A digital flow microsphere biochemical analysis method based on spherical nucleic acid signal amplification mechanism

By employing a digital flow cytometry microsphere biochemical analysis method based on the signal amplification mechanism of spherical nucleic acids, a sandwich reaction and nucleic acid amplification using magnetic microspheres and functionalized spherical nucleic acids are achieved. This method solves the problems of low sensitivity and reliance on high-end instruments in traditional methods, and enables high-sensitivity analysis of biomarkers with extremely low abundance.

CN116359493BActive Publication Date: 2026-05-12SHAANXI NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310313057.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-28
Publication Date
2026-05-12
Estimated Expiration
2043-03-28

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve highly sensitive and accurate analysis of biomarkers with extremely low abundance, especially when detecting protein or exosome markers in body fluids. Traditional methods are susceptible to interference, rely on high-end instruments and microchambers, are cumbersome to operate, and suffer from low sampling efficiency due to magnetic bead loss.

Method used

A digital flow cytometry microsphere biochemical analysis method based on the signal amplification mechanism of spherical nucleic acids was adopted. Target proteins or exosomes were loaded onto magnetic microspheres with uniform particle size. The signal was converted and amplified by sandwich reaction and efficient nucleic acid amplification through functionalized spherical nucleic acids, and then digital analysis was performed using a flow cytometer.

Benefits of technology

It enables highly sensitive analysis of target proteins or exosomes, simplifies operation, reduces dependence on high-end instruments, and improves the accuracy and efficiency of analysis. It is applicable to various reaction media and nucleic acid amplification methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116359493B_ABST
    Figure CN116359493B_ABST
Patent Text Reader

Abstract

The application discloses a digital flow microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism and belongs to the technical field of protein and exosome marker detection. The application loads antibodies or aptamers on magnetic microspheres, and when the concentration of ultra-micro content targets is high, a single target marker molecule is specifically combined on the surface of one magnetic microsphere. The conversion efficiency of proteins or exosomes to nucleic acids is greatly improved by introducing functionalized spherical nucleic acids, a single target marker molecule on the surface of the microsphere triggers a large amount of nucleic acid amplification, and enough fluorescent signal is enriched to light the single magnetic microsphere, which is a positive microsphere. The magnetic microspheres without the target marker molecules cannot combine the functionalized spherical nucleic acids, trigger nucleic acid amplification and enrich the fluorescent signal, and are negative microspheres. Ordinary flow cytometers can obviously distinguish the positive microspheres from the negative microspheres, and the number of positive microspheres is counted to realize digital analysis of protein or exosome markers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of protein and exosome biomarker detection technology, specifically to a digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism. Background Technology

[0002] Abnormal expression of important proteins or exosome markers in body fluids is directly and closely related to the occurrence and development of related diseases. However, the most challenging aspect of early liquid biopsy for major diseases is the highly sensitive and accurate analysis of extremely low abundance biomarkers. Therefore, achieving highly sensitive and accurate analysis of relevant proteins or exosome markers is of great significance for the screening and diagnosis of early diseases.

