Amino acid yield-related protein cynT, and biomaterials and applications thereof

By using amino acid sequence mutation and DNA recombination techniques on the cynT protein, the production efficiency of L-threonine in Escherichia coli was improved, solving the problem of increasing L-threonine yield and achieving a significant increase in production.

CN116286759BActive Publication Date: 2026-04-07INNER MONGOLIA EPPEN BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211724762.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2026-04-07
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

How to increase the yield of L-threonine, especially to achieve more efficient L-threonine production in microorganisms such as Escherichia coli.

Method used

By mutating the amino acid sequence of the cynT protein, especially replacing the phenylalanine residue at position 74 with leucine, tyrosine, cysteine, proline, tryptophan, or histidine residues, and combining this with DNA recombination technology, recombinant microorganisms can be constructed to enhance the expression and activity of the cynT protein, thereby increasing the amino acid production of the microorganisms.

Benefits of technology

The production of L-threonine was significantly increased, especially after specific mutations in the cynT protein, particularly the substitution of leucine residues, which resulted in a marked increase in L-threonine production and achieved higher production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116286759B_ABST
    Figure CN116286759B_ABST
Patent Text Reader

Abstract

The application discloses amino acid yield related protein cynT and a biomaterial and application thereof. The technical problem solved is how to improve the amino acid yield of microorganisms. The application specifically discloses A1) a protein, wherein the protein is a cynT protein or a cynT mutant protein obtained by replacing a phenylalanine residue at the 74th position of the amino acid sequence of the cynT protein with other amino acid residues; the cynT protein is a protein with the amino acid sequence of sequence 2; A2) a protein obtained by substituting, deleting and / or adding amino acid residues of the protein of A1) and having more than 80% identity with the protein of A1) and having the function of improving the amino acid yield of microorganisms; A3) a fusion protein with the same function obtained by connecting a label to the N terminal and / or C terminal of A1) or A2). The substance for improving the expression of the cynT protein gene can be used for improving the amino acid yield of microorganisms or breeding of an amino acid yield strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application specifically relates to the amino acid production-related protein cynT, its biomaterials, and applications. Background Technology

[0002] L-Threonine is an important nutritional fortifier, commonly used in food additives, feed additives, and fertilizer additives. It can fortify grains, pastries, and dairy products, and like tryptophan, it helps alleviate fatigue and promotes growth and development. It also has a water-retaining effect on human skin. It is an amino acid-based drug, primarily used in amino acid infusions, comprehensive amino acid preparations, and food fortifiers. A deficiency in threonine can cause loss of appetite, weight loss, fatty liver, testicular atrophy, changes in anterior pituitary cell staining, and impaired bone development. When heated with glucose, it readily produces a caramel and chocolate aroma, enhancing flavor and also having applications in biochemical research. As a feed fortifier, L-Threonine is an essential amino acid, often added to the feed of immature piglets and poultry. It is the second limiting amino acid in pig feed and the third limiting amino acid in poultry feed, added to feeds primarily composed of grains such as wheat and barley. As a nutritional additive, it is also used in the formulation of amino acid infusions and comprehensive amino acid preparations. It can also be used as an adjunct treatment for peptic ulcers, and can treat anemia, angina pectoris, aortitis, heart failure, and other cardiovascular diseases. Simultaneously, it plays a crucial physiological role in animals, such as promoting growth, enhancing immune function, and balancing dietary amino acids to bring the amino acid ratio closer to ideal protein, thereby reducing the protein content requirements of livestock and poultry feed. Therefore, increasing L-threonine production is a current need. Summary of the Invention

[0003] This application discloses the amino acid production-related protein cynT, its biomaterials, and applications, addressing the technical problem of how to increase L-threonine production.

[0004] To address the aforementioned problems, this application provides a protein.

[0005] The protein is any one of the following:

[0006] A1) A protein, wherein the protein is the cynT protein or a cynT mutant protein obtained by replacing the phenylalanine residue at position 74 of the amino acid sequence of the cynT protein with any of the following amino acid residues:

[0007] The cynT protein contains cysteine ​​residues, arginine residues, leucine residues, isoleucine residues, methionine residues, valine residues, serine residues, proline residues, threonine residues, alanine residues, tyrosine residues, histidine residues, glutamine residues, asparagine residues, lysine residues, aspartic acid residues, glutamic acid residues, tryptophan residues, serine residues, or glycine residues; the cynT protein is a protein with the amino acid sequence of sequence 2.

[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that has more than 80% identity with the protein shown in A1) and has the ability to increase the amino acid production of microorganisms.

[0009] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] In the above-mentioned proteins, the protein is a cynT protein or the phenylalanine residue at position 74 of the amino acid sequence of the cynT protein is replaced with any of the following:

[0011] The amino acid residues are leucine residues, tyrosine residues, cysteine ​​residues, proline residues, tryptophan residues, or histidine residues; the cynT protein is a protein with the amino acid sequence of sequence 2.

[0012] In the above text, the amino acid sequence of the cynT mutant protein may be one or more of sequences 6 (L), 16 (Y), 18 (C), 20 (P), 22 (W), and 24 (H). In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to a leucine residue is sequence 6.

[0013] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to a leucine residue is sequence 6.

[0014] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to a tyrosine residue is sequence 16.

[0015] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine at position 74 of sequence 2 to a cysteine ​​residue is sequence 18.

[0016] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to a proline residue is sequence 20.

[0017] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to tryptophan is sequence 22.

[0018] In the above text, the amino acid sequence of the protein obtained by mutating the phenylalanine residue at position 74 of sequence 2 to histidine residue is sequence 24.

[0019] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0020] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0021] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0022] In the above protein, sequence 2 (SEQ ID No. 2) consists of 207 amino acid residues.

[0023] To address the aforementioned issues, this application also provides biological materials.

