Use of MST1 interfering RNA in promoting differentiation of ESCs into insulin-secreting cells in vitro

CN116262920BActive Publication Date: 2026-07-07NINGXIA MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGXIA MEDICAL UNIV
Filing Date
2021-12-15
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing pancreatic β-cell differentiation efficiency is low and unstable, making it difficult to promote its clinical application.

Method used

We used MST1 interfering RNA to infect rat ESCs with a recombinant MST1 shRNA lentiviral vector to reduce MST1 expression. Combining cell biology and molecular biology methods, we optimized the process of ESCs' directed differentiation into β-cells and used PDX1 to regulate β-cell maturation.

Benefits of technology

This improved the efficiency of ESCs in directed differentiation into β-cells, resulting in β-cells with normal insulin secretion function and promoting the clinical application of β-cell transplantation technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003413282940000011
    Figure HDA0003413282940000011
  • Figure HDA0003413282940000012
    Figure HDA0003413282940000012
  • Figure HDA0003413282940000013
    Figure HDA0003413282940000013
Patent Text Reader

Abstract

The application discloses application of MST1 interfering RNA in promoting in-vitro differentiation of ESCs into insulin-secreting cells, and belongs to the technical field of biotechnology. In the process of in-vitro directional differentiation of rat ESCs into beta cells, the application infects by using an MST1 shRNA lentivirus vector, and indexes are detected and functions are determined by using cell biology and molecular biology methods, and it is found for the first time that the efficiency of inducing ESCs to differentiate into beta cell-like cells can be improved by reducing the expression of MST1. Meanwhile, how MST1 realizes the regulation of beta cell maturation by means of PDX1 in the process of directional differentiation of rat ESCs into beta cells is described, the reason affecting in-vitro maturation of beta cells is discussed, and thus the system of directional differentiation of ESCs into mature beta cells is optimized, which has important significance for obtaining beta cells with normal insulin secretion function in-vitro.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of MST1 interfering RNA in promoting the in vitro differentiation of ESCs into insulin-secreting cells. Background Technology

[0002] Pancreatic β-cell transplantation can increase the total number of functional pancreatic islet cells in diabetic patients, thus treating the disease. Traditional treatments for diabetes, including oral hypoglycemic agents and insulin injections, cannot cure the disease and can cause other complications, resulting in significant physical and psychological harm to patients. Pancreatic β-cell transplantation technology has become a promising new strategy for diabetes treatment because it can overcome the shortcomings of these treatments. Currently, pancreatic β-cells are mainly differentiated in vitro from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), and adult stem cells. However, these methods face problems such as low differentiation efficiency and instability, making them difficult to widely apply in clinical practice. Summary of the Invention

[0003] To address the aforementioned shortcomings, the purpose of this invention is to provide the application of MST1 interfering RNA in promoting the in vitro differentiation of ESCs into insulin-secreting cells. In the directed differentiation of rat ESCs into β-cells, this invention, through infection with a lentiviral vector such as MST1 shRNA, and using cell biology and molecular biology methods for indicator detection and functional assays, has for the first time discovered that reducing MST1 expression can improve the efficiency of ESCs inducing differentiation into β-cell-like cells. Simultaneously, this invention elucidates how MST1, through PDX1, regulates β-cell maturation during the directed differentiation of rat ESCs into β-cells, explores the factors affecting in vitro β-cell maturation, and thus optimizes the system for the directed differentiation of ESCs into mature β-cells. This is of great significance for obtaining β-cells with normal insulin-secreting function in vitro and also has a positive promoting effect on the clinical application of β-cell transplantation technology.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] This invention provides the application of MST1 interfering RNA in promoting the in vitro differentiation of ESCs into insulin-secreting cells.

[0006] Furthermore, insulin-secreting cells, including β-cells, are a type of cell that has insulin secretion function.