[0003] Taking immunoassay for protein biomarkers as an example, current high-sensitivity analyses for protein biomarkers mainly rely on enzyme-linked immunosorbent assays (ELISA) based on analog signal readout modes. These methods primarily reflect the concentration of target protein biomarker molecules based on the overall signal output from the reaction system. While widely used, they are susceptible to interference and have low sensitivity, failing to meet the need for ultrasensitive and accurate analysis of target protein molecules with extremely low abundance in body fluids and unable to reflect inter-individual variability. To address the shortcomings of existing analytical methods, a digital immunoassay method has emerged in recent years. This method can detect target protein molecules at the single-molecule level, thus possessing unique advantages in the ultrasensitive detection of ultra-microscopic target protein molecules. Currently, the most mature and widely commercialized technique is single-molecule array (Sioma) technology. This method uses microwells as independent reaction units and utilizes the Poisson distribution principle. Each magnetic bead is loaded with 1 or 0 target protein molecules. The magnetic beads are then loaded into the microwells, triggering an enzymatic reaction that releases fluorescence, illuminating the microwells and displaying a positive fluorescence signal. Digital analysis of the target protein molecules is achieved by counting the number of positive microwells. Compared to traditional immunoassay methods, this method has a lower detection limit. However, the loading of magnetic beads into the microwells can lead to significant bead loss, resulting in low sampling efficiency and limiting its accuracy. Furthermore, this method requires the preparation of a large number of uniformly sized microwells as microreaction units to segment target protein molecules and generate signals, and the microwells need to be sealed with oil. This process is cumbersome and requires specialized equipment or proprietary reagents / consumables. However, an ideal method for detecting protein or exosome biomarkers should possess similar digital analytical principles while eliminating dependence on high-end instruments and microchambers, and should also be stable, simple, inexpensive, highly efficient, sensitive, and widely applicable. Therefore, this invention provides a digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism. It utilizes non-microchamber-dependent microspheres as completely open, independent reaction carriers. Through a Poisson distribution, one or zero target protein molecules or exosomes are loaded onto their surface. Gold nanoparticles are used as carriers to simultaneously load target protein or exosome-specific recognition elements and high-density nucleic acid amplification primers, forming functionalized spherical nucleic acids that serve as recognition, protein / exosome-nucleic acid signal conversion, and amplification elements. This method leverages efficient nucleic acid amplification to amplify protein and exosome signals, overcoming the technical challenge of proteins and exosomes lacking similar nucleic acid signal amplification mechanisms. Using functionalized spherical nucleic acids as intermediates significantly improves the protein / exosome-to-nucleic acid conversion efficiency. The nucleic acid amplification and fluorescence signal enrichment triggered by a single target molecule are sufficient to illuminate a single microsphere. Digital analysis of target proteins or exosomes can be achieved using simple instruments and operations.

[0005] This invention provides a digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism, characterized by comprising the following steps:

[0006] S1. Prepare functionalized spherical nucleic acids that simultaneously load recognition elements and nucleic acid probes; load capture antibodies or aptamers that specifically recognize target marker molecules onto magnetic microspheres to obtain functionalized magnetic microspheres;

[0007] S2, through the capture antibody or aptamer of S1 functionalized magnetic microspheres, specifically binds to the target biomarker molecule to form magnetic microspheres loaded with one or zero target biomarker molecules;

[0008] S3, through the specific binding of the target biomarker molecule on the S2 magnetic microsphere with the recognition element of the S1 functionalized spherical nucleic acid, forms a sandwich composite structure of magnetic microsphere-single target biomarker molecule-functionalized spherical nucleic acid;

[0009] S4 initiates rolling circle amplification on a single target marker molecule in the sandwich composite structure of S3, and enriches fluorophores to illuminate the corresponding magnetic microspheres, which are positive fluorescent magnetic microspheres; while magnetic microspheres in S2 loaded with 0 target marker molecules do not initiate rolling circle amplification or enrich fluorophores, which are negative fluorescent magnetic microspheres.

[0010] S5 uses flow cytometry to distinguish between positive and negative fluorescent magnetic microspheres in S4, and performs digital analysis of target biomarkers based on the number or proportion of positive fluorescent microspheres.

[0011] Preferably, in S1, the recognition element is a detection antibody or aptamer.

[0012] Preferably, the detection antibodies include specific detection antibodies for prostate-specific antigen (PSA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), and cardiac troponin I (cTnI) proteins, and the aptamers include exosomal membrane protein CD63 aptamers, HER2 aptamers, EpCAM aptamers, and PSA aptamers.

[0013] Preferably, in S1, the capture antibody or aptamer is loaded onto magnetic microspheres via a group reaction or the binding between streptavidin and biotin.

