Reference gene of 'doulu' peony and primer and application thereof

By using UBC and MBF1A as internal reference genes for floral organs and tissues, and GAPDH and ACT as internal reference genes for developmental stages in 'Doulu' peony, and designing specific primers for quantitative PCR, the problem of the lack of universality of internal reference genes in 'Doulu' peony was solved, and rapid and convenient gene expression detection was achieved, which promoted the research and breeding of green peony varieties.

CN116287378BActive Publication Date: 2026-03-17HENAN UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310052252.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-02
Publication Date
2026-03-17
Estimated Expiration
2043-02-02

AI Technical Summary

Technical Problem

In existing technologies, the internal reference gene of 'Doulu' peony lacks universality, making it impossible to accurately and reliably detect its gene expression, which has become a bottleneck restricting its theoretical research and molecular breeding.

Method used

UBC and MBF1A were used as internal reference genes for different floral organs and tissues of 'Dou Lü' peony, and GAPDH and ACT were used as internal reference genes for petaloid stamens at different developmental stages. Specific primers were designed for quantitative PCR detection, and a stable quantitative PCR system was constructed.

Benefits of technology

This method enables rapid, simple, and reliable detection of gene expression in the 'Doulu' peony variety, providing a basis for subsequent gene function research and the breeding of new green peony varieties, improving ornamental quality, and providing a reference for the study of maintaining green color in other green peony varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287378B_ABST
    Figure CN116287378B_ABST
Patent Text Reader

Abstract

The present application relates to the internal reference gene of 'bean green' peony and its primer and application, and belongs to the field of biotechnology, the present application takes green peony 'bean green' as the test material, analyzes the expression stability of 9 candidate internal reference genes, and the results show that UBC and MBF1A In different tissues of 'bean green'; GAPDH and ACT In different development periods of 'bean green' petal stamen, the present application constructs a stable and reliable quantitative detection system of 'bean green', provides a basis for gene expression analysis in 'bean green' peony and the molecular mechanism research of 'bean green' flower type and flower color formation, provides technical support for prolonging the coloring time of 'bean green' flower and improving its ornamental quality, provides a reference for the green flower research of other varieties of green peony, and also provides a theoretical basis for the subsequent cultivation of new varieties of green flower peony.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and relates to the fields of landscaping, horticulture, and molecular breeding. Specifically, it relates to the internal reference gene of 'Doulu' peony, its primers, and applications. Background Technology

[0002] Quantitative real-time PCR (qRT-PCR) is one of the most common techniques in molecular biology for detecting gene expression. qRT-PCR is simple to operate, highly specific, sensitive, efficient, and rapid, and has become an essential basic detection method for gene function research.

[0003] When using qRT-PCR to analyze gene expression, it is necessary to correct the experimental results using a suitable internal reference gene to eliminate potential errors caused by different RNA samples. An ideal internal reference gene should have a high expression level and be stably expressed in different tissues, at different growth and development stages, and under different treatment conditions. Screening for a suitable internal reference gene is a prerequisite for obtaining reliable qRT-PCR analysis results.

[0004] Peony (Paeonia suffruticosa), originating in my country, is a prized ornamental and medicinal plant belonging to the genus Paeonia and section Moutan DC of the family Paeoniaceae. Renowned for its large flowers and vibrant colors, it is known as the "King of Flowers." Cultivated peony varieties have undergone repeated hybridization during breeding, resulting in unclear genetic backgrounds. Lv et al. sequenced the genome of the peony variety 'Luoshen Xiaochun', obtaining a 13.79 Gb genome sequence. The transcriptome and genome data of 'Luoshen Xiaochun' showed a match rate of only 73.2%. The match rates between the transcriptome data and the genome of the other four publicly reported peony varieties were even lower, ranging from only 0.04% to 68.41%, indicating high genetic diversity among different peony varieties (Lv et al., 2020), leading to a lack of universality in peony reference genes. The applicable internal reference genes vary significantly among different peony varieties, and even within the same peony variety, different tissues, and different treatment conditions, the applicable internal reference genes differ. β-actin and b-tubulin were the most stable during the dormancy release process of 'Luhehong' flower buds (Zhang Yuxi et al., 2011); CYC and EF2α were the most stable internal reference gene combinations in Yunnan peony seeds (Pan Mohan et al., 2020). ubiquitin and GAPDH were the most stable internal reference gene combinations in 'Luoyanghong' under different experimental conditions (Wang Yanjie et al., 2012). Li Jian et al. tested the stability of 10 candidate internal reference genes in petals of 3 peony varieties at 6 developmental stages. The results showed that GAPDH and UBC were the most stable in 'Fengdan' and 'Xishi', while EF-1α and UBC were the most stable in 'Quehao' (Li et al., 2016). Liu Hongfeng et al. studied 33 samples from three peony varieties—'Fengdan,' 'Xishi,' and 'Quehao'—and screened 16 candidate internal reference genes. Among the petals of 'Fengdan,' 'Xishi,' and 'Quehao' at different developmental stages, ERVTP and PP2CFP were the most stable; among the petals of 'Fengdan' with different color gradients, RPS9 and ARFA1C were the most stable; among the different tissues of 'Fengdan,' AMPDS and PUF1639 were the most stable; and among the seeds of 'Fengdan' at different developmental stages, RPS9 and PUF1639 were the most stable (Liu Hongfeng et al., 2015). These results indicate that the stability of internal reference genes varies greatly among different peony varieties, and that peony internal reference genes are not universally applicable across different varieties, tissues, and treatment conditions. Therefore, when conducting gene expression analysis in peonies, it is necessary to screen for suitable combinations of internal reference genes.