[0007] Furthermore, MST1 interfering RNA refers to a small RNA that can inhibit MST1 activity and / or reduce MST1 gene expression; including MST1 interfering RNAs such as recombinant MST1 shRNA lentiviral vectors, recombinant MST1 miRNA, and recombinant MST1 siRNA; its preparation method can adopt conventional methods in the field, such as production by direct RNA synthesis, in vitro transcription, and recombinant RNA technology, etc., without the need for complicated preparation processes and procedures.

[0008] It should be noted that ESCs (embryonic stem cells) refer to embryonic stem cells.

[0009] A method for promoting the in vitro differentiation of ESCs into insulin-secreting cells includes the following steps: transfecting ESCs with MST1 interfering RNA during the directed differentiation of ESCs into insulin-secreting cells.

[0010] Furthermore, insulin-secreting cells, including β-cells, are a type of cell that has insulin secretion function.

[0011] Furthermore, MST1 interfering RNA refers to a small RNA that can inhibit MST1 activity and / or reduce MST1 gene expression; including MST1 interfering RNAs such as recombinant MST1 shRNA lentiviral vectors, recombinant MST1 miRNA, and recombinant MST1 siRNA; its preparation methods can adopt conventional methods in the field, such as production by direct RNA synthesis, in vitro transcription, and recombinant RNA technology, etc.

[0012] An agent that promotes the in vitro differentiation of ESCs into insulin-secreting cells, characterized in that the active ingredient of the agent includes MST1 interfering RNA.

[0013] In summary, the present invention has the following advantages:

[0014] 1. This invention, during the directed differentiation of rat ESCs into β-cells, utilizes an MST1 shRNA lentiviral vector for infection and employs cell biology and molecular biology methods for indicator detection and functional assays. It elucidates how MST1, through PDX1, regulates β-cell maturation during this process, explores the factors influencing in vitro β-cell maturation, and optimizes the system for directed differentiation of ESCs into mature β-cells. This is significant for obtaining β-cells with normal insulin secretion function in vitro. Furthermore, it positively promotes the clinical application of β-cell transplantation technology.

[0015] 2. This invention is the first to discover that reducing MST1 expression can improve the efficiency of ESCs inducing differentiation into β-cell-like cells, and provides a method to promote the in vitro differentiation of ESCs into insulin-secreting cells and the application of MST1 interfering RNA in promoting the in vitro differentiation of ESCs into insulin-secreting cells. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the three-step process for obtaining rat β-cells in this invention;

[0017] Figure 2 This is a diagram showing the results of rat ESCs being induced to differentiate into β-cell-like cells in this invention;

[0018] Figure 3 This shows the expression of MST1 protein in cells at different differentiation stages in this invention.

[0019] Figure 4 This shows the expression of the MST1 gene in cells at 7, 14, and 21 days after MST1 shRNA interference in the third stage of this invention.

[0020] Figure 5 The mRNA expression of SOX17 and FOXA2 in the control group and the MST1 shRNA group on day 3 after treatment with MST1 shRNA in this invention.

[0021] Figure 6 This is the mRNA and protein expression of PDX1 and NKX6.1 in the control group and the MST1shRNA group on day 7 of the third stage after MST1 shRNA treatment in this invention.

[0022] Figure 7 This invention shows the mRNA and protein expression of PDX1 and NKX6.1 in the control group and the MST1 shRNA group on day 14 of phase 3 after MST1 interference.

[0023] Figure 8 The expression of PDX1, NKX6.1, MAFA, Insulin and C-peptide proteins in the control group and the MST1shRNA group on day 21 of the third stage after MST1 shRNA treatment in this invention.

[0024] Figure 9 This invention shows the mRNA and protein expression of PDX1 and NKX6.1 in the control group and the MST1 shRNA group on day 21 of phase 3 after MST1 interference.

