Ghicr24 cru_d08 promoter and use thereof
By introducing the Ghicr24CRU_D08 promoter into Arabidopsis thaliana, the problem of lack of specific expression of promoters in existing technologies was solved, and efficient gene expression was achieved in the late stage of seed development, germination period and seedling stage, which reduced the burden on plants and improved the controllability of research.
Patent Information
- Application Number
- CN202310275480.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-21
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2043-03-21
AI Technical Summary
The lack of promoters in current technologies that can be specifically and highly expressed in the later stages of plant seed development, germination, and seedlings leads to the overexpression of exogenous genes at different stages, which burdens plants and has an uncontrolled impact on research.
A promoter sequence Ghicr24CRU_D08 is provided. By constructing a nucleic acid construct and vector, it is introduced into Arabidopsis thaliana using plant gene transformation technology to achieve specific expression of the GUS gene at specific stages, including high expression in the late seed development stage, germination stage and seedling stage.
This study enabled the specific expression of exogenous genes in the later stages of plant seed development, germination, and seedlings, reducing the burden of transgenics on plants and improving the controllability and economic benefits of the research.
Smart Images

Figure CN116200390B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and mainly relates to a promoter derived from cotton and its application in plants. Background Technology
[0002] A gene promoter is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription of. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation, and is mostly located upstream of the transcription start site of structural genes. Although promoters themselves are not transcribed, they are an important component of a gene. Promoters control the level, timing, and location of gene expression, acting as a key "switch" for gene expression regulation. Different promoters determine the vastly different expression characteristics of genes. Using genetic engineering techniques, cloning promoters with known regulatory functions into target genes allows for the modification of specific gene expression patterns and the regulation of specific gene expression according to individual needs. With the continuous development of genetic engineering technology, the role of promoters will continue to be emphasized, providing crucial technical support for genetic engineering.
[0003] Seeds are the reproductive bodies unique to gymnosperms and angiosperms. They are formed from ovules through pollination and fertilization and play a vital role in the continuation of the species. Seeds are also important agricultural inputs, closely related to human life. Besides essential daily necessities like grains, oils, and cotton, seeds are the source of many medicinal (e.g., almonds), flavorings (e.g., pepper), and beverage (e.g., coffee, cocoa) ingredients. Identifying and utilizing promoters that are specifically highly expressed during plant seed development and germination is of great significance to botanical research and agricultural production, possessing undeniable biological and economic value. However, in transgenic work, indiscriminate overexpression of exogenous genes can place a significant burden on the organism itself and introduce many uncontrollable impacts on research, which is detrimental to in-depth studies. Currently, no promoters have been discovered that can drive the specific high expression of target genes during plant seed development and germination. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide a promoter and its application, which can drive the specific expression of a target gene in the later stages of plant seed development, germination period and seedling.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] One aspect of the present invention relates to a promoter containing a nucleotide sequence selected from any one of the following groups and having promoter function:
[0007] a. The nucleotide sequence shown in SEQ ID NO: 1;
[0008] b. A nucleotide sequence complementary to SEQ ID NO: 1.
