A heat-resistant reverse transcriptase mutant and a preparation method and application thereof

By performing site-directed mutagenesis on the reverse transcriptase of Monilo mouse leukemia virus and optimizing the preparation method, a heat-resistant reverse transcriptase mutant was constructed, which solved the problem of insufficient activity of reverse transcriptase under high temperature conditions and realized the effective application of reverse transcriptase at high temperatures.

CN116286721BActive Publication Date: 2026-06-26苏州源启生物科技有限公司
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310323050.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-29
Publication Date
2026-06-26
Estimated Expiration
2043-03-29

AI Technical Summary

Technical Problem

Existing reverse transcriptases have poor thermal stability and cannot work effectively under high temperature conditions, which limits their application scenarios and efficiency.

Method used

Thermostable reverse transcriptase mutants were constructed by site-directed mutagenesis at specific amino acid sites of Moniro murine leukemia virus (MMLV) reverse transcriptase, including H8Y, H204R, N249D, M289L, T306K, F309N, D524G, E562Q, K571R, D583N, and T664N mutants. These mutants were then combined with optimized preparation methods, including recombination ligation, host cell expression, and purification steps.

Benefits of technology

This achievement enabled reverse transcriptase to maintain more than 50% activity at 50℃ or even 55℃, solving the problem of high temperature intolerance of wild-type MMLV reverse transcriptase and expanding the application efficiency and prospects of reverse transcriptase.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116286721B_ABST
    Figure CN116286721B_ABST
Patent Text Reader

Abstract

The application discloses a heat-resistant reverse transcriptase mutant and a preparation method and application thereof, and relates to the technical fields of genetic engineering and enzyme engineering. The amino acid sequence of the reverse transcriptase mutant is compared with the amino acid sequence shown in SEQ ID NO:1, and one or more of the positions of the amino acid sequence shown in SEQ ID NO:1 are mutated, that is, the 8th position, the 204th position, the 249th position, the 289th position, the 306th position, the 309th position, the 524th position, the 562th position, the 571th position, the 583th position and the 664th position. The purity of the reverse transcriptase mutant can reach more than 98 %, the reverse transcription temperature of 50 DEG C and 55 DEG C is tolerated, more than 50 % of reverse transcriptase activity is retained, one-step RT-PCR is realized, and the application efficiency and prospect of the reverse transcriptase are expanded.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, specifically to a thermostable reverse transcriptase mutant, its preparation method, and its application. Background Technology

[0002] Reverse transcriptase is an enzyme that uses RNA as a template to guide the synthesis of complementary DNA from deoxyribonucleotide triphosphates. The main functions of reverse transcriptase include: (1) DNA polymerase function using RNA as a template; (2) DNA polymerase function using DNA as a template, which plays an important role in the process of completing DNA double-strand synthesis; (3) RNase H function: The C-terminus of reverse transcriptase contains a group with RNase H function, which can specifically degrade the RNA single strand in RNA / DNA hybrids.

[0003] Reverse transcriptase derived from Monillo murine leukemia virus (MMLV) is one of the most commonly used reverse transcriptases on the market. However, wild-type M-MLV reverse transcriptase has poor thermostability, and it cannot solve the problem of nucleic acid sequences forming secondary structures of mRNA by increasing the temperature, thus greatly limiting the application scenarios and efficiency of reverse transcriptase.

[0004] Chinese patent CN202210096427.0 discloses an M-MLV reverse transcriptase and its preparation method. This patent describes a method for constructing an M-MLV reverse transcriptase gene sequence, ligating it into a vector, and then expressing it in *E. coli*. The gene mutant sites include one or more of D524G, E562Q, D538N, and G638H. This patent alters the spatial structure of the M-MLV reverse transcriptase by changing the charge or hydrophobicity of amino acids at key mutation sites, thereby weakening the M-MLV RNase HMinus and improving the activity and stability of the M-MLV reverse transcriptase. However, this patent only improves the stability of the reverse transcriptase at 25°C and does not address the issue of improving the stability of the reverse transcriptase at higher temperatures.

[0005] Chinese patent CN202111174974.8 discloses a potassium-tolerant M-MLV reverse transcriptase mutant. This reverse transcriptase mutant possesses one or more of the following mutations based on the Moroni murine leukemia virus (M-MLV) reverse transcriptase: E275K, E441K, E596K, and K658E. The reverse transcriptase mutant described in this invention exhibits significantly improved tolerance to high concentrations of potassium ions, but its thermal stability at high temperatures is not improved.

[0006] Chinese patent CN201710253825.8 discloses a method for preparing high-performance M-MLV reverse transcriptase. The method includes mutant cloning and construction, with the constructed mutant plasmid sequences confirmed by sequencing, yielding 17 mutant plasmids. Mutant screening is then performed: wild-type pET28b-M-MLV and the 17 mutant plasmids are transformed into competent *E. coli* cells, cultured, and mutant enzyme expression is induced. The bacterial cells are collected to obtain a crude mutant extract; the crude extracts showing protein expression are selected and screened for reverse transcription activity at different temperatures. Mutants showing positive activity screening results are cultured in a culture medium to induce protein expression, and the bacterial cells are collected and purified to obtain M-MLV reverse transcriptase. This invention combines molecular rational design with functional screening to obtain stable reverse transcriptases within a relatively small range. This patent involves 17 point mutations, and the preparation method is relatively complex.

[0007] Therefore, constructing a reverse transcriptase with high heat resistance and high reverse transcriptase activity is an urgent problem to be solved. Summary of the Invention

[0008] The purpose of this invention is to provide a highly heat-resistant reverse transcriptase, specifically a heat-resistant reverse transcriptase mutant and its preparation method. This mutant has high purity and is tolerant to high temperatures, thus solving the problem of high-temperature intolerance of wild-type MMLV reverse transcriptase.

[0009] To achieve the above-mentioned objectives, the technical solution of the present invention is as follows:

[0010] On one hand, the present invention provides a reverse transcriptase mutant, wherein the amino acid sequence of the reverse transcriptase mutant is mutated at one or more of the following positions: position 8, position 204, position 249, position 289, position 306, position 309, position 524, position 562, position 571, position 583, and position 664, compared with the amino acid sequence shown in SEQ ID NO:1.

[0011] Specifically, the mutation is the insertion, substitution, or deletion of one or more amino acids in the amino acid sequence.

[0012] Preferably, the reverse transcriptase mutant has 80% identity with SEQ ID NO:1.

[0013] More preferably, the reverse transcriptase mutant has 85% identity with SEQ ID NO:1.

[0014] More preferably, the reverse transcriptase mutant has 95% identity with SEQ ID NO:1.

[0015] Most preferably, the reverse transcriptase mutant has 98% identity with SEQ ID NO:1.

[0016] Preferably, the reverse transcriptase mutant is a wild-type M-MLV reverse transcriptase (SEQ ID NO: 1). NO.1) A series of site-directed mutations were performed, including: histidine at position 8 was mutated to tyrosine (H8Y), histidine at position 204 was mutated to arginine (H204R), asparagine at position 249 was mutated to aspartic acid (N249D), methionine at position 289 was mutated to leucine (M289L), threonine at position 306 was mutated to lysine (T306K), phenylalanine at position 309 was mutated to asparagine (F309N), aspartic acid at position 524 was mutated to glycine (D524G), glutamic acid at position 562 was mutated to glutamine (E562Q), lysine at position 571 was mutated to arginine (K571R), aspartic acid at position 583 was mutated to asparagine (D583N), and threonine at position 664 was mutated to asparagine (T664N).