[0014] Preferably, the group reaction is one of the following: reaction of amino with carboxyl group, reaction of amino with epoxy group, reaction of amino with aldehyde group, and reaction of amino with ester group.

[0015] Preferably, the capture antibody includes specific capture antibodies for prostate-specific antigen (PSA), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), and cardiac troponin I (cTnI) protein, and the aptamer includes exosomal membrane protein CD63 aptamer, HER2 aptamer, EpCAM aptamer, and PSA aptamer.

[0016] Preferably, in S2, the target marker molecule is a protein molecule or an exosome.

[0017] Preferably, in S2, when the number of target marker molecules is less than the number of magnetic microspheres, according to the Poisson distribution principle, each magnetic microsphere is loaded with 1 or 0 target marker molecules.

[0018] Preferably, in S4, the high-density nucleic acid probe loaded on the functionalized spherical nucleic acid surface triggers nucleic acid amplification through any one or a combination of extension amplification mechanisms such as rolling circle amplification reaction (RCA) and primer exchange reaction (PER).

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] 1. This invention uses uniformly sized magnetic microspheres as carriers, loading antibodies or aptamers onto the surface of these microspheres. At ultra-micro target marker concentrations, based on Poisson distribution, the antibody or aptamer on the surface of a single magnetic microsphere can specifically bind to a single target protein molecule or exosome. Then, by introducing functionalized spherical nucleic acids to perform a sandwich reaction, the protein or exosome concentration information is converted into nucleic acid quantitative information. Furthermore, using efficient nucleic acid amplification technology, a single target protein molecule or exosome triggers a large amount of nucleic acid amplification and enrichment of sufficient fluorescence signal on the surface of the magnetic microsphere, illuminating the single magnetic microsphere as a positive fluorescence signal (positive microsphere). Magnetic microspheres that do not bind target protein molecules or exosomes cannot bind functionalized spherical nucleic acids, trigger nucleic acid amplification, or enrich fluorescence signal, exhibiting a negative fluorescence signal (negative microsphere). Flow cytometry can clearly distinguish between positive and negative microspheres. Digital analysis of the target protein or exosome is achieved by counting the number of positive microspheres. The mechanism of this invention is as follows: Figure 1 As shown.

[0021] 2. This invention uses microspheres with uniform particle size as fully open independent carrier units, eliminating the need for any closed microreactors such as micropores or microemulsions to distribute target protein molecules or exosomes and to perform signal generation reactions. Furthermore, various surface-functionalized microspheres are readily available, highly stable, and suitable for various reaction media and nucleic acid amplification methods. In addition, this invention does not rely on special equipment for preparing various microreactors, making it simple to operate and universally efficient.

[0022] 3. This invention introduces spherical nucleic acids loaded with high-density nucleic acid amplification primers and probes as signal conversion and amplification elements, which greatly improves the conversion efficiency from target to nucleic acid. This results in the fluorescence signal deposited on the surface of magnetic microspheres loaded with a single target protein molecule / exosome being significantly higher than that of negative microspheres. Flow cytometers, which are widely used in clinical and general laboratories, can be used to make significant differential distinctions between positive and negative microspheres. Attached Figure Description

[0023] Figure 1 This is a mechanism diagram of the present invention;

[0024] Figure 2 This is a scatter plot showing the relationship between the forward scattered light (FSC) intensity and the fluorescence intensity of the FL1 channel of the positive microspheres in Example 1 as the concentration of prostate-specific antigen (PSA) changes.

[0025] Figure 3 This is a standard curve showing the change in the proportion of positive microspheres with PSA concentration in Example 1.

[0026] Figure 4 This is a scatter plot showing the relationship between the forward scattered light (FSC) intensity and the fluorescence intensity of the FL1 channel of the positive microspheres as the exosome concentration changes in Example 2.

[0027] Figure 5 This is a standard curve showing the change in the proportion of positive microspheres with the concentration of exosomes in Example 2. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to these embodiments.