[0025] Figure 10 These are the results of in vitro insulin secretion function detection of β-cells in this invention;

[0026] Figure 11 The results of weight measurement in β-cell transplantation to restore diabetic rats in this invention;

[0027] Figure 12 These are the test results of β-cell transplantation in the present invention to restore pancreatic islet function in diabetic rats;

[0028] Figure 13 In this invention, rat pancreatic tissue was taken 6 weeks after transplantation, and insulin expression was detected using immunohistochemistry. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention; that is, the described embodiments are merely some embodiments of the invention, and not all embodiments.

[0030] Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0031] Example

[0032] Unless otherwise specified, the experimental procedures, steps, and reagents involved in this embodiment can be achieved using conventional techniques or commercially available products in the field. Furthermore, this embodiment uses a recombinant MST1 shRNA lentiviral vector as MST1 interfering RNA to silence the expression of the target gene MST1, thereby providing partial illustration and verification of the content and effects of this invention. However, it does not limit the MST1 interfering RNA to only MST1 shRNA. Using other MST1 interfering RNAs that can inhibit MST1 activity and / or reduce MST1 gene expression, such as recombinant MST1 miRNA and recombinant MST1 siRNA, can also promote the in vitro differentiation of stem cells into insulin-secreting cells, and these methods are still within the scope of this invention.

[0033] 1. Experimental procedure for reducing MST1 expression to improve the efficiency of ESCs in differentiating into β-cell-like cells.

[0034] 1.1 Construction and Packaging of MST1 Silent Lentiviral Vector

[0035] MST1 silencing and control shRNA were designed. The silencing plasmid pGreenPuro was double-digested with enzymes. The linearized pGreenPuro was ligated with the MST1 shRNA, and the recombinant plasmid was re-transformed and sequenced to identify the recombinant silencing plasmid pGreen-MST1 shRNA. Virus packaging was performed using 293T cells, and the virus was collected to obtain LV-shMST1 or LV-shCtrl lentivirus stock solution.

[0036] MST1 shRNA primer sequence

[0037] Rat1 F:

[0038] GATCCGCTGGTTCTGTATCCGATATTCTCGAGAATATCGGATACAGAACCAGCTTTTTG

[0039] Rat1 R:

[0040] AATTCAAAAAGCTGGTTCTGTATCCGATATTCTCGAGAATATCGGATACAGAACCAGCG

[0041] 1.2 In vitro induction of rat ESCs into β-cell-like cells

[0042] First, rat ESCs were digested into a single-cell suspension using trypsin and cultured in differentiation medium using the hanging drop method for 2 to 5 days to form embryoid bodies (Step 1). The embryoid bodies were then transferred to adherent culture dishes containing differentiation medium and cultured for another 9 days, with the medium changed every 2 to 3 days (Step 2). Finally, they were cultured for 20 days in B27 conditioned medium containing laminin, butanediamine, insulin, nicotinic acid, selenoside, transferrin, and progesterone to differentiate into β-cell-like cells (Step 3). The three-step procedure for obtaining rat β-cell-like cells is as follows: Figure 1 As shown; the differentiation results of rat ESCs induced into β-cell-like cells are as follows. Figure 2 As shown, Figure 2 A differentiated in 2 days, B in 6 days, C in 10 days, D in 13 days, and E and F in 4-5 days after passage. Scale bar = 100 μm.

[0043] 1.3 MST1 Silent Lentiviral Vector Infection

[0044] On day 2 of step 3, cells were infected using the MST1 silencing lentiviral vector, while cells not infected with the lentiviral vector served as the control group.

[0045] 1.4 Quantitative Real-Time PCR (RT-PCR)

[0046] This assay was used to determine the mRNA expression of markers Sox17, FOXA2, PDX1, NKX6.1, MAFA, and Insulin at various stages of cell differentiation. Total RNA was extracted from cells, reverse transcribed into cDNA, and analyzed using a Takara quantitative real-time PCR kit (catalog number: RR430A). The reaction volume was 10 μL. Green Real-time PCR Master Mix, 0.3uL upstream and downstream primers, 2uL cDNA template, were used for RT-PCR experiments.