[0005] There are over 2,000 varieties of peonies worldwide, with more than 1,000 of them found in China. Vibrant flower colors are the focal point of peony appreciation. Wild peony varieties have relatively uniform flower colors, but through long-term natural and artificial selection, their colors have gradually become more diverse. Currently, nine major color systems have been developed: red, pink, yellow, purple, green, white, black, blue, and multi-colored. Each color system has further derived various transitional and similar colors. Green flowers are due to the synthesis of chlorophyll in the petal tissue. Many plant flowers contain chlorophyll in their early development, but the chlorophyll content in the petal tissue decreases sharply after the flower opens. In nature, green flowers are inconspicuous, failing to attract pollinators and hindering plant reproduction, generally preventing successful propagation. In ornamental horticulture, green flowers are considered a precious and rare trait, and have been selected and developed, resulting in stable varieties. Currently, green-flowered varieties have been cultivated in a few flower species, such as peonies, herbaceous peonies, chrysanthemums, roses, orchids, and lilies, but research on the coloring mechanism of green flowers is still insufficient.

[0006] Currently, more than ten green-flowered peony varieties have been cultivated, but none of them can maintain their green color for long. The flowers gradually fade as the flowering process progresses, turning into a mix of green and white ('Jade'), white ('Emerald Curtain', 'Green Curtain', 'Green Curtain Hidden Jade', 'Green Fragrance Ball'), or pink ('Bean Green', 'Jade Ball', 'Lotus Green', 'Green Fragrance Ball', 'Blooming Green') in the later stages of flowering. This severely affects their ornamental quality and does not meet the expectations of the general public for "green peonies." Research on green-flowered peonies mainly focuses on genetic classification, conventional breeding, and cultivation techniques; research on their coloring mechanisms has not yet been reported.

[0007] 'Doulu' is a rare green variety from the Central Plains Peony, the largest peony variety in China, and one of the four most famous peony varieties, boasting a long history and international renown. In the early stages of flower organ development, 'Doulu' is a vibrant green. As the flower organs mature, the petals loosen, and the color turns a pinkish-white when in full bloom. The fading of the green during the opening process severely impacts the ornamental quality of 'Doulu'. 'Doulu' flowers are crown-shaped or hydrangea-shaped, with completely petaloid stamens and pistils. The petaloid stamens form the main part of its flower organs and are excellent material for studying the mechanism of peony flower shape formation.

[0008] 'Doulu' is the most famous and typical variety of green peony. Its coloring mechanism is of great reference value to other green peony varieties and is also a good material for studying the formation mechanism of peony flower shape. However, the internal reference genes of all other peony varieties that have been reported are not applicable to 'Doulu', and the expression of 'Doulu' related genes cannot be accurately and reliably detected, which has become a bottleneck restricting its theoretical research and molecular breeding. Summary of the Invention

[0009] To address the aforementioned problems, the present invention aims to provide a quantitative PCR system for detecting gene expression in different floral organs or petaloid stamens of the 'Dou Lü' peony at different developmental stages. The constructed system is stable and reliable, and can rapidly and easily detect the relative expression of genes related to the green peony 'Dou Lü' in batches, providing an important basis for subsequent gene function research and the breeding of new green peony varieties.

[0010] To achieve the above objectives, the specific solution adopted by the present invention is as follows:

[0011] Quantitative PCR was used to detect the expression of internal reference genes in different floral organs and tissues of 'Dou Lü' peony. The internal reference genes were UBC and MBF1A. The nucleotide sequence of the UBC gene is shown in SEQ ID NO: 27. The nucleotide sequence of the MBF1A gene is shown in SEQ ID NO: 24.