[0029] Example 1

[0030] Taking the detection of PSA molecules based on a sandwich-type immunoreaction as an example, the digital analysis method is as follows:

[0031] 1. Using gold nanoparticles as carriers, PSA-specific detection antibodies and high-density 5' thiol-labeled rolling circle amplification primers and probes (nucleic acid sequence: SH-CCCCCCCCCCTAGCTGAGGATAGGACATAATAGCT) were loaded onto their surfaces to prepare functionalized spherical nucleic acids that specifically recognize PSA.

[0032] 2. A biotin-modified PSA-specific capture antibody was mixed with approximately 1.8 × 10⁻⁶ ppm of... 6 Microspheres labeled with streptavidin (STV) (1.0 μm in diameter) were mixed and reacted in a 10 μL system. The PSA-specific capture antibody was loaded onto the microspheres through the specific reaction between STV and biotin.

[0033] 3. Perform magnetic separation on the microspheres after the reaction in step 2. Add the functionalized spherical nucleic acid obtained in step (1) to the separated microspheres, and add PSA molecules and PBST-BSA buffer solution (1×PBS, 0.1% Tw-20, 1% BSA) to make the final volume of the system 10 μL. Control the concentration of functionalized spherical nucleic acid in the system to 60 pM. The concentrations of PSA molecules are 0 (Blank), 10 fg / mL, 50 fg / mL, 100 fg / mL, 500 fg / mL, 1 pg / mL, 2 pg / mL, 5 pg / mL, and 10 pg / mL, respectively. Perform the immunoreaction at room temperature for 2 h to load 1 or 0 PSA molecules on each microsphere.

[0034] 4. Perform magnetic separation on the microspheres after the reaction in step 3, add 10 nM circular probe template for rolling circle amplification (nucleic acid sequence: GACGGTGTCTATTATGTCCTATCCTCAGCTATTATGTCCTATCCTCAGCTATTATGTCCTATCC) and PBST-BSA buffer solution to the separated microspheres, and react at room temperature for 1 h.

[0035] 5. Perform magnetic separation on the microspheres after the reaction in step 4. Add deoxyribonucleic acid triphosphate (dNTP), phi29 DNA polymerase and phi29 buffer solution to the separated microspheres to make the final volume of the system 10 μL. Control the concentration of dNTP in the system to 0.25 mM and phi29 DNA polymerase to 5 U. Perform nucleic acid extension amplification reaction at 37℃ using a circular probe as a template for 2 h. After the reaction, magnetic separation was performed, and two nucleic acid probes A and B (with nucleic acid sequences TATTATGTCCTATCCTCAGC-AF488 and CTGTCCAAGGAACGGTGTCTATT-AF488, respectively) labeled with bright green fluorescent dye (Alexa Fluor 488, AF488) at their 3' ends were added, along with PBST-BSA buffer solution, to bring the final volume of the system to 10 μL. The concentrations of nucleic acid probes A and B in the system were controlled at 500 nM each. The reaction was carried out at 4 °C for 1 h, allowing nucleic acid probes A and B to hybridize with the extended products of rolling circle amplification and enrich the fluorescent signal. Microspheres loaded with one PSA molecule showed a positive fluorescent signal, while microspheres loaded with zero PSA molecules showed a negative fluorescent signal.

[0036] 6. Using flow cytometry, fluorescence signals from the FL1 channel of 10,000 microbeads in samples corresponding to different PSA concentrations were collected. The number of positive fluorescent microbeads (hereinafter referred to as positive microbeads) and negative fluorescent microbeads (hereinafter referred to as negative microbeads) were counted, and the percentage of positive microbeads (PPB) as a function of PSA concentration (C) was plotted. PSA A linear graph showing the changes is available. Figure 2 and 3 .Depend on Figure 2 and Figure 3 It can be seen that the proportion of positive microspheres and the concentration of PSA show a good linear relationship in the range of 0 to 10 pg / mL, thus realizing digital analysis of PSA.