[0009] The sequence of SEQ ID NO: 1 is as follows:
[0010] TTACTACAAACAAGACTGAAGTGCATGGAAAACCTTTATTTGAGC
[0011] ACTTTTTAATGATTATGCCTTATATGAATAGTTAAAAGGTTTGGCATTTAT
[0012] TTAAGCAACCCTTAAAAAGTTAGATCCCAATTTAGCATTTAATCTTTTTT
[0013] CTTCTCCACGCCACCCTCCCACACTCCTGCTTCACAAAATATTCGCTAA
[0014] ATCTATTCCTCAATTCATTTAAGTAGAGTTACTCAATTTGGGAAGCAGG<000003'1>
[0015] GTGATGTGGAGAAAAAAATGGGTTAAGGAAGAAGAATATGAACAATGA
[0016] TAGAGTTAAAAAATAGTAACAAATTGTAACACACCTCATCCGACCTGAT
[0017] CACTGGATCCGAGCTACAGGATGTCACATTCATTGTCGAAGCAACTAC
[0018] AAACATTTAACTTTCAATTCACAGCTTAATGCATACAAACATAACATTTT
[0019] CAAGCCATAAACATGATATACAACTTTTCTCGGGTCTTATACAAGCTTAC
[0020] GTATGCTCTAAAATTAGCCTGGAATCAAACAAGGAACGATTTGTAAAA
[0021] GTTTTAAAAATTTTGGATTGACGTCGCGACATGAGGGGGTTCCTCGTCG
[0022] CGACGTACATACTAACTTGGCATCGTTGTGACGACGATGTTCCTCATC
[0023] ACGTCGTGGTCTGAAATCCAGAGCTCCATTGCTGAAGTCGCAATGTGG
[0024] ACTCTATTTTTGGTACATTTTAGGCCATTTGATACCTATTTTAAGCTTACA
[0025] CTTCAATGCATTCATTTTGTGCACTTTATTAATTAATTAATTAAAATTAAC
[0026] TTTAAATTAATGAACCTTAAGCATAATTAACATTTCTTAGTGGATAACAC
[0027] TTAGAATCTACCACCGTTTGGTCATATAATAGTAGTTCAATTGCTCAATT
[0028] GGTGTTTTGATTAATTAAAAATTTATAACAATGAATTTTTACAATTTAATT
[0029] TTTGTATCTTAATTAACTATTAATTTGATAAAATTAAGATACCAAAATTTA
[0030] ATTAACTTTTATATTAACCTCATATATATTAAACAATAATATTTACGGACTT
[0031] GAATATCAAAAATAGAATTCTAAAATTACCCTTTCCACCACTACTATAGT
[0032] AACCGATAGATTTTGTTTGACTTATTTTTGTTCTCATCAGTTATATTTTAT
[0033] ATCGTAAAAATTGCAATTATCGGAATAATGTACGACCGTATAGAATGTAG
[0034] TACAACTTGGCTTAAACAGATGGCAAGAGGTATAACATGCTACGGCCC
[0035] AGTTGTCGCAACACCATCACAGTTCACAAACAAACAAGTAATTCCCTG
[0036] CGTAGGTTCTTCACGTCCTGCCTCCACACCACATTTTCACTCTCCTTAC
[0037] CCTTTTTAGTTGTTATTAAAATAATTTTGACACTTTTTTATATTATTGTAGA
[0038] TTAGTAAAAAGTTAAAAATTAAATATAATTTAATGATATTTAGGGTCAAA
[0039] TTAAAATATAAAAATATATAAATACTGTAAAAATAAAATTTATTGTTTTGT
[0040] GAAATGAATGGATTTTTGGTGAGACTAAAATGATCTCATTTAAACTCTT
[0041] AATATATGTAGTAAGTACAAGTTAACGAGGAGAAATATATATTTTTAACA
[0042] ATAAAATCAATTAATGTTTTTTAAACGAAAATGGAAATTTAAATAAAATC
[0043] ATAATATAATGAATCATGTTTTAAAGAACTCTTGAACGCTTAATTAATAA
[0044] ATTGATGAATCATTTTGGTTTGATTAGTGTAACCAAAATTCAAGACTCTC
[0045] TCCTTAACCAATCTCATCTGGCGACATATCGTGGTTTCCGATTCTTCTTC
[0046] ATTTCCTGGTATTGTTATTTGTAAGTATTCATCGAAGCTTTGAGCCACCT
[0047] GCCCTCCCCCAGTCTATGATGTGTAAGCCATTAACCTCAACTCCCCCAT
[0048] GCAAACTGCTGTGTGTCGACACAACCCTGACCTCCTTTTCCACTCTTTC
[0049] TCCCCTATAAATACCACTATCCCTCCACTCCCTTCTTCACCAAATAACCA
[0050] TTTCAACACGTAGATATG.
[0051] In this invention, the promoter sequence shown in SEQ ID NO: 1 is referred to as promoter Ghicr24CRU_D08. Arabidopsis thaliana carrying this promoter, the cotton Ghicr24CRU_D08 gene, and the β-glucuronidase (GUS) gene, after GUS staining, showed no blue expression in mature roots, stems, leaves, flowers (excluding anthers), and siliques at 0-6 DPA. A small amount of blue expression was observed in anthers and rosette petioles. However, stable and high levels of blue expression were observed in siliques at 10-15 DPA, mature dry seeds, embryos during germination, 7-day seedlings, and 14-day seedlings (cotyledons, hypocotyls, and roots).