[0012] Preferably, the different floral organs of the 'Dou Lü' peony include sepals, petals, petaloid stamens, and petaloid pistils.

[0013] The specific primers used to amplify the above-mentioned internal reference genes are as follows: primers for amplifying the internal reference gene UBC are shown in SEQ ID NO:17 and SEQ ID NO:18; primers for amplifying the internal reference gene MBF1A are shown in SEQ ID NO:11 and SEQ ID NO:12.

[0014] A quantitative PCR detection system for different floral organs and tissues of 'Dou Lü' peony is disclosed, using UBC and MBF1A as internal reference genes. Primers for amplifying the internal reference gene UBC are shown in SEQ ID NO:17 and SEQ ID NO:18; primers for amplifying the internal reference gene MBF1A are shown in SEQ ID NO:11 and SEQ ID NO:12.

[0015] The above-mentioned internal reference gene, specific primers or quantitative PCR detection system were used in the detection of gene expression in different floral organs and tissues of 'Dou Lü' peony.

[0016] Quantitative PCR was used to detect the expression of internal reference genes in the petaloid stamens of 'Dou Lü' peony at different developmental stages. The internal reference genes were GAPDH and ACT. The nucleotide sequence of the GAPDH gene is shown in SEQ ID NO: 25. The nucleotide sequence of the ACT gene is shown in SEQ ID NO: 19.

[0017] Furthermore, the different developmental stages of the petaloid stamens of the 'Dou Lü' peony include the color-revealing stage (I), the opening stage (II), the initial opening stage (III), the half-opening stage (IV), the full bloom stage (V), and the initial decline stage (VI).

[0018] Specific primers for amplifying the above internal reference genes. The primers for amplifying the internal reference gene GAPDH are shown in SEQ ID NO:13 and SEQ ID NO:14; the primers for amplifying the internal reference gene ACT are shown in SEQ ID NO:01 and SEQ ID NO:02.

[0019] A quantitative PCR detection system for petaloid stamens of 'Doulü' peonies at different developmental stages, using GAPDH and ACT as internal reference genes. The primers for amplifying the internal reference gene GAPDH are shown in SEQ ID NO:13 and SEQ ID NO:14; the primers for amplifying the internal reference gene ACT are shown in SEQ ID NO:01 and SEQ ID NO:02.

[0020] Application of the above internal reference genes, specific primers or quantitative PCR detection system in detecting gene expression in petaloid stamens of 'Doulü' peonies at different developmental stages.

[0021] Beneficial effects: The present invention can batch, quickly, simply and reliably detect the relative expression of genes related to the green peony 'Doulü' only with ordinary conventional molecular biology instruments and reagents. The system is simple and reliable, with strong operability, suitable for large-scale screening, and can provide target sites for subsequent regulation of peony flower types by horticultural and chemical methods. It can also utilize the rich peony resource library in Luoyang to batch screen mutant genes related to flower types and construct a mutant gene library of peony flower types; the present invention provides a basis for extending the coloring time of 'Doulü' flowers and improving their ornamental quality, provides a reference for the green-holding research of other green-flowered peony varieties, and can also provide support for the subsequent cultivation of new green-flowered peony varieties; it provides gene resources and a basis for subsequent theoretical research and molecular breeding of peony varieties. Brief Description of the Drawings

[0022] Figure 1 It is the phenotype diagram of 'Doulü'; 'Doulü' is green when it first blooms and fades to white after blooming. The stamens and pistils of 'Doulü' are petaloid, and the petaloid stamens are the main part of its flower organs.

[0023] Figure 2 It is the agarose gel electrophoresis pattern of candidate internal reference genes of 'Doulü'.

[0024] Figure 3 It is the melting curve of candidate internal reference genes.

[0025] Figure 4 It is the analysis of the expression stability value (M value) and paired variation value (V value) of candidate internal reference genes by geNorm software; among them, A: M value of internal reference genes in different tissues of 'Doulü'; B: V value of internal reference genes in different tissues of 'Doulü'; C: M value of internal reference genes in petaloid stamens of 'Doulü' at different developmental stages; D: V value of internal reference genes in petaloid stamens of 'Doulü' at different developmental stages.

[0026] Figure 5 This is a diagram showing the expression of the PsCUC3 gene in different floral organs of the 'Doulu' peony.

[0027] Figure 6 This is a diagram showing the expression of the PsNAC5 gene in different floral organs of the 'Doulu' peony.

[0028] Figure 7 This is a diagram showing the expression of the PsNAC24 gene in different floral organs of the 'Doulu' peony.

