A drug target gene and its encoded protein MoPh1

Abstract

The present invention discloses the application of the rice blast fungus membrane protein gene MoPH1 in regulating the pathogenicity of rice blast fungus, belonging to the field of biotechnology. In the present invention, a gene knockout vector is constructed and introduced into the protoplasts of rice blast fungus, and the gene is knocked out from rice blast fungus by homologous recombination to obtain the knockout mutant ΔMoph1. Experiments prove that compared with the wild type of rice blast fungus, the vegetative growth and development of the knockout mutant ΔMoph1 are slow, and the number of conidia is reduced, the function of appressoria is abnormal, and it is more tolerant to cell wall stress and osmotic stress, etc.; the pathogenicity test shows that the deletion of MoPH1 significantly reduces the pathogenicity of rice blast fungus; after the gene is complemented, its pathogenicity is restored to the wild type level. The present invention proves that MoPH1 is a pathogenic gene of rice blast fungus. Studying the membrane protein coding gene MoPH1 in rice blast fungus helps to deeply understand the pathogenic molecular mechanism of rice blast fungus and provides a target gene for the development of effective fungicides.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of a rice blast fungus membrane protein gene MoPH1 in regulating the pathogenicity of Magnaporthe oryzae. Background Art

[0002] Rice (Oryza sativa) is the most important food crop in China, and the stable and high-yield production of rice is an important guarantee for China's food security. Rice blast, caused by Magnaporthe oryzae, has long been the most serious fungal disease threatening rice production. The annual grain loss is sufficient to feed more than 60 million people.

[0003] At present, the prevention and control of major crop fungal diseases in China mainly rely on chemical control, crop rotation and biological control. Among them, chemical control is the main method for disease control. In view of the environmental pollution and pesticide residue problems caused by the extensive use of fungicides, the research on green biological control is an important direction for plant disease control.

[0004] Although the whole genome sequencing of Magnaporthe oryzae has been completed, there are more than 11,000 genes in Magnaporthe oryzae, and there are still a large number of proteins with unknown functions (uncharacteized protein). Therefore, fully exploring the genes related to the pathogenicity of Magnaporthe oryzae and carrying out functional research on them will help to fully understand the molecular mechanism of the pathogenicity of Magnaporthe oryzae and provide a theoretical basis for the prevention and control of Magnaporthe oryzae. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide the application of a rice blast fungus membrane protein gene MoPH1 in regulating the pathogenicity of Magnaporthe oryzae.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided the application of gene MoPH1 in regulating the pathogenicity of Magnaporthe oryzae;

[0008] The gene moph1 is a nucleic acid molecule as shown in the following (i) or (ii):

[0009] (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1;

[0010] (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i).

[0011] In the above application, the gene MoPH1 regulates the pathogenicity of Magnaporthe oryzae through at least one of the following (1)-(4) pathways:

[0012] (1) Control the vegetative growth of Magnaporthe oryzae;

[0013] (2) Control the number of conidia formed by Magnaporthe oryzae;

[0014] (3) Affect the response of Magnaporthe oryzae to external stresses;

[0015] (4) Control the function of appressoria of Magnaporthe oryzae.

[0016] In the second aspect of the present invention, there is provided the use of the gene MoPH1 in regulating the response of Magnaporthe oryzae to external stresses;

[0017] The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii):

[0018] (i) A nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1;

[0019] (ii) A nucleic acid molecule other than (i) encoding the amino acid sequence as shown in SEQ ID NO: 2.

[0020] In the above application, the high osmotic stress is caused by NaCl or sorbitol, the cell wall stress is caused by congo red and SDS, and the oxidative stress is caused by hydrogen peroxide.

[0021] In the third aspect of the present invention, there is provided the use of the gene MoPH1 in controlling rice blast caused by Magnaporthe oryzae;

[0022] The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii):

[0023] (i) A nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1;

[0024] (ii) A nucleic acid molecule other than (i) encoding the amino acid sequence as shown in SEQ ID NO: 2.

[0025] In the above application, the control is achieved by blocking or inhibiting the expression of the gene MoPH1.

[0026] In the fourth aspect of the present invention, there is provided the use of the protein encoded by the gene MoPH1 in the following (1) or (2):

[0027] (1) Control rice blast caused by Magnaporthe oryzae;

[0028] (2) As a target for developing drugs for controlling rice blast.

[0029] In the above application, the amino acid sequence of the protein encoded by the gene MoPH1 is as shown in SEQ ID NO: 2.