[0024] The biomaterial is any one of the following:

[0025] B1) Nucleic acid molecules that encode the above proteins;

[0026] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0027] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0028] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0029] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is any one of the following:

[0030] Z1) The coding sequence is the DNA molecule shown in SEQ ID No. 1;

[0031] The coding sequence for Z2 is the DNA molecule shown in SEQ ID No. 5;

[0032] The coding sequence for Z3 is the DNA molecule shown in SEQ ID No. 15;

[0033] The coding sequence for Z4 is the DNA molecule shown in SEQ ID No. 17;

[0034] The coding sequence for Z5 is the DNA molecule shown in SEQ ID No. 19;

[0035] The coding sequence for Z6 is the DNA molecule shown in SEQ ID No. 21;

[0036] The coding sequence for Z7 is the DNA molecule shown in SEQ ID No. 23;

[0037] The nucleotide sequence of Z8 is the DNA molecule shown in SEQ ID No. 1;

[0038] The nucleotide sequence of Z9 is the DNA molecule shown in SEQ ID No. 5;

[0039] The nucleotide sequence of Z10 is the DNA molecule shown in SEQ ID No. 15;

[0040] The nucleotide sequence of Z11 is the DNA molecule shown in SEQ ID No. 17;

[0041] The nucleotide sequence of Z12 is the DNA molecule shown in SEQ ID No. 19;

[0042] The nucleotide sequence of Z13 is the DNA molecule shown in SEQ ID No. 21;

[0043] The nucleotide sequence of Z14 is the DNA molecule shown in SEQ ID No. 23.

[0044] To address the aforementioned problems, this application also provides the following uses.

[0045] The following are applications of materials in regulating microbial amino acid production, preparing materials for regulating microbial amino acid production, or in microbial breeding:

[0046] C1) Protein, wherein the protein is the protein described above:

[0047] C2) Substances that regulate the expression of the gene encoding the protein;

[0048] C3) Substances that regulate the activity or content of the protein.

[0049] In the above-described uses, the substance regulating the expression of the protein-coding gene is any one of the following:

[0050] D1), the nucleic acid molecule encoding the protein described in C1);

[0051] D2), an expression cassette containing the nucleic acid molecules described in D1);

[0052] D3), ​​a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0053] D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3).

[0054] In the nucleic acid molecule described in B1), those skilled in the art can easily mutate the nucleotide sequence encoding the protein cynT of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the protein cynT isolated in the present invention, as long as they encode and function the protein cynT, are all derived from and equivalent to the nucleotide sequence of the present invention.

[0055] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0056] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0057] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be the gene encoding the protein.

[0058] In the above text, the gene encoded by sequence 2 is as shown in sequence 1.

[0059] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to leucine is shown in sequence 6. Its encoding gene is shown in sequence 5.

[0060] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to tyrosine is shown in sequence 16. Its encoding gene is shown in sequence 15.

[0061] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to cysteine ​​is shown in sequence 18. Its encoding gene is shown in sequence 17.

[0062] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to proline is shown in sequence 20. Its encoding gene is shown in sequence 19.

[0063] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to tryptophan is shown in sequence 22. Its encoding gene is shown in sequence 21.

[0064] In the above text, the protein with the phenylalanine at position 74 of sequence 2 mutated to histidine is shown in sequence 24. Its encoding gene is shown in sequence 23.

[0065] In this document, the vectors described are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be the vectors pEASY-Blunt and / or pCAMBIA-139;

[0066] In the aforementioned biological materials, the expression cassette described in B2) or D2) refers to DNA capable of expressing the gene in a host cell. This DNA may include not only a promoter to initiate gene transcription but also a terminator to terminate gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0067] In the above-mentioned biological materials, the nucleic acid molecule described in B5) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0068] B2) The promoter in the expression box can be the GapA promoter.

[0069] B3) The carrier may be pXMJ19.

[0070] In the nucleic acid molecule described in B5), those skilled in the art can easily mutate the nucleotide sequence encoding the protein cynT of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein cynT isolated in the present invention, as long as they encode and function the protein cynT, are all derived from and equivalent to the nucleotide sequence of the present invention.

[0071] The aforementioned 75% or higher identity can be 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0072] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0073] To address the aforementioned issues, this application also provides a method for increasing or enhancing the production of amino acids by microorganisms.

[0074] The method includes upregulating or enhancing or increasing the expression of the coding gene of the above-mentioned protein or the activity or content of the protein in the target microorganism, so as to upregulate or enhance or increase the microbial amino acid production.

[0075] To address the aforementioned issues, this application also provides a method for constructing recombinant microorganisms.

[0076] The method includes upregulating or enhancing or increasing the expression of the coding gene of the above-mentioned protein or the activity or content of the protein in the target microorganism to obtain a recombinant microorganism with a change in amino acid production, wherein the amino acid production of the recombinant microorganism is higher than that of the target microorganism.

[0077] Specifically, upregulating or enhancing the expression of the gene encoding the protein, or increasing the activity or content of the protein, can upregulate or enhance or increase the production of microbial amino acids. The amino acid may be L-threonine.

[0078] In the above text, the expression of the gene encoding the protein (hereinafter referred to as the gene) can be regulated by at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0079] In the above methods, the upregulation, enhancement, or increase of the expression of the coding gene for the aforementioned protein in the target microorganism is achieved by any of the following methods:

[0080] E1) Introduce the gene encoding the protein described above into the target microorganism;

[0081] E2) Introduce at least one of the protein-coding genes of sequence 2, sequence 6, sequence 16, sequence 18, sequence 20, sequence 22 or sequence 24 into the target microorganism.

[0082] In the above, E1 can be achieved by inserting the coding gene into a chromosome. The insertion site on the chromosome can specifically be the yaiT coding region. E1 can also be achieved by introducing a recombinant plasmid expressing the coding gene into the target microorganism, whereby the recombinant plasmid can exist as an extrachromosomal genetic factor. In the recombinant plasmid, the nucleotide sequence of the coding gene can be at least one of sequence 1, sequence 5, sequence 15, sequence 17, sequence 19, sequence 21, and sequence 23.

[0083] In the above text, E1 can be expressed by expressing the coding gene in plasmid form.

[0084] The plasmid may be pXMJ19.

[0085] To address the aforementioned problems, this application provides a method for preparing amino acids.

[0086] The method includes producing amino acids using the proteins, biological materials, or recombinant microorganisms described above.

[0087] In the aforementioned proteins, biological materials, uses, or methods, the microorganism is any one of the following:

[0088] C1) Kingdom Bacteria;

[0089] C2) Enterobacteriaceae;

[0090] C3) Escherichia coli;

[0091] C4) Escherichia coli.

[0092] The Escherichia coli may be W3110 or CGMCC No. 25404.

[0093] In this application, the amino acid may be L-threonine.