[0017] Preferably, the amino acid sequence of the reverse transcriptase mutant is shown in SEQ ID NO:3.

[0018] In another aspect, the present invention provides a nucleic acid molecule that encodes the nucleotide sequence of the aforementioned reverse transcriptase mutant.

[0019] In another aspect, the present invention provides a nucleic acid molecule, the nucleotide sequence of which is shown in SEQ ID NO:4.

[0020] Preferably, one or more nucleotides are mutated from the nucleotide sequence described in SEQ ID NO:2 to form a synonymous mutation, thereby obtaining a nucleotide sequence that can encode the mutant amino acid sequence described in this invention.

[0021] Preferably, a nucleotide sequence capable of encoding the amino acid sequence of the reverse transcriptase mutant described in this invention is designed based on codon optimization.

[0022] In another aspect, the present invention provides a carrier comprising the above-mentioned nucleic acid molecule encoding the present invention.

[0023] Preferably, the vector further comprises an expression regulatory sequence operatively linked to the nucleic acid.

[0024] This invention does not impose any particular limitation on the expression vector for inserting the nucleic acid encoding the present invention, and it can be any expression vector commonly used in the art. Vectors capable of autonomous replication in host cells or vectors that can integrate into the host chromosome can be used. Host-compatible vectors can be used.

[0025] Preferably, the expression vector encoding the nucleic acid of the present invention includes plasmid vectors, phage vectors, viral vectors, etc. As a plasmid vector, a plasmid suitable for the host to be used is preferred, such as a plasmid derived from *Escherichia coli*, a plasmid derived from *Bacillus*, or a plasmid derived from yeast.

[0026] Preferably, the carrier is selected from one or more of pET28a, pEZZ18, pHT304, pMK3, pPIC9, pPIC9K, and pHIL-S1.

[0027] More preferably, the carrier is pET28a.

[0028] More preferably, the vector pET28a contains restriction enzyme sites NcoI and XhoI.

[0029] In another aspect, the present invention provides a host cell containing the aforementioned carrier.

[0030] Preferably, the host cell is selected from one or more of Escherichia coli, Pichia pastoris, and Bacillus subtilis.

[0031] More preferably, the host cell is Escherichia coli.

[0032] More preferably, the host cell is Escherichia coli BL21.

[0033] In another aspect, the present invention provides a method for preparing the above-mentioned reverse transcriptase mutant, comprising the following steps: recombinantly linking a DNA fragment containing the reverse transcriptase mutant gene sequence with a linearized vector, then introducing it into a host competent cell, and obtaining the reverse transcriptase mutant after induction, culture, collection, crude enzyme extraction, and protein purification, wherein the DNA fragment is shown in SEQ ID NO:5.

[0034] Preferably, the crude enzyme extraction includes the following steps:

[0035] (1) Cell suspension: Add an appropriate amount of RT enzyme lysis buffer (10 mL RT enzyme lysis buffer per 1 g of cells) to the collected bacterial cells and mix thoroughly to suspend the cells;

[0036] (2) Ultrasonic cell disruption: The suspended bacterial solution is ultrasonically disrupted in an ice-water mixture, with a maximum disruption of 100 mL at a time, at 300 W, for 3 seconds of operation followed by a 3-second interval, for a total of 60 minutes. The sample should be very clear to the naked eye after disruption.

[0037] (3) Collect the supernatant; centrifuge at 9000 rpm for 45 min at 4℃ to collect the supernatant.

[0038] (4) PEI precipitation: Weigh the supernatant, add 8% of the supernatant mass of 5% PEI solution at pH 8.0, mix well, incubate on ice for 10 min, then centrifuge at 9000 rpm for 45 min at 4℃ to collect the supernatant, and perform electrophoresis to test cell lysis and PEI effect.

[0039] Preferably, the RT enzyme lysis buffer in step (1) comprises: 20 Mm Tris-HCl (pH 7.3 25 °C), 1 Mm DTT, 1 Mm EDTA, 0.1% NP-40, 5% glycerol and 1 Mm PMSF.

[0040] Preferably, the purification of the reverse transcriptase mutant includes, but is not limited to, extraction, precipitation, hydrophobic chromatography, ion exchange chromatography, affinity chromatography, and electrophoresis.

[0041] Preferably, the shake-flask fermentation production of the reverse transcriptase mutant includes the following steps:

[0042] (1) Select Escherichia coli strains and inoculate them into LB liquid medium from 20% glycerol culture tubes for culture as the starting strain for shake flask fermentation;

[0043] (2) Shake flask fermentation culture, inoculated with TB medium, cultured until OD is 0.5-1.5, then IPTG is added for induction culture.

[0044] (3) Centrifuge and collect the bacterial cells.

[0045] Preferably, the culture temperature in step (1) is 35-37℃ and the culture time is 10-20h;

[0046] More preferably, the culture temperature in step (1) is 37°C and the culture time is 12h.

[0047] Preferably, the LB culture medium in step (1) comprises 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.

[0048] Preferably, the culture temperature in step (2) is 35-37℃ and the culture rotation speed is 200-250 rpm;

[0049] More preferably, the culture temperature in step (2) is 37°C and the culture rotation speed is 220 rpm.

[0050] Preferably, the concentration of IPTG in step (2) is 0.5-1 mM.

[0051] Preferably, in step (2), after adding IPTG, the culture temperature is 16℃-25℃, the culture speed is 200-250rpm, and the culture time is 10-20h;

[0052] More preferably, in step (2), after adding IPTG, the rotation speed is 220 rpm and the incubation time is 16 h.

[0053] Preferably, the TB culture medium in step (2) includes 24 g / L yeast extract, 12 g / L peptone, 4 mL / L glycerol, 17 mM potassium dihydrogen phosphate, and 72 mM dipotassium hydrogen phosphate, wherein the dipotassium hydrogen phosphate and potassium dihydrogen phosphate are sterilized separately.

[0054] Preferably, the centrifugation speed in step (3) is 8000-12000 rpm, the centrifugation time is 10-20 min, and the centrifugation temperature is 4℃;

[0055] More preferably, the centrifugation speed in step (3) is 9000 rpm and the centrifugation time is 15 min.

[0056] Preferably, in step (3), the bacterial cells are collected and stored at -80°C.

[0057] In another aspect, the present invention provides a kit comprising the above-mentioned reverse transcriptase mutant, or the above-mentioned nucleic acid molecule, or the above-mentioned vector, or the above-mentioned host cell, or the reverse transcriptase mutant prepared by the above-mentioned preparation method.

[0058] Preferably, the kit further includes one or more of the following: reverse transcription reaction buffer, RNA template, dNTPs, reverse transcription primers, DTT, and RNase inhibitors.

[0059] In another aspect, the present invention provides the application of the above-mentioned reverse transcriptase mutant, or the above-mentioned nucleic acid molecule, or the above-mentioned vector, or the above-mentioned host cell, or the reverse transcriptase mutant prepared by the above-mentioned preparation method, or the above-mentioned kit in reverse transcription reactions.