[0030] The fifth aspect of the present invention provides a method for reducing the pathogenicity of Magnaporthe oryzae, including:

[0031] the step of knocking out the gene MoPH1 in Magnaporthe oryzae;

[0032] or, the step of rendering the function of the protein encoded by the gene moph1 in Magnaporthe oryzae deficient.

[0033] In the above method, techniques such as VIGS technology, T-DNA insertion, CRISPR-Cas9 gene editing technology, RNA interference, etc. can be used to knock out the gene MoPH1.

[0034] The sixth aspect of the present invention provides the use of an agent that blocks or inhibits the expression of the gene MoPH1 in the preparation of a drug for preventing and treating rice blast.

[0035] In the above use, the agent is an antisense RNA or siRNA of the gene MoPH1.

[0036] In the above use, the gene moph1 is a nucleic acid molecule as shown in the following (i) or (ii):

[0037] (i) a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1;

[0038] (ii) a nucleic acid molecule other than (i) that encodes the amino acid sequence shown in SEQ ID NO: 2.

[0039] The beneficial effects of the present invention:

[0040] The present invention has for the first time studied and confirmed the new functions of the unknown function protein MoPh1 and its encoding gene MoPH1 in Magnaporthe oryzae. The present invention constructs a gene knockout vector and introduces it into the protoplasts of Magnaporthe oryzae; uses the homologous recombination method to knock out this gene from Magnaporthe oryzae to obtain the knockout mutant ΔMoph1; constructs a gene complementation vector and introduces it into the protoplasts of ΔMoph1; obtains the complementation mutant ΔMoph1 / MoPH1. The vegetative growth and conidia number of this gene knockout mutant are slowed down, the appressorium turgor is abnormal, the infection rate is reduced, and the sensitivity to cell wall, osmotic and oxidative stresses is reduced. Pathogenicity determination shows that the pathogenicity of the knockout mutant ΔMoph1 is significantly reduced; the pathogenicity of the complementation mutant ΔMoph1 / MoPH1 can be restored to the wild-type level. The above experiments prove that MoPH1 is essential for the vegetative growth, conidia formation, appressorium function and pathogenicity of Magnaporthe oryzae, so MoPH1 is a pathogenicity-related gene of Magnaporthe oryzae. Studying the membrane protein encoding gene MoPH1 in Magnaporthe oryzae helps to deeply understand the pathogenic molecular mechanism of Magnaporthe oryzae and provides a target for the development of effective fungicides. Description of the Drawings

[0041] Figure 1 : PCR verification results of MoPH1 knockout mutants.

[0042] Figure 2 : PCR verification results of ΔMoph1 / MoPH1 complementation mutants.

[0043] Figure 3 : Investigation results of vegetative growth and development of MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants.

[0044] Figure 4 : Investigation results of the number of conidia of MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants.

[0045] Figure 5 : Growth states of MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants under different stress conditions.

[0046] Figure 6 : Inhibition rates of different stress conditions on MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants.

[0047] Figure 7 : Investigation results of the appressorium turgor pressure and infection rate of MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants.

[0048] Figure 8 : Investigation results of the pathogenicity of MoPH1 knockout mutants and ΔMoph1 / MoPH1 complementation mutants. Specific implementation manners

[0049] It should be noted that the following detailed descriptions are all illustrative and are intended to provide further explanations for this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0050] As mentioned above, fully exploring the genes related to the pathogenicity of Magnaporthe oryzae and conducting research on their functions contribute to fully understanding the molecular mechanism of the pathogenicity of Magnaporthe oryzae and providing a theoretical basis for the prevention and control of Magnaporthe oryzae.

[0051] Based on this, the present invention has conducted in-depth research on the unknown genes in the genome of Magnaporthe oryzae. Among them, uncharacterized protein MGG_11259 [Pyricularia oryzae 70-15] is an uncharacterized protein in Magnaporthe oryzae, and it is named as the Magnaporthe oryzae membrane protein MoPh1.

