A primer combination and kit for detecting pathogenic gene mutations of Alzheimer's disease and APOE genotypes

Through ARMS-NEAR constant temperature amplification technology combined with capillary electrophoresis, a specific primer combination is designed to achieve multiple amplification and genotyping of familial Alzheimer's disease genes, solving the problems of high detection costs and long time in the existing technology, and achieving rapid and low-cost gene detection.

CN116162693BActive Publication Date: 2025-08-01ZHEJIANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210969714.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-12
Publication Date
2025-08-01
Estimated Expiration
2042-08-12

AI Technical Summary

Technical Problem

In the prior art, familial Alzheimer's disease gene detection has problems such as high detection costs, large data analysis volume, long waiting time for results, complex operation of conventional PCR methods and long detection cycles, and lacks cheap and fast detection methods.

Method used

The ARMS-NEAR constant temperature amplification technology combined with capillary electrophoresis was used to design a specific primer combination to achieve multiple amplification of 12 hot spot mutations and 2 risk sites. The detection was completed within 15-30 minutes through constant temperature reaction, and genotyping was performed in combination with capillary electrophoresis analysis.

Benefits of technology

Significantly improve detection efficiency, reduce costs, simplify operation steps, shorten detection time, and achieve fast and efficient genotyping. The cost is only one-tenth of second-generation sequencing, and the detection cycle is 1-2 days.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_46
    Figure SMS_46
Patent Text Reader

Abstract

The present invention provides a primer combination, a kit, a detection system, a detection method and an application for detecting pathogenic gene mutations of familial Alzheimer's disease and APOE genotypes by means of constant temperature multiplex rapid detection. The method of the present invention uses the amplification refractory mutation system technology combined with the nicking endonuclease nucleic acid detection reaction isothermal amplification system to perform multiplex amplification on 14 sites including 12 hot spot mutations and 2 risk sites of the Alzheimer's disease pathogenic gene, and at the same time combines capillary electrophoresis for product analysis to perform genotyping detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a detection method and a detection system for gene SNP typing based on constant temperature and multiple amplification. Background Art

[0002] Alzheimer's disease (AD) is a degenerative disorder of the nervous system. Its clinical manifestations include memory impairment, cognitive impairment, language impairment, behavioral impairment, and decreased ability to function, causing significant pain and a decline in quality of life for patients.

[0003] As my country's aging population intensifies, the incidence of AD is increasing year by year. Approximately 90% of AD patients have sporadic AD, with the remainder suffering from familial AD. Although familial AD accounts for a small proportion, the number of familial AD patients is still very large due to my country's large population base.

[0004] For familial AD, genetic testing is a crucial method for early detection and diagnosis. Due to the high number of mutation sites in familial AD, clinical genetic diagnosis of familial AD typically relies on next-generation sequencing. This method has drawbacks such as high testing costs, extensive data analysis, and long wait times for results. Conventional PCR amplification techniques are complex and require long testing cycles. Currently, there are no inexpensive, rapid methods for detecting the pathogenic genes of familial AD. Summary of the Invention

[0005] To address these shortcomings in the existing technology, the present invention provides a method and system for detecting 12 hotspot mutations (covering 56% of reported familial AD pathogenic mutations in the Han Chinese population) through a constant-temperature multiplex assay. This method utilizes the Amplification Repressor Mutation System (ARMS) technology combined with the Nicking Endonuclease Nucleic Acid Detection Reaction (NEAR) constant-temperature amplification system to perform multiplex amplification targeting 12 hotspot mutations and two risk loci in AD pathogenic genes, totaling 14 sites. This method also incorporates capillary electrophoresis for product analysis and genotyping.

[0006] The present invention has the following beneficial effects

[0007] The present invention provides a novel method for rapid SNP genotyping detection using ARMS-combined nicking endonuclease-mediated isothermal amplification. The beneficial effects of the method include:

[0008] 1) The method of the present invention significantly improves detection efficiency and reduces detection costs;

[0009] 2) The present invention adopts a constant-temperature reaction system, which can minimize the dependence on high-precision instruments. In the prior art, the PCR method requires a temperature-changing process, which leads to the need for an instrument module capable of changing temperature, such as a PCR instrument. Due to the high precision requirements of the temperature-raising and -lowering modules of the PCR instrument, different PCR instruments are prone to unstable results or inconsistent results in different laboratories due to different temperature-raising and -lowering rates. At the same time, the cost of the PCR instrument is also relatively high. The constant-temperature system of the present invention helps to lower the threshold of molecular biology detection, remove the temperature-changing module, and reduce the instrument cost;

[0010] 3) The method of the present invention is more efficient than conventional PCR; the method of the present invention adopts the nicking endonuclease technology with mild reaction conditions, high efficiency and rapidity, and can obtain amplified fragments within 15 - 30 minutes. Compared with the traditional PCR technology which requires 1.5 - 2 hours, the reaction time is greatly shortened, achieving rapidity and high efficiency, which plays a positive role in rapid diagnosis;

[0011] 4) The present invention adopts a multi-compound amplification system combined with capillary electrophoresis analysis to achieve multiplex amplification in a single tube and detect the genotyping of multiple SNP sites at one time. Moreover, the detection results are easy to analyze and interpret. Compared with other single detection methods on the market, on the basis of improving the detection efficiency and simplifying the operation steps, the detection reagent cost is further reduced.

[0012] 5) For SNP sites with relatively close genomic positions, the present invention adopts the method of constant-temperature amplification in separate tubes and mixing the amplification products in one tube for capillary electrophoresis, which not only avoids the mutual interference of SNP sites with close detection distances during the amplification process and affects the genotyping results, but also can display the detection results of 1 sample in one electrophoresis diagram, saving the electrophoresis cost and making the detection results of the same sample intuitive, easy to analyze and interpret.

[0013] 6) The present invention can achieve high throughput, strong specificity, high sensitivity, simple operation, rapidity, high efficiency and low cost;

[0014] 7) Compared with the high detection cost (1 - 2000 yuan), large amount of data analysis and long waiting time for results (22 - 30 days) required by the second-generation sequencing method for detecting familial AD, the 12 hot spots detected by this invention can detect 56% of the familial AD that can be detected by the second-generation sequencing method, while the cost is only 100 - 200 yuan, which is one-tenth of the detection cost of the second-generation sequencing, and the detection cycle is 1 - 2 days, with obvious advantages.

[0015] According to one aspect of the present invention, the present invention provides a set of 3 primer combinations for detecting hot pathogenic gene mutations and APOE genotypes of familial Alzheimer's disease, characterized in that the set of 3 primer combinations can achieve one-time amplification of the following 14 risk sites:

[0016] APP V715M;

[0017] APP I716F;

[0018] APP V717I;

[0019] PSEN1 F105C;

[0020] PSEN1 P117S;

[0021] PSEN1 M139I;

[0022] PSEN1 I167del;

[0023] PSEN1 L173F;

[0024] PSEN1 F177S;

[0025] PSEN1 G206A;

[0026] PSEN1 I213T;

[0027] PSEN1 K311R;

[0028] APOE C130R; and

[0029] APOE R176C.

[0030] According to certain embodiments of the present invention, each primer included in the 3 sets of primers includes a recognition site for a nicking endonuclease restriction site, a stable region, a nucleic acid strand of a target binding region complementary to the target; and the SNP recognition specific upstream primer at each detection site includes a mismatch with one base introduced at the 3'-end at -2 or -3, and the base corresponding to the SNP site at the last base.