[0052] Another aspect of the present invention relates to a nucleic acid construct comprising the promoter described herein, and a gene sequence operatively linked to the promoter, wherein the promoter and the gene sequence may be of the same or different origin. In one embodiment of the present invention, the gene is a GUS reporter gene.
[0053] Another aspect of the present invention relates to a vector containing the promoter or nucleic acid construct described in this invention. The vector can be obtained, for example, by inserting the aforementioned promoter nucleotide sequence or nucleic acid construct into a cloning vector or expression vector, or it can be synthesized artificially. Suitable vectors for constructing the expression vectors described in this invention include, but are not limited to, pBI121.
[0054] In one embodiment of the present invention, the method for preparing the carrier includes the following steps:
[0055] 1) The overexpression vector pBI121 was digested with enzymes to obtain the digested vector;
[0056] 2) The promoter described in this invention is recombined into the enzyme digestion vector obtained in step 1) to obtain a fusion vector.
[0057] The enzymes used for step 1) of the digestion include, but are not limited to, the restriction endonucleases Hind III and BamHI. In this invention, the digestion removes the 35S promoter from the overexpression vector pBI121. This invention does not impose special limitations on the digestion conditions; those skilled in the art can follow conventional procedures.
[0058] Another aspect of the present invention relates to a recombinant cell containing the vector described in the present invention, which can be obtained by transforming a host cell containing the vector described in the present invention. Suitable host cells for constructing the recombinant cells of the present invention include, but are not limited to, recombinant *Escherichia coli* cells or *Agrobacterium* cells.
[0059] Another aspect of the present invention relates to a method for preparing the promoter shown in SEQ ID NO: 1, comprising using cotton genomic DNA as a template and amplifying it with a pair of amplification primers, the amplification primers being designed for the beginning and end of the sequence of SEQ ID NO: 1 in cotton gDNA.
[0060] In one embodiment of the present invention, the nucleotide sequence of the upstream primer of the amplification primer is shown in SEQ ID No. 2, and is as follows:
[0061] 5'-GACCATGATTACGCCAAGCTTttactacaaacaagactgaagtgc-3';
[0062] The nucleotide sequence of the downstream primer of the amplification primer is shown in SEQ ID No. 3, and is as follows:
[0063] 5'-GGACTGACCACCCGGGGATCCcatatctacgtgttgaaatgg-3'.
[0064] In one embodiment of the present invention, the amplification system comprises:
[0065]
[0066] In one embodiment of the present invention, the amplification process includes:
[0067]
[0068]
[0069] Another aspect of the present invention relates to a method for regulating the expression of a target gene in a plant, the method comprising the steps of converting the promoter nucleotide sequence and / or nucleic acid construct and / or vector of the present invention into plant callus or explant, or the steps of infecting a plant or plant callus or explant with recombinant cells of the present invention.
[0070] In one embodiment of the present invention, the target gene is the cotton gene and / or the GUS gene.
[0071] In one embodiment of the present invention, recombinant cells containing the recombinant vector pBI121::Pro Ghicr24CRU_D08 were transformed into Arabidopsis plants, and T2 generation transgenic Arabidopsis plants were screened. GUS gene expression was confirmed by GUS staining in anthers and rosette petioles, siliques at 10-15 DPA, mature dry seeds, embryos during germination, 7-day seedlings, and 14-day seedlings. However, GUS gene expression was not found in mature roots, stems, leaves, flowers (except anthers), or siliques at 0-6 DPA.
[0072] To achieve the above-mentioned goal of regulating the expression of target genes, the promoter described in this invention can be used in single-copy and / or multiple-copy forms.
[0073] In this invention, plant gene transformation technologies can be used to insert the target gene into the plant genome, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, gene gun transformation, and electroporation. As is well known in the art, Agrobacterium-mediated gene transformation is commonly used for gene transformation of monocots and dicots, but other transformation technologies can also be used for gene transformation of monocots as described in this invention. Of course, another method suitable for transforming monocots according to this invention is particle bombardment (microscopic gold or tungsten particles coating the transformed DNA) of embryogenic callus or embryo development. Additionally, protoplast transformation can also be used to transform monocots. After gene transformation, common methods are used to screen and regenerate plants integrating the expression unit.