[0052] The coding gene MoPH1 of the blast fungus membrane protein MoPh1 has a nucleotide sequence as shown in SEQ ID NO: 1, which is as follows:

[0053] ATGTCGGACGCACAGAAGCCCGTTGAGGTCCCGAAGGACGCCGCCGCTGCCCCGGC

[0054] AGTTGAGCCAATTGTTGCTGCCCCCGAGGCGACCCCCGCTGTTGTCGAGGCCCCCA

[0055] AAGAGGCCGAGCCCGTTGTCGCTGCCACCACTGCCGAGCCCGAGACCGCCGCTACG

[0056] ACGACCGCCGAGACCCCCGCCGCCGCTGCTACGACTGAGGCTGCTACCGAGACCGC

[0057] GGCTGCCGAGACCGAGGGGGCTAAGAAGGAGGAGAAGGAGGTTACCCCCATCGAG

[0058] GAGGGCTACCTTGAGTCAAAGGGCACCAAGTTTCCTCAGAACTTCATCTACACCAA

[0059] GCGCTTCTTCTGGTTCGGTACTGATGCCGTCGAGCCCAAGAACTTGGCCTCTTTCCT

[0060] CAAGTCAGAGAAGTCAACTGAGAGCGCGCAGAACATTGCCGCATGGGCTAGCCAC

[0061] ACTGGCGAGGGTCTCCTTTTCTTCACCGAGAAGGGCACTGACAAGACCGCTCCTGG

[0062] TGGCGCCATCCAACTGAGCGAGGCTTCTGAGCCAACTGCCGACGGCCCCACTAAGT

[0063] TCCACTTTACTGCCAAGGGCCACAAGCACACGTTCAAGGCTGCTACTGCTGCCGAC

[0064] CGCGACAACTGGGTCGCCCAAATCAAGGCCAAGTCCGCTGCCGCCAAGGAGCTCGC

[0065] CGCTTCTGTGACTGAGAGCGAGACCTACAAGAAGACCTTGGAGAGTTTCAAGCCTG

[0066] CTGCCCCTGTCGCTCCCGCCAAGAAGGGGGAGGCTAAGGCTGAGGAGCCTGCCGCT

[0067] GAGGTTGCCGCCGCTACCGAGGCCGAGCCTGCCACTGAGGCCAAGGAGACTGAGGT

[0068] CCCCAAGATTGAGGAGCCCGCCGAGGCCAAGGAGGCTGCTGCCGCCAAGGACGAG

[0069] AAGAAGGAGGAGCCCCAGCGTCGCTCTGCTAGCCGCAAGCGCGCCTCGATCTTCGG

[0070] CTCGCTCCTCGGCAAGAAGGATGAGAAGAAGGAGGCCAAGAAGGAGGAGGCCAAG

[0071] TCCGAGGAGGCTGCCGCCGCCGCCGCCCCTGCTGAGACTCCTTCCGCCGAGGCCGC

[0072] CGTCGCTGAGCCTATTGATGCCGCTGTCGAGGCCCCCGCCGCTGCGACCGCTGACG

[0073] CCGCAGCTACTGAGGCTCCCGCCGCCACTGAGGAGAAGAAGGAGGAGGAGAAGGC

[0074] TGCCCCTGTCAAGCCAACTCCTGTCAAGCGCAACAGCCTGTTCGGCAACCTGAGCTT

[0075] CGGCAAGAAGAAGACTGCTGAGCCCGTCGCCGCCGAGGCTGCTCCTGCCGTCCCTA

[0076] CCAAGGAGGCTGATGCTGGCCCCGTCGCTGACGCTGCCCCTGTCATCCCTGCCGTTG

[0077] AGACCTCTGCCCCTCTCTCCGCCGAGGTCGCCTCGCCCGCCACTGTCCCTACTGAGA

[0078] CCGTTGAGGCTGCCCCGGCCGCCGCTGCTGAGCCGGCCAAGAAGGACATGAAGAGC

[0079] GAGAAGCGTAAGTCTTCGCTTCCTTTCGCTTTCGGCAAGAAGGACAAGGCTACTTCC

[0080] TCGGACGAGGAGGGTGAGAAGGCCCCCAAGTCTCCTTCTGCTTTCTCCAAGCTCCGT

[0081] GCCACCATCAAGGGCAAGAACAAGGCCGAGAAGCCTGTTGAGAAGCCCGAGGCTA

[0082] CTCCCGAGGAGACTGCTGAGAAGACCGAGGCCGAGGCCCCCAAGGCCGATGAGAC

[0083] CACCGAGGTTAAGGCCGAGGAGCCTGCCAAGCCCGTTGAGGCCGAGGCCGCTGCCC

[0084] CTGCTCCTGTCGTTGAGGAGGCCCCCAAGCCTGTAGCTGCTACCCCCGTTGTTGCTGCCTCGGCTTAG。

[0085] The amino acid sequence of the blast fungus membrane protein MoPh1 is shown in SEQ ID NO: 2 as follows: MSDAQKPVEVPKDAAAAPAVEPIVAAPEATPAVVEAPKEAEPVVAATTAEPETAATTTAETPAAAATTEAATETAAAETEGAKKEEKEVTPIEEGYLESKGTKFPQNFIYTKRFFWFGTDAVEPKNLASFLKSEKSTESAQNIAAWASHTGEGLLFFTEKGTDKTAPGGAIQLSEASEPTADGPTKFHFTAKGHKHTFKAATAADRDNWVAQIKAKSAAAKELAASVTESETYKKTLESFKPAAPVAPAKKGEAKAEEPAAEVAAATEAEPATEAKETEVPKIEEPAEAKEAAAAKDEKKEEPQRRSASRKRASIFGSLLGKKDEKKEAKKEEAKSEEAAAAAAPAETPSAEAAVAEPIDAAVEAPAAATADAAATEAPAATEEKKEEEKAAPVKPTPVKRNSLFGNLSFGKKKTAEPVAAEAAPAVPTKEADAGPVADAAPVIPAVETSAPLSAEVASPATVPTETVEAAPAAAAEPAKKDMKSEKRKSSLPFAFGKKDKATSSDEEGEKAPKSPSAFSKLRATIKGKNKAEKPVEKPEATPEETAEKTEAEAPKADETTEVKAEEPAKPVEAEAAAPAPVVEEAPKPVAATPVVAASA。