[0094] The recombinant microorganisms described above can be used to produce a variety of products, including but not limited to lysine, glutamic acid, and valine in the examples. The products produced may also include glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc.

[0095] The present invention also provides a method for producing amino acids, the method comprising: introducing the above-mentioned biological material into biological cells capable of synthesizing the target amino acid to obtain recombinant biological cells, culturing the recombinant biological cells to obtain the target amino acid.

[0096] In the above method, the biological cell can be yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target amino acid. The biological cell can be any biological cell capable of synthesizing the target amino acid. The bacteria can be *Escherichia coli*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Corynebacterium pekinense*, *Brevibacterium ammonia-eating*, *Corynebacterium obliterans*, or *Pantoea*.

[0097] In this application, Escherichia coli is preferred, but any type of Escherichia coli can be used. The strains selected in the examples are only representative strains and have general applicability to Escherichia coli.

[0098] Beneficial effects

[0099] This application constructed the gene knockout vector pGRB-yaiT based on yaiT sgRNA. Recombinant sequences with homologous arms, sequences 1, 5, 15, 17, 19, 21, and 23, were also constructed. Using Cas9 protein and homologous sequences, sequences 1, 5, 15, 17, 19, 21, and 23 were inserted into the yaiT region of the model strain W3110 and the threonine-producing strain CGMCC No. 25404, obtaining YPW3110-cynT and YPThr-cynT, respectively. F74L and YPThr-cynT F74L YPW3110-cynT F74Y and YPThr-cynT F74Y YPW3110-cynT F74C and YPThr-cynT F74C YPW3110-cynT F74P and YPThr-cynT F74P YPW3110-cynT F74W and YPThr-cynT F74W and YPW3110-cynT F74H and YPThr-cynT F74H Compared with the model strain W3110 and the threonine-producing strain CGMCCNo.25404, its L-threonine production was significantly increased.

[0100] The results showed that, for both CGMCC strain No. 25404 and the model strain W3110, the substitution of phenylalanine at position 74 of the cynT protein amino acid sequence with cysteine ​​residues, arginine residues, leucine residues, isoleucine, methionine residues, valine residues, serine residues, proline residues, threonine residues, alanine residues, tyrosine residues, histidine residues, glutamine residues, asparagine residues, lysine residues, aspartic acid residues, glutamic acid residues, tryptophan residues, serine residues, or glycine residues had a more significant effect, especially when substituted with leucine residues.

[0101] Preservation Instructions

[0102] Bacterial species name: Escherichia coli

[0103] Latin name: Escherichia coli

[0104] Strain number: YP0158

[0105] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0106] Collection institution abbreviation: CGMCC

[0107] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0108] Date of preservation: July 25, 2022

[0109] Registration number at the Preservation Center: CGMCC No. 25404. Attached Figure Description

[0110] Figure 1 Fermentation results for YPThr-cynTP and YPThr-cynTM in 96-well plates. Detailed Implementation

[0111] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0112] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0113] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0114] Carbonic anhydrases are enzymes involved in the interconversion of carbon dioxide and bicarbonate (EC 4.2.1.1), which can capture carbon dioxide during microbial metabolism and improve the carbon source utilization efficiency of microorganisms. In Corynebacterium glutamicum, both β- and γ-type carbonic anhydrases have been identified, with the β-type playing a major role; it is a zinc metalloenzyme. In Corynebacterium glutamicum ATCC13032, the β-type carbonic anhydrase is encoded by cynT, and its nucleotide and amino acid sequences are shown in SEQ ID No. 1 and SEQ ID No. 2. The nucleotide sequence is 624 bp, and the encoded carbonic anhydrase consists of 207 amino acids.

[0115] This invention aims to study the role of the carbonic anhydrase encoding gene cynT and its mutants in the fermentation production of L-threonine from *Corynebacterium glutamicum* CGMCC No. 25404, in order to improve the yield and conversion rate of L-threonine.

[0116] Example 1: Construction of a cynT engineered strain containing carbonic anhydrase activity overexpressed on a plasmid

[0117] The carbonic anhydrase encoding gene cynT from Corynebacterium glutamicum ATCC13032 was introduced into Escherichia coli CGMCC No. 25404 using the Escherichia coli / Corynebacterium glutamicum shuttle expression vector pXMJ19 (Catalog No. Biovector pXMJ19, purchased from Biovector). The expression of cynT in plasmid pXMJ19 was initiated by the E. coli GapA promoter, thereby studying the effect of the exogenous carbonic anhydrase encoded by cynT on L-threonine synthesis in E. coli in a high-yielding strain.

[0118] I. Construction of wild-type cynT expression vector with carbonic anhydrase activity and its engineered strain

[0119] Using the Escherichia coli W3110 genome sequence published by NCBI as a template, the E. coli GapA promoter was amplified by PCR using KAPA HiFi HotStart DNA polymerase (catalog number KK2501, purchased from Kapa Biosystems) with primers P1 / P2. The nucleotide sequence is shown in SEQ ID No. 3, 341 bp. Using the Corynebacterium glutamicum ATCC13032 genome DNA published by NCBI as a template, the cynT coding region was amplified by PCR using KAPA HiFi HotStart DNA polymerase with primers P3 / P4.

[0120] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPAHiFi HotStart (1 U / μL) 0.5 μL, add ddH2O to a total volume of 50 μL.

[0121] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 30 s; 30 cycles), 72℃ over-extension for 5 min.

[0122] The GapA promoter amplified by primers P1 / P2 and the cynT DNA fragment amplified by primers P3 / P4 were recovered and ligated with the expression vector pXMJ19 recovered by EcoRI / KpnI digestion using the NEBuilder HiFi DNA Assembly Cloning Kit (catalog number E2621S, New England Biolabs) at 50°C for 30 min. The ligation products were transformed into wild-type strain W3110 and threonine-producing strain CGMCC No. 25404, respectively, and plated on 2-YT agar plates containing chloramphenicol (34 mg / L) and cultured at 37°C. Single clones were then purified using Premix Taq. TM DNA polymerase (catalog number RR901A, purchased from TaKaRa) was used with primers M13R(-48)(5'AGCGGATAAC AATTTCACAC AGGA 3') / T1TER(5')

[0123] PCR identification showed that the positive transformants containing the pXMJ19-PGapA-cynT recombinant vector were amplified by PCR and were named YPW3110-cynTP and YPThr-cynTP, respectively.