[0029] Figure 8 This is a diagram showing the expression of the PsCLH gene in the petaloid stamens of the 'Dou Lü' peony at different developmental stages.

[0030] Figure 9 This diagram shows the expression of the PsPAO gene in the petaloid stamens of the 'Dou Lü' peony at different developmental stages.

[0031] Figure 10 This is a diagram showing the expression of the PsNAC24 gene in the petaloid stamens of the 'Dou Lü' peony at different developmental stages. Detailed Implementation

[0032] This invention uses the green peony 'Doulv' as experimental material and analyzes the expression stability of nine candidate internal reference genes using conventional PCR, qRT-PCR, and software such as geNorm, NormFinder, and BestKeeper. The results show that UBC and MBF1A are the most stable genes in different floral organ tissues of 'Doulv'; GAPDH and ACT are the most stable genes in the petaloid stamens of 'Doulv' at different developmental stages. This invention constructs a stable and reliable quantitative detection system for 'Doulv', providing a basis for gene expression analysis in 'Doulv' peony and research on the molecular mechanisms of 'Doulv' flower shape and color formation.

[0033] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Unless otherwise specified, the reagents used in the following embodiments are all conventional commercially available reagents, and the operations used are all conventional technical means.

[0034] Example 1

[0035] I. Quantitative PCR Primer Screening

[0036] 1. cDNA of petaloid stamens from different floral organs and tissues of the 'Doulu' peony at different stages was obtained.

[0037] This section allows for the use of reagents and systems commonly used by various laboratories, as needed. 'Dou Lü' stamens were collected at the following stages: color reveal (I), opening stage (II), initial opening stage (III), half-open stage (IV), full bloom stage (V), and initial decline stage (VI). Petals, petaloid pistils, and sepals were also collected. After quick-freezing in liquid nitrogen, RNA was extracted using a polysaccharide- and polyphenol-free RNA extraction kit (due to high polysaccharide content in the samples, this kit is essential). Agarose gel electrophoresis was used to assess RNA extraction efficiency. If the RNA bands were clear and bright, the RNA concentration was determined. cDNA was then synthesized using a reverse transcription kit, adjusting the RNA concentration to 1000 ng / 20 μl during reverse transcription. The TaKaRaMiniBEST Plant RNA Extraction Kit and PrimeScript reverse transcription kit from Takara Bio are recommended. TM The synthesized cDNA was stored at -20°C until use. The RT reagent kit with gDNA Eraser (Perfect Real Time) was used.

[0038] 2. Selection of candidate internal control genes and primer design for 'Doulu' peony

[0039] Based on the research results of internal reference genes in peony varieties such as 'Luhehong' (Zhang Yuxi et al., 2011), 'Yunnan Peony' (Pan Mohan et al., 2020), 'Fengdan', 'Xishi', 'Quehao' (Ji Siyu, 2013; Liu Hongfeng et al., 2015; Li et al., 2016), and 'Luoyanghong' (Wang Yanjie et al., 2012; Liu Chuanjiao et al., 2015), nine candidate internal reference genes were selected (Table 1): actin gene (ACT), β-tubulin gene (TUB), ubiquitin conjugating enzyme gene (UBC), ubiquitin gene (UBQ), ubiquitin protein ligase gene (UPL), protein phosphatase 2A gene (PP2A), and protein phosphatase 2C gene (PP2A). The gene sequences of 2C (PP2C), multiprotein bridging factor 1A (MBF1A), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were extracted from the 'Doulv' transcriptome data by blasting based on homology comparison (SEQ ID NO:19-27).

[0040] Primers for quantitative PCR were designed using Primer Premier 5.0, with primer lengths ranging from 20 to 25 bp and amplification product lengths from 140 to 233 bp. The PP2C primer sequences were based on the results of Liu Hongfeng et al. (Liu Hongfeng et al., 2015). Primers were synthesized by Shanghai Sangon Biotech, as shown in Table 1.

[0041] Table 1 Primer information for quantitative PCR

[0042]

[0043] 3. Conventional PCR analysis and amplification efficiency detection of candidate internal reference genes.

[0044] For conventional PCR analysis of candidate genes, 'Doulv' mixed cDNA diluted 10-fold was used as a template. The reaction mixture consisted of: 10 μL of 2×Taq PCR MasterMix, 1.0 μL of cDNA, 0.5 μL each of forward and reverse primers (10 μmol / L), and ddH2O added to a final volume of 20.0 μL. The following procedure was followed: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. After the reaction, 1.5% agarose gel electrophoresis was used to detect the amplification of the PCR products. The results are as follows: Figure 2 As shown.