[0086] Furthermore, the present invention has conducted a series of verifications on this gene. The present invention constructs a gene MoPH1 knockout vector, introduces it into the protoplasts of the blast fungus, and uses the method of homologous recombination to knockout this gene from the blast fungus to obtain the knockout mutant ΔMoph1. The experiments prove that, compared with the wild type of the blast fungus, the vegetative growth and development of the knockout mutant ΔMoph1 are slow, and the number of conidia is significantly reduced; the turgor pressure of the appressorium is abnormal and the infection rate is reduced; the sensitivity to external stresses such as cell wall stress, osmotic stress, and oxidative stress is reduced; the pathogenicity test shows that the deletion of MoPH1 significantly reduces the pathogenicity of the blast fungus; after the gene is complemented, its pathogenicity is restored to the wild type level. Thus, it is proved that the MoPH1 gene is a pathogenicity-related gene of the blast fungus, and using its encoded protein as a drug target is expected to provide a new way for the prevention and control of rice blast.

[0087] To enable those skilled in the art to more clearly understand the technical solution of this application, the technical solution of this application will be described in detail below in conjunction with specific embodiments.

[0088] The test materials used in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. The experimental methods without specified detailed conditions are carried out according to conventional test methods or according to the operation manuals recommended by the suppliers. Among them:

[0089] The test strain is Magnaporthe oryzae Guy11, which is recorded in the literature "Histone acetyltransferase MoHat1 acetylates autophagy-related proteins MoAtg3 and MoAtg9 to orchestrate functional appressorium formation and pathogenicity in Magnaporthe oryzae, Autophagy, 15:7, 1234-1257, DOI: 10.1080 / 15548627.2019.1580104"; the test rice is the susceptible indica rice line CO39.

[0090] The gene knockout vector is PCX62, and the gene complementation vector is PYF11.

[0091] Liquid complete medium: The formula is 50 ml 20×Nitrate Salts * 1 ml Trace Elements * 10 g D-Glucose * 2 g Peptone * 1 g Yeast Extract * 1 g Casamino Acids * 1 ml Vitamin Solution *, Add ddH 2 O to 1 L).

[0092] Solid complete medium (CM): Add 12 g Agar to the liquid complete medium.

[0093] SDC medium: The formula is 100 g rice straw (boiled for 20 min, filtered through two layers of gauze, discard the residue), 40 g corn flour, 15 g agar powder, slightly boiled, made up to 1 L, dispensed 150 ml / bottle (200 ml conical flask), sterilization conditions are 121 degrees, 15 minutes.

[0094] Example 1: Construction of the MoPH1 gene knockout vector

[0095] According to the DNA sequences at both ends of the MoPH1 gene in the whole genome database of Magnaporthe oryzae on the FungiDB website, about 1 kb of DNA sequences upstream and downstream of the MoPH1 coding region (shown as SEQ ID NO: 3 and SEQ ID NO: 4) were selected as the two homologous arms in the homologous recombination process to construct a knockout vector.