[0047] 1.5 Immunohistochemistry

[0048] Immunohistochemistry was used to detect the protein expression of insulin and C-peptide. The specific method was as follows: paraffin section → dewaxing with xylene → graded alcohol dehydration → incubation with 3% H2O2 at 37℃ for 10 min to block and inactivate endogenous peroxidase → boiling in 0.01M citrate buffer (pH 6.0) (95℃, 15-20 min) → blocking with 10% non-immune goat serum (37℃, 10 min) → adding primary antibody (4℃, overnight) → adding secondary antibody (37℃, 30 min) → DAB staining → observation under a microscope.

[0049] 1.6 Western blot

[0050] The expression of MST1, PDX1, NKX6.1, and NGN3 proteins was detected by Western blot. The specific method is as follows: Cells were incubated in pre-chilled Lysis Buffer for 30 min to lyse the cells → Protein concentration was determined by BAC method → ​​10%-15% SDS-PAGE gel electrophoresis → Electroporation to NC membrane → Blocking (0.1% TBST prepared with 5% skim milk powder) → Target protein was measured using antibody → Gray-scale scanning of product bands was performed for relative quantification.

[0051] 1.7 ELISA

[0052] Insulin secretion was detected using a rat insulin ELISA kit (Linco, USA). The procedure was as follows: The sample was diluted 1:1 with diluent and 50 μL was added to each well. Then, 50 μL of the test sample was added to each well. 50 μL of biotin-labeled antibody was added. The sample was gently shaken (incubated at 37°C for 1 h), and washed three times with washing buffer. 80 μL of streptavidin-HRP was added to each well, and the sample was gently shaken (incubated at 37°C for 30 min), and washed three times with washing buffer. 50 μL each of substrates A and B were added to each well, and the sample was gently shaken (incubated at 37°C for 10 min). 50 μL of stop solution was added, and the results were measured. The OD value of each well was measured at 450 nm.

[0053] 1.8 Flow cytometry

[0054] Cells were digested into single-cell suspensions with trypsin (centrifuged at 1000×g for 5 min) → fixed with 4% paraformaldehyde solution for 15 min → treated with 0.3% Triton X-100 for 5 min → blocked with 0.5% bovine serum albumin for 5 min → incubated overnight at 4°C with anti-insulin primary antibody (centrifuged at 1000×g for 5 min) → incubated with FITC-labeled secondary antibody at room temperature for 30 min (centrifuged at 1000×g for 5 min) → resuspended in PBS solution and detected by flow cytometry.

[0055] The test results in 1.1-1.8 above show that:

[0056] (1) Western blot and RT-PCR experiments showed that MST1 expression decreased continuously during subsequent cell differentiation, laying the foundation for further experimental studies on the role of MST1 in the in vitro differentiation of β-like cells. The results are as follows: Figure 3 As shown.

[0057] (2) MST1 gene expression in cells at 7, 14, and 21 days after MST1 interference was as follows: Figure 4 As shown, Figure 4 The data represent the mean ± SEM, *p<0.05, **p<0.01, ***p<0.001, and t-test (n=3).

[0058] (3) On day 3 after MST1 shRNA treatment, immunofluorescence and RT-PCR experiments showed that the expression of endoderm marker genes SOX17 and FOXA2 was upregulated, indicating that the cells were differentiating into pancreatic cells. However, MST1 shRNA had no effect on the expression of SOX17 and FOXA2 (p>0.05, e.g., Figure 5 As shown in the figure, Figure A shows the immunofluorescence detection of SOX17 and FOXA2 protein expression in cells after treatment with MST1 shRNA, and Figure B shows the RT-PCR detection of SOX17 and FOXA2 gene expression in cells after treatment with MST1 shRNA.