[0124] The pXMJ19-PGapA-cynT recombinant vector is obtained by replacing the fragment between the EcoRI and KpnI recognition sites of the restriction endonucleases in the pXMJ19 vector with the nucleotide sequence SEQ ID No. 3-SEQ ID No. 1 (SEQ ID No. 3 is the GapA promoter sequence), while keeping the other nucleotide sequences of the pXMJ19 vector unchanged.

[0125] The above SEQ ID No.3-SEQ ID No.1 are DNA fragments formed by linking SEQ ID No.3 to SEQ ID No.1 with phosphodiester bonds.

[0126] The phosphodiester bond mentioned above is the way deoxyribonucleotides in natural genes are linked together.

[0127] A phosphodiester bond is a chemical group consisting of two ester bonds formed by the esterification of a phosphate molecule with two alcohols (hydroxyl groups). The phosphodiester bond acts as a bridge between two alcohols. Specifically, the -OH (hydroxyl group) on the 3' carbonyl group of the preceding nucleotide forms an ester bond with the 5'-phosphate group of the following nucleotide. Here, the phosphate group simultaneously forms ester bonds with both the preceding and following hydroxyl groups, hence the name phosphodiester bond. This chain continues in sequence to form a polynucleotide chain, i.e., a nucleic acid macromolecule.

[0128] The following SEQ ID No. A-SEQ ID No. B all represent DNA fragments formed by linking SEQ ID No. A with SEQ ID No. B via phosphodiester bonds.

[0129] PCR amplification system: 2×Premix Taq TM 12.5 μL, 1 μL each of primers (10 pM), add ddH2O to a total volume of 25 μL.

[0130] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0131] The primers were designed as follows (synthesized by Shanghai Paisenno Gene Technology Co., Ltd.):

[0132] P1:

[0133] 5'-GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTGCTCACATCTCACTT-3',

[0134] P2:5'-CAACATTACGCAAAGGCATATATTCCACCAGCTATTTGT-3',

[0135] P3:5'-ACAAATAGCTGGTGGAATATATGCCTTTGCGTAATGTTG-3',

[0136] P4:

[0137] 5'-ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCTAACCCACGTTCTTGCT-3'. II. Construction of a mutant cynT expression vector with carbonic anhydrase activity and its engineered strain.

[0138] To obtain a carbonic anhydrase with higher enzymatic activity, the cynT gene was randomly mutated using a GeneMorph II Random Mutagenesis Kit (catalog number 200550, purchased from Agilent Technologies). Using the recombinant plasmid pXMJ19-PGapA-cynT as a template, PCR amplification with primers P3 / P4 using the GeneMorph II Random Mutagenesis Kit yielded a 624bp cynT gene containing random point mutations.

[0139] PCR amplification system: 5 μL 10× Mutazyme II Buffer, 1 μL dNTP™ Specimen (40 mM), 0.5 μL each of primers (10 pM), 0.5 μL Mutazyme II DNA polymerase (2.5 U / μL), 0.5 μL template, and ddH2O added to a total volume of 50 μL.

[0140] PCR amplification program: 95℃ pre-denaturation for 5 min, (95℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0141] The DNA fragments were recovered using the QlAquick gel recovery kit (catalog number 28706, purchased from QIAGEN GmbH) and ligated with the GapA promoter amplified in step one and the expression vector pXMJ19 recovered by EcoRI / KpnI digestion using the NEBuilder HiFi DNA assembly cloning kit at 50°C for 30 min. The ligation product was transformed into CGMCC No. 25404 and plated onto 2-YT agar plates containing chloramphenicol (34 mg / L) and incubated at 37°C.

[0142] Use Premix Taq to grow single clones. TM DNA polymerase was used for PCR identification with primers M13R(-48)(5'AGCGGATAACAATTTCACAC AGGA 3') / T1TER(5'CGTTCACCGACAAACAACAG3'). Transformants containing a 1305 bp fragment were identified as positive transformants containing the pXMJ19-PGapA-cynTM recombinant vector and named YPThr-cynTM. Fifty-four mutant plants were obtained, named YPThr-cynTM1-YPThr-cynTM54, abbreviated as M1-M54 (e.g., YPThr-cynTM1-YPThr-cynTM54). Figure 1 (As shown).

[0143] PCR amplification system: 2×Premix Taq TM 12.5 μL, 1 μL each of primers (10 pM), add ddH2O to a total volume of 25 μL.

[0144] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0145] III. 96-well plate fermentation experiment of cynT strain

[0146] To assess the L-threonine production performance of the wild-type and mutant cynT engineered strains constructed in steps one and two, YPThr-cynTP and YPThr-cynTM were passaged three times on 2-YT agar plates containing chloramphenicol (34 mg / L), and then inoculated into 96-well plates containing 200 μL of L-threonine fermentation medium. The plates were then fermented for 24 h on a ZQZY-88BH model (Shanghai Zhichu Instrument Co., Ltd.). The fermentation conditions were 85% humidity, 37℃ temperature, and 800 rpm.

[0147] Fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 20 g / L, (NH4)2SO4 2 g / L, NaNO3 0.5 g / L, KH2PO4 2 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, ZnSO4 0.025 g / L, VH 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L. 12 1.5 g / L, pH adjusted to 7.0 with sodium hydroxide.

[0148] After fermentation, the concentration of L-threonine was determined by high-performance liquid chromatography (HPLC). CK0 was the threonine-producing strain CGMCC No.25404, CK1 was the strain CGMCC No.25404 transformed into the empty vector pXMJ19, CK2 was YPThr-cynTP, and M1-M54 were 54 mutant strains of YPThr-cynTM.

[0149] like Figure 1 As shown, CK2, which was introduced with exogenous cynT, had a higher L-threonine yield than CK1, which was introduced with only the empty vector pXMJ19, and the starting strain CGMCCNo.25404, indicating that the introduction of exogenous cynT helps to increase L-threonine production. M2, M7, M16, M17, M18, M19, M20, M21, M30, M31, M35, and M36 all had higher L-threonine yields than CK0 and CK1; among them, M2, M7, M16, M17, and M18 had higher L-threonine production capacity than CK2, indicating that mutation of cynT is more conducive to increasing L-threonine production, with M2 and M7 showing the greatest advantage.