[0096] In this experiment, the PCX62 vector was used, which carried a hygromycin phosphotransferase gene (HPH) between two restriction enzyme sites. The upper and lower arms were respectively ligated to both ends of the HPH by the method of restriction enzyme digestion and ligation. Using the genomic DNA of the Guy11 strain as a template, the fragment of the upper arm was amplified with the primers shown as SEQ ID NO: 5 and SEQ ID NO: 6; the fragment of the lower arm was amplified with the primers shown as SEQ ID NO: 7 and SEQ ID NO: 8.

[0097] ATAAGCTTGATATCGAATTCCAGCACATGATGACTTACGGC; (SEQ ID NO: 5)

[0098] AGGCATTGATGTGTTGACCTCCTGTGAAAAATGTTTTGGGGTATCAAAG. (SEQ ID NO: 6)

[0099] TCGTCCGAGGGCAAAGGAATAGGGAACGCGAAGCAGTTTG; (SEQ ID NO: 7)

[0100] GCGGTGGCGGCCGCTCTAGAAAGGTGCACTTGTTAATCCAGTT. (SEQ ID NO: 8)

[0101] The PCR reaction conditions were as follows: reacting at 94 °C for 5 min; reacting at 94 °C for 30 s, 56 °C for 30 s, 72 °C for 2 min, for a total of 35 cycles; reacting at 72 °C for 10 min. Using the MonPure Gel&PCR Purification Kit (MI17101) kit, the PCR amplification products were recovered and purified and then respectively ligated to the PMD19-T simple vector. After double digestion of the upper and lower arms, they were respectively ligated to the PCX62 vector to obtain the PCX62:MoPH1:HPH knockout vector, and sequencing analysis was carried out.

[0102] Example 2: Construction of the MoPH1 gene complementation vector

[0103] Near the XhoI cleavage site of the PYF11 vector, a sequence of about 30 bp was selected as the homologous arm, and primers were designed (the primer sequences are shown in SEQ ID NO: 13 and SEQ ID NO: 14).

[0104] ACTCACTATAGGGCGAATTGGGTACTCAAATTGGTTACCAGACTTTTAGCTAATATCGT; (SEQ IDNO: 13)

[0105] CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACAGCCGAGGCAGCAAC. (SEQ ID NO: 14)

[0106] Using the extracted genomic DNA of Magnaporthe oryzae as a template, PCR amplification was performed with primers SEQ ID NO: 13 and SEQ ID NO: 14 to obtain the complementation fragment of the MoPH1 gene, as shown in sequence SEQ ID NO: 15. After recovering and purifying the complementation fragment of the MoPH1 gene, it was ligated to the PYF11 vector by homologous recombination. After sequencing analysis and comparison, the PYF11-MoPH1 gene complementation vector was obtained.

[0107] Example 3: Preparation of Magnaporthe oryzae protoplasts

[0108] After inoculating the mycelial blocks on the CM plate and growing for 6 days, the colonies were cut and chopped and placed in a liquid medium in a 100 ml Erlenmeyer flask and shaken at 28 °C for 2 nights and 1 day. Weigh 0.3 g of Lysing Enzymes from Trichoderma harzianum (Sigma, L1412) and add it to a 50 ml sterile centrifuge tube, add 30 ml of 0.7 M Nacl, shake to dissolve. Take another 50 ml centrifuge tube, suck the above solution with a syringe, and place a 0.45 μm bacterial filter on the syringe, and inject the liquid into a 50 ml disposable centrifuge tube. Filter the mycelium with non-woven fabric and press it dry. Put the treated mycelium into the enzyme solution. Seal the centrifuge tube with a sealing film, shake vigorously to break up the mycelial blocks and make them fully enzymolyzed. Shake the centrifuge tube horizontally at 30 °C and 60 rpm for 2 hours. Take out the enzyme solution and filter it through 4 layers of non-woven fabric into a new 50 ml tube. Centrifuge at 4 °C for 10 minutes at 3300 rpm, discard the supernatant, add an appropriate amount of STC (containing 1.2 M sorbitol, 10 mM Tris-HCl, pH 7.5, 50 mM CaCl 2 ) Pipette and mix well, leave a drop on the tip and place it on a glass slide for microscopic examination. Calculate the protoplast concentration with a hemocytometer; and control the final protoplast concentration at 1×10 7 cells / mL - 1×10 8cells / mL, and then take 150 μL of protoplasts and place them in a 10 mL EP tube. The protoplasts of the Magnaporthe oryzae knockout mutant were prepared with reference to the above-mentioned preparation steps of the Magnaporthe oryzae protoplasts.