[0059] (4) On day 7 of the third stage after MST1 shRNA treatment, the results of cell immunofluorescence, RT-PCR and Western blot experiments showed that pancreatic progenitor cell markers PDX1 and NKX6.1 began to be expressed, indicating that cells further differentiated into β-cells. At the same time, the expression levels of PDX1 and NKX6.1 in the MST1 shRNA group were significantly higher than those in the control group (p<0.01), indicating that reducing the expression of MST1 during the β-cell induction differentiation process can increase the expression of PDX1 and NKX6.1, which has a promoting effect on the production of β-cells (e.g., Figure 6 As shown in Figure A, the expression of pancreatic progenitor cell markers PDX1 and NKX6.1 proteins on day 7 after MST1 shRNA treatment was detected by immunofluorescence; Figure B, the expression of pancreatic progenitor cell markers PDX1 and NKX6.1 genes on day 7 after MST1 shRNA treatment was detected by RT-PCR; and Figure C, the expression of pancreatic progenitor cell markers PDX1 and NKX6.1 proteins on day 7 after MST1 shRNA treatment was detected by Western blot. Data represent mean ± SEM, *p<0.05, **p<0.01, ***p<0.001, t-test (n=3)).

[0060] (5) On day 14 of the third stage after MST1 shRNA treatment, the results of Western blot experiment showed that the expression level of MST1 decreased, which could promote the expression of PDX1, NKX6.1 and NGN3.

[0061] (6) On day 21 of the third phase after MST1 shRNA treatment, the expression levels of PDX1, NKX6.1, MAFA, insulin, and C-peptide in the MST1 shRNA group were significantly higher than those in the control group (e.g., ...). Figure 8 (As shown).

[0062] (7) On day 21 of the third stage after MST1 shRNA treatment, RT-PCR and Western blot experiments showed that decreased MST1 expression promoted the expression of PDX1, NKX6.1, MAFA, and insulin. Flow cytometry analysis showed that the positive rates of NKX6.1 and insulin in the MST1 shRNA group were significantly higher than those in the control group, further demonstrating that MST1 shRNA can promote the production of β-cells (e.g., Figure 9As shown in the figures, Figure A shows the expression of MST1, PDX1, NKX6.1, MAFA, and Insulin genes in cells on day 21 after MST1 shRNA treatment, detected by RT-PCR; Figure B shows the expression of MST1, PDX1, NKX6.1, MAFA, and Insulin proteins in cells on day 21 after MST1 shRNA treatment, detected by Western blot; and Figure C shows the expression of MST1, PDX1, NKX6.1, MAFA, and Insulin proteins in cells on day 21 after MST1 shRNA treatment, detected by flow cytometry. Data represent mean ± SEM; *p<0.05, **p<0.01, ***p<0.001; t-test (n=3)).

[0063] 2. Experimental Procedure for Verifying the Repair Function of β-Cell Transplanted into a T1D Rat Model

[0064] 2.1 Establishment and identification of T1D rat model

[0065] Male SD rats (weighing 180–200 g) were purchased from the Experimental Animal Center of Ningxia Medical University and housed there.

[0066] Rats were randomly divided into two groups: a T1D animal model group and a control group. After one week of acclimatization feeding, rats were fasted for 12 hours. The T1D animal model group received a single intraperitoneal injection of 60 mg / kg STZ solution, while the control group received an equal volume of citrate-trisodium citrate buffer intraperitoneally. Rats that were fasted for 12 hours before the experiment and exhibited symptoms such as polydipsia, polyphagia, polyuria, and weight loss after 7 days were identified as T1D animal models.

[0067] 2.2 β-cell transplantation

[0068] T1D rats were anesthetized with 3% pentobarbital at a dose of 2.5 ml / 100 g. On day 7 of step 3, β-like cells differentiated from rat ESCs were digested into a single-cell suspension using trypsin and transplanted into the T1D rat model via tail vein and peritoneal cavity. Each rat was injected with 2 x 10 g of the suspension. 6 Each cell.