[0045] like Figure 2 As shown, UPL did not produce a band, while the PCR products of the other eight internal reference genes ranged from 100 to 250 bp, consistent with the expected results. The PCR product bands were single and showed no primer dimers, making them suitable for subsequent analysis.

[0046] 4. Detection of amplification efficiency of candidate internal reference genes

[0047] The 'bean green' cDNA template was diluted sequentially to 5-6 gradients, with each gradient being diluted 5-fold (1, 5, 5). 2 5 3 5 4 5 5 Diluted several times. The reaction system was TB Green. TM Premix Ex Taq TM5 μL of Tli RNaseH Plus (TaKaRa), 0.5 μL each of upstream and downstream primers (10 μmol / L), 1 μL of cDNA mixed at different dilutions of 'Dou Lv', and 3 μL of ddH2O, for a total of 10 μL. The quantitative PCR reaction used a two-step method: 95℃ pre-denaturation for 60 s; 95℃ denaturation for 10 s, 60℃ extension for 30 s, for a total of 40 cycles. After the cycles, the temperature was increased to 95℃ for 10 s, 65℃ for 60 s, and then slowly raised to 97℃. A melting curve was plotted to detect the specificity of the quantitative PCR product. Each sample was replicated three times, a standard curve was plotted, and the amplification efficiency of each primer pair was calculated using the following formula: E = [10 (1 / -斜率) -1]×100% (Pfaffl., 2001). For example... Figure 3 As shown, the amplification products are all single peaks, and the negative control did not produce any peaks, which preliminarily meets the conditions for quantitative PCR analysis.

[0048] R of all standard curves 2 All values ​​were greater than 0.99 (Table 2). The QRT-PCR experiment requires primer amplification efficiencies between 90% and 105%. PP2A had an amplification efficiency of 165.38%, which is greater than 105% and does not meet the requirement. The remaining 7 primer pairs met the requirements and could be used for subsequent analysis (Table 2).

[0049] Table 2 Quantitative PCR amplification efficiency and R 2 .

[0050]

[0051] 5. Analysis of expression stability of 'Doulv' candidate internal reference gene.

[0052] (1)geNorm

[0053] The geNorm software assesses the stability of internal reference genes by calculating their M-value (Expression stability value). An M-value less than 1.5 is required; the smaller the M-value, the more stable the internal reference gene. geNorm can also calculate the V-value (Pairwise variation value) for different combinations of internal reference genes to determine the required number of internal reference genes. The default V-value is 0.15. n / V n+1 If the value is less than 0.15, then the optimal number of internal reference genes is n. For example... Figure 4 As shown in Figure A, among the different tissues of 'Bean Green' (sepals, petals, petaloid stamens, petaloid pistils), MBF1A and UBC exhibit the best stability. Figure 4 As shown in Figure B, the paired variance value V in different tissues of 'Bean Green' is... 2 / 3The value was 0.080, which is less than 0.15, so the combination of two genes as internal reference genes in different tissues of 'Dou Lü' (a type of 'green bean') can meet the requirements. The petaloid stamens are the main part of the 'Dou Lü' flower organs and determine its flower color variation; therefore, the expression of internal reference genes in the petaloid stamens was also analyzed. For example... Figure 4 As shown in Figure C, among the petaloid stamens at the stages of color emergence, opening, initial opening, half-opening, full bloom, and initial decline, GAPDH and UBC exhibit the best stability. Figure 4 As shown in D, the pairing variation value V in petaloid stamens at different developmental stages 2 / 3 The value is 0.147, which is less than 0.15, so the combination of the two genes as internal reference genes for petaloid stamens at different developmental stages of 'Dou Lv' can meet the requirements.

[0054] (2) NormFinder

[0055] Like geNorm, NormFinder uses expression stability values ​​to screen reference genes. A lower expression stability value indicates a more stable candidate reference gene, but NormFinder can only select one optimal reference gene. As shown in Table 3, UBC exhibits the best stability in different floral organ tissues of 'DouLü'; as shown in Table 4, GAPDH shows the best stability in petaloid stamens at different developmental stages of 'DouLü'.

[0056] Table 3 shows the stability of candidate internal reference genes in different floral organ tissues of 'Dou Lü' using NormFinder software analysis.

[0057]

[0058] Table 4 shows the stability of candidate internal reference genes in petaloid stamens of 'Dou Lü' at different stages, analyzed using NormFinder software.