[0109] Example 4: Transformation of Magnaporthe oryzae Protoplasts

[0110] Mix the PCX62:MoPH1:HPH knockout vector plasmid constructed in Example 1 with 150 μL of Magnaporthe oryzae protoplasts, or mix the PYF11-MoPH1 plasmid constructed in Example 2 with 150 μL of Magnaporthe oryzae knockout mutant protoplasts. Let it stand for 25 minutes in a laminar flow hood. Pipette 1 mL of PTC (PEG4000 + STC) into a 10 mL EP tube, rotate and mix well, and let it stand for 15 minutes. Then add 6 mL of liquid TB3 to the 10 mL EP tube. Seal the tube mouth with a sealing film, invert and mix well, and incubate at 28 °C with shaking at 60 rpm for 2 - 3 hours.

[0111] Melt the TB3 solid medium, and then add the antibiotic hygromycin so that the concentration of hygromycin in the medium is 50 mg / mL. Take 50 mL of TB3, pour the transformed protoplasts into a large centrifuge tube, mix well, and pour plates, about 10 mL per plate.

[0112] When the first layer of medium is dry, add 200 mL of TB3 with a hygromycin concentration of 100 mg / mL, mix well, and pour plates, about 10 mL per plate for the second layer, and dry it with sterile air blowing. Incubate in the dark at 28 °C for 5 days.

[0113] Example 5: PCR Verification and Analysis of MoPH1 Knockout Mutants

[0114] According to the method of crude extraction of Magnaporthe oryzae genomic DNA, extract the genomic DNA of the transformants for PCR verification and analysis. First, cut small pieces of mycelium blocks for backup, and then scrape 1 / 2 of the colony mycelium into a 2 mL EP tube and add a little quartz sand. Add 500 μL of 2% CTAB and 500 μL of phenol / chloroform to each tube. Incubate in a shaker at 37 °C and 250 rpm for 1 - 1.5 h, centrifuge at 12,000 rpm for 15 min, take the supernatant (about 400 μL), add an equal volume of isopropanol for precipitation, centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 1 mL of ice-cold 70% ethanol for washing once, and remove the residual liquid in a vacuum concentrator. Add 20 μL of ddH 2Dissolve gDNA and incubate it in a 37°C incubator for more than 30 min. Then perform PCR to verify the transformants. First, pair the probe primers (internal gene primers SEQ ID NO: 9 and SEQ ID NO: 10) with the external arm primers / HphconR primers (SEQ ID NO: 11 and SEQ ID NO: 12) for verification twice. The PCR reaction system is as follows: 2 μl of template DNA, 0.5 μl of each primer, 10 μl of 2×Taq plus Master Mix, ddH 2 O 7 μl. The PCR reaction conditions are: react at 94°C for 5 min; react at 94°C for 30 s, 56°C for 30 s, 72°C for 2 min, for a total of 35 cycles; react at 72°C for 10 min to obtain the amplification product.

[0115] ATGTCGGACGCACAGAAGCC; (SEQ ID NO: 9)

[0116] CAGCCTCCTTGGCCTCGGCG. (SEQ ID NO: 10)

[0117] AATGCGAAAAGGGGATCGTTC; (SEQ ID NO: 11)

[0118] GCTGATCTGACCAGTTGCCTA. (SEQ ID NO: 12)

[0119] Perform PCR amplification using the probe primers (SEQ ID NO: 9 and SEQ ID NO: 10). There is no internal probe band of the MoPH1 gene in the knockout mutant Figure 1 A); perform PCR amplification using the external arm primers / HphconR primers (SEQ ID NO: 11 and SEQ ID NO: 12). There is an amplification band in the knockout mutant Figure 1 B).

[0120] The results show that: In this example, the MoPH1 knockout mutants ΔMoph1-6 and ΔMoph1-8 were successfully constructed.

[0121] Example 6: PCR verification analysis of Moph1 complementation mutants

[0122] According to the method of crude extraction of Magnaporthe oryzae genomic DNA in Example 5, extract the genomic DNA of the complementation transformants and perform PCR verification analysis. Perform PCR amplification of the gene fragment using primers SEQ ID NO: 9 and SEQ ID NO: 10. The PCR reaction system is 2 μl of template DNA, 0.5 μl of each primer, 10 μl of 2×Taq plus Master Mix, ddH 2O 7 μl. The PCR reaction conditions were as follows: reaction at 94°C for 5 min; reaction at 94°C for 30 s, 56°C for 30 s, 72°C for 2 min, for a total of 35 cycles; reaction at 72°C for 10 min to obtain the amplification product. The result of the complementation mutant showed a target band, and the result was as Figure 2 shown. In this example, the Moph1 complementation mutant ΔMoph1 / MoPH1 was successfully constructed.