[0069] 2.3 Measurement of changes in body weight, blood glucose, and insulin in rats after β-cell transplantation

[0070] After cell transplantation, the T1D model group and the control group were weighed once a week, and blood was collected from the tail tip to measure blood glucose levels using a blood glucose meter for a total of 6 weeks. Curves of weight change over time and curves of blood glucose change over time were plotted.

[0071] 2.4 Intense Pulsed Glucose Tolerance Test (IPGT) in Rats After β-Cell Transplantation

[0072] The IPGT test was performed 4 weeks after cell transplantation. Rats in each group were fasted and deprived of water for 12 hours. A glucose solution of 2 mg / g body weight was injected into the peritoneum once. Blood was collected from the tail tip at 0 min, 15 min, 30 min, 60 min, 90 min and 120 min after the injection. Blood glucose values ​​were measured using a blood glucose meter and a curve of blood glucose value change over time was plotted.

[0073] 2.5 Immunohistochemical staining of rat pancreas after β-cell transplantation

[0074] Six weeks after cell transplantation, pancreatic tissue was surgically removed from the T1D model group and the control group. Immunohistochemistry was used to detect the expression of insulin and C-peptide proteins. The specific method was as follows: paraffin section → xylene dewaxing → graded alcohol dehydration → incubation at 3% H2O2 at 37℃ for 10 min to block and inactivate endogenous peroxidase → boiling in 0.01M citrate buffer (pH 6.0) (95℃, 15-20 min) → blocking with 10% non-immune goat serum (37℃, 10 min) → adding primary antibody (4℃, overnight) → adding secondary antibody (37℃, 30 min) → DAB staining → microscopic observation.

[0075] The test results in 2.1-2.5 above show that:

[0076] (1) In vitro functional verification of β-like cells: ELISA results showed that β-like cells generated by MST1 shRNA treatment were more sensitive to glucose than the control group, with a significant difference (p<0.05). Figure 10 (As shown).

[0077] (2) In vivo functional verification of β-like cells: The induced β-like cells were transplanted into diabetic rat models via tail vein injection and intraperitoneal injection at weeks 2 and 5, respectively (1*10⁶ cells transplanted each time). Figure 11 As shown, Figure 11 In the figures: Figure a shows a normal rat (control), and Figure e shows a diabetic rat model, which is thin and has yellowish fur. Six weeks after transplantation, rats with MSTI shRNA cells transplanted into the tail tip showed the best weight recovery (Figures A and b), followed by rats with MSTI shRNA cells transplanted into the peritoneum (Figures A and c), while rats with shControl cells transplanted into the tail tip showed the worst weight recovery. This indicates that MSTI shRNA cells transplanted into the tail tip have a better repair effect.