[0031] According to certain embodiments of the present invention, the 3 sets of primer combinations include a first primer set, a second primer set, and a third primer set;

[0032] Wherein, the first primer set detects mutation sites:

[0033] APP V715M;

[0034] PSEN1 F105C;

[0035] PSEN1 G206A; and

[0036] PSEN1 F177S;

[0037] The second primer set detects mutation sites:

[0038] APP I716F;

[0039] PSEN1 P117S; and

[0040] PSEN1 I167del;

[0041] The third primer set detects the mutation sites:

[0042] APP V717I;

[0043] PSEN1 L173F;

[0044] PSEN1 M139I;

[0045] PSEN1 I213T;

[0046] PSEN1 K311R;

[0047] APOE C130R; and

[0048] APOE R176C.

[0049] According to certain embodiments of the present invention, the familial AD hotspot pathogenic mutations are for the Chinese Han population.

[0050] According to certain embodiments of the present invention, the primer pair for each site includes a wild-type upstream primer, a mutant upstream primer, and a common downstream primer.

[0051] According to certain embodiments of the present invention, the first primer set sequences include SEQ ID NO.1-3; SEQ ID NO.10-12; SEQ ID NO.28-30; and SEQ ID NO.25-27; the second primer set sequences include SEQ ID NO.4-6; SEQ ID NO.13-15; and SEQ ID NO.19-21; the third primer set sequences include SEQ ID NO.7-9; SEQ ID NO.22-24; SEQ ID NO.16-18; SEQ ID NO.31-33; SEQ ID NO.34-36; SEQ ID NO.37-39; and SEQ ID NO.40-42.

[0052] According to certain embodiments of the present invention, the primers are labeled with a fluorescent group recognized for later capillary electrophoresis detection, the fluorescent group is modified on a T base of the specific primer segment, and the fluorescent group can be modified with FAM, HEX, ROX, TAMER or CY5.

[0053] According to certain embodiments of the present invention, the fluorescent group is labeled on a T base at the 2nd to 10th base at the 3'-end of the specific primer segment of the common downstream primer at each detection site, away from the recognition site of the nicking endonuclease.

[0054] According to certain embodiments of the present invention, the fluorescent group is labeled on a T base at the 2nd to 10th base at the 3'-end of the specific primer segment of the common downstream primer at each detection site, away from the recognition site of the nicking endonuclease, such as the 2nd to 8th base, the 2nd to 6th base, the 2nd to 4th base, the 4th to 10th base, the 4th to 8th base, the 4th to 6th base, the 6th to 10th base, the 6th to 8th base, or the 8th to 10th base.

[0055] According to certain embodiments of the present invention, the fluorescent group is labeled on a T base at the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, or 10th base at the 3'-end of the specific primer segment of the common downstream primer at each detection site, away from the recognition site of the nicking endonuclease.

[0056] According to certain embodiments of the present invention, in the primer combination, the amount of the upstream primer is 4 times that of the downstream primer.

[0057] According to one aspect of the present invention, the present invention provides a kit for multiplex amplification detection of pathogenic gene mutations of familial AD and APOE genotypes, characterized in that the kit includes the 3 groups of primer combinations, NERA isothermal composite amplification enzyme mixture, 10X reaction buffer, dNTP (10 mM), positive control product, and internal standard required for capillary electrophoresis.

[0058] According to certain embodiments of the present invention, the NERA isothermal composite amplification enzyme mixture includes a nicking endonuclease and a DNA polymerase.

[0059] According to certain embodiments of the present invention, the nicking endonuclease is selected from N.ALwl, Nb.BbvCI, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, or other similar nicking endonucleases.

[0060] According to certain embodiments of the present invention, the nicking enzyme is Nt.Bst NBI nicking enzyme.

[0061] According to certain embodiments of the present invention, the DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, phi29 DNA polymerase, or other similar DNA polymerases with strand displacement activity.

[0062] According to certain embodiments of the present invention, the DNA polymerase is Nt.BstNBI-Bst 3.0 polymerase.

[0063] According to certain embodiments of the present invention, the 10X reaction buffer is: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8).

[0064] According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions can be adjusted according to the detection effect and can be adjusted between 10 mM and 40 mM to obtain the optimal amplification efficiency. According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions is 10 mM - 40 mM, 10 mM - 30 mM, 10 mM - 20 mM, 20 mM - 40 mM, 20 mM - 30 mM, 30 mM - 40 mM. According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions is 10 mM, 20 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 21 mM, 22 mM, 23 mM, 24 mM, 25 mM, 26 mM, 27 mM, 28 mM, 29 mM, 30 mM, 31 mM, 32 mM, 33 mM, 34 mM, 35 mM, 36 mM, 37 mM, 38 mM, 39 mM or 40 mM.

[0065] According to certain embodiments of the present invention, the 10X reaction buffer is: 10 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 15 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8).

[0066] According to certain embodiments of the present invention, the 10X reaction buffer is: 25 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 30 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 35 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 40 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8).

[0067] According to certain embodiments of the present invention, the reaction buffer further comprises 1-3% DMSO.

[0068] According to certain embodiments of the present invention, the reaction buffer further comprises 2.5-10 μg BSA.

[0069] According to one aspect of the present invention, the present invention provides a isothermal multiplex amplification detection system for the pathogenic gene mutations and APOE genotypes of the familial AD hotspots in the Chinese Han population using the 3 primer combinations, and the isothermal multiplex amplification detection system is as follows:

[0070] Component (Added) Amount 10X Reaction Buffer 2.5 μL 5X Primer Set 1 MIX1 / Primer Set 2 MIX1 / Primer Set 3 MIX3 5 μL dNTP (10 mM) 2.5 μL DMSO 0.5 μL BSA (10 μg / μL) 0.5 μL DNA Template (10 ng / μL) 2.5 μL Make up with double-distilled water to 24 μL

[0071] Among them, the 10X reaction buffer is: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8);

[0072] The above reaction system is treated at 95°C for 5 min, quickly placed on ice, and after cooling, nicking enzyme and polymerase are added to each tube of the reaction solution according to the amounts in the following table, as follows:

[0073] Nicking Enzyme (10 U / μL) 0.2 μL 3.0 Polymerase (8 U / μL) 0.8 μL

[0074] According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions can be adjusted according to the detection effect, and can be adjusted between 10 mM and 40 mM to obtain the optimal amplification efficiency. According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions is 10 mM - 40 mM, 10 mM - 30 mM, 10 mM - 20 mM, 20 mM - 40 mM, 20 mM - 30 mM, 30 mM - 40 mM. According to certain embodiments of the present invention, in the 10X buffer, the concentration of Mg+ ions is 10 mM, 20 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 21 mM, 22 mM, 23 mM, 24 mM, 25 mM, 26 mM, 27 mM, 28 mM, 29 mM, 30 mM, 31 mM, 32 mM, 33 mM, 34 mM, 35 mM, 36 mM, 37 mM, 38 mM, 39 mM or 40 mM.

[0075] According to certain embodiments of the present invention, the 10X reaction buffer is: 10 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 15 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 25 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 30 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 35 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8). According to certain embodiments of the present invention, the 10X reaction buffer is: 40 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8).

[0076] According to certain embodiments of the present invention, the nicking endonuclease can be selected from N. Alwl, Nb. BbvCI, Nt. BbvCI, Nt. BstNBI, Nb. BsmI or other similar nicking endonucleases.

[0077] According to certain embodiments of the present invention, the DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, phi29 DNA polymerase or other similar DNA polymerases with strand displacement activity.

[0078] According to one aspect of the present invention, the present invention provides the use of the primer combination or the isothermal multiplex amplification detection system in the preparation of reagents for detecting hot pathogenic mutations of familial AD and APOE genotypes.