[0123] Example 7: Observation on the vegetative growth and development of the ΔMoPH1 knockout mutant and the ΔMoph1 / MoPH1 complementation mutant

[0124] The wild-type Magnaporthe oryzae Guy11, the knockout mutant ΔMoph1, and the complementation mutant were respectively inoculated into solid complete medium, liquid complete medium, and SDC medium. The growth was observed on the 7th day for solid complete culture and SDC culture, and the growth was observed on the 3rd day for liquid complete medium.

[0125] Figure 3 A shows the growth of the wild type, the Moph1 knockout mutant, and the Moph1 complementation mutant on CM medium and SDC medium; Figure 3 B shows the morphological status of the mycelial pellets after liquid culture of the wild type, the Moph1 knockout mutant, and the Moph1 complementation mutant under the condition of liquid complete medium. The results showed that there was no obvious difference in the colony morphology of ΔMoph1 compared with the wild-type Magnaporthe oryzae ( Figure 3 A, B); however, the growth rate was significantly slowed down, and the colony diameter was significantly smaller than that of the wild type ( Figure 3 C); and the dry weight of the mycelium was significantly smaller than that of the wild type ( Figure 3 D); while after complementation, it recovered to a level similar to that of the wild type.

[0126] Example 8: Investigation on the number of conidia of the ΔMoPH1 knockout mutant and the ΔMoph1 / MoPH1 complementation mutant

[0127] The Moph1 knockout mutants (ΔMoph1-6, ΔMoph1-8), the Moph1 complementation mutant (ΔMoph1 / MoPH1), and the wild-type Magnaporthe oryzae (Guy11) were respectively inoculated on SDC medium, and conidia production was induced by direct illumination with a black light for 10 days at 28°C. 5 ml of sterile water was added to the plate, and the aerial hyphae and spores were brushed off together with the bottom of a 1.5 ml EP tube, and then filtered through a filter cloth. The filtrate was collected into a 10 ml EP tube, and the number of conidia was counted using a hemocytometer. Each experiment was repeated 3 times, with 3 replicates set each time, and the final results were averaged and subjected to significance analysis.

[0128] The results showed that the conidia production of the Magnaporthe oryzae knockout mutant ΔMoph1 was reduced compared with that of the wild type; the complemented mutant ΔMoph1 / MoPH1 restored to a level similar to that of the wild type. Figure 4 )

[0129] Example 9: Investigation of the ΔMoph1 knockout mutant and the ΔMoph1 / MoPH1 complemented mutant under different stress conditions

[0130] The MoPH1 knockout mutants (ΔMoph1-6, ΔMoph1-8), the MoPH1 complemented mutant (ΔMoph1 / MoPH1), and the wild-type Magnaporthe oryzae (Guy11) were respectively inoculated on the complete medium supplemented with 200 μg / mL Congo Red, 400 μg / mL CR, 0.005% SDS, 0.008% SDS, 0.6 M KCl, 0.7 M NaCl, 1 M sorbitol, 2.5 mM H 2 O 2 、5 mM H 2 O 2 . They were placed in an incubator at 28 °C for 7 days, and their colony growth status and colony diameter were observed. The growth inhibition rate was calculated according to the following formula:

[0131] Growth inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100%.

[0132] The results showed that the knockout mutant ΔMoph1 had reduced sensitivity to these stresses. Figure 5 、 Figure 6 )

[0133] Example 10: Investigation of the ΔMoph1 knockout mutant and the ΔMoph1 / MoPH1 complemented mutant for controlling the appressorium function of Magnaporthe oryzae

[0134] Rice plants about 4 weeks old were selected, and the outer leaves were removed, leaving the second-to-last leaf sheath and the new leaf. The new leaf was slowly taken out, leaving the leaf sheath part. The conidia of the wild type, the ΔMoph1 knockout mutant, and the ΔMoph1 / MoPH1 complemented mutant were collected and adjusted to a concentration of 1×10 5 spores / ml. The spore suspension was injected into the leaf sheath with a 1 ml syringe, and then placed in a humidified culture dish for humidified culture. The roots of the rice were covered with absorbent cotton for moisturizing. After 48 h, the leaf sheath was cut with a scalpel, and the inner epidermis of the leaf sheath was torn at a position close to the root. Then, slides were prepared and observed and counted under a microscope. At least 100 spores were used for each strain, and the experiment was repeated at least 3 times.