[0060] Preferably, the reverse transcription reaction system includes one or more of the following: reverse transcription reaction buffer, RNA template, dNTPs, reverse transcription primers, DTT, and RNase inhibitors.

[0061] The beneficial effects of this invention are as follows:

[0062] This invention provides a heat-resistant reverse transcriptase mutant and its preparation method, which can achieve a purity of over 98%. It also solves the problem of high temperature intolerance of wild-type MMLV reverse transcriptase, achieving tolerance to reverse transcription temperatures of 50℃ or even 55℃ while retaining more than 50% of reverse transcriptase activity. This enables one-step RT-PCR, expanding the application efficiency and prospects of reverse transcriptase. Attached Figure Description

[0063] Figure 1 This is a diagram showing the nucleic acid gel electrophoresis results of Example 1;

[0064] In the figure, M is the marker, and 1 and 2 are electrophoresis results after double digestion of plasmid pET28a.

[0065] Figure 2(a) shows the SDS-PAGE results of the embodiment;

[0066] In Figure 2(a), the lanes from left to right are: Marker; MMLV standard; sample before induction; induction conditions 1: temperature 15℃, induced OD600 0.5, IPTG dosage 0.5mM; induction conditions 2: temperature 15℃, induced OD600 1.0, IPTG dosage 0.5mM; induction conditions 3: temperature 15℃, induced OD600 1.5, IPTG dosage 0.5mM; induction conditions 4: temperature 15℃, induced OD600 0.5, IPTG dosage 1.0mM; induction conditions 5: temperature 15℃, induced OD600 1.0, IPTG dosage 1.0mM; induction conditions 6: temperature 15℃, induced OD600 1.5, IPTG dosage 1.0mM; The induction conditions for sample 7 were: temperature 25℃, induced OD600 of 0.5, and IPTG addition of 0.5mM; for sample 8, the induction conditions were: temperature 25℃, induced OD600 of 1.0, and IPTG addition of 0.5mM; for sample 9, the induction conditions were: temperature 25℃, induced OD600 of 1.5, and IPTG addition of 0.5mM; for sample 10, the induction conditions were: temperature 25℃, induced OD600 of 0.5, and IPTG addition of 1.0mM; for sample 11, the induction conditions were: temperature 25℃, induced OD600 of 1.0, and IPTG addition of 1.0mM; for sample 12, the induction conditions were: temperature 25℃, induced OD600 of 1.5, and IPTG addition of 1.0mM.

[0067] Figure 2(b) shows the SDS-PAGE results of Comparative Example 1;

[0068] In Figure 2(b), the lanes from left to right are: Marker; MMLV standard; sample before induction; induction conditions 1: temperature 15℃, induced OD600 0.5, IPTG dosage 0.5mM; induction conditions 2: temperature 15℃, induced OD600 1.0, IPTG dosage 0.5mM; induction conditions 3: temperature 15℃, induced OD600 1.5, IPTG dosage 0.5mM; induction conditions 4: temperature 15℃, induced OD600 0.5, IPTG dosage 1.0mM; induction conditions 5: temperature 15℃, induced OD600 1.0, IPTG dosage 1.0mM; induction conditions 6: temperature 15℃, induced OD600 1.5, IPTG dosage 1.0mM; The induction conditions for sample 7 were: temperature 25℃, induced OD600 of 0.5, and IPTG addition of 0.5mM; for sample 8, the induction conditions were: temperature 25℃, induced OD600 of 1.0, and IPTG addition of 0.5mM; for sample 9, the induction conditions were: temperature 25℃, induced OD600 of 1.5, and IPTG addition of 0.5mM; for sample 10, the induction conditions were: temperature 25℃, induced OD600 of 0.5, and IPTG addition of 1.0mM; for sample 11, the induction conditions were: temperature 25℃, induced OD600 of 1.0, and IPTG addition of 1.0mM; for sample 12, the induction conditions were: temperature 25℃, induced OD600 of 1.5, and IPTG addition of 1.0mM.

[0069] Figure 3(a) shows the SDS-PAGE results of the example;

[0070] In Figure 3(a), the lanes from left to right are: Marker; sample before induction; sample after induction; MMLV standard; supernatant after sonication; precipitate after sonication; supernatant after PEI treatment; precipitate after PEI treatment.

[0071] Figure 3(b) shows the SDS-PAGE results of Comparative Example 1;

[0072] In Figure 3(b), the lanes from left to right are: Marker; MMLV standard; supernatant after sonication; precipitate after sonication; supernatant after PEI treatment; precipitate after PEI treatment.

[0073] Figure 4(a) shows the SDS-PAGE results of the example after purification by SP column;

[0074] In Figure 4(a), the lanes from left to right are: Marker (3450 6ul); crude enzyme solution 8ul; PEI precipitate reconstitution solution 8ul; SP column flow-through solution 16ul; 4% elution buffer elution collection 1 (8ul); 4% elution buffer elution collection 2 (8ul); 4% elution buffer elution collection 3 (8ul); 4% elution buffer elution collection 4 (8ul); 10% elution buffer elution collection 1 (8ul); 10% elution buffer elution collection 2 (8ul); 10% elution buffer elution collection 3 (8ul); 10% elution buffer elution collection 4 (8ul); 10% elution buffer elution collection 5 (8ul); 15% elution buffer elution collection 1 (8ul); 15% elution buffer elution collection 2 (8ul).

[0075] Figure 4(b) shows the SDS-PAGE results of the example after purification by SP column;

[0076] In Figure 4(b), the lanes from left to right are: 15% elution buffer elution collection 3 (8 μL); Marker (3450 6 μL); 15% elution buffer elution collection 4 (8 μL); 15% elution buffer elution collection 5 (8 μL); 15% elution buffer elution collection 6 (8 μL); 15% elution buffer elution collection 7 (8 μL); 15% elution buffer elution collection 8 ... Elution collection solution 9 (8ul); 15% elution solution elution collection solution 10 (8ul); 15% elution solution elution collection solution 11 (8ul); 15% elution solution elution collection solution 12 (8ul); 15% elution solution elution collection solution 13 (8ul); 15% Buffer B elution collection solution 14 (8ul); 15% elution solution elution collection solution 15 (8ul); 65% elution solution elution collection solution 1 (8ul).

[0077] Figure 5(a) shows the SDS-PAGE results of Comparative Example 1 after purification by SP column;

[0078] In Figure 5(a), the lanes from left to right are: Marker (3450 6ul); crude enzyme solution (8ul); SP column flow-through solution 16ul; 4% elution solution elution collection 1 (8ul); 4% elution solution elution collection 2 (8ul); 4% elution solution elution collection 3 (8ul); 10% elution solution elution collection 1 (8ul); 10% elution solution elution collection 2 (8ul); 10% elution solution elution collection 3 (8ul); 15% elution solution elution collection 1 (8ul); 15% elution solution elution collection 2 (8ul); 15% elution solution elution collection 3 (8ul); 15% elution solution elution collection 4 (8ul); 15% elution solution elution collection 5 (8ul); 15% elution solution elution collection 6 (8ul).