[0074] Another aspect of this invention relates to the use of the promoter nucleotide sequence and / or nucleic acid construct and / or vector and / or recombinant cell of this invention in regulating the expression of a target gene in plants or in plant breeding, wherein the regulation is the regulation of the specific expression of the target gene in the later stages of seed development, germination, and seedlings. Specifically, the regulation is the regulation of the specific expression of the target gene in the cotyledons, hypocotyls, and roots of plant seeds during the 10-15 DPA development stage, germination, and 0-14 day seedling stages.
[0075] Beneficial effects of the present invention
[0076] The promoter of this invention can be used to specifically express exogenous target genes in the later stages of seed development, germination, and seedlings, in order to study the effects of these target genes on seed development and vigor. It can also be used to specifically express certain genes beneficial to seed development and vigor, thereby improving germplasm resources and increasing yield. The promoter of this invention regulates the expression of target genes at specific stages, reducing the burden of transgenic technology on plants and avoiding adverse effects on plant growth and development caused by indiscriminate overexpression of exogenous genes, thus making the research more controllable. Attached Figure Description
[0077] Figure 1Agarose gel electrophoresis image of PCR amplification products;
[0078] Figure 2 This is a structural diagram of the overexpression vector pBI121;
[0079] Figure 3 Electrophoresis image for PCR identification of the pBI121::Pro Ghicr24CRU_D08 vector;
[0080] Figure 4 Electrophoresis images of PCR identification of some T2 generation transgenic Arabidopsis thaliana plants;
[0081] Figure 5 GUS staining results for Arabidopsis thaliana transfected with pBI121::Pro Ghicr24CRU_D08; where A, dry seeds; B, seeds after 12 h of imbibition; C, embryos after 12 h of imbibition; D, seed coats after 12 h of imbibition; E, seeds after 24 h of imbibition; F, 7-day seedlings; G, 14-day seedlings; H, roots; I, stems and cauline leaves; J, flowers; K, anthers; L, 3-DPA siliques; M, 6-DPA siliques; N, 10-DPA siliques; O, 12-DPA siliques; P, 15-DPA siliques. Detailed Implementation
[0082] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0083] Example 1
[0084] Ghicr24CRU_D08 promoter cloning and sequencing
[0085] 1. Using genomic DNA from ZM24 as a template, PCR amplification was performed using Ghicr24CRU_D08p-Hind III-F and Ghicr24CRU_D08p-BamH IR primers, yielding a PCR amplification product of 2003 bp. The primer sequences are as follows:
[0086] Ghicr24CRU_D08p-Hind III-F(SEQ ID No.2):
[0087] 5'-GACCATGATTACGCCAAGCTTttactacaaacaagactgaagtgc-3';
[0088] Ghicr24CRU_D08p-BamH IR(SEQ ID No.3):
[0089] 5'-GGACTGACCACCCGGGGATCCcatatctacgtgttgaaatgg-3'.
[0090] The amplification system includes:
[0091]
[0092] The amplification procedure includes:
[0093]
[0094] 2. The PCR amplification products obtained in step 1 were detected by 1% agarose gel electrophoresis. The target bands were recovered and purified using the AXYGEN centrifuge column gel recovery kit according to the instructions.
[0095] 3. Agarose gel electrophoresis image of PCR amplification products is shown below. Figure 1 (The lane markers are DNA molecular weight standards, and the bands from largest to smallest are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp; lanes 1 and 2 are PCR amplification products, approximately 2003bp in size, and the product sequences are shown in SEQ ID No.1.)
[0096] Example 2
[0097] pBI121::Pro Ghicr24CRU_D08 vector construction
[0098] 1. The overexpression vector pBI121 was digested with restriction endonucleases Hind III and BamHI (the structure of the vector is shown below). Figure 2 As shown in the figure, a linear vector sequence with the 35S promoter removed was obtained.
[0099] Enzyme digestion system:
[0100]
[0101]
[0102] Enzyme digestion conditions: 37℃, 2h; 65℃, 20min.