[0079] According to one aspect of the present invention, the present invention provides a method for multiplex amplification detection of pathogenic gene mutations of familial Alzheimer's disease and APOE genotypes, and the method includes:

[0080] a) Configure the isothermal amplification system; perform isothermal amplification at 58°C for 25 minutes;

[0081] b) Perform capillary electrophoresis detection, and determine the genotype of the sample at this site according to whether specific amplification peak spectra appear in the wild-type and mutant peak maps of each detection site.

[0082] According to certain embodiments of the present invention, the method includes:

[0083] a) Configure the isothermal amplification system; perform isothermal amplification at 58°C for 25 minutes;

[0084] b) Configure a loading mixture mixed with a molecular weight internal standard and formamide: (0.5 μL molecular weight internal standard + 8 μL formamide) × the number of test samples, vortex for 1 - 15 seconds, use a pipette to dispense 9 μL of the formamide and internal standard mixture into each detection well, then for each sample's 3 groups of amplification products, respectively take 0.5 μL of the amplification products (a total of 1.5 μL) and add them to the loading mixture of the molecular weight internal standard and formamide, and perform electrophoresis detection according to the steps in the user manual of the genetic analyzer; data analysis: import relevant files into the GeneMapper software, import the original data detected by the genetic analyzer, and analyze the data; determination of detection: determine the genotype of the sample at this site according to whether specific amplification peak spectra (the peak height threshold is set to Rfu100) appear in the wild-type and mutant peak maps of each detection site.

[0085] According to one aspect of the present invention, there is provided a kit for isothermal multiplex rapid amplification detection of familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population. The kit uses a rapid and efficient SNP genotyping technique, namely the ARMS technique combined with NEAR isothermal amplification, and a method for SNP genotyping by capillary electrophoresis analysis.

[0086] According to one aspect of the present invention, there is provided a kit for isothermal multiplex rapid amplification detection of familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population. The kit comprises three primer sets for 14 SNP sites including 12 hotspot mutations of AD pathogenic genes and 2 risk loci, a NERA isothermal multiplex amplification enzyme mixture, a reaction buffer, a positive control, and an internal standard required for capillary electrophoresis.

[0087] According to some embodiments of the present invention, the amplification primers in the three primer sets each contain a recognition site for a restriction site (5'-GAGTCNNNN-3', such as Nt.BstNBI), a stable region, and a nucleic acid strand of a target-binding region complementary to the target. Moreover, the upstream primers for amplification of each site are further designed according to the principle of allele specificity. Each specific primer can only bind to the DNA template of the corresponding genotype and perform specific amplification. In order to improve the resolution ability of the specific primers for SNP sites, according to the design principle of ARMS primers, in addition to the last base at the 3' end corresponding to the specific base of the SNP site, a base mismatch is introduced at the -2 or -3 position at the 3' end of the SNP recognition specific upstream primers at each detection site. The primer sequences are shown in SEQ ID NOs. 1-42.

[0088] According to some embodiments of the present invention, a fluorescent group for later capillary electrophoresis detection is labeled on the common downstream primer of each detection site. The fluorescent group is modified on a T base of the specific primer segment, and the fluorescent group can be modified with FAM, HEX, ROX, TAMER or CY5.

[0089] According to some embodiments of the present invention, the fluorescent group is labeled on a T base at 2-10 bases at the 3' end from the recognition site of the nicking endonuclease on the specific primer segment of the common downstream primer of each detection site.

[0090] According to some embodiments of the present invention, in the three primer sets, the amount of the upstream primer is 4 times that of the downstream primer.

[0091] According to certain embodiments of the present invention, the reaction buffer is: 2 mM MgSO4, 150 mM KCl, 10 mM (NH4)2SO4, 50 mM NaCl, 40 mM Tris-Cl (pH 8.8).

[0092] According to certain embodiments of the present invention, the NERA isothermal multiplex amplification enzyme mixture includes a nicking endonuclease and a DNA polymerase, wherein the nicking endonuclease is selected from N.ALwl, Nb.BbvCI, Nt.BbvCI, Nt.BstNBI, Nb.BsmI or other similar nicking endonucleases; the DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, phi29 DNA polymerase or other similar DNA polymerases with strand displacement activity.

[0093] According to certain embodiments of the present invention, the preparation method of the three primer combination mixtures and the preparation method of the isothermal amplification system.

[0094] According to one aspect of the present invention, the present invention provides a kit for isothermal multiplex rapid amplification detection of familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population and a method for isothermal multiplex amplification detection of familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population. The method includes the following steps: isothermal amplification, detection of amplification products by a genetic analyzer, data analysis, and specific usage methods for judgment of detection results.

[0095] Definition

[0096] Alzheimer's disease

[0097] Alzheimer's disease (AD) occurs in the elderly and pre-elderly, and is a central nervous system degenerative disease characterized by progressive cognitive impairment and behavioral impairment. Clinically, it is manifested as memory impairment, aphasia, apraxia, agnosia, visuospatial ability impairment, abstract thinking and calculation ability impairment, personality and behavior changes, etc. Alzheimer's disease can be divided into two types: familial and sporadic.

[0098] Familial Alzheimer's disease accounts for about 10% of the total number of patients. It refers to hereditary AD. At least two generations in the family have AD patients, and the onset age is earlier, usually before 65 years old, often around 40 years old, and it is easily found in the family tree.

[0099] Sporadic AD has nothing to do with genetic factors. 90% of Alzheimer's disease is not related to genetics.

[0100] Pathogenic genes of familial AD

[0101] The three pathogenic genes of familial AD that have been identified so far are: amyloid precursor protein gene (APP), presenilin 1 gene (PS1), and presenilin 2 gene (PS2). In addition, the apolipoprotein E gene (APOE) is the most recognized risk gene for sporadic AD.

[0102] Nearly 300 pathogenic mutations of the above-mentioned pathogenic genes have been reported globally. The genetic backgrounds of the Chinese Han population and the Caucasian population abroad are different. By summarizing and analyzing all reported familial AD families and pathogenic mutations in the Chinese Han population, as of December 2021, a total of 603 familial AD families and 66 pathogenic mutations have been reported. Among them, we screened out 12 hotspot mutations in the APP, PS1, and PS2 genes in the Han population (listed as No. 1-12 in Table 1 below), and there are also two sporadic AD risks. These 12 hotspot mutations can cover 56% of the diagnosed Han population with familial AD patients.

[0103] Table 1: 14 hotspot mutations of AD pathogenic genes

[0104] Serial Number Mutation Site Mutated Base Corresponding RS Number 1 APP V715M 21:27264102 rs63750734 2 ​ 21:27264099 rs63750399 3 ​ ​ rs63750264 4 ​ ​ rs1057518919 5 ​ 14:73640284 rs63750550 6 ​ ​ rs63750522 7 ​ ​ rs63750879 8 ​ 14:73653599 rs63750299 9 ​ ​ rs63749806 10 ​ 14:73659420 rs63750082 11 ​ 14:73659441 rs63751309 12 ​ ​ / 13 ​ ​ rs429358 14 ​ ​ rs7412

[0105] Nicking enzyme-assisted nucleic acid detection reaction

[0106] The nicking enzyme-assisted reaction (NEAR) is a new isothermal nucleic acid amplification technology that depends on nicking enzymes and is developed on the basis of strand displacement amplification (SDA). Compared with the ordinary PCR reaction, NEAR has the advantages of constant reaction temperature, simple operation, short time consumption, strong specificity, and high sensitivity. The reaction system mainly consists of primers, DNA polymerase with strand displacement activity, nicking enzymes, and dNTPs. The main principle is that the nicking enzyme can recognize specific DNA sequences and cut one strand of the double-stranded DNA molecule at specific sites. The DNA polymerase with strand displacement activity uses the 3' end of the nick made by the nicking enzyme as the starting point, uses the uncut single strand as the template, synthesizes a new strand, and strips the old strand; the strand that restores the recognition site of the nicking enzyme can repeat the above amplification reaction, and finally realizes the exponential amplification of the target sequence. The whole reaction can be carried out at a constant temperature of 50-60 °C, and the whole process can reach the detection level in 15-30 minutes. The detection methods of NEAR products include gel electrophoresis, real-time fluorescence detection, chemiluminescence immunoassay, etc.