[0079] Figure 5(b) shows the SDS-PAGE results of Comparative Example 1 after purification by SP column;

[0080] In Figure 5(b), the lanes from left to right are: 15% elution eluent 7 (8 μL); 15% elution eluent 8 (8 μL); 15% elution eluent 9 (8 μL); 15% elution eluent 10 (8 μL); 65% elution eluent 1 (8 μL); 65% elution eluent 2 (8 μL); 65% elution eluent 3 (8 μL); 65% elution eluent 4 (8 μL); and Marker (3450 6 μL).

[0081] Figure 6(a) shows the SDS-PAGE results of the example after purification by Q-FF+HeparinFF column;

[0082] In Figure 6(a), the lanes from left to right are: Marker (3450 6ul); SP column collection solution (8ul after dialysis); Q-FF + Heparin FF column flow-through 16ul; Heparin FF column 10% elution solution collection 1 (8ul); Heparin FF column 10% elution solution collection 2 (8ul); Heparin FF column 10% elution solution collection 3 (8ul); Heparin FF column 15% elution solution collection 1 (8ul); Heparin FF column 15% elution solution collection 2 (8ul); Heparin Elution collection 2 (8 μL) of 15% elution buffer for FF column; Elution collection 4 (8 μL) of 15% elution buffer for Heparin FF column; Elution collection 5 (8 μL) of 15% elution buffer for Heparin FF column; Elution collection 1 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 2 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 3 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 4 (8 μL) of 20% elution buffer for Heparin FF column.

[0083] Figure 6(b) shows the SDS-PAGE results of the example after purification by Q-FF+HeparinFF column;

[0084] In Figure 6(b), the lanes from left to right are Marker (3450) 6ul); Heparin FF column 20% eluent elution collection 5 (8ul); Heparin FF column 20% eluent elution collection 6 (8ul); Heparin FF column 20% eluent elution collection 7 (8ul); Heparin FF column 20% eluent elution collection 8 (8ul); Heparin FF column 20% eluent elution collection 8 (8ul); Heparin FF column 20% eluent elution collection 10 (8ul); Heparin FF column 20% eluent elution collection 11 (8ul); Heparin FF column 65% eluent elution collection 1 (8ul); Heparin FF column 65% eluent elution collection 2 (8ul); Q-FF column 65% eluent elution collection 1 (8ul); Q-FF column 65% eluent elution collection 2 (8ul).

[0085] Figure 7(a) shows the SDS-PAGE results of Comparative Example 1 purified by Q-FF+HeparinFF column;

[0086] In Figure 7(a), the lanes from left to right are: Marker (3450 6ul); SP column collection solution (8ul after dialysis); Q-FF + Heparin FF column flow-through 16ul; Heparin FF column 10% elution solution collection solution (8ul); Heparin FF column 15% elution solution collection solution 1 (8ul); Heparin FF column 15% elution solution collection solution 2 (8ul); Heparin FF column 15% elution solution collection solution 3 (8ul); Heparin FF column 15% elution solution collection solution 4 (8ul); Heparin Elution collection 5 (8 μL) of 15% elution buffer for FF column; Elution collection 6 (8 μL) of 15% elution buffer for Heparin FF column; Elution collection 1 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 2 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 3 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 4 (8 μL) of 20% elution buffer for Heparin FF column; Elution collection 5 (8 μL) of 20% elution buffer for Heparin FF column.

[0087] Figure 7(b) shows the SDS-PAGE results of Comparative Example 1 purified by Q-FF+HeparinFF column;

[0088] In Figure 7(b), the lanes from left to right are: Heparin FF column 20% elution buffer elution collection 6 (8ul); Heparin FF column 20% elution buffer elution collection 7 (8ul); Heparin FF column 20% elution buffer elution collection 8 (8ul); Heparin FF column 65% elution buffer elution collection 1 (8ul); Q-FF column 65% elution buffer elution collection (8ul); Marker (3450 6ul).

[0089] Figure 8(a) shows the SDS-PAGE purity results of the example;

[0090] In Figure (a), lane 1: Marker 5ul; lane 2: The thermostable reverse transcriptase mutant prepared in Example 4 15ul; lane 3: 15ul of sample from lane 2 after 20-fold dilution; lane 4: 15ul of sample from lane 2 after 50-fold dilution.

[0091] Figure 8(b) shows the SDS-PAGE purity results of Comparative Example 1;

[0092] In Figure (b), lane 1: Marker 5ul; lane 2: The thermostable reverse transcriptase mutant prepared in Example 4 (comparative example) 15ul; lane 3: 15ul of sample from lane 2 after 20-fold dilution; lane 4: 15ul of sample from lane 2 after 50-fold dilution.

[0093] Figure 9 The image shows the enzyme activity detection results of the reverse transcriptase mutant in Example 5.

[0094] Figures 10(a) and 10(b) show the results of the thermostability test of the reverse transcriptase mutant in Example 6.

[0095] Figure 11(ae) ​​shows the one-step RT-PCR performance test results of the reverse transcriptase mutant in Example 7;

[0096] In Figure 11(a), the dark green amplification curve represents the Thermo Fisher Scientific SuperScript enzyme. TM III. PCR amplification diagram after reverse transcription at 50℃; the red amplification curve is the PCR amplification diagram of the thermoresistant reverse transcriptase mutant (RT-B2) after reverse transcription at 50℃.

[0097] In Figure 11(b), the light green amplification curve represents the Thermo Fisher Scientific SuperScript enzyme. TM III. PCR amplification diagram after reverse transcription at 55℃; the blue amplification curve is the PCR amplification diagram of the thermoresistant reverse transcriptase mutant (RT-B2) after reverse transcription at 55℃.

[0098] In Figure 11(c), the light blue amplification curve represents the Thermo Fisher Scientific SuperScript enzyme.TM III. PCR amplification diagram after reverse transcription at 60℃; the purple amplification curve is the PCR amplification diagram of the thermostable reverse transcriptase mutant (RT-B2) after reverse transcription at 60℃.

[0099] In Figure 11(d), the yellow amplification curve is the PCR amplification diagram of the reverse transcriptase after reverse transcription at 50℃ in Comparative Example 1; the red amplification curve is the PCR amplification diagram of the thermostable reverse transcriptase mutant (RT-B2) after reverse transcription at 50℃.

[0100] In Figure 11(e), the brown amplification curve is the PCR amplification diagram of the reverse transcriptase after reverse transcription at 60℃ in Comparative Example 1; the purple amplification curve is the PCR amplification diagram of the thermostable reverse transcriptase mutant (RT-B2) after reverse transcription at 60℃. Detailed Implementation

[0101] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. Unless otherwise specified, the operating methods and equipment used in the following embodiments are conventional operating methods, and the materials and equipment used in each embodiment are the same.

[0102] Example 1

[0103] Construction of strains containing thermostable reverse transcriptase mutant genes: This Example 1 provides a method for constructing recombinant plasmids and recombinant strains.

[0104] The recombinant plasmid was constructed by using homologous recombination, which involved chemically transforming a DNA fragment containing the reverse transcriptase mutant gene sequence into a linearized pET28a vector to obtain the recombinant plasmid.