[0135] The invasion rate was calculated as (number of spores invading the leaf sheath / total number of spores) × 100%. It was found that the invasion rate of the ΔMoph1 mutant was lower than that of the wild type and the complemented strain ( Figure 7 A), indicating that the deletion of MoPH1 affected the function of the appressorium of the pathogen.

[0136] The rice blast fungus was transferred to SDC medium. After 4 days, the aerial mycelium was scraped off and the sporulation plate was induced by a black light for 3 days. A cover glass (Fisherbrand, 12 - 540 - A 18×18 - 2) was placed on a glass slide (sterile water was dropped below), and 30 μl of the washed spore suspension with a concentration of 5×10 4 conidia / ml was added dropwise to the center of the cover glass. After sucking off the water from the appressoria obtained after 24 h of culture, glycerol with concentrations of 1, 2, 3, and 4 M was immediately added dropwise. After 3 min, the shrinkage rate of the appressoria was observed. Each sample was set with at least 3 replicates, and the experiment was repeated at least 3 times. It was found that the shrinkage rate of the ΔMoph1 mutant was higher than that of the wild type and the complemented strain ( Figure 7 B), indicating that the deletion of MoPH1 affected the turgor pressure of the appressorium.

[0137] Example 11: Investigation of the pathogenicity of the ΔMoph1 knockout mutant and the ΔMoph1 / MoPH1 complemented mutant to rice

[0138] The MoPH1 knockout mutants (ΔMoph1 - 6, ΔMoph1 - 8), the Moph1 complemented mutant (ΔMoph1 / MoPH1), and the wild - type rice blast fungus (Guy11) were respectively inoculated on SDC medium and induced to produce conidia under direct black - light illumination at 28°C for 10 days. 5 ml of sterile water was added to the plate, and the aerial mycelium and spores were brushed off together with the bottom of a 1.5 - ml EP tube, and then filtered through a filter cloth. The filtrate was collected in a 10 - ml EP tube, and the concentration of the spore suspension was adjusted to 5×10 4 conidia / ml. For each treatment, 5 - 8 ml of the spore suspension was added with 0.2% gelatin and sprayed onto rice seedlings using a sprayer. The seedlings were placed at 28°C and 90% humidity, first cultured in the dark for 24 h, and then cultured under the condition of 12 - h light and 12 - h dark alternation. The results were counted after 7 days. Each group had 3 replicates.

[0139] The results showed that the deletion of MoPH1 significantly reduced the pathogenicity of the rice blast fungus; after the gene was complemented, its pathogenicity was restored ( Figure 8 ).

[0140] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of knocking out or deleting gene MoPH1 in reducing the pathogenicity of Magnaporthe oryzae; The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii): (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1; (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i).

2. The use according to claim 1, wherein, the gene MoPH1 regulates the pathogenicity of Magnaporthe oryzae through at least one of the following (1)-(4) pathways: (1) Controlling the vegetative growth of Magnaporthe oryzae; (2) Controlling the number of conidia formed by Magnaporthe oryzae; (3) Affecting the response of Magnaporthe oryzae to external stresses; (4) Controlling the function of appressoria of Magnaporthe oryzae; The external stresses are high osmotic pressure stress, cell wall stress or oxidative stress.

3. Use of knocking out gene MoPH1 in promoting the resistance of Magnaporthe oryzae to external stresses; The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii): (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1; (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i); The external stresses are high osmotic pressure stress, cell wall stress or oxidative stress.

4. Use of knocking out or deleting gene MoPH1 in preventing and treating rice blast caused by Magnaporthe oryzae; The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii): (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1; (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i).

5. Use of the protein encoded by gene MoPH1 as a target in developing drugs for preventing and treating rice blast; the amino acid sequence of the protein encoded by gene MoPH1 is as shown in SEQ ID NO:

2.

6. A method for reducing the pathogenicity of Magnaporthe oryzae, wherein, it includes: the step of knocking out gene MoPH1 in Magnaporthe oryzae; or, the step of making the function of the protein encoded by gene MoPH1 in Magnaporthe oryzae deficient; The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii): (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1; (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i).

7. Use of an agent that blocks or inhibits the expression of gene MoPH1 and the function of its encoded protein MoPh1 in preparing drugs for preventing and treating rice blast; The gene MoPH1 is a nucleic acid molecule as shown in the following (i) or (ii): (i) A nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 1; (ii) A nucleic acid molecule encoding the amino acid sequence as shown in SEQ ID NO: 2 other than (i).

8. The use according to claim 7, wherein, the agent is the antisense RNA or siRNA of gene MoPH1.

Images