[0037] Example 2

[0038] Taking the detection of HepG2 exosome based on sandwich reaction as an example, the specific digital analysis method is as follows:

[0039] 1. Using gold nanoparticles as carriers, 3' thiol-labeled exosomal membrane protein CD63 aptamer (nucleic acid sequence: CACCCCACCTCGCTCCCGTGACACTAATGCTACTTTTTTTTTT-SH) and high-density 5' thiol-labeled rolling circle amplification primers and probes (nucleic acid sequence: SH-CCCCCCCCCCTAGCTGAGGATAGGACATAATAGCT) were simultaneously loaded onto their surface to prepare functionalized spherical nucleic acids that specifically recognize exosomes.

[0040] 2. Add the 3' end-labeled biotin CD63 aptamer (nucleic acid sequence: CACCCCACCTCGCTCCCGTGACACTAATGCTACCCCCCCCCC-biotin) to approximately 1.8 × 10⁻⁶ ppm of biotin-labeled CD63 aptamer. 6 Microspheres labeled with streptavidin (STV) (1.0 μm in diameter) were mixed and reacted in a 10 μL system, and the CD63 aptamer was loaded onto the microspheres through the specific reaction of STV and biotin.

[0041] 3. Perform magnetic separation on the microspheres after the reaction in step 2. Add the functionalized spherical nucleic acid obtained in step (1) to the separated microspheres, and add exosomes and PBST-BSA buffer solution (1×PBS, 0.1% Tw-20, 1% BSA) to make the final volume of the system 10 μL. Control the concentration of functionalized spherical nucleic acid in the system to 300 pM, and the concentration of exosomes to be 0 (Blank) and 1.8×10⁻⁶ pM, respectively. 3 exosomes / μL, 5×10 3 exosomes / μL, 9×10 3 exosomes / μL, 1.8×10 4 exosomes / μL, 5×10 4 exosomes / μL, 9×10 4 exosomes / μL, 1.8×10 5 The exosomes were s / μL, and the recognition reaction between the CD63 aptamer and the exosomal membrane protein CD63 was carried out at room temperature for 3 h, so that each microsphere was loaded with 1 or 0 exosomes.

[0042] 4. Perform magnetic separation on the microspheres after the reaction in step 3, add 10 nM circular probe template for rolling circle amplification (nucleic acid sequence: GACGGTGTCTATTATGTCCTATCCTCAGCTATTATGTCCTATCCTCAGCTATTATGTCCTATCC) and PBST-BSA buffer solution to the separated microspheres, and react at room temperature for 1 h.

[0043] 5. Perform magnetic separation on the microspheres after the reaction in step 4. Add deoxyribonucleic acid triphosphate (dNTP), phi29 DNA polymerase and phi29 buffer solution to the separated microspheres to make the final volume of the system 10 μL. Control the concentration of dNTP in the system to 0.25 mM and phi29 DNA polymerase to 5 U. Perform nucleic acid extension amplification reaction with circular probe as template at 37 °C for 2 h. After the reaction, magnetic separation was performed, and two nucleic acid probes A and B (with nucleic acid sequences TATTATGTCCTATCCTCAGC-AF488 and CTGTCCAAGGAACGGTGTCTATT-AF488, respectively) labeled with bright green fluorescent dye (Alexa Fluor 488, AF488) at their 3' ends were added, along with PBST-BSA buffer solution, to bring the final volume of the system to 10 μL. The concentrations of nucleic acid probes A and B in the system were controlled at 500 nM each. The reaction was carried out at 4 °C for 1 h, allowing nucleic acid probes A and B to hybridize with the extension products of rolling circle amplification and enrich the fluorescent signal. Microspheres loaded with one exosome showed a positive fluorescent signal, while microspheres loaded with zero exosomes showed a negative fluorescent signal.