[0105] 1. The specific steps for constructing recombinant plasmids are as follows:

[0106] 1.1 Preparation of DNA fragments of reverse transcriptase mutant gene sequences

[0107] When preparing the fragment, homologous regions of the linear vector should be added to both ends of the target gene (SEQ ID NO:4). That is, add "ACTTTAAGAAGGAGATATACCATGG" to the 5' end and "GCGGCCGCACTCGAGCACCACCACC" to the 3' end.

[0108] 1.2 Preparation of linear carriers

[0109] The preparation of linear carriers includes the following steps:

[0110] (1) The strain carrying the pET28a empty plasmid was cultured in a shaker for 12 hours at a temperature of 37°C.

[0111] (2) Use a plasmid extraction kit to extract and recover plasmids. For detailed operating procedures, please refer to the instruction manual of Plasmid Mini KitⅠ(200) manufactured by OMEGA (Guangzhou) Co., Ltd. (catalog number D6943-02).

[0112] (3) A double digestion method was used, i.e., the digestion system was incubated in a water bath at 37°C for 30 minutes. The digestion system consisted of 2000 ng of recombinant plasmid, 1 μL of each of the two restriction endonucleases, 5 μL of 10×Q.cut Buffer, and ddH2O to a final volume of 50 μL. Restriction endonucleases NcoI and XcoI were used to digest the pET28a plasmid.

[0113] (4) Plasmid linearization was determined by agarose gel electrophoresis results. The electrophoresis results are as follows: Figure 1 As shown.

[0114] (5) Finally, the rubber is cut and recycled. The method for rubber cutting and recycling is as follows:

[0115] ①The bands were separated by macroporous agarose gel electrophoresis. The target bands were obtained under UV light in a gel imaging system, placed in EP tubes and weighed.

[0116] ② Add 300μL of Binding Buffer solution to each 0.3g agar block (in actual operation, the solution should just cover the agar block). Place the EP tube with the added solution in a 55℃ water bath to melt the agar block.

[0117] ③ Load the melted solution onto the column, centrifuge at 12000 rpm for 2 min, and discard the centrifuged liquid (this process can be repeated multiple times as needed).

[0118] ④ Add 700 μL of DNA Wash Buffer solution to the column, centrifuge at 12000 rpm for 1 min, discard the centrifuged liquid, and repeat the operation.

[0119] ⑤ Centrifuge the column at 12000 rpm for 2 min to remove residual washing liquid from the filter membrane.

[0120] ⑥ Place the column in a 1.5 mL EP tube, open the cap and place it in a 37℃ oven to dry for 5-10 min. After drying, add 20-30 μL of Elution Buffer or ddH2O in a 65℃ water bath, let stand for 10 min, centrifuge at 12000 rpm for 2 min, discard the column, measure and record the concentration using a nucleic acid analyzer, and store at -20℃ for later use.

[0121] 1.3 Recombinant ligation of DNA fragments containing reverse transcriptase mutant gene sequences with linearized vectors

[0122] use The II One Step Cloning Kit series (purchased from Novizan, catalog number C112-01) uses recombinase to ligate the target sequence to the linearized pET28a vector. The DNA fragment is as described in 1.1, and the linearized pGRB vector is as described in 1.2. The reaction system consists of 4 μL of 5×CE II Buffer, 50 ng of linearized cloning vector, and 20 ng of DNA fragment. II. Add 2 μL of ddH2O to a final volume of 20 μL. Incubate at 37°C for 30 minutes. Transform the recombinant pET28a into E. coli DH5α competent cells. Screen and culture positive transformants, then extract and recover the plasmid using a plasmid extraction kit.

[0123] The conversion method is as follows:

[0124] (1) Add 1 μL of the recombinant system to the transcompetent cells, mix by repeatedly pipetting, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 1 min, and immediately incubate on ice for 5 min after removal.

[0125] (2) After the plasmid was placed on ice, the transcompetent cells were added to 900 μL of SOC buffer and cultured at 37°C for 1 h.

[0126] (3) Spread 100-150 μL of resuscitation solution onto a plate containing the corresponding resistance and incubate at 37°C for 24 h.

[0127] (4) After the single colony matures, select a single colony for colony PCR screening to identify positive transformants.

[0128] (5) The obtained positive transformants were inoculated into 5 mL LB shaker tubes for culture, and the bacterial culture was preserved and plasmids were extracted.

[0129] 2. Construction of recombinant strains

[0130] The recombinant plasmid was transformed into E. coli BL21 competent cells. The transformation method is as follows:

[0131] (1) Add 100 ng of recombinant plasmid to the transcompetent cells, mix them repeatedly by pipetting, incubate on ice for 30 min, then heat shock them in a 42℃ water bath for 1 min, and immediately incubate on ice for 5 min after removing them.

[0132] (2) After the plasmid was placed on ice, the transcompetent cells were added to 900 μL of SOC buffer and cultured at 37°C for 1 h.

[0133] (3) Spread 100-150 μL of resuscitation solution onto a plate containing the corresponding resistance and incubate at 37°C for 24 h.

[0134] (4) After the single colony matures, pick a single colony for colony PCR screening to select positive transformants and preserve the bacteria.

[0135] Comparative Example 1

[0136] The strain containing the reverse transcriptase mutant gene was constructed using the same method as in Example 1, and the mutant gene sequence is shown in SEQ ID NO:7.

[0137] Example 2

[0138] The recombinant strains containing reverse transcriptase mutants prepared in Example 1 and Comparative Example 1 were used to conduct a shake-tube fermentation verification experiment.

[0139] The specific steps are as follows:

[0140] (1) The recombinant strain was transferred from a 20% glycerol incubator at -80℃ to an LB shaker for culture. The culture conditions were 37℃, 220 rpm, and overnight culture, which served as the starting strain for fermentation.

[0141] (2) Transfer the overnight culture to 10 mL LB medium (containing 50 μg / mL kanamycin at a working concentration) at a ratio of 1:50 and incubate at 37°C and 220 rpm until the corresponding OD is reached. Add the appropriate amount of IPTG (take 1000 μL for electrophoresis detection).

[0142] (3) The induced OD and IPTG induced concentrations of each shaker are shown in Table 1.

[0143] Table 1.

[0144]

[0145] Incubate for 16 hours according to the requirements in Table 1 (take 1000 μL for electrophoresis detection).

[0146] Experimental results:

[0147] Figure 2(a) shows the results of the mutant in Example 1. Expression was observed under all conditions. The best expression was achieved with an induction temperature of 15℃, an IPTG addition of 0.5 mM, and an OD of 0.5 before induction. The optimal induction conditions were an induction temperature of 25℃, an induction OD of 0.5, and an IPTG addition of 1 mM. Figure 2(b) shows the results of the mutant in Comparative Example 1. Expression was observed under all conditions. The optimal induction conditions were an induction temperature of 25℃, an induction OD of 1, and an IPTG addition of 1 mM.

[0148] Example 3: Crude enzyme extraction process of reverse transcriptase mutant

[0149] Weigh 10g of the collected bacterial cells for crude enzyme extraction.

[0150] The specific steps are as follows:

[0151] (1) Cell suspension

[0152] Add 100 mL of RT enzyme lysis buffer (10 mL of RT enzyme lysis buffer per 1 g of cells) to the collected bacterial cells and mix thoroughly to suspend the cells.