[0059]

[0060] (3) BestKeeper

[0061] BestKeeper software does not require calculating relative expression levels. Simply input the Cq values ​​obtained from quantitative PCR experiments into the software, and it will automatically calculate the correlation coefficient (r), standard deviation (SD), and coefficient of variation (CV) between candidate internal reference genes. When SD is greater than 1, the candidate internal reference gene is unstable; when SD is less than 1, the larger the r, and the smaller the SD and CV, the better the stability of the internal reference gene. By analyzing and comparing the values, the internal reference gene with good stability is determined. As shown in Table 5, in different floral organ tissues of 'DouLü', the correlation coefficients (r) of UBQ and PP2C are -0.315 and 0.034, respectively, and the standard deviation (SD) of TUB is 1.74, which is greater than 1. Therefore, these three genes will not be considered in subsequent analyses. In different tissues of 'DouLü', UBC has the smallest standard deviation (SD) and the best stability.

[0062] Table 5 shows the stability of candidate internal reference genes in different floral organ tissues of 'Dou Lü' using BestKeeper software analysis.

[0063]

[0064] As shown in Table 6, among the petaloid stamens at different developmental stages of 'Dou Lv', the standard deviation (SD) of PP2C and TUB were both greater than 1, and they were not considered in subsequent evaluations; MBF1A had the smallest standard deviation (SD) and the best stability.

[0065] Table 6 shows the stability of candidate internal reference genes in petaloid stamens of 'Dou Lü' at different stages, analyzed using BestKeeper software.

[0066]

[0067] (4) Comprehensive evaluation of geNorm, NormFinder and BestKeeper

[0068] The geometric mean of the analysis results for geNorm, NormFinder, and BestKeeper was calculated to comprehensively evaluate the stability of the internal reference genes. For example... Figure 4 As shown in B, the combination of two internal reference genes can meet the requirements in different floral organ tissues of 'Dou Lü'. As shown in Table 7, UBC and MBF1A exhibit the best stability. In petaloid stamens at different developmental stages of 'Dou Lü', the combination of two internal reference genes can meet the requirements (…). Figure 4 D), as shown in Table 8, GAPDH and ACT have the best stability.

[0069] In summary, UBC and MBF1A are the optimal internal reference gene combinations for different floral organ tissues of 'Dou Lv'; GAPDH and ACT are the optimal internal reference gene combinations for petaloid stamens at different developmental stages of 'Dou Lv'.

[0070] Table 7. Comprehensive analysis of the stability of candidate internal reference genes in different floral organs and tissues of 'Doulv' variegation.

[0071]

[0072]

[0073] Table 8. Comprehensive analysis of the stability of candidate internal reference genes in petaloid stamens of 'Doulv' at different developmental stages.

[0074]

[0075] II. Quantitative PCR Detection System for Different Floral Organs and Tissues of 'Doulv' Peony

[0076] Based on the screening results, UBC and MBF1A were used as internal reference genes in different floral organ tissues of 'Dou Lü' variegated 'Bean Green' to meet the requirements of quantitative PCR analysis. The relevant primer information is as follows:

[0077] Table 9. Primer information for quantitative PCR of different floral organs and tissues of 'Dou Lü' peony.

[0078]

[0079] The reaction system is a standard quantitative PCR system, and commonly used quantitative PCR reagents in the laboratory can be used. TB Green from Takara Bio is recommended. TM Premix Ex Taq TM II (Tli RNaseH Plus):

[0080] The cDNA from the sepals, petals, petaloid stamens, and petaloid pistils of the 'Dou Lü' peony synthesized in the aforementioned steps were diluted 20-fold and used as templates for quantitative PCR. The reaction system is as follows:

[0081]

[0082] Total: 10 μl

[0083] After the quantitative primers are synthesized, the primer powder is dissolved in water as required and then mixed in equal proportions to serve as primers for the quantitative reaction.

[0084] UBC and MBF1A were used as internal control genes. Two biological replicates and three technical replicates were set up for each tissue sample.

[0085] Set the quantitative PCR instrument as follows: 95℃ for 60s; 95℃ for 5s, 60℃ for 30s, for a total of 40 cycles; after the cycle, 95℃ for 10s, 65℃ for 60s, and slowly increase the temperature to 97℃, and plot the melting curve.

[0086] After the quantitative PCR reaction is complete, the Cq value is read and calculated using the following formula:

[0087] ΔCt = Target gene Cq - Internal reference gene Cq

[0088] ΔCt = ΔCt - Average value of petal sample ΔCt (with petal sample set as control)

[0089] Relative expression level = 2 -ΔΔCt

[0090] The relative expression level of the target gene is the average value calculated using UBC and MBF1A as internal reference genes.

