in ATXN1 RNA relative to the untreated control. Where possible, the half-maximal inhibitory concentration (IC50) for each modified oligonucleotide was calculated using linear regression of the logarithm / line plot in Excel. 50 ).

[1026] Table 49 shows the percentage dose-dependent reduction in human ATXN1 RNA induced by modified oligonucleotides in cells A-431.

[1027]

[1028] Table 50 shows the percentage dose-dependent reduction in human ATXN1 RNA induced by modified oligonucleotides in cells 50A-431.

[1029]

[1030]

[1031] Table 51. Percentage dose-dependent reduction in human ATXN1 RNA induced by modified oligonucleotides.

[1032]

[1033]

[1034] Table 52. Percentage dose-dependent reduction in human ATXN1 RNA induced by modified oligonucleotides.

[1035]

[1036] Example 4: Design of modified oligonucleotides complementary to human ATXN1 nucleic acid

[1037] Design and synthesize modified oligonucleotides as indicated in the following tables.

[1038] The compounds in Table 53 are 5-10-5 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 20 nucleosides in length, with a central interstitial region consisting of ten 2'-β-D-deoxynucleosides, a 5'-winged region consisting of five 2'-MOE nucleosides, and a 3'-winged region consisting of five 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeddddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following nucleoside linkage motif (from 5' to 3'): sooosssssssssssooss; where "s" represents a thiophosphate nucleoside linkage and "o" represents a phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1039] Table 53. 5-10-5 MOE interstitial polymers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking.

[1040]

[1041]

[1042]

[1043] The compounds in Table 54 are 5-10-5 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 20 nucleosides in length, with a central interstitial region consisting of ten 2'-β-D-deoxynucleosides, a 5'-winged region consisting of five 2'-MOE nucleosides, and a 3'-winged region consisting of five 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeeddddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following interstitial linkage motif (from 5' to 3'): sssosssssssssssss; where "s" represents a thiophosphate nucleoside linkage and "o" represents a phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1044] Table 54. 5-10-5 MOE interstitial polymers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking.

[1045]

[1046]

[1047] The compounds in Table 55 are 6-10-4 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 20 nucleosides in length, with a central interstitial region consisting of ten 2'-β-D-deoxynucleosides, a 5'-wing region consisting of six 2'-MOE nucleosides, and a 3'-wing region consisting of four 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeeeddddddddddeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following interstitial linkage motif (from 5' to 3'): soooooossssssssssss; where "s" represents a thiophosphate nucleoside linkage and "o" represents a phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1048] Table 55 6-10-4 MOE interstitial polymers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking

[1049]

[1050]

[1051]

[1052] The compounds in Table 56 are 5-8-4 mixed MOE / cEt interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 17 nucleosides in length, with the central interstitial segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of five 2'-MOE nucleosides, and the 3' wing segment consisting of two cEt nucleosides and two 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeeddddddddkkee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'k' represents the cEt sugar moiety, and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following nucleoside linkage motif (from 5' to 3'): sssossssssssss; where "s" represents the thiophosphate nucleoside linkage and "o" represents the phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1053] Table 56. 5-8-4 MOE / cEt hybrid interwing spacers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking.

[1054]

[1055] The compounds in Table 57 are 5-8-4 mixed interstitial polymers with mixed nucleoside linkages. These mixed interstitial polymers have mixed cEt / MOE wings and a 2'-OMe-modified nucleoside at the 2-position of the interstitial space. The interstitial polymer is 17 nucleosides long, with the 5' wing consisting of five 2'-MOE nucleosides and the 3' wing consisting of two cEt nucleosides and two 2'-MOE nucleosides. The interstitial space is eight nucleosides long and has nucleosides containing the 2'-β-D-deoxyribosyl sugar moiety at positions 1, 3, 4, 5, 6, 7, and 8 (counting from the 5' end) and a 2'-OMe nucleoside at position 2 (counting from the 5' end). The glycosylation motif of the mixed interstitial polymer is (from 5' to 3'): eeeedyddddddkkee; where 'd' represents the 2'-β-D-deoxyribosyl sugar motif, 'y' represents the 2'-O-methylribosyl sugar motif, 'k' represents the cEt sugar motif, and 'e' represents the 2'-MOE sugar motif. The interstitial polymer has the following nucleoside-linked motif (from 5' to 3'): sssossssssssss; where "s" represents the thiophosphate nucleoside link and "o" represents the phosphodiester nucleoside link. All cytosine residues are 5-methylcytosine.