[0153] (2) Ultrasonic cell disruption

[0154] The suspended bacterial culture was ultrasonically disrupted in an ice-water mixture, with a maximum of 100 mL disrupted at a time, at 300 W, for 3 seconds followed by a 3-second interval, for a total of 60 minutes. The disrupted sample should be very clear to the naked eye.

[0155] (3) Collection of supernatant: Centrifuge at 9000 rpm, 45 min, and 4℃ to collect the supernatant.

[0156] (4) PEI precipitation

[0157] Add 8% of the bacterial culture mass of 5% PEI solution at pH 8.0, mix well, incubate on ice for 10 min, then centrifuge at 9000 rpm for 45 min at 4℃ to collect the supernatant, and perform electrophoresis to test cell lysis and PEI effect.

[0158] (5) SDS-PAGE electrophoresis

[0159] Figure 3(a) shows the electrophoresis results of Example 1, and Figure 3(b) shows the electrophoresis results of Comparative Example 1.

[0160] Example 4: Protein purification of reverse transcriptase mutants

[0161] In the following steps, the SP column equilibration solution was: 20 mM Tris-HCl (pH 7.3), 0.1 mM EDTA, 0.01% NP-40, 20 mM NaCl, 1 mM DTT, and 10% glycerol.

[0162] SP column eluent: 20 mM Tris-HCl (pH 7.3), 0.1 mM EDTA, 0.01% NP-40, 2 M NaCl, 1 mM M DTT, 10% glycerol.

[0163] Q-FF+HeparinFF column equilibration solution: 20mM Tris-HCl (pH 7.3), 0.1mM EDTA, 0.01% NP-40, 20mM NaCl, 1mM DTT, 10% glycerol.

[0164] Q-FF+Heparin FF column eluent: 20mM Tris-HCl (pH 7.3), 0.1mM EDTA, 0.01% NP-40, 2M NaCl, 1mM DTT, 10% glycerol.

[0165] Protein purification from crude enzyme solution includes the following steps:

[0166] (1) After connecting the protein purification instrument to the cation exchange resin SP column, use SP column equilibration buffer to equilibrate for 3-5 Cv. At the same time, filter the crude enzyme solution through a 0.45 μm ultrafiltration membrane before loading the sample.

[0167] (2) After ultrafiltration, the sample was diluted 3 times with SP column equilibration solution and after SP column equilibration was completed, it was purified by cation exchange resin SP column.

[0168] (3) After loading the sample, equilibrate 1-2 Cvs with SP column equilibration buffer, and perform gradient elution with SP column elution buffer at 4%, 10%, 15%, and 65%, and collect the elution peaks. Take 20 μL of each elution peak and detect it by SDS-PAGE protein electrophoresis. Figures 4(a) and 4(b) show the results of SP column purification of the example, and Figures 5(a) and 5(b) show the results of SP column purification of Comparative Example 1.

[0169] (4) Based on the electrophoresis results, merge the target band (15% elution peak), dialyze with SP equilibration buffer to a final NaCl concentration of 50mM-100mM, dilute with Q-FF+HeparinFF column equilibration buffer by 1 time, and then load Q-FF+HeparinFF.

[0170] (5) After loading the sample, equilibrate 1-3 Cv using Q-FF+Heparin FF column equilibration buffer, and perform gradient elution using Q-FF+Heparin FF column elution buffer at 10%, 15%, 20%, and 65%. Take 20 μL of each elution peak and detect it by SDS-PAGE protein electrophoresis. Figures 6(a) and 6(b) show the results of purification of the example using Q-FF+Heparin FF column, and Figures 7(a) and 7(b) show the results of purification of Comparative Example 1 using Q-FF+Heparin FF column.

[0171] More specific operating methods are as follows:

[0172] Use the Q-FF column and Heparin FF column in series. Equilibrate the Q-FF+Heparin FF column in series with Q-FF+Heparin FF column equilibration buffer for 1-3 Cv before loading the sample.

[0173] After loading the sample, equilibrate 3 Cv using Q-FF+Heparin FF column equilibration buffer to ensure that the target band in the crude enzyme solution flows through and adheres to the Heparin FF column as much as possible.

[0174] After equilibrating for 3 column volumes, remove the Q-FF column, leaving the Hparin FF column. Equilibrate for another column volume and then perform gradient elution with Q-FF + Heparin FF column elution buffer at 10%, 15%, 20%, and 65%. After elution with the Hparin FF column, remove it and reconnect the Q-FF column. Elute any remaining proteins directly with Q-FF + Heparin FF column elution buffer at 65%.

[0175] (6) Based on the electrophoresis results, the target bands were merged and concentrated by dialysis using 1X RT enzyme storage solution (20mM Tris-HCl (pH 7.5), 200mM NaCl, 1mM DTT, 0.1mM EDTA, 0.01% NP-40, 50% glycerol). The purity was then detected by SDS-PAGE electrophoresis. The purity was over 98%. Figure 8(a) shows the purity electrophoresis results of the example, and Figure 8(b) shows the purity electrophoresis results of Comparative Example 1.

[0176] Example 5: Activity detection of reverse transcriptase mutants

[0177] The thermostable reverse transcriptase mutant prepared in Example 4 (hereinafter referred to as RT-B2) and the thermostable reverse transcriptase mutant prepared in the comparative example (hereinafter referred to as Comparative Example 1) were subjected to activity testing according to the following activity detection methods:

[0178] With SuperScript TM Ⅲ (hereinafter abbreviated as SSⅢ, purchased from Thermo Fisher, product number 18080044, specification 200U / ul, 10000U) was used as a reference for activity testing;

[0179] Using single-stranded RNA:MS2 (manufacturer Roche, purchased from Sigma, catalog number 10165948001) as a template, its sequence is shown in SEQ ID NO:6.

[0180] The specific method for detecting the activity of reverse transcriptase mutants is as follows:

[0181] (1) Dilute 5×RT activity buffer to 1×RT activity buffer (specifically, add 200μL 5×RT activity buffer and 800μL water), vortex to mix, and centrifuge for later use (operate on ice).

[0182] The 5×RT liveness buffer is shown in the table below:

[0183] Table 2.

[0184] Components Mother liquor concentration Added amount Final concentration Tris-HCl (pH 8.3) 25℃ 1M 12.5ml 250mM KCl 3M 6.25ml 375mM CA630 10% (w / w) 5ml 1% Trehalose Trehalose (dry powder) 2.5g 0.05g / ml BSA 40mg / ml 0.625ml 0.5mg / ml TCEP (pH 8.0) 25℃ 0.5M 0.1ml 1mM glycerin 100% 12.5ml 25% water Process water Adjust the volume to 50ml /

[0185] (2) Take 10ul of SSⅢ commercial enzyme (standard 200U / ul) and dilute it to 20U / ul with 1X RT enzyme storage solution (specifically, take 10ul of SSⅢ and add 90ul of 1×RT storage solution, for a total of 100ul, and dispense it into 3 tubes (30ul / 30ul / 40ul respectively).

[0186] (3) Perform serial dilutions of the SSⅢ commercial enzyme (20 U / μL) to 1 U / μL, 0.8 U / μL, 0.6 U / μL, 0.4 U / μL, 0.2 U / μL, 0.1 U / μL, and 0 U / μL (the dilution process should be completed within 10 minutes and performed on ice). See the table below for details:

[0187] Table 3.