[0091] III. Quantitative PCR Detection System for Main Organs (Petalized Stamens) of 'Dou Lü' Peony

[0092] Based on the screening results, GAPDH and ACT can meet the requirements for quantitative PCR analysis in petaloid stamens at different developmental stages of 'Dou Lv' stamens. The relevant primer information is as follows:

[0093] Table 10 Primer information for quantitative PCR of the main organs (petalous stamens) of the 'Dou Lü' peony flower.

[0094]

[0095] The reaction system is a standard quantitative PCR system, and commonly used quantitative PCR reagents in the laboratory can be used. TB Green from Takara Bio is recommended. TM Premix Ex Taq TM II (Tli RNaseH Plus). The cDNA from the petiolate stamens of 'Dou Lü' at the stages of color emergence (I), bud opening (II), initial opening (III), half-opening (IV), full bloom (V), and initial decline (VI) synthesized in the previous steps was diluted 20-fold and used as templates for quantitative PCR. The reaction system is as follows:

[0096]

[0097] Total: 10 μl

[0098] After the quantitative primers are synthesized, the primer powder is dissolved in water as required and then mixed in equal proportions to serve as primers for the quantitative reaction.

[0099] GAPDH and ACT were used as internal control genes. Two biological replicates and three technical replicates were set up for each tissue sample.

[0100] Set the quantitative PCR instrument as follows: 95℃ for 60s; 95℃ for 5s, 60℃ for 30s, for a total of 40 cycles; after the cycle, 95℃ for 10s, 65℃ for 60s, and slowly increase the temperature to 97℃, and plot the melting curve.

[0101] After the quantitative PCR reaction is complete, the Cq value is read and calculated using the following formula:

[0102] ΔCt = Target gene Cq - Internal reference gene Cq ΔCt = ΔCt - Average ΔCt value of petaloid stamens at the color-revealing stage (samples of petaloid stamens at the color-revealing stage are set as controls)

[0103] Relative expression level = 2 -ΔΔCt

[0104] The relative expression level of the target gene is the average value calculated using GAPDH and ACT as internal reference genes.

[0105] Example 2

[0106] I. Quantitative PCR detection of different floral organs and tissues of 'Dou Lü' peony

[0107] 1. PsCUC3 gene

[0108] Based on the transcriptome sequence information, quantitative PCR primers for the PsCUC3 gene were designed using Primer Premier 5.0. The sequence of the front primer was 5'TGCTGGTTCGTCTGGCTTG 3', and the sequence of the back primer was 5'AGGTGAAAACGAGGGCTGGAG3'.

[0109] UBC and MBF1A were used as internal controls to detect the expression level of the PsCUC3 gene in different floral organs of 'Doulv' variegated ... -ΔΔCt The relative expression level of the PsCUC3 gene was calculated using a method.

[0110] like Figure 5 As shown, the expression level of the PsCUC3 gene is high in the petaloid tissues (petals, petaloid stamens and petaloid pistils) of the 'Dou Lü' peony.

[0111] 2. PsNAC5 gene

[0112] Based on the transcriptome sequence information, quantitative PCR primers for the PsNAC5 gene were designed using Primer Premier 5.0. The sequence of the first primer was 5'CCATGCATTGTGGGTATCAGC 3', and the sequence of the second primer was 5'TCGTCTTCACCATCTTTGGAGTC 3'.

[0113] UBC and MBF1A were used as internal controls to detect the expression level of the PsNAC5 gene in different floral organs of 'Doulv' variegated ... -ΔΔCtThe relative expression level of the PsNAC5 gene was calculated using a method.

[0114] like Figure 6 As shown, the expression level of the PsNAC5 gene is high in the sepals and petaloid pistils of the 'Dou Lü' peony.

[0115] 3. PsNAC24 gene

[0116] Based on the transcriptome sequence information, quantitative PCR primers for the PsNAC24 gene were designed using Primer Premier 5.0. The sequence of the first primer was 5'GAGGTTAGCAATGGTTCGTCTTC 3', and the sequence of the second primer was 5'TTCCTTGAGTTTGAGCCTGTCC 3'.

[0117] UBC and MBF1A were used as internal controls to detect the expression level of the PsNAC24 gene in different floral organs of 'Doulv' variegated ... -ΔΔCt The relative expression level of the PsNAC24 gene was calculated using a method.

[0118] like Figure 7 As shown, the PsNAC24 gene was expressed at the highest level in the petals of the 'Dou Lü' peony.

[0119] II. Quantitative PCR detection of the main flower organs (petaloid stamens) of the 'Bean Green' peony.