[1056] Table 57

[1057] 5-8-4 MOE / cEt complementary to human ATXN1 with mixed PO / PS nucleotide interlinking

[1058] Mixed interstitial polymers

[1059]

[1060]

[1061] The compounds in Table 58 are 5-8-4 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 17 nucleosides in length, with a central interstitial region consisting of eight 2'-β-D-deoxyribosides, a 5'-wing region consisting of five 2'-MOE nucleosides, and a 3'-wing region consisting of four 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeddddddddeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following interstitial linkage motif (from 5' to 3'): sssossssssssss; where "s" represents a thiophosphate nucleoside linkage and "o" represents a phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1062] Table 58. 5-8-4 MOE interstitial polymers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking.

[1063]

[1064] The compounds in Table 59 are 5-10-5 MOE interstitial polymers with mixed nucleoside linkages. The interstitial polymers are 20 nucleosides in length, with a central interstitial region consisting of ten 2'-β-D-deoxynucleosides, a 5' wing region consisting of five 2'-MOE nucleosides, and a 3' wing region consisting of five 2'-MOE nucleosides. The glycosylation motif of the interstitial polymers is (from 5' to 3'): eeeeddddddddddeeeee; where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety. The interstitial polymers have the following nucleoside linkage motif (from 5' to 3'): sooosssssssssssooss; where "s" represents a thiophosphate nucleoside linkage and "o" represents a phosphodiester nucleoside linkage. All cytosine residues are 5-methylcytosine.

[1065] Table 59. 5-10-5 MOE interstitial polymers complementary to human ATXN1 with mixed PO / PS nucleotide interlinking.

[1066]

[1067] Example 5: Tolerance of modified oligonucleotides complementary to human ATXN1 in rats, long-term evaluation

[1068] In separate studies conducted under identical conditions, the modified oligonucleotides described above were tested in Sprague Dawley rats to evaluate the long-term tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) delivery dose of 3 mg of the oligonucleotide or PBS. Each animal was weighed weekly by trained observers, and adverse events were assessed. Adverse events were defined as atypical neurological dysfunctions in PBS-treated control animals, including (but not limited to): abnormal limb opening, abnormal gait, tremor, abnormal breathing, paralysis, and spasticity. Animals treated with compounds 994509, 1040500, 1041927, 1055001, 1371311, or 1385293 did not experience adverse events during the study duration.

[1069] Example 6: Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice

[1070] The transgenic mouse model was generated in the laboratory of Dr. Harry Orr and Michael Koob at the University of Minnesota. The construct contained human Atxn1 exon 8, intron 8, and exon 9, including the entire 3'UTR flanked by the Frt site of the FLP recombinase (Banfi et al., Nat. Genet. 7:513-520, 1994) (including nucleotides 435531-464889 of SEQ ID NO:2) and the selection marker Hygro flanked by the LoxN site of the CRE recombinase. The construct was injected into mouse embryonic sacs. The human sequences of exon 8, intron 8, and exon 9 replaced mouse Atxn1 exon 7, intron 7, and exon 8. The Hygro box was removed via recombination to generate chimeric mice expressing human coding sequences of exon 8 and exon 9. Human RNA expression was observed in the brain and spinal cord of this model. A stop codon is produced by the deletion of a base at amino acid 190, thus preventing the formation of a protein.

[1071] The activity of the modified oligonucleotides described above was tested using the aforementioned transgenic mice.

[1072] treat

[1073] ATXN1 transgenic mice were treated with a single ICV concentration of 300 μg of modified oligonucleotides. On each treatment day, a group of 3–4 mice received PBS as a negative control, and PCR values ​​were normalized relative to the PBS control group of mice treated on the same day. In some cases, individual mice treated with a given modified oligonucleotide were treated on different days, and the reported results for each modified oligonucleotide in the table below represent the average of 1–3 independent experiments representing 1–5 treated mice for each modified oligonucleotide.