[0188] SSⅢ enzyme dilution SSⅢ sample volume (ul) 1X Viability Buffer (ul) 1U / ul 5ul 20U / ul SSⅢ 95 0.8U / ul 10ul 1U / ul 2.5 0.6U / ul 10ul 1U / ul 6.66 0.4U / ul 10ul 1U / ul 15 0.2U / ul 10ul 1U / ul 40 0.1U / ul 10ul 1U / ul 90 0U / ul 0 30

[0189] (4) Dilution of the test sample: The RT-B2 (20221012) prepared in Example 4 was diluted by 1000X / 2000X / 4000X, as shown in Table 4 below.

[0190] Table 4.

[0191] RT-B2 dilution factor Sample volume / μL 1X RT liveness detection buffer volume / μL 100X 2ul RT-B2 198 1000X 10ul (100X) 90 2000X 10ul (1000X) 10 4000X 10ul (1000X) 30

[0192] Comparative Example 1 (20220923) was diluted by 1000X / 2000X / 4000X, as shown in Table 5 below.

[0193] Table 5.

[0194] Compare column 1 dilution factor Sample volume / μL 1X RT liveness detection buffer volume / μL 100X 2ul comparison column 1 198 1000X 10ul (100X) 90 2000X 10ul (1000X) 10 4000X 10ul (1000X) 30

[0195] (5) Preparation of RT activity reaction Mix: Add each component to a 1.5ml centrifuge tube in the order shown in the table below, vortex to mix, and centrifuge for later use (operate on ice).

[0196] Table 6.

[0197] name Amount added / reaction 60T 5X RT liveness detection buffer 5μL 300 <![CDATA[25mM MgCl2]]> 1μL 60 100mM dNTPs 0.2μL 12 100mM MS2-B 0.1μL 6 0.8 mg / ml MS2 RNA 0.3μL 18 RNase inhibitor (40 U / μL) 0.2μL 12 0.5mMSYTO 0.2μL 12 50XROX 0.25ul 15 water 15.75μL 945

[0198] Insert the eight-well pack into the ice box, add 23 μL of RT activity assay MIX to each well, and then add 2 μL of the corresponding diluent and the sample to be tested (reaction volume 25 μL). Shake the mixture thoroughly, centrifuge, and immediately run it on the instrument.

[0199] (6) Test on the machine. Set the reaction program at 7500. Put the above mixture into 7500 and set the program according to the table below.

[0200] Table 7.

[0201]

[0202]

[0203] Table 8.

[0204]

[0205] A standard curve was generated using different amounts of SSⅢ enzyme and the net increase in signal intensity. The activity of the enzyme to be tested could be determined by substituting the net increase in the signal intensity into the curve. See the attached table for specific results. Figure 9 The results showed that the activity unit of the heat-resistant reverse transcriptase mutant RT-B2 of the present invention was 1236.4 U / μl, and the activity unit of Comparative Example 1 was 903.2 U / μl.

[0206] Example 6: Thermal stability test of reverse transcriptase mutants

[0207] The thermostable reverse transcriptase mutant prepared in Example 4 (hereinafter referred to as RT-B2) and Comparative Example 1 were used to conduct thermostability tests on RT-B2, Comparative Example 1 and wild-type MMLV according to the activity measured in Example 5: 1236.4 U / ul (RT-B2) and 903.2 U / ul (Comparative Example 1).

[0208] With SuperScript TM Ⅲ (hereinafter abbreviated as SSⅢ, purchased from Thermo Fisher, part number 18080044, specifications 200U / ul, 10000U) was used as a reference for thermal stability testing;

[0209] Using single-stranded RNA:MS2 (manufacturer Roche, purchased from Sigma, catalog number 10165948001) as a template, its sequence is shown in SEQ ID NO:6.

[0210] The thermal stability testing steps are as follows:

[0211] (1) Dilute RT-B2 to 200 U / ul with 1X RT enzyme storage solution, vortex to mix, and centrifuge for later use (operate on ice). Dilute Comparative Example 1 to 200 U / ul with 1X RT enzyme storage solution, vortex to mix, and centrifuge for later use (operate on ice).

[0212] (2) Dilute 5×RT activity test buffer to 1×RT activity test buffer (specifically, add 200μL of 5×RT activity test buffer and 800μL of water), vortex to mix, and centrifuge for later use (operate on ice).

[0213] (3) Take 10ul of SSⅢ commercial enzyme (standard 200U / ul) and release it to 20U / ul with 1×RT activity assay buffer (specifically, take 10ul of SSⅢ and add 90ul of 1×RT storage solution), vortex to mix, centrifuge and dispense 25ul / tube for later use (operate on ice).

[0214] (4) Take 10 μL of RT-B2 (200 U / μL) and dilute it to 20 U / μL with 1×RT activity buffer (specifically, take 10 μL of RT-B2 and add 90 μL of 1×RT storage solution), vortex to mix, centrifuge and aliquot 25 μL / tube for later use (operate on ice). Take 10 μL of Comparative Example 1 (200 U / μL) and dilute it to 20 U / μL with 1×RT activity buffer (specifically, take 10 μL of Comparative Example 1 and add 90 μL of 1×RT storage solution), vortex to mix, centrifuge and aliquot 25 μL / tube for later use (operate on ice); Take 10 μL of wild-type MMLV (200 U / μL) and dilute it to 20 U / μL with 1×RT activity buffer (specifically, take 10 μL of wild-type MMLV and add 90 μL of 1×RT storage solution), vortex to mix, centrifuge and aliquot 25 μL / tube for later use (operate on ice).

[0215] (5) Take the SSⅢ commercial enzyme (25ul / tube) prepared in step (3), the self-made mutant RT-B2-20221010 (25ul / tube), the self-made mutant RT-B2-20221012 (25ul / tube), the self-made comparative example 1 (20220923) (25ul / tube), and the wild-type MMLV (25ul / tube) and heat them on an ABI 7500 at 50℃ for 10min. After heating, immediately take them out and place them in an ice bath, and label them as heated.

[0216] (6) Dilution of the test samples: The samples SSⅢ, RT-B2, Comparative Example 1 and wild-type MMLV prepared in steps (3) and (4) before heating were diluted by 10X / 20X respectively according to the following gradients;

[0217] Table 9.

[0218] Table 10.

[0219]

[0220] Table 11.

[0221] Table 12.

[0222]

[0223] (7) Dilution of the test samples: The heated samples SSⅢ, RT-B2, Comparative Example 1 and wild-type MMLV prepared in step (5) were diluted 5X / 10X respectively according to the following gradients;

[0224] Table 13.

[0225]

[0226] Table 14.

[0227]

[0228] Table 15.

[0229]

[0230] Table 16.

[0231]

[0232] (8) Standard curve dilution: The SSⅢ commercial enzyme (prepared in Example 5.3, 20 U / μL) was serially diluted to 1 U / μL, 0.8 U / μL, 0.6 U / μL, 0.4 U / μL, 0.2 U / μL, 0.1 U / μL, and 0 U / μL (the dilution process should be completed within 10 minutes and performed on ice). See the table below for details.

[0233] Table 17.