[0150] IV. Fermentation experiments of strains YPW3110-cynTP, YPThr-cynTP, and YPThr-cynTM

[0151] The dominant acid-producing strains M2, M7, M16, M17, and M18 were inoculated into a 5L BLBIO-5GC-4-H fermenter (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-threonine fermentation medium and conditions. Each strain was replicated three times. After fermentation, the L-threonine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 1.

[0152] L-Threonine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, ZnSO4 0.05 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, and ammonia is added to adjust the pH to 7.0.

[0153] L-threonine fermentation culture conditions:

[0154] Calibrate DO 100%: Temperature 37℃, Airflow 5L / min, Rotation speed 800rpm, Tank pressure 0MPa, calibrate after 5min;

[0155] Inoculation dose: 10%;

[0156] Initial conditions: pH 7.0, culture temperature 37℃, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0157] Full process control: 1. When dissolved oxygen < 30%, increase the speed sequentially by 500 rpm → 600 rpm → air volume.

[0158] 1L / min → 700rpm → 800rpm; 2. After 8 hours of fermentation, the tank pressure was increased to 0.01MPa; after 12 hours, the tank pressure was increased.

[0159] 0.02Mpa→0.03Mpa→0.04Mpa→0.05Mpa;

[0160] Residual sugar control: 0.1-0.5% before F12h; after F12h, control residual sugar to 0.1-0.3% in conjunction with DO requirements;

[0161] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0162] Fermentation cycle: about 30 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20-30%.

[0163] Table 1. Fermentation results of YPThr-cynTP and YPThr-cynTM strains

[0164]

[0165] As shown in Table 1, the L-threonine production was increased after introducing exogenous cynT into both the model strain W3110 and the acid-producing strain CGMCC No.25404. After mutating cynT, the L-threonine production of mutant strains 2 and 7, which were screened by fermentation in 96 wells, was significantly different from that of the starting strain CGMCC No.25404.

[0166] Example 2: Sequencing of mutant cynT

[0167] Sequencing of the mutant cynT in the aforementioned dominant strains YPThr-cynTM2 and YPThr-cynTM7 revealed that in YPThr-cynTM2, the thymine (T) at position 222 of cynT was mutated to guanine (G), resulting in a mutation at codon 74 from TTT to TTG. This resulted in a mutation at codon 74 encoding phenylalanine (F) to leucine (L). The mutated nucleotide sequence cynT... F74L The DNA molecule shown in SEQ ID No. 5 encodes the amino acid sequence of SEQ ID No. 6, a mutant carbonic anhydrase (the mutant carbonic anhydrase is named cynT). F74L The mutant carbonic anhydrase cynT F74L The leucine (L) at position 74 in the amino acid sequence (SEQ ID No. 6) is derived from a mutation of phenylalanine (F).

[0168] In YPThr-cynTM7, the guanine (G) at position 37 is mutated to cytosine (C), resulting in a mutation in codon 13 from GTA to CTA, and the valine (V) at position 13 is mutated to leucine (L); the adenine (A) at position 137 is mutated to guanine (G), resulting in a mutation in codon 46 from CAA to CGA, but the glutamine (Q) at position 46 is mutated to arginine (R). The mutated nucleotide sequence is cynT. V13LQ46R The DNA molecule shown in SEQ ID No. 7 encodes the amino acid sequence of SEQ ID No. 8, which is a mutant carbonic anhydrase (named cynT). V13LQ46R The mutant carbonic anhydrase cynT V13LQ46R The leucine (L) at position 13 in the amino acid sequence (SEQ ID No. 8) is derived from valine (V) by mutation, and the arginine (R) at position 46 is derived from glutamine (Q) by mutation.

[0169] Example 3: Construction of a cynT engineered strain expressing carbonic anhydrase activity

[0170] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the cynT gene of Corynebacterium glutamicum was introduced into the coding region of the yaiT site in the model strain W3110 and the threonine-producing strain CGMCC No. 25404, respectively, using CRISPR / Cas9 gene editing technology. F74L Gene.

[0171] I. Construction of sgRNA

[0172] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector (catalog number 71539, purchased from Addgene) terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0173] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: yaiTF 10 μL, yaiTR 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment (also known as sgRNA) is recovered using the QlAquick gel extraction kit (catalog number 28706, purchased from QIAGEN GmbH).

[0174] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the plasmid was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the dephosphorylated linear pGRB plasmid was recovered using a DNA purification kit. Recombination of the sgRNA (the recovered target fragment) and the pGRB plasmid (the dephosphorylated linear pGRB plasmid) was then performed using the NEBuilder HiFi DNA Assembly and Cloning Kit (catalog number E2621S, purchased from New England Biolabs). Recombination system: 2.5 μL NEBuilder HiFi DNA recombinase, 2 μL of the above-mentioned dephosphorylated linear pGRB plasmid, and 0.5 μL sgRNA (the recovered target fragment). After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells. A 639 bp (SEQ ID No. 9) transformant was obtained by PCR using primers sgRNAF / sgRNAR, and the plasmid was further extracted and sequenced. The constructed plasmid was named pGRB-yaiT.

[0175] The primers used in this experiment were designed as follows (synthesized by Shanghai Paisenno Gene Technology Co., Ltd.). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase are the yaiT sgRNA sequences:

[0176] yaiTF:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTggcaactatg taaactatagGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'

[0177] yaiTR:5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACctatagttta catagttgccACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3''

[0178] sgRNAF: 5'-GTCTCATGAGCGGATACATATTTG-3'

[0179] sgRNAR: 5'-ATGAGAAAGCGCCACGCT-3'

[0180] II. PCR amplification of overexpressed cynT or cynT gene in W3110 and CGMCC No.25404 F74L DNA sequence

[0181] Based on the Escherichia coli W3110 genome sequence published by NCBI, three pairs of amplified upstream and downstream homologous arm sequences, as well as the cynT gene and cynT gene, were designed and synthesized. F74L Primers for the gene coding region and GapA promoter region were used to introduce the cynT gene or cynT gene into the yaiT coding region of the model strain W3110 and the threonine-producing strain CGMCC No.25404, respectively, using CRISPR / Cas9 gene editing. F74L Gene.