[0107] Amplification refractory mutation system

[0108] Amplification Refractory Mutation System (ARMS), also known as Allele-Specific Detection System, is based on the reaction of DNA polymerase for allele-specific extension. Only when the base at the 3'-end of an allele-specific primer is complementary to the base at the mutation site can the extension reaction occur. Primers with bases at the 3'-end that do not fully match the template cannot bind and extend normally, and no specific extension products can be obtained. It is a reliable genotyping method.

[0109] The present invention uses ARMS technology combined with the NEAR isothermal amplification system to perform multiplex amplification on 14 sites, including 12 hotspot mutations and 2 risk loci of AD pathogenic genes, and combines capillary electrophoresis for product analysis to perform genotyping detection, which can achieve high throughput, strong specificity, high sensitivity, simple operation, fast and efficient, and low cost.

[0110] Detection of Familial AD Hotspot Pathogenic Gene Mutations and APOE Genotypes Based on ARMS Technology Combined with NEAR Isothermal Amplification

[0111] To solve the problems of the existing technology, the present invention provides a kit and application method for detecting familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population based on ARMS technology combined with NEAR isothermal amplification. The present invention is achieved through the following scheme:

[0112] The present invention provides a primer combination for detecting familial AD hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population based on ARMS combined with NEAR isothermal amplification. The primer combination includes 3 groups of primer sets for detecting a total of 14 SNP sites. The 3 groups of primer combinations include primers for the ARMS-NEAR isothermal amplification system for the 14 sites listed in Table 1. The 3 groups of primer combinations can achieve multiplex amplification of 4 (APP V715M, PSEN1 F105C, PSEN1 G206A, PSEN1 F177S), 3 (APP I716F, PSEN1 P117S, PSEN1 I167del), and 7 (APP V717I, PSEN1 L173F, PSEN1 M139I, PSEN1 I213T, PSEN1 K311R, APOE C130R, APOE R176C) sites among the 14 sites in the same NEAR system respectively. Since the 3 hotspot SNP sites of the APP gene are too close to each other in the genome, in order to prevent interference during the amplification process, the detection primers are divided into 3 groups and detected and amplified independently in 3 systems. The sites amplified by the 3 groups of primers are shown in Table 2 below, where the bold letters indicate the bases mutated or changed according to the ARMS principle.

[0113]

[0114]

[0115] Table 2: Loci amplified by three sets of primers

[0116] In some embodiments, the three sets of primer sequences include primers having sequences as shown in SEQ ID NOs. 1-42. These primers are different from ordinary primers and are specifically designed for nicking endonucleases. Generally, each primer contains a recognition site for a restriction site (5'-GAGTCNNNN-3', such as Nt.BstNBI), a stable region, and a nucleic acid strand of a target-binding region complementary to the target. According to the principle of allele specificity, for the upstream primer of each locus amplified, each specific primer can only bind to the DNA template of the corresponding genotype and amplify.

[0117] Preferably, among more than 40 bases of the upstream and downstream primers at each detection locus, approximately 20-23 bp at the 3' end are specific ARMS primers complementary to the template, and there is also a recognition site for a nicking endonuclease at its 5' end (indicated by ), and there are also approximately 10-14 bp of protection bases at the 5' end of the recognition site to ensure that the nicking endonuclease can perform enzymatic cleavage quickly and efficiently.

[0118] Preferably, the common downstream primer at each detection locus is labeled with a fluorescent group recognized for later capillary electrophoresis detection, and the fluorescent group needs to be modified on a T base of the specific primer segment.

[0119] Preferably, the fluorescent group can be modified with FAM, HEX, ROX, TAMER, or CY5.

[0120] The present invention also provides a kit for isothermal multiplex amplification to detect hotspot pathogenic gene mutations and APOE genotypes in the Chinese Han population, and the kit includes the above three sets of primer combinations, a NERA isothermal multiplex amplification enzyme mixture, a reaction buffer, a positive control product, and an internal standard required for capillary electrophoresis.

[0121] Preferably, the NERA isothermal multiplex amplification enzyme mixture includes a nicking endonuclease and a DNA polymerase, wherein the nicking endonuclease can be selected from N.ALwl, Nb.BbvCI, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, or other similar nicking endonucleases; the DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, phi29 DNA polymerase, or other similar DNA polymerases having strand displacement activity.

[0122] Preferably, the nicking endonuclease used in the present invention is Nt.BstNBI, and the DNA polymerase used is Bst DNA polymerase, both of which can be purchased from NEB, USA.

[0123] Preferably, in the primer combination, 3 primers are set for each detection site. For the two SNP genotypings of the same site, one specific primer with different lengths (differing by 2 - 3 bp) is set respectively, and one fluorescently labeled downstream primer is set. Each specific primer can only bind to the DNA template of the corresponding genotype and amplify. After multiplex isothermal amplification is completed, capillary electrophoresis detection is carried out. Through specific fluorescent labeling, the presence or absence of amplification products of specific lengths can be used to determine whether a specific genotype exists at a specific site in the sample. In the setting of the present invention, the target fragment amplified by the wild-type primer will be 2 - 3 bp smaller than the fragment amplified by the mutant primer.

[0124] Preferably, in order to improve the resolution ability of the specific primer for the SNP site, according to the design principle of ARMS primers, in addition to the last base at the 3' end of each SNP recognition specific upstream primer corresponding to the specific base of the SNP site, a base mismatch is introduced at the -2 or -3 position at the 3' end. The mismatched base at the 3' end of the primer will slow down the primer extension speed. When the mismatch reaches a certain degree, the primer extension will terminate and no PCR product of specific length can be obtained, indicating that the template DNA does not have a base complementary to the 3' end of the primer.

[0125] Preferably, in the isothermal reaction system, the amount of the upstream primer is usually 4 times that of the downstream primer.

[0126] The reaction buffer in the present invention is: 2 mM MgSO4, 150 mM KCl, 10 mM (NH4)2SO4, 50 mM NaCl, 40 mM Tris-Cl (pH 8.8).

[0127] Preferably, DMSO is also added to the system of the present invention to disrupt the secondary structure of DNA and improve the efficiency of the isothermal reaction.

[0128] Preferably, BSA is also added to the system of the present invention to stabilize the reaction system.

[0129] The present invention also provides the application of the above-mentioned kit for isothermal multiplex amplification to detect hot-spot pathogenic gene mutations and APOE genotypes in Chinese Han population with familial AD in screening suspected familial AD cases and evaluating the risk of sporadic AD.

[0130] The present invention also provides a method for applying the kit for detecting hot-spot pathogenic gene mutations and APOE genotypes of familial AD in the Chinese Han population by the above-mentioned isothermal multiplex amplification detection, which mainly includes the following steps: isothermal amplification, detection of amplification products by a genetic analyzer, data analysis, and judgment of detection results.

[0131] Preferably, the detection system of the present invention can be used to detect human whole blood or peripheral blood samples.