[0078] (3) In the transplanted diabetic rats, blood glucose levels decreased to varying degrees. Rats with MST1shRNA cells transplanted at the tail tip experienced the greatest decrease in blood glucose, ultimately maintaining a level of around 8 mM. Rats with MST1shRNA cells transplanted intraperitoneally showed the second greatest decrease, ultimately maintaining a level of around 16 mM. Rats with shControl cells transplanted at the tail tip showed the worst recovery in blood glucose. Blood glucose levels in the non-transplanted diabetic rats continuously increased, indicating that MST1shRNA cells have a better blood glucose-lowering effect in diabetic rats. The glucose tolerance test is a method for examining the blood glucose regulation function of rats. In normal rats, after injection of a certain amount of glucose solution, blood glucose concentration rises rapidly in a short period, but returns to normal levels within 2 hours. As shown in Figure A, the fasting blood glucose level of normal rats was approximately 6 mM. After glucose injection, the blood glucose level reached its peak at 15 minutes and returned to the fasting level at 120 minutes. In the MST1 shRNA cell tail tip transplantation group, the fasting blood glucose level of diabetic rats was approximately 13 mM, also reaching its peak at 15 minutes and returning to 13 mM at 120 minutes. In the MST1 shRNA cell peritoneal transplantation group, the fasting blood glucose level of diabetic rats was approximately 17 mM, rapidly increasing within 15 minutes after glucose injection and decreasing to 20 mM at 120 minutes. The fasting blood glucose level of shControl cell tail tip transplantation group was approximately... The fasting blood glucose level in the non-transplanted diabetic rats was approximately 30 mM, reaching a peak at 15 minutes and recovering to 21 mM at 120 minutes. This peak exceeded 35 mM (since the maximum range of the blood glucose meter is 35 mM, values ​​exceeding 35 mM are recorded as 35 mM), and did not decrease after 120 minutes. This indicates that transplantation of β-cells restored the glycemic function of the rat pancreas. Furthermore, tail tip transplantation of MST1 shRNA cells showed the best effect, followed by peritoneal transplantation, while tail tip transplantation of shControl cells showed the worst effect. This suggests that reducing MST1 expression during the induction and differentiation of β-cells in vitro can increase β-cell activity. It also indicates that, for the same cell type, tail tip transplantation is more effective than peritoneal transplantation (e.g., ...). Figure 12 As shown in the figure, Figure A shows the changes in blood glucose concentration in rats before and after β-cell transplantation, and Figure B shows the glucose tolerance test.

[0079] (4) To further verify whether transplanted cells can promote pancreatic islet repair, insulin expression in rats was detected by immunohistochemistry, such as... Figure 13As shown. Six weeks after transplantation, the islets of Langerhans in diabetic rats were smaller than normal, with significant morphological changes and lower insulin secretion. The islets of Langerhans in the transplantation group were similar in morphology and size to normal rats, but insulin secretion was significantly higher than in the non-transplantation group. MST1shRNA cell tail tip transplantation showed the best results, while shControl cell tail tip transplantation showed poorer results. This indicates that β-cell-like cells can promote islet repair, and MST1shRNA cell tail tip transplantation has the best repair effect. When we harvested the rat pancreas, we observed an interesting phenomenon: the pancreas of almost all diabetic rats after cell transplantation was purple, as shown in the image. Figure 13 As shown in Figure Ab, instead of the light red color of a normal rat pancreas, it appears as... Figure 13 As shown in Figure Aa, the volume of the pancreas in the rats after cell transplantation is similar to that of normal rats, but larger than that of diabetic rats, which also shows the repair effect of transplanted cells on the pancreas.

[0080] In summary, the regulation of PDX1 by MST1 during the in vitro differentiation of ESCs into β-cell-like cells and its intrinsic regulatory mechanism have not been reported to date, either domestically or internationally. This invention is the first to study the regulatory role of MST1 on PDX1 during the in vitro differentiation of ESCs into β-cell-like cells, elucidating the interaction between MST1, PDX1, and in vitro differentiated β-cell-like cells. This invention is of great significance for obtaining normal β-cells with insulin-secreting function in vitro, and also has a positive promoting effect on the clinical application of β-cell transplantation technology.

[0081] The above content is merely an example and illustration of the structure of the present invention. Any modifications or additions to the specific embodiments described, or substitutions made by those skilled in the art without creative effort, shall still fall within the scope of protection of this patent.

Claims

1. Application of MST1 interfering RNA in promoting the in vitro differentiation of ESCs into insulin-secreting cells.

2. The application as described in claim 1, characterized in that, The MST1 interfering RNA includes MST1 shRNA.

3. Application of MST1 interfering RNA in the preparation of a formulation that promotes the in vitro differentiation of ESCs into insulin-secreting cells.

4. A method for promoting the in vitro differentiation of ESCs into insulin-secreting cells, characterized in that, The procedure includes the following steps: transfecting MST1 interfering RNA into ESCs during their directed differentiation into insulin-secreting cells.

Citation Information

Patent Citations

  • CN112220925A

  • US20230128770A1