[0044] 6. Using flow cytometry, fluorescence signals from the FL1 channel of 10,000 microbeads in samples corresponding to different concentrations of exosome were collected. The number of positive fluorescent signal microbeads (hereinafter referred to as positive microbeads) and negative fluorescent signal microbeads (hereinafter referred to as negative microbeads) were counted, and the percentage of positive microbeads (PPB) as a function of exosome concentration (C) was plotted. exosome A linear graph showing the changes is available. Figure 4 and 5 .Depend on Figure 4 and Figure 5 It can be seen that the proportion of positive microspheres and the concentration of exosomes are in the range of 0–1.8 × 10⁻⁶. 5 The exosomes exhibit good linearity within the range of s / μL, thus enabling numerical analysis of exosomes.

[0045] It should be noted that for different proteins or exosome biomarkers, for specific target molecules, the method of the present invention only needs to select the corresponding specific recognition probe, and the remaining steps can be completely followed in accordance with the above-described similar detection process to achieve digital analysis of specific target proteins or exosome biomarkers.

Claims

1. A digital flow cytometry method for biochemical analysis of microspheres based on a spherical nucleic acid signal amplification mechanism, characterized in that, Includes the following steps: S1, Prepare functionalized spherical nucleic acids that simultaneously load recognition elements and nucleic acid probes; Capture antibodies or aptamers that specifically recognize target biomarker molecules are loaded onto magnetic microspheres to obtain functionalized magnetic microspheres. S2, through the capture antibody or aptamer on the surface of the S1-functionalized magnetic microspheres, specifically binds to the target biomarker molecule, forming a magnetic microsphere loaded with one or zero target biomarker molecules; S3, through the specific binding of the target biomarker molecule on the S2 magnetic microsphere with the recognition element of the S1 functionalized spherical nucleic acid, forms a sandwich composite structure of magnetic microsphere-single target biomarker molecule-functionalized spherical nucleic acid; S4 initiates a rolling ring amplification reaction on a single target marker molecule in the sandwich composite structure of S3, and enriches fluorophores to light up the corresponding magnetic microspheres, which are positive fluorescent magnetic microspheres. The magnetic microspheres in S2 loaded with 0 target marker molecules do not trigger rolling circle amplification and enrichment of fluorophores, and are therefore negative fluorescent magnetic microspheres. S5 uses flow cytometry to distinguish between positive and negative fluorescent magnetic microspheres in S4, and performs digital analysis of target biomarkers based on the number or proportion of positive fluorescent magnetic microspheres.

2. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 1, characterized in that, In S1, the recognition element is a detection antibody or aptamer.

3. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 2, characterized in that, The detection antibodies include specific detection antibodies for prostate-specific antigen, alpha-fetoprotein, carcinoembryonic antigen, and cardiac troponin I, and the aptamers include exosomal membrane protein CD63 aptamer, HER2 aptamer, EpCAM aptamer, and PSA aptamer.

4. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 1, characterized in that, In S1, the capture antibody or aptamer is loaded onto magnetic microspheres via a group reaction or the binding between streptavidin and biotin.

5. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 4, characterized in that, The group reaction is one of the following: reaction of amino with carboxyl group, reaction of amino with epoxy group, reaction of amino with aldehyde group, and reaction of amino with ester group.

6. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 4, characterized in that, The capture antibodies include specific capture antibodies against prostate-specific antigen, alpha-fetoprotein, carcinoembryonic antigen, and cardiac troponin I protein, and the aptamers include exosomal membrane protein CD63 aptamer, HER2 aptamer, EpCAM aptamer, and PSA aptamer.

7. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 1, characterized in that, In S2, the target marker molecule is a protein molecule or an exosome.

8. The digital flow cytometry microsphere biochemical analysis method based on a spherical nucleic acid signal amplification mechanism according to claim 1, characterized in that, In S2, when the number of target marker molecules is less than the number of magnetic microspheres, according to the Poisson distribution principle, each magnetic microsphere is loaded with 1 or 0 target marker molecules.