[0132] According to one aspect of the present invention, the present invention provides a specific detection method for detecting hot-spot pathogenic gene mutations and APOE genotypes of familial AD in the Chinese Han population based on ARMS combined with NEAR isothermal amplification method. The method steps are as follows:

[0133] (1) According to the sequence information of the 14 loci listed in Table 1, and according to the above-mentioned ARMS combined with NEAR primer design principle, the following detection primers are designed, and the primer sequences are shown in SEQ ID NO.1-42:

[0134] Wild-type upstream primer for APP V715M locus (SEQ ID NO.1):

[0135]

[0136] Mutant upstream primer for APP V715M locus (SEQ ID NO.2):

[0137]

[0138] Common downstream primer for APP V715M locus (SEQ ID NO.3):

[0139]

[0140] Wild-type upstream primer for APP I716F locus (SEQ ID NO.4):

[0141]

[0142] Mutant upstream primer for APP I716F locus (SEQ ID NO.5):

[0143]

[0144] Common downstream primer for APP I716F locus (SEQ ID NO.6):

[0145]

[0146] Wild-type upstream primer for APP V717I locus (SEQ ID NO.7):

[0147]

[0148] APP V717I site mutant upstream primer (SEQ ID NO.8):

[0149]

[0150] APP V717I site common downstream primer (SEQ ID NO.9):

[0151]

[0152] PSEN1 F105 site wild-type upstream primer (SEQ ID NO.10):

[0153]

[0154] PSEN1 F105 site mutant upstream primer (SEQ ID NO.11):

[0155]

[0156] PSEN1 F105 site common downstream primer (SEQ ID NO.12):

[0157]

[0158] PSEN1 P117S site wild-type upstream primer (SEQ ID NO.13)

[0159]

[0160] PSEN1 P117S site mutant upstream primer (SEQ ID NO.14)

[0161]

[0162] PSEN1 P117S site common downstream primer (SEQ ID NO.15)

[0163]

[0164] PSEN1 M139I site wild-type upstream primer (SEQ ID NO.16)

[0165]

[0166] PSEN1 M139I site mutant upstream primer (SEQ ID NO.17)

[0167]

[0168] Downstream primer shared by PSEN1 M139I site (SEQ ID NO.18)

[0169]

[0170] Wild-type upstream primer of PSEN1 I167del site (SEQ ID NO.19)

[0171]

[0172] Mutant-type downstream primer of PSEN1 I167del site (SEQ ID NO.20)

[0173]

[0174] Downstream primer shared by PSEN1 I167del site (SEQ ID NO.21)

[0175]

[0176] Wild-type upstream primer of PSEN1 L173F site (SEQ ID NO.22)

[0177]

[0178] Mutant-type upstream primer of PSEN1 L173F site (SEQ ID NO.23)

[0179]

[0180] Downstream primer shared by PSEN1 L173F site (SEQ ID NO.24)

[0181] GTGCTCATCG ​ CTT(FAM-dT)CAGAGTAATTCATCAACA

[0182] Wild-type upstream primer of PSEN1 F177S site (SEQ ID NO.25)

[0183]

[0184] Mutant-type upstream primer of PSEN1 F177S site (SEQ ID NO.26)

[0185]

[0186] Common downstream primer for the PSEN1 F177S site (SEQ ID NO.27)

[0187]

[0188] Wild-type upstream primer for the PSEN1 G206A site (SEQ ID NO.28)

[0189]

[0190] Mutant upstream primer for the PSEN1 G206A site (SEQ ID NO.29)

[0191]

[0192] Common downstream primer for the PSEN1 G206A site (SEQ ID NO.30)

[0193]

[0194] Wild-type upstream primer for the PSEN1 I213T site (SEQ ID NO.31)

[0195]

[0196] Mutant upstream primer for the PSEN1 I213T site (SEQ ID NO.32)

[0197]

[0198] Common downstream primer for the PSEN1 I213T site (SEQ ID NO.33)

[0199]

[0200] Wild-type upstream primer for the PSEN1 K311R site (SEQ ID NO.34)

[0201]

[0202] Mutant upstream primer for the PSEN1 K311R site (SEQ ID NO.35)

[0203]

[0204] Common downstream primer for the PSEN1 K311R site (SEQ ID NO.36)

[0205]

[0206] Wild-type upstream primer for APOE C130R site (SEQ ID NO. 37)

[0207]

[0208] Mutant-type upstream primer for APOE C130R site (SEQ ID NO. 38)

[0209]

[0210] Common downstream primer for APOE C130R site (SEQ ID NO. 39)

[0211]

[0212] Wild-type upstream primer for APOE R176C site (SEQ ID NO. 40)

[0213]

[0214] Mutant-type upstream primer for APOE R176C site (SEQ ID NO. 41)

[0215]

[0216] Common downstream primer for APOE R176C site (SEQ ID NO. 42)

[0217]

[0218] Among the upstream and downstream primers of more than 40 bases at each detection site described above, about 20 - 23 bp at the 3' end are specific ARMS primers complementary to the template, and there is a recognition site for the nicking endonuclease at the 5' end (represented by ), and there are about 10 - 14 bp of protective bases at the 5' end of the recognition site to ensure that the nicking endonuclease can perform enzymatic cleavage quickly and efficiently.

[0219] In order to coordinate the amplification efficiency, improve the product sealing, control the product fragment length, and facilitate capillary electrophoresis detection, the present invention has made certain modifications to the ARMS primer sequence segment, introducing different degrees of mismatches at the 5' end and 3' end of the ARMS primer part respectively.

[0220] Among them, the single underline “—” represents that 1 to 3 bases are modified at positions -2 to -4 at the 3' end of each primer (the above sequences are the modified sequences); the double underline “=” represents that the sequence after position -15 at the 3' end of the primer is modified, mainly by adding other sequences at the end and changing some base sequences (the above are the modified base sequences). [[ID=AB]] [[ID=AC]]

[0221] To solve the problem that the products after NEAR multiplex isothermal amplification can be detected and recognized by a capillary electrophoresis detection platform, in the present invention, a fluorescent group for recognition in later capillary electrophoresis detection is labeled on the common downstream primer at each detection site. This fluorescent group is different from conventional fluorescent labels that can be modified at the 5'-end of the primer because there is a recognition site for nicking endonuclease at the 5'-end of the primer in the present invention, and there are also about 10-14 bp of protective bases at the 5'-end of the recognition site. This part of the sequence fragment will be recognized by the nicking endonuclease and spliced off during the isothermal reaction stage. Therefore, the fluorescent group needs to be modified at the 3'-end to be a specific ARMS primer segment complementary to the template. Therefore, in the present invention, the fluorescent group is modified on a T base of the specific primer segment (as shown above as the modified sequence information).

[0222] Preferably, the fluorescent group can be modified with FAM, HEX, ROX, TAMER or CY5.

[0223] (2) Extract the DNA of the sample to be tested as a template and adjust the concentration to 10 ng / μL for standby.

[0224] (3) Prepare 3 primer group mixes for detecting the hot-spot pathogenic gene mutations and APOE genotypes of familial AD in the Chinese Han population respectively, as listed in Table 3-5 below:

[0225] Table 3: Primer Group One MIX1

[0226] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0227] Table 4: Primer Group Two MIX2

[0228]

[0229]

[0230] Table 5: Primer Group Three MIX3

[0231] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ PSEN1 M139I Common Downstream Primer (100 μM) 1 μL PSEN1 I213T Wild-Type Upstream Primer (100 μM) 4 μL PSEN1 I213T Mutant Upstream Primer (100 μM) 4 μL ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0232] (4) Prepare 3 groups of NEAR reaction pre-liquids (24 μL); wherein the 10X reaction buffer is: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8)

[0233]

[0234]

[0235] (5) Simultaneously perform a 95°C treatment on the three sets of reaction solutions prepared in step (3) for 5 minutes, quickly place them on ice, and after cooling, add nicking enzyme and polymerase to each tube of the reaction solution according to the amounts in the following table.