[0234] SSⅢ enzyme dilution SSⅢ sample volume (ul) 1X Viability Buffer (ul) 1U / ul 5ul 20U / ul SSⅢ 95 0.8U / ul 10ul 1U / ul 2.5 0.6U / ul 10ul 1U / ul 6.66 0.4U / ul 10ul 1U / ul 15 0.2U / ul 10ul 1U / ul 40 0.1U / ul 10ul 1U / ul 90 0U / ul 0 30

[0235] (9) Preparation of RT activity reaction mixture: Add each component to a 1.5ml centrifuge tube in the following order, vortex to mix, and centrifuge for later use (operate on ice).

[0236] Table 18.

[0237] name Amount added / reaction 60T 5X RT liveness detection buffer 5μL 300 <![CDATA[25mM MgCL2]]> 1μL 60 100mM dNTPs 0.2μL 12 100mM MS2-B 0.1μL 6 0.8 mg / ml MS2 RNA 0.3μL 18 RNase inhibitor (40 U / μL) 0.2μL 12 0.5mM SYTO 0.2μL 12 50X ROX 0.25ul 15 water 15.75μL 945

[0238] Insert the eight-pack into the ice box, add 23 μL of RT activity assay MIX to each well, and then add 2 μL of the diluent from step (8) and the sample to be tested from steps (6) and (7) respectively (reaction volume 25 μL). Shake the above mixture to mix well, centrifuge, and immediately load it onto the instrument.

[0239] (10) Test on the machine. Set the reaction program at 7500. Put the above mixture into 7500 and set the program according to the table below.

[0240] Table 19.

[0241] temperature time Cycle number fluorescence signal Internal Reference 50℃ 30s 60 SYBR ROX

[0242] Table 20.

[0243]

[0244]

[0245] Table 21.

[0246]

[0247] Experimental results:

[0248] The specific results are shown in Figures 10(a) and 10(b). The results indicate that the thermostable reverse transcriptase mutant 1X of this invention retains approximately 50% of its activity after heating at 50°C for 10 min in a RT activity assay buffer volume / μL. Comparative Example 1 retains approximately 31% of its activity after heating at 50°C for 10 min, and wild-type MMLV retains approximately 4% of its activity after heating at 50°C for 10 min. The thermostability of the thermostable reverse transcriptase mutant RT-B2 of this invention is superior to that of Comparative Example 1 and is essentially consistent with the thermostability of commercially available enzyme SSⅢ.

[0249] Example 7: Performance Test of One-Step RT-PCR with Thermoresistant Reverse Transcriptase Mutant

[0250] (1) Take the thermoresistant reverse transcriptase mutant prepared in Example 4 (hereinafter referred to as RT-B2), and dilute it to 200 U / ul with 1X RT enzyme storage solution according to the activity of 1236.4 U / ul determined in Example 5. Perform one-step RT-PCR performance test of RT-B2 according to the following scheme.

[0251] The thermostable reverse transcriptase mutant prepared in Comparative Example 1 was diluted to 200 U / ul with 1X RT enzyme storage solution according to the activity of 903.2 U / ul as measured in Example 5, and its one-step RT-PCR performance was tested according to the following protocol.

[0252] With SuperScript TM Ⅲ (hereinafter abbreviated as SSⅢ, purchased from Thermo Fisher, product number 18080044, specifications 200U / ul, 10000U) was used as a reference for one-step RT-PCR performance testing.

[0253] The specific steps are as follows:

[0254] (1) Prepare the reaction MIX according to the table below.

[0255] Table 22.

[0256] Components concentration Final concentration μL / person 10T / ul One-step RT PCR Buffer 5× 1X 5 50 UDG, Heat-labile 1U / μL 0.2U / reaction 0.2 2 Rnase inhibitor 40 U / μL 4U / reaction 0.1 1 Anti Taq 5U / ul 4U / reaction 0.8 8 dATP 100mM 200uM 0.05 0.5 dGTP 100mM 200uM 0.05 0.5 dCTP 100mM 200uM 0.05 0.5 dTTP 100mM 200uM 0.05 0.5 dUTP 100mM 200uM 0.05 0.5 Primer-probe mixture 25X 1X 1 10 DEPC water / / 12.61 126.1 RT enzyme (variable) 200U / ul 8U / reaction 0.04 0.4 RNA template 5

[0257] RT enzyme (variable): Comparative tests of SuperScript TM III, RT-B2, and Comparative Example 1.

[0258] (2) After mixing and centrifuging the reaction system prepared according to the table above in the reagent preparation room, add 20 μL / well to a 96-well plate. Seal the negative wells in advance and transfer them to the positive template room for sample addition after processing.

[0259] (3) Add 5 μL of RNA template to each well as needed between positive templates, seal the membrane, mix well, centrifuge, and then amplify and detect.

[0260] (4) The reaction procedure is shown in the table below. The Thermo Fisher Scientific QuantStudio real-time quantitative PCR instrument was used. TM 5. Select the FAM, CY5, and ROX channels, and set the Sample Volume to 25μL. The specific procedure is as follows:

[0261] Table 23.

[0262]

[0263] Experimental results:

[0264] The results are shown in Figures 11(a), 11(b), 11(c), 11(d), and 11(e). The results indicate that the one-step RT-PCR performance of the thermostable reverse transcriptase mutant of this invention is slightly better than that of SuperScript at 60°C. TM III. Reverse transcriptase: The performance of both is basically the same at 50℃ and 55℃.

[0265] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A reverse transcriptase mutant, characterized in that, The amino acid sequence of the reverse transcriptase mutant was obtained by translating the nucleotide sequence shown in SEQ ID NO:

4.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the nucleotide sequence of the reverse transcriptase mutant of claim 1.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the nucleotide sequence of the reverse transcriptase mutant of claim 1, the nucleotide sequence being shown in SEQ ID NO:

4.

4. A carrier, characterized in that, The vector comprises encoding the nucleic acid molecule according to any one of claims 2-3.

5. A host cell, characterized in that, The host cell comprises the vector of claim 4.

6. The method for preparing the reverse transcriptase mutant according to claim 1, characterized in that, Includes the following steps: A DNA fragment containing a reverse transcriptase mutant gene sequence was recombined and ligated with a linearized vector, introduced into host cells, and after induction, culture, collection, crude enzyme extraction, and protein purification, a reverse transcriptase mutant was obtained. The DNA fragment is shown in SEQ ID NO:

5.

7. A reagent kit, characterized in that, The kit comprises the reverse transcriptase mutant of claim 1, or the nucleic acid molecule of any one of claims 2-3, or the vector of claim 4, or the host cell of claim 5, or the reverse transcriptase mutant prepared by the preparation method of claim 6.

8. The application of the reverse transcriptase mutant according to claim 1, or the nucleic acid molecule according to any one of claims 2-3, or the vector according to claim 4, or the host cell according to claim 5, or the reverse transcriptase mutant prepared by the preparation method according to claim 6, or the kit according to claim 7, in reverse transcription reactions.

Citation Information

Patent Citations

  • A method of preparing high-performance M-MLV reverse transcriptase

    CN106906237A

  • Potassium ion tolerant M-MLV reverse transcriptase mutant

    CN113913402A

  • M-MLV reverse transcriptase and preparation method thereof

    CN114214299A