[0182] The primers were designed as follows (synthesized by Shanghai Paisenno Gene Technology Co., Ltd.):

[0183] P5:5'-AAGAGAATGG AAGAGAGGCC-3',

[0184] P6:5'-AAGTGAGATG TGAGCAA AGTGCATTGTC ATCCCTCC-3',

[0185] P7:5'-GGAGGGATGACAAATGCACTTTGCTCACATCTCACTT-3',

[0186] P8:5'-CGGTAGTGTA GGTTTCGTTG CTAACCCACGTTCTTGCT-3',

[0187] P9:5'-AGCAAGAACGTGGGTTAG CAACGAAAACC TACACTACCG-3',

[0188] P10:5'-CGACCTGTAG TATCCCATTC-3'.

[0189] Using W3110 genomic DNA as a template, KAPAHiFi HotStart DNA polymerase (catalog number KK2501, purchased from Kapa Biosystems) was used with primers P5 / P6 and P9 / P10 for PCR amplification, yielding a 458bp upper homologous arm (SEQ ID No. 101-458) and a 603bp lower homologous arm (SEQ ID No. 101389-1991). Using pXMJ19-PGapA-cynT and pXMJ19-PGapA-cynTM2 plasmid DNA as templates, KAPAHiFi HotStart DNA polymerase was used with primers P7 / P8 for PCR amplification of PGapA-cynT 1005bp (SEQ ID No. 10422-1426) and PGapA-cynT, respectively. F74L 1005bp (SEQ ID No. 11422-1426). After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using the QlAquick gel recovery kit (catalog number 28706, purchased from QIAGEN GmbH). The recovered DNA was then used to obtain the genomically overexpressed recombinant DNA fragments Up-cynT-Down (SEQ ID No. 10) and Up-cynT using KAPAHiFi HotStart DNA polymerase with primers P5 and P10 overlap PCR. F74L -Down(SEQ ID No.11)1991bp.

[0190] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPAHiFi HotStart (1 U / μL) 0.5 μL, add ddH2O to a total volume of 50 μL.

[0191] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 90 s; 30 cycles), 72℃ over-extension for 5 min.

[0192] III. Preparation and Transformation of Competent Behaviors

[0193] Competent cells of the model strain W3110 and the threonine-producing strain CGMCC No.25404 were prepared and transformed with pREDCas9 plasmid (catalog number 71541, purchased from Addgene). Positive transformants were identified by primer pCF / pCR PCR yielding 943bp (SEQ ID No. 12). Model strains W3110-Cas9 and CGMCC No.25404-Cas9 were obtained. pREDCas9 carried an sgRNA plasmid elimination system, a λRed recombination system, and a Cas9 protein expression system. It then bound yaiT sgRNA to express cynT and cynT protein in the CGMCC No.25404 genome. F74L CRISPR homologous recombination.

[0194] Prepare competent cells of strains W3110-Cas9 and CGMCC No.25404-Cas9, and when the cells grow to OD... 600 =0.1 Add IPTG to a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of the bacterial cell was 0.6, competent cells were collected and transformed into pGRB-yaiT plasmid and the genomic overexpression DNA fragment Up-cynT-Down or Up-cynT, respectively. F74L -Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L), and incubate at 32°C. Single colonies produced are analyzed by Premix Taq. TM DNA polymerase (product number RR901A, purchased from TaKaRa) was used for PCR identification with primers P11 / P12. Positive transformants were those that amplified a fragment of 1457 bp (the sequence without point mutations is shown in SEQ ID No. 13, the sequence with point mutations has G at position 1116, and the rest is as shown in SEQ ID No. 13). The original bacteria were those that could not be amplified.

[0195] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and arabinose to a final concentration of 0.2% to eliminate the pGRB-yaiT plasmid. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and incubated at 42°C to eliminate the pREDCas9 plasmid. Colonies that grew on antibiotic-free 2-YT but not on spectinomycin (100 mg / L) were selected and analyzed using Premix Taq. TMDNA polymerase was used for PCR identification with primers P13 / P14. Positive transformants were those that amplified by PCR and contained a 1512bp fragment (the sequence without point mutations is shown in SEQ ID No. 14, and the sequence with point mutations has G at position 334, and the rest is as shown in SEQ ID No. 14). The original bacteria were those that could not be amplified.

[0196] The wild-type cynT gene and the mutant cynT gene overexpressed in the model strain W3110 were compared. F74L The strains that produced the gene were named YPW3110-cynT (without the mutation point) and YPW3110-cynT, respectively. F74L (Including mutation points).

[0197] The wild-type and mutant cynT genes overexpressed in Escherichia coli CGMCC 25404 were compared. F74L The strains that produced the gene were named YPThr-cynT (without the mutation point) and YPThr-cynT, respectively. F74L (Including mutation points).

[0198] The recombinant strain YPThr-cynT contains the cynT gene shown in SEQ ID No. 1 from Corynebacterium glutamicum. Specifically, the recombinant strain YPW3110-cynT is obtained by replacing the yaiT coding region of the model strain W3110 and its genome with the Corynebacterium glutamicum cynT gene and the GapA promoter (SEQ ID No. 3-SEQ ID No. 1), while keeping other nucleotides in its genome unchanged. Recombinant strains containing the Corynebacterium glutamicum cynT gene can stably express β-carbonic anhydrase.

[0199] Specifically, the recombinant strain YPThr-cynT is obtained by replacing the yaiT coding region in the genome of Escherichia coli CGMCC 25404 with the Corynebacterium glutamicum cynT gene and the GapA promoter (SEQ ID No. 3-SEQ ID No. 1), while keeping other nucleotides in its genome unchanged. The recombinant strain containing the Corynebacterium glutamicum cynT gene can stably express β-carbonic anhydrase.

[0200] Recombinant strain YPW3110-cynT F74L and YPThr-cynT F74L Contains the mutant cynT shown in SEQ ID No. 5 from Corynebacterium glutamicum. F74L Gene; specifically, recombinant strain YPW3110-cynT F74L The yaiT coding region in the genome of the type strain W3110 was replaced with cynT.F74L Recombinant bacteria were obtained by maintaining the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 5) while keeping other nucleotides in their genome unchanged. This includes Corynebacterium glutamicum cynT. F74L Recombinant bacteria can stably express β-carbonic anhydrase.

[0201] Recombinant strain YPThr-cynT F74L Contains the mutant cynT shown in SEQ ID No. 5 from Corynebacterium glutamicum. F74L Gene; specifically, recombinant bacteria YPThr-cynT F74L The yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74L Recombinant bacteria were obtained by maintaining the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 5) while keeping other nucleotides in their genome unchanged. This includes Corynebacterium glutamicum cynT. F74L Recombinant bacteria can stably express β-carbonic anhydrase.