[0236] ​ ​ ​ ​

[0237] (6) After the above reaction configuration is completed, place it in a metal bath with a temperature controlled at 58°C and perform isothermal amplification for 25 minutes.

[0238] (7) Detect the amplification products by capillary electrophoresis: Prepare a loading mixture containing a molecular weight internal standard and formamide: (0.5 μL of molecular weight internal standard + 8 μL of formamide) × the number of test samples, vortex for 1 - 15 seconds, use a pipette to dispense 9 μL of the formamide and internal standard mixture into each detection well, and then for each sample's three sets of amplification products, respectively take 0.5 μL of the amplification products and add them to the loading mixture containing the molecular weight internal standard and formamide, and perform electrophoresis detection according to the steps in the user manual of the genetic analyzer.

[0239] (8) Data analysis: Import relevant files into the GeneMapper software, import the original data detected by the genetic analyzer, and analyze the data.

[0240] (9) Judgment of detection: Based on whether specific amplification peak spectra appear in the wild-type and mutant peak maps in the fluorescence channels carried by each detection site, judge the genotype of the sample at this site: Taking the PSEN1 F105C site as an example, the detection fragment of the PSEN1 F105C site carries FAM fluorescence, the wild-type fragment length is 129 bp, and the mutant fragment length is 131 bp. Therefore, when only a specific amplification peak appears at the 79 bp position in the FAM channel in the detection graph and no specific amplification peak appears at 129 bp, it can be judged that the site of the test sample is homozygous wild-type; when specific amplification peaks appear at both 129 bp and 133 bp in the detection graph, it can be judged that the site of the test sample is heterozygous mutant; when only a specific amplification peak appears at the 133 bp position in the detection graph and no specific amplification peak appears at 129 bp in the detection, it can be judged that the site of the test sample is homozygous mutant.

[0241] Specifically, the detection results of all detection sites are shown in the figure. ​ For the detection results of clinical samples, where the wild-type SNP in the figure is labeled as "Wt" and the mutant type is labeled as "Mu".

[0242] In this application, when "about" is used to modify a numerical value, it means that the numerical value can fluctuate within the range of ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2% or ±1%.

[0243] Unless otherwise specified in this application or in clear contradiction to the context, the terms "a", "an", "the", "said", "this", "at least one" and similar references used in the context of describing this application (including the context of the claims) are construed to cover both the singular and the plural. Unless otherwise specified in this application or in clear contradiction to the context, the terms "comprising", "having", "including" and "containing" used in this application are construed as open-ended terms (i.e., "including but not limited to"). Unless otherwise specified in this application or in clear contradiction to the context, all methods described in this application can be carried out in any suitable order according to the understanding of those skilled in the art.

[0244] All patents, patent applications and references cited in this application are hereby incorporated by reference in their entirety into this application to the same extent as if each document were individually cited as a reference. If there is a conflict between this application and the documents provided herein, the content of this application shall prevail. BRIEF DESCRIPTION OF THE DRAWINGS

[0245] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of this application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0246] ​ It is a detection graph of the homozygous control plasmid, showing that according to certain embodiments of the present invention, all sites are homozygous wild-type detection results;

[0247] ​ It is a detection graph of the heterozygous control plasmid, showing that according to certain embodiments of the present invention, all sites are heterozygous mutant detection results;

[0248] ​ It is a detection graph of the homozygous mutant plasmid, showing that according to certain embodiments of the present invention, all sites are homozygous mutant detection results;

[0249] ​ It shows the detection result graph of clinical sample 1 (pure wild-type sample) according to certain embodiments of the present invention;

[0250] ​ It shows the detection result graph of clinical sample 2 (PSEN1 F105C heterozygous mutant sample) according to certain embodiments of the present invention;

[0251] ​ It shows the detection result graph of clinical sample 3 (APOE C130R heterozygous mutant sample) according to certain embodiments of the present invention. Detailed implementation mode

[0252] The content of the present invention will be further clarified below in combination with specific examples, but the protection scope of the present invention is not limited to these examples.

[0253] Example 1:

[0254] Samples of the pathogenic gene mutations of the hotspots of familial AD and the genotypes of 14 loci of APOE in 3 cases of the Chinese Han population confirmed by the gold standard method (Sanger sequencing method) and 3 plasmid controls (wild, heterozygous, and homozygous mutations) were detected using the present invention. (The sample source is the clinical test samples of the Second Affiliated Hospital of Zhejiang University)

[0255] Among them, the genotyping results of 14 loci of 3 samples are as follows:

[0256] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0257] (1) Primer design: According to the ARMS combined with the NEAR primer design principle described in the present invention, the primer sequences shown in SEQ ID NO. 1-42 were used.

[0258] (2) Sample DNA extraction: The EDTA anticoagulated whole blood of 3 samples with known genotyping results was provided by the Second Affiliated Hospital of Zhejiang University School of Medicine. 2 ml of EDTA anticoagulated blood was taken from each sample, and the genomic DNA in the blood was extracted using the Qiagen DNeasy Blood Tissue Kit kit (Qiagen, Germany, product number 69506). After measuring the concentration with Nanodrop, it was uniformly diluted to 10 ng / μL and then reserved for use.

[0259] (3) Three primer group mixes were respectively configured for the detection of the pathogenic gene mutations of the hotspots of familial AD and the APOE genotypes in the Chinese Han population, as listed in Table 6-7 below:

[0260] Table 6: Primer group one MIX1

[0261] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ PSEN1 F177S wild-type upstream primer (100 μM) 4 μL PSEN1 F177S mutant upstream primer (100 μM) 4 μL PSEN1 F177S common downstream primer (100 μM) 1 μL Make up to with Tris-HCl buffer 100 μL

[0262] Table 7: Primer group two MIX2

[0263]

[0264] Table 8: Primer group three MIX3

[0265]

[0266]

[0267] (4) Prepare 3 sets of NEAR pre-reaction solutions (24 μL); among them, the 10X reaction buffer is: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-Cl (pH 8.8).

[0268] Component (Added) amount 10X reaction buffer 2.5 μL 5X Primer Set 1 MIX1 / Primer Set 2 MIX1 / Primer Set 3 MIX3 5 μL dNTP (10 mM) 2.5 μL DMSO 0.5 μL BSA (10 μg / μL) 0.5 μL DNA template (10 ng / μL) 2.5 μL Make up to with double-distilled water 24 μL

[0269] (5) Treat the 3 sets of reaction solutions prepared in step (3) simultaneously at 95 °C for 5 min, quickly place them on ice, and after cooling, add nicking enzyme and polymerase to each tube of the reaction solution according to the amounts in the following table.

[0270] Nt.Bst NBI nicking enzyme (10 U / μL) 0.2 μL Nt.BstNBI-Bst 3.0 polymerase (8 U / μL) 0.8 μL

[0271] (6) After the above reaction is configured, place it in a metal bath with a temperature controlled at 58 °C and perform constant-temperature amplification for 25 min.

[0272] (7) Detect the amplification products by capillary electrophoresis: Prepare a loading mixture mixed with a molecular weight internal standard and formamide: (0.5 μL molecular weight internal standard + 8 μL formamide) × number of test samples, vortex for 1 - 15 seconds, use a pipette to dispense 9 μL of the formamide and internal standard mixture into each detection well, and then for each sample, take 0.5 μL of each of the 3 sets of amplification products (a total of 1.5 μL) and add them to the loading mixture of the molecular weight internal standard and formamide, and perform electrophoresis detection according to the steps in the user manual of the genetic analyzer.

[0273] (8) Data analysis: Import relevant files into the GeneMapper software, import the original data detected by the genetic analyzer, and analyze the data.