[0120] 1. PsCLH gene

[0121] Based on the transcriptome sequence information, quantitative PCR primers for the PsCLH gene were designed using Primer Premier 5.0. The sequence of the first primer was 5'TATTTGGAAGGCAATGGTG 3', and the sequence of the second primer was 5'CCGTATAGCTAACTGGATCA 3'.

[0122] Using GAPDH and ACT as internal controls, the expression level of the PsCLH gene in petaloid stamens at different developmental stages of 'Doulv' variegated stamens was detected. The qRT-PCR reaction conditions and procedure were as described above. Two biological replicates and three technical replicates were set up, employing 2... -ΔΔCt The relative expression level of the PsCLH gene was calculated using this method.

[0123] like Figure 8 As shown, the expression of the PsCLH gene gradually increased during the flowering process of 'Doulu' peony, with higher expression levels in the petaloid stamens during the full bloom stage and the initial fading stage after the green color fades and turns white. This indicates that the PsCLH gene is related to the color change of 'Doulu' peony.

[0124] 2. PsPAO gene

[0125] Based on the transcriptome sequence information, quantitative PCR primers for the PsPAO gene were designed using Primer Premier 5.0. The sequence of the first primer was 5'TTCATCATGTAGAGGAGCC 3', and the sequence of the second primer was 5'AGCTAAGATAATCCGCAAC 3'.

[0126] Using GAPDH and ACT as internal controls, the expression level of the PsPAO gene in petaloid stamens at different developmental stages of 'Doulv' variegated stamens was detected. The qRT-PCR reaction conditions and procedure were as described above. Two biological replicates and three technical replicates were set up, employing 2... -ΔΔCt The relative expression level of the PsPAO gene was calculated using this method.

[0127] like Figure 9 As shown, the expression level of the PsPAO gene is high in the petaloid stamens that turn white after fading from green. This indicates that the PsPAO gene is related to the color change of 'Dou Lü' flowers.

[0128] 3. PsNAC24 gene

[0129] Based on the transcriptome sequence information, quantitative PCR primers for the PsNAC24 gene were designed using Primer Premier 5.0. The sequence of the first primer was 5'GAGGTTAGCAATGGTTCGTCTTC 3', and the sequence of the second primer was 5'TTCCTTGAGTTTGAGCCTGTCC 3'.

[0130] Using GAPDH and ACT as internal controls, the expression level of the PsNAC24 gene in petaloid stamens at different developmental stages of 'Dou Lv' variegated stamens was detected. The qRT-PCR reaction conditions and procedure were as described above. Two biological replicates and three technical replicates were set up, employing 2... -ΔΔCt The relative expression level of the PsNAC24 gene was calculated using a method.

[0131] like Figure 10 As shown, the expression of the PsNAC24 gene gradually increased during the flowering process of 'Doulu' peony, with higher expression levels in the petaloid stamens during the full bloom stage and the initial fading stage after the green color fades and turns white. This indicates that the PsNAC24 gene is related to the color change of 'Doulu' peony.

[0132] It should be noted that the above-described embodiments should be understood as illustrative, not as limiting the scope of protection of this invention. The scope of protection of this invention is defined by the claims. For those skilled in the art, some non-essential improvements and adjustments made to this invention without departing from the essence and scope of this invention still fall within the scope of protection of this invention.

Claims

1. An application of an internal reference gene in quantitative PCR detection of 'Doulu' peony, characterized in that: including internal reference genes UBC and MBF1A application in gene expression detection in different floral organ tissues of 'Doulu' peony, and internal reference genes GAPDH and ACT application in gene expression detection in different development periods of petaloid stamen of 'Doulu' peony The different floral organ tissues of the ‘Doulu’ peony include sepals, petals, petaloid stamens, and petaloid pistils; different development stages include the color-exposed stage, the blooming stage, the initial opening stage, the half-open stage, the full-bloom stage, and the initial wilting stage, and the UBC nucleotide sequence of the gene is shown as SEQ ID NO: 27; the MBF1A nucleotide sequence of the gene is shown as SEQ ID NO: 24; the primers for amplifying the internal reference gene UBC are shown as SEQ ID NO: 17 and SEQ ID NO: 18; the primers for amplifying the internal reference gene MBF1A are shown as SEQ ID NO: 11 and SEQ ID NO: 12; The GAPDH The nucleotide sequence of the gene is shown in SEQ ID NO: 25; ACT The nucleotide sequence of the gene is shown in SEQ ID NO: 19; amplification of the internal reference gene. GAPDH The primers are shown in SEQ ID NO:13 and SEQ ID NO:14; amplification of the internal reference gene. ACT The primers are shown in SEQ ID NO:01 and SEQ ID NO:02.