[0202] The primers were designed as follows (synthesized by Shanghai Paisenno Gene Technology Co., Ltd.):

[0203] pCF:5'-GCAGTGGCGGTTTTCATG-3',

[0204] pCR:5'-CCTTGGTGATCTCGCCTTTC-3',

[0205] P11:5'-GGGCGTTGGA TTAAGTCTGT-3',

[0206] P12:5'-CCAATGATTC CCAACTCACC-3',

[0207] P13:5'-GGCACAGGATTGATTTGTCG-3',

[0208] P14:5'-CCCACCCAGT AGATTCGGTC-3'.

[0209] PCR amplification system: 2×Premix Taq TM 12.5 μL, 1 μL each of primers (10 pM), and ddH2O supplemented to a total volume of 25 μL.

[0210] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0211] Example 4: Construction of cynT containing carbonic anhydrase activity F74* engineered strains

[0212] To obtain more mutant strains with the 74th amino acid of cynT to improve its L-threonine production capacity, mutant strains with the 74th amino acid of cynT substituted with five different amino acids were constructed. Based on the genome sequence of Escherichia coli W3110 published by NCBI, four pairs of amplified upstream and downstream homologous arm sequences and cynT were designed and synthesized. F74* Primers for the gene coding region and promoter region were used to introduce five mutants with different amino acid substitutions at position 74 of cynT into the coding region of the model strain W3110 and the threonine-producing strain CGMCC No.25404yaiT using CRISPR / Cas9 gene editing. The names of the amino acids substituted by the mutants and the primers used in each mutant are shown in Table 2.

[0213] Table 2 cynT F74* The amino acids substituted by the mutants and the names of the primers used in each mutant.

[0214]

[0215] The primers were designed as follows (synthesized by Shanghai Paisenno Gene Technology Co., Ltd.):

[0216] P6Y:5'-GATTTCTCCGGCAGTACGGACAACATAGAGGTCACCGAGA-3',

[0217] P7Y:5'-TCTCGGTGACCTCTATGTTGTCCGTACTGCCGGAGAAATC-3',

[0218] P6C:5'-GATTTCTCCGGCAGTACGGACAACACAGAGGTCACCGAGA-3',

[0219] P7C:5'-TCTCGGTGACCTCTGTGTTGTCCGTACTGCCGGAGAAATC-3',

[0220] P6P:5'-GATTTCTCCGGCAGTACGGACAACAGGGAGGTCACCGAGA-3',

[0221] P7P:5'-TCTCGGTGACCTCCCTGTTGTCCGTACTGCCGGAGAAATC-3',

[0222] P6W:5'-GATTTCTCCGGCAGTACGGACAACCCAGAGGTCACCGAGA-3',

[0223] P7W:5'-TCTCGGTGACCTCTGGGTTGTCCGTACTGCCGGAGAAATC-3',

[0224] P6H:5'-GATTTCTCCGGCAGTACGGACAACATGGAGGTCACCGAGA-3',

[0225] P7H:5'-TCTCGGTGACCTCCATGTTGTCCGTACTGCCGGAGAAATC-3',

[0226] Using W3110 genomic DNA as a template, PCR amplification was performed using KAPAHiFi HotStart DNA polymerase with primers P5 / P6 and P9 / P10 to obtain a 458bp upper homologous arm (SEQ ID No. 111-458) and a 603bp lower homologous arm (SEQ ID No. 111389-1991). Using the pXMJ19-PGapA-cynT plasmid DNA constructed in our laboratory as a template, PCR amplification of PGapA and the 5' end 246bp cynT was performed using KAPAHiFi HotStart DNA polymerase with primers P7 / P6Y, P7 / P6C, P7 / P6P, P7 / P6W, and P7 / P6H. F74* 607bp (SEQ ID No. 11422-1028), cynT was amplified by PCR using primers P7Y / P8, P7C / P8, P7P / P8, P7W / P8 and P7H / P8. F74* 438bp (SEQ ID No. 11989-1426), but positions 1002-1004 in SEQ ID No. 11 are mutated to the codons in Table 2.

[0227] After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using the QlAquick gel recovery kit. The recovered DNA was then used to obtain the overexpressed recombinant DNA fragment Up-cynT using KAPAHiFi HotStart DNA polymerase with primers P5 and P10 overlap PCR. F74* -Down 1991bp.

[0228] The above five mutant cynT types were processed using the method described in Example 3. F74*The mutant strain containing cynT was transformed into the type strain W3110 and the threonine-producing strain CGMCC No. 25404, and the constructed strain was named YPW3110-cynT, respectively. F74Y YPW3110-cynT F74C YPW3110-cynT F74P YPW3110-cynT F74W and YPW3110-cynT F74H and YPThr-cynT F74Y YPThr-cynT F74C YPThr-cynT F74P YPThr-cynT F74W and YPThr-cynT F74H .

[0229] Recombinant strain YPW3110-cynT F74Y and YPThr-cynT F74Y Contains the mutant cynT shown in SEQ ID No. 15 from Corynebacterium glutamicum. F74Y Gene; specifically, recombinant strain YPW3110-cynT F74Y The method involves replacing the yaiT coding region with cynT in the genome of the type strain W3110. F74Y The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 15) unchanged, while maintaining other nucleotides in its genome.

[0230] Specifically, the recombinant strain YPThr-cynT F74Y The yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74Y The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 15) unchanged, while maintaining other nucleotides in its genome.

[0231] Recombinant strain YPW3110-cynT F74C and YPThr-cynT F74C Contains the mutant cynT shown in SEQ ID No. 17 from Corynebacterium glutamicum. F74C Gene; specifically, recombinant strain YPW3110-cynT F74C The yaiT coding region in the genome of the type strain W3110 was replaced with cynT. F74CThe recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 17) unchanged, while maintaining other nucleotides in its genome.

[0232] Specifically, the recombinant strain YPThr-cynT F74C The yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74C The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 17) unchanged, while maintaining other nucleotides in its genome.

[0233] Recombinant strain YPW3110-cynT F74P and YPThr-cynT F74P Contains the mutant cynT shown in SEQ ID No. 19 from Corynebacterium glutamicum. F74P Gene; specifically, recombinant strain YPW3110-cynT F74P The yaiT coding region in the genome of the type strain W3110 was replaced with cynT. F74P The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 19) unchanged, while maintaining other nucleotides in its genome.