[0274] (9) Result interpretation: Judge the genotype of the sample at this site based on whether specific amplification peak spectra appear in the wild-type and mutant peak maps in the fluorescence channels carried by each detection site: Taking the PSEN1 F105C site as an example, the detection fragment of the PSEN1 F105C site carries FAM fluorescence, the wild-type fragment length is 129 bp, and the mutant fragment length is 131 bp. Therefore, when only a specific amplification peak appears at the position of 79 bp in the FAM channel in the detection graph, and there is no specific amplification peak at 129 bp, it can be judged that this site of the test sample is homozygous wild-type; when specific amplification peaks appear at both 129 bp and 133 bp in the detection graph, it can be judged that this site of the test sample is heterozygous mutant; when only a specific amplification peak appears at the position of 133 bp in the detection graph, and there is no detection of a specific amplification peak at 129 bp, it can be judged that this site of the test sample is homozygous mutant.

[0275] Specific detection results of all detection sites are shown in the figure. Figure 1Results of the wild-type control sample, Figure 2 Results of the heterozygous control sample, Figure 3 Results of the mutant control sample, Figure 4 Results of clinical sample 1, Figure 5 Results of clinical sample 2, Figure 6 Results of clinical sample 3. Among them, the wild-type SNP in the figure is labeled as "Wt", and the mutant type is labeled as "Mu".

[0276] The innovation of the present invention lies in that the isothermal multiplex rapid detection reduces the demand for amplification instruments, shortens the detection time, and saves the detection cost. It has very important significance in clinical gene typing detection, especially in scenarios such as monogenic genetic diseases, pharmacogenomics, and microbial drug resistance, and has important value.

[0277] Example 2

[0278] In order to verify the universality of the method of the present invention, the inventor conducted the following verification experiment:

[0279] Twenty patient and control samples (already verified by Sanger sequencing) from the Second Affiliated Hospital of Zhejiang University School of Medicine were used as the samples to be tested, and the experimental methods and steps, as well as the analysis and determination conditions, were the same as those in Example 1 for detection.

[0280]

[0281] The results obtained in this example are as follows:

[0282] The results obtained by the method of the present invention are as follows: 10 samples are wild-type at all 14 detected loci; 4 samples are heterozygous mutants at the APOE C130R locus, and the remaining loci are wild-type; 2 samples are heterozygous mutants at the APOE R176C locus, and the remaining loci are wild-type; 1 sample is a double-site heterozygous mutant at the APOE C130R and APOE R176C loci, and the remaining loci are wild-type; 1 sample is a heterozygous mutant at the APP V715M locus, and the remaining loci are wild-type; 1 sample is a heterozygous mutant at the PSEN1 G206A locus and a heterozygous mutant at the APOE C130R locus, and the remaining loci are all wild-type; 1 sample is a heterozygous mutant at the PSEN1 K311R locus, and the remaining loci are wild-type.

[0283] The results obtained in this experiment are completely consistent with the results obtained by detecting according to the gold standard method. Further illustrate the accuracy and stability of the detection results obtained by the method of the present invention.

[0284] Comparative Example 1

[0285] According to the design principle of NEAR isothermal amplification primers, three sites out of the 14 selected sites were used for comparative experiment to design primers. The upstream and downstream primer sets for the APP V715M site, the upstream and downstream primer sets for the PSEN1 F105C site, and the upstream and downstream primer sets for the APOEC130R site were designed. Each primer also contains a recognition site for a restriction site (5'-GAGTCNNNN-3', such as Nt.BstNBI), a stable region, and a nucleic acid strand of a target-binding region complementary to the target. However, the upstream primer for amplification at each site is simply identical to the target detection site. The primer design for each site is as follows:

[0286] Among them, the upstream and downstream primer sequences for detecting the APP V715M site are:

[0287] Wild-type upstream primer for the APP V715M site (SEQ ID NO.43):

[0288] AACCTGAAGC GAGTCAACT CACCAAGGTGATGACGATCAC

[0289] Mutant-type upstream primer for the APP V715M site (SEQ ID NO.44):

[0290] AACCTGAAGC GAGTCAACT CACACCAAGGTGATGACGATCAT

[0291] Common downstream primer for the APP V715M site (SEQ ID NO.45):

[0292] GTGCTCATCG GAGTCAACT GGGT(FAM-dT)TCAAACAAAGGTGCAA

[0293] The upstream and downstream primer sequences for detecting the PSEN1 F105C site are:

[0294] Wild-type upstream primer for the PSEN1 F105 site (SEQ ID NO.46):

[0295] AACCTGAAGC GAGTCAACT TACCATTAAGTCAGTCAGCTT

[0296] Mutant-type upstream primer for the PSEN1 F105 site (SEQ ID NO.47):

[0297] AACCTGAAGC GAGTCAACT GGTACCATTAAGTCAGTCAGCTG

[0298] Downstream primer for the F105 site of PSEN1 (SEQ ID NO. 48):

[0299] GTGCTCATCG GAGTCAACT GCAGAGGCC(FAM-dT)TTCAAGGTGATG

[0300] The upstream and downstream primer sequences for detecting the APOE C130R site are as follows:

[0301] Wild-type upstream primer for the APOE C130R site (SEQ ID NO. 49)

[0302] AACCTGAAGC GAGTCAACT CGGACATGGAGGACGTGT

[0303] Mutant-type upstream primer for the APOE C130R site (SEQ ID NO. 50)

[0304] AACCTGAAGC GAGTCAACT AAACGGACAT)GGAGGACGTGC

[0305] Downstream primer shared by the APOE C130R site (SEQ ID NO. 51)

[0306] GTGCTCATCG GAGTCAACT CT(HEX-dT)CCTCGGTGCTCTGGCC

[0307] In this example, other modifications and primer sequences are the same as those in Example 1, except that a base mismatch is no longer introduced at the 3'-2 or -3 position at the specific end for the experiment.

[0308] The above primers fully meet the requirements for the design of NEAR isothermal amplification primers, that is, each primer contains a recognition site for a restriction site (5'-GAGTCNNNN-3', such as Nt.BstNBI), a stable region, and a nucleic acid strand of a target-binding region complementary to the target. Using this primer set, three known samples were detected according to the method described in Example 1, and the results are shown in the following table:

[0309]

[0310]

[0311] When detecting with the above primers, the detection results were inconsistent with the gold standard method. Each sample was detected as a heterozygous mutant at each locus, indicating that the primers do not have the ability to perform SNP genotyping. Therefore, if only the NEAR isothermal amplification method is simply used to detect the samples, it is impossible to stably achieve genotyping of the detected SNP loci.