[1074] RNA analysis

[1075] Two weeks after treatment, mice were euthanized, and RNA was extracted from cortical brain tissue for real-time qPCR analysis of ATXN1 RNA expression using primer and probe set RTS37573 (described above). Results are presented as percentage changes in RNA relative to the PBS control, normalized relative to mouse cyclophilin A. Data indicated as "nd" (no data) means that no data of the compound was found in the tissue.

[1076] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction in ATXN1 RNA compared to the PBS control.

[1077] Table 60. Reduction of human ATXN1 RNA in transgenic mice

[1078]

[1079]

[1080]

[1081]

[1082]

[1083]

[1084]

[1085]

[1086]

[1087]

[1088]

[1089]

[1090] Example 7: Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice, multiple doses

[1091] The modified oligonucleotides described above were tested in the ATXN1 transgenic mice described above.

[1092] treat

[1093] ATXN1 transgenic mice were divided into groups of 3-4 mice each. Each mouse received a single ICV concentration of the modified oligonucleotide at the doses described in the tables below and was sacrificed after two weeks. Four mice in each group served as a negative control with PBS in each experiment. Each table represents a separate experiment.

[1094] RNA analysis

[1095] Two weeks later, mice were euthanized, and RNA was extracted from cortical brain tissue for real-time PCR analysis of ATXN1 RNA expression measurements using the primer-probe set RTS37573. Results are presented as the percentage change in RNA relative to the PBS control, normalized relative to mouse cyclophilin A (measured using the primer-probe set m_cyclo24 described above). ED50 values ​​were calculated in GraphPadPrism. N / A indicates that an ED50 value could not be reliably calculated for the experiment.

[1096] As shown in the tables below, treatment with modified oligonucleotides resulted in a dose-dependent reduction in ATXN1 RNA compared to the PBS control.

[1097] Table 61. Percentage of dose-dependent reduction in human ATXN1 RNA in the cortex of transgenic mice.

[1098]

[1099] Table 62. Percentage of dose-dependent reduction in human ATXN1 RNA in transgenic mice.

[1100]

[1101] Table 63. Percentage of dose-dependent reduction in human ATXN1 RNA in transgenic mice.

[1102]

[1103] Table 64. Percentage of dose-dependent reduction in human ATXN1 RNA in transgenic mice.

[1104]

[1105] Table 65. Percentage of dose-dependent reduction in human ATXN1 RNA in transgenic mice.

[1106]

Claims

1. A modified oligonucleotide having the following chemical structure: (SEQ ID NO: 3590), or its salt.

2. The modified oligonucleotide as described in claim 1, wherein the modified oligonucleotide is a sodium or potassium salt.

3. A modified oligonucleotide having the following chemical structure: (SEQ ID NO: 3590).

4. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m Ces m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m CeoAes Thes m Ce (SEQ ID NO: 3590), known as, A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside linkage, and o = Phosphodiester nucleoside linkage.

5. A group of modified oligonucleotides as described in any one of claims 1-3 or a group of oligomeric compounds as described in claim 4, wherein all phosphate thioester nucleoside linkages of the modified oligonucleotides are stereorandom.

6. A pharmaceutical composition comprising a modified oligonucleotide as described in any one of claims 1-3, an oligomeric compound as described in claim 4, or a group as described in claim 5, and a pharmaceutically acceptable diluent.

7. The pharmaceutical composition of claim 6, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS) or artificial cerebrospinal fluid.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition comprises the modified oligonucleotide or oligomer and artificial cerebrospinal fluid.

9. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition comprises the modified oligonucleotide or oligomer and PBS.

10. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition comprises a group of the modified oligonucleotides or a group of oligomeric compounds and artificial cerebrospinal fluid.

11. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition comprises a group of the modified oligonucleotides or a group of oligomeric compounds and PBS.

Citation Information

Patent Citations

  • Bright enamel paint for inner wall and its production process

    CN1336404A

  • Nuclease resistant chimeric oligonucleotides

    US20030158403A1

  • Nuclease resistant chimeric oligonucleotides

    US20030175906A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • 2' and 5' modified monomers and oligonucleotides

    US20130203836A1