[0234] Specifically, the recombinant strain YPThr-cynT F74P The yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74P The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 19) unchanged, while maintaining other nucleotides in its genome.

[0235] Recombinant strain YPW3110-cynT F74W and YPThr-cynT F74W Contains the mutant cynT shown in SEQ ID No. 21 from Corynebacterium glutamicum. F74W Gene; specifically, recombinant strain YPW3110-cynT F74W The yaiT coding region in the genome of the type strain W3110 was replaced with cynT. F74W The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 21) unchanged, while maintaining other nucleotides in its genome.

[0236] Specifically, the recombinant strain YPThr-cynT F74WThe yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74W The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 21) unchanged, while maintaining other nucleotides in its genome.

[0237] Recombinant strain YPW3110-cynT F74H and YPThr-cynT F74H Contains the mutant cynT shown in SEQ ID No. 23 from Corynebacterium glutamicum. F74H Gene; specifically, YPW3110-cynT F74H The yaiT coding region in the genome of the type strain W3110 was replaced with cynT. F74H The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 23) unchanged, while maintaining other nucleotides in its genome.

[0238] Specifically, the recombinant strain YPThr-cynT F74H The yaiT coding region in the genome of the threonine-producing strain CGMCC No.25404 was replaced with cynT. F74H The recombinant bacteria were obtained by keeping the gene and GapA promoter (SEQ ID No. 3-SEQ ID No. 23) unchanged, while maintaining other nucleotides in its genome.

[0239] Example 5: L-Threonine Fermentation Experiment

[0240] The model strains W3110 and YPW3110-cynT F74Y YPW3110-cynT F74C YPW3110-cynT F74P YPW3110-cynT F74W and YPW3110-cynT F74H and CGMCC No.25404, YPThr-cynT, YPThr-cynT F74L YPThr-cynT F74Y YPThr-cynT F74C YPThr-cynT F74P YPThr-cynT F74W and YPThr-cynT F74H The strains were inoculated into a 5L fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-threonine fermentation medium and conditions. Each strain was repeated three times.

[0241] The fermentation medium and culture conditions for L-threonine are described in Part IV of Example 1.

[0242] Table 3. Fermentation results of the cynT strain with genome overexpression.

[0243]

[0244]

[0245] The fermentation results above show that cynT and its mutant cynT from Corynebacterium glutamicum F74* All of them could increase the yield of L-threonine, and the differences were significant and highly significant compared with the starting strain W3110 and the threonine-producing strain CGMCC No.25404; among them, YPThr-cynT F74L Higher yield. Therefore, the substitution of phenylalanine at position 74 of the carbonic anhydrase encoded by cynT with amino acids such as leucine, tyrosine, cysteine, proline, tryptophan, and histidine all contribute to the increase of L-threonine production, with the mutant strain that replaces it with leucine showing a more significant advantage.

[0246] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A protein, characterized in that, The protein is any one of the following: A1) A protein, wherein the protein is a cynT mutant protein obtained by replacing the phenylalanine residue at position 74 of the amino acid sequence of the cynT protein with any of the following amino acid residues: Leucine residues, tyrosine residues, cysteine ​​residues, proline residues, tryptophan residues, or histidine residues; the cynT protein is a protein with the amino acid sequence of sequence 2; A2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1).

2. A biomaterial, characterized in that, The biomaterial is any one of the following: B1) A nucleic acid molecule encoding the protein of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

3. The biomaterial as described in claim 2, characterized in that, B1) The nucleic acid molecule is any one of the following: The coding sequence of Z1 is the DNA molecule shown in SEQ ID No. 5; The coding sequence for Z2 is the DNA molecule shown in SEQ ID No. 15; The coding sequence for Z3 is the DNA molecule shown in SEQ ID No. 17; The coding sequence for Z4 is the DNA molecule shown in SEQ ID No. 19; The coding sequence for Z5 is the DNA molecule shown in SEQ ID No. 21; The coding sequence for Z6 is the DNA molecule shown in SEQ ID No.

23.

4. The biomaterial as described in claim 2 or 3 is characterized in that, B4) The recombinant microorganism is a recombinant Escherichia coli microorganism.

5. The biomaterial as described in claim 2 or 3, characterized in that, B4) The recombinant microorganism is recombinant Escherichia coli.

6. The use of any of the following materials in increasing microbial L-threonine production or in the preparation of products that increase microbial L-threonine production: C1) Protein, wherein the protein is the protein according to claim 1; C2) A substance that enhances the expression of the gene encoding the protein described in C1); The substance that enhances the expression of the gene encoding the protein is any one of the following: D1), the nucleic acid molecule encoding the protein described in C1); D2), an expression cassette containing the nucleic acid molecules described in D1); D3), ​​a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3).

7. The use as described in claim 6, characterized in that, The microorganisms mentioned are Escherichia coli.

8. The use as described in claim 6, characterized in that, The microorganism in question is Escherichia coli.

9. A method for increasing the yield of L-threonine from microorganisms, characterized in that, The method includes increasing the content of the protein of claim 1 in the target microorganism by introducing the gene encoding the protein of claim 1, thereby increasing the microbial L-threonine production.

10. A method for constructing a recombinant microorganism, the method comprising upregulating the expression of the protein-coding gene of claim 1 or the content of the protein in a target microorganism to obtain a recombinant microorganism with a change in L-threonine production, wherein the L-threonine production of the recombinant microorganism is higher than that of the target microorganism.

11. The method as described in claim 10, characterized in that, The upregulation of the expression of the protein-coding gene of claim 1 in the target microorganism is achieved by introducing at least one of the protein-coding genes of sequence 6, sequence 16, sequence 18, sequence 20, sequence 22 or sequence 24 into the target microorganism.

12. A method for preparing L-threonine, characterized in that, The method includes producing L-threonine using the protein of claim 1 or the biomaterial of claim 2 or 3.

13. The method according to any one of claims 9-12, characterized in that, The microorganisms mentioned are Escherichia coli.

14. The method according to any one of claims 9-12, characterized in that, The microorganism in question is Escherichia coli.

Citation Information

Patent Citations

  • PRocess for production of L-amino acid

    CN102498216A