[0312] Comparative Example 2

[0313] Using the currently relatively mature multiplex SNP genotyping method, namely the method of combining ARMS-PCR and capillary electrophoresis detection, the samples in Example 1 were detected. The specific experimental steps are as follows:

[0314] (1) Design ARMS-PCR amplification primers. According to the ARMS-PCR primer design principle, the present invention selectively designs 3 out of 14 loci, namely the upstream and downstream primer sets for the APP V715M locus, the upstream and downstream primer sets for the PSEN1 F105C locus, and the upstream and downstream primer sets for the APOE C130R locus. The primer design for each locus is as follows:

[0315] Among them, the upstream and downstream primer sequences for detecting the APP V715M locus are: (146-148bp)

[0316] Wild-type upstream inner primer: 5’-CACCAAGGTGATGACGAT A AC-3’(SEQ ID NO.52)

[0317] Mutant-type upstream inner primer: 5’-CACACCAAGGTGATGACGATC C T-3’(SEQ ID NO.53)

[0318] Common downstream inner primer: 5’-FAM-GGGTTCAAACAAAGGTGCAA-3’(SEQ ID NO.54)

[0319] The upstream and downstream primer sequences for detecting the PSEN1 F105C locus are:

[0320] Wild-type upstream inner primer: 5’-TACCATTAAGTCAGTCAG G TT-3’(SEQ ID NO.55)

[0321] Mutant-type upstream inner primer: 5’-GGTACCATTAAGTCAGTCAGC A G-3’(SEQ ID NO.56)

[0322] Common downstream primer: 5’-FAM-GCAGAGGCCTTCAAGGTGATG-3’ (SEQ ID NO.57)

[0323] The upstream and downstream primer sequences for detecting the APOE C130R locus are as follows:

[0324] Wild-type upstream primer: 5’-CGGACATGGAGGACG A GT-3’ (SEQ ID NO.58)

[0325] Mutant upstream primer: 5’-AAACGGACATGGAGGACGT T C-3’ (SEQ ID NO.59)

[0326] Common downstream primer: 5’-FAM-CTCCTCGGTGCTCTGGCC-3’ (SEQ ID NO.60)

[0327] In this example, the NEAR isothermal digestion site sequence is no longer introduced into the primers, and only the specific detection primers for amplifying each locus are designed.

[0328] (2) Prepare the PCR amplification system

[0329] Component Added amount 2×PCR amplification enzyme mix 5 μL APP V715M wild-type upstream primer (10 μM) 0.2 μL APP V715M mutant upstream primer (10 μM) 0.2 μL APP V715M common downstream primer (10 μM) 0.4 μL PSEN1 F105C wild-type upstream primer (10 μM) 0.2 μL PSEN1 F105C mutant upstream primer (10 μM) 0.2 μL PSEN1 F105C common downstream primer (10 μM) 0.5 μL APOE C130R wild-type upstream primer (10 μM) 0.2 μL [[ID= ​ ​ ​ ​ ​ ​ ​

[0330] (3) PCR amplification

[0331] Using a PCR instrument, perform the following amplification procedure:

[0332]

[0333] (4) Detect the amplified product by capillary electrophoresis: Follow the electrophoresis detection steps in Example 1 and perform data analysis.

[0334] Using this primer set and amplification method to detect the 5 known samples in Example 1, the obtained results are shown in the following table:

[0335] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0336] That is, it is completely consistent with the detection results obtained in Example 1, and is also completely consistent with the detection results by the Sanger sequencing gold standard method.

[0337] It shows that the detection method in Example 1 is consistent with the detection method in Comparative Example 2 in terms of accuracy; however, comparing the entire experimental processes of Comparative Example 1 and Comparative Example 2, in Comparative Example 2, because there is a step of cycling temperature change, a relatively expensive PCR instrument is required, and the PCR amplification process takes 90 minutes, while Example 1 only takes 25 minutes to complete the isothermal amplification process.

[0338] Through this comparative experiment, it is further illustrated that the method of the present invention can achieve constant-temperature multiple rapid detections, reduce the requirements for amplification instruments, shorten the detection time, and save the detection cost.

[0339] The above are only the preferred embodiments of the present application and are not used to limit the present application. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A set of three primer combinations for detecting pathogenic gene mutations of familial Alzheimer's disease and APOE genotypes, characterized in that, The three primer combinations can achieve one-time amplification of the following 14 mutation sites: APP V715M; APP I716F; APP V717I; PSEN1 F105C; PSEN1 P117S; PSEN1 M139I; PSEN1 I167del; PSEN1 L173F; PSEN1 F177S; PSEN1 G206A; PSEN1 I213T; PSEN1 K311R; APOE C130R; and APOE R176C; Among them, the three primer combinations include a first primer combination, a second primer combination, and a third primer combination; among them, the first primer combination detects mutation sites: APP V715M; PSEN1 F105C; PSEN1 G206A; and PSEN1 F177S; The second primer combination detects mutation sites: APP I716F; PSEN1 P117S; and PSEN1 I167del; The third primer combination detects mutation sites: APP V717I; PSEN1 L173F; PSEN1 M139I; PSEN1 I213T; PSEN1 K311R; APOE C130R; and APOE R176C; Among them, the pathogenic gene mutations of familial Alzheimer's disease are for the Chinese Han population; Among them, the primers for each site include a wild-type upstream primer, a mutant upstream primer, and a common downstream primer; among them, the first primer combination sequence includes SEQ ID NO.1-3; SEQ ID NO.10-12; SEQ ID NO.28-30; and SEQ ID NO.25-27; the second primer combination sequence includes SEQ ID NO.4-6; SEQ ID NO.13-15; and SEQ ID NO.19-21; the third primer combination sequence includes SEQ ID NO.7-9; SEQ ID NO.22-24; SEQ ID NO.16-18; SEQ ID NO.31-33; SEQ ID NO.34-36; SEQ ID NO.37-39; and SEQ ID NO.40-42; The common downstream primer is labeled with a fluorescent group recognized for later capillary electrophoresis detection; the fluorescent group is labeled on a T base at the 2-10th base at the 3' end of the specific primer segment of the common downstream primer away from the nicking endonuclease recognition site.

2. The primer combination according to claim 1, wherein The fluorescent group can be modified with FAM, HEX, ROX, TAMER or CY5.

3. The primer combination according to claim 1, wherein In the primer combination, the amount of the upstream primer is 4 times that of the downstream primer.

4. A kit for multiplex amplification detection of pathogenic gene mutations and APOE genotypes in familial Alzheimer's disease, characterized in that, The kit includes the three primer combinations according to any one of claims 1-3, the NERA isothermal multiplex amplification enzyme mixture, 10X reaction buffer, 10 mM dNTP, positive control product and internal standard required for capillary electrophoresis.

5. The kit according to claim 4, wherein The NERA isothermal multiplex amplification enzyme mixture includes a nicking endonuclease and a DNA polymerase, and the nicking endonuclease is Nt.BstNBI; The DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, or phi29 DNA polymerase.

6. The kit according to claim 4, wherein The 10X reaction buffer is as follows: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-HCl at pH 8.

8.

7. The kit according to claim 6, characterized in that, The reaction buffer further contains 1-3% DMSO and / or 2.5-10 μg BSA.

8. Use of the three primer combinations according to any one of claims 1-3 in the preparation of an isothermal multiplex amplification detection system for hot pathogenic gene mutations and APOE genotypes of familial Alzheimer's disease in the Chinese Han population, characterized in that, The isothermal multiplex amplification detection system is as follows: Wherein, The 10X reaction buffer is as follows: 20 mM MgSO4, 1500 mM KCl, 100 mM (NH4)2SO4, 500 mM NaCl, 400 mM Tris-HCl at pH 8.8; The above detection system is treated at 95 °C for 5 min, quickly placed on ice, and after cooling, nicking endonuclease and polymerase are added to each tube of the reaction solution according to the amounts in the following table, as follows: Wherein the nicking endonuclease is Nt.BstNBI; The DNA polymerase is selected from Bst DNA polymerase, Klenow DNA polymerase, Vent DNA polymerase, or phi29 DNA polymerase.

9. The constant temperature multiple amplification detection system according to claim 8, wherein, The DNA polymerase is selected from Bst 3.0 polymerase. Use of the primer combination according to any one of claims 1-3 or the isothermal multiplex amplification detection system according to claim 8 or 9 in the preparation of reagents for detecting pathogenic gene mutations of familial Alzheimer's disease and APOE genotypes.

Citation Information

Patent Citations

  • Anchored strand displacement amplification on an electronically addressable microchip

    WO2000060919A2

  • Gene therapy for neurodegenerative disorders using polynucleotide silencing and replacement

    WO2021155296A1