[0103] 2. The amplified and purified promoter sequence from Example 1 and the enzyme-digested pBI121 vector were recombined using a recombinant kit (Novizan). The recombinant product was then transformed into *E. coli* DH5α competent cells using the heat shock method. The cells were plated on LB agar plates containing kanamycin and incubated at 37°C for 12 hours. Positive clones were screened and sequenced. Due to the complex structure of the promoter, amplifying the full-length promoter plus a portion of the vector sequence from transgenic *Arabidopsis thaliana* is difficult and inconvenient for detection. Therefore, this experiment designed primers in the middle of the promoter to amplify together with the vector primers, reducing the length of the amplified product and facilitating detection. Colony PCR detection and sequencing were performed using primers Ghicr24CRU_D08p-1284F (SEQ ID No. 4) (5'-TGCGTAGGTTCTTCACGTCC-3') and GUS-R (SEQ ID No. 5) (5'-GCGAACTGATCGTTAAAACTGC-3'). The identification results showed that the vector with a band of approximately 910 bp obtained by PCR amplification was correctly ligated into the pBI121::Pro Ghicr24CRU_D08 vector. Figure 3 ).
[0104] Example 3
[0105] Obtaining transgenic Arabidopsis
[0106] The pBI121::ProGhicr24CRU_D08 vector constructed in Example 2 was introduced into Agrobacterium GV3101 competent cells, and transgenic Arabidopsis was obtained using the Floral-dip method.
[0107] Identification of transgenic plants
[0108] Genomic DNA was extracted from leaves of T2 generation transgenic Arabidopsis plants after resistance selection. PCR identification of the genomic DNA of the T2 generation transgenic Arabidopsis plants was performed using ProGhicr24CRU_D08-1284F and GUS-R primers. Plants with positive PCR identification were identified as pBI121::ProGhicr24CRU_D08 Arabidopsis plants. Electrophoresis images of some T2 generation transgenic Arabidopsis plants after PCR identification are shown below. Figure 4 Lane M represents the DNA molecular weight standard, with the bands decreasing in size from 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 1, 4, 8, 9, and 12 represent the PCR amplification products of T2 generation transgenic positive Arabidopsis thaliana, with a size of approximately 910bp.
[0109] GUS staining of Arabidopsis thaliana pBI121::ProGhicr24CRU_D08
[0110] Mature dry seeds, seeds imbibed for 12 hours (seed coat and embryo), seeds imbibed for 2 hours, 7-day-old seedlings, 14-day-old seedlings, mature leaves, stems, roots, floral organs, and siliques with 3DPA, 6DPA, 10DPA, 12DPA, and 15DPA were collected from T2 generation Arabidopsis thaliana plants that were positive for PCR and subjected to GUS staining analysis. The specific steps for GUS staining analysis are as follows: The plant tissues were immersed in GUS staining solution at 37°C for 12 hours, then destained 2-3 times with 75% ethanol solution. Observation was performed under a stereomicroscope; the blue color against a white background indicated the GUS expression sites. Figure 5 The results indicate that the promoter of the Ghicr24CRU_D08 gene is not expressed in mature roots, stems, leaves, flowers (except anthers), or siliques at 0-6 DPA. It is expressed in small amounts in anthers and rosette petioles, but is stably and highly expressed in siliques at 10-15 DPA, mature dry seeds, embryos during germination, 7-day seedlings, and 14-day seedlings (cotyledons, hypocotyls, and roots). Therefore, the Ghicr24CRU_D08 promoter is specifically expressed in the late stages of seed development (10-15 DPA), during germination, and in the cotyledons, hypocotyls, and roots of seedlings (0-14 days).
[0111] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The use of promoters in regulating the expression of target genes in Arabidopsis thaliana, characterized in that, The regulation refers to the regulation of the specific expression of the target gene in the cotyledons, hypocotyls, and roots of Arabidopsis thaliana seedlings at 14 days old. The target gene is the cotton Ghicr24CRU_D08 gene; The nucleotide sequence of the promoter is shown in SEQ ID NO: 1.
Citation Information
Patent Citations
Cloning and functional identification of upland cotton seed globulin gene promoters
CN105112418A