MicroRNAs and their use in diagnosis and therapy

By inhibiting the Tyro3/MLKL signaling pathway through miR-494-3p, the high mortality and disability rates of acute pancreatitis have been addressed, providing an effective diagnostic and treatment approach and significantly inhibiting the occurrence and development of pancreatitis.

CN116392500BActive Publication Date: 2026-03-17SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111627103.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-28
Publication Date
2026-03-17
Estimated Expiration
2041-12-28

AI Technical Summary

Technical Problem

The treatment of acute pancreatitis remains challenging, with high mortality, high disability rates, and high costs. Furthermore, little is known about the role of microRNA in acute pancreatitis and pancreatic cancer, and there is a lack of effective treatments.

Method used

miR-494-3p and related reagents are provided for the prevention or treatment of diseases induced by necrosis and apoptosis. By inhibiting the Tyro3/MLKL signaling pathway, downregulating Tyro3 protein levels and Tyr376 phosphorylation of MLKL, cell necrosis and apoptosis are blocked, which can be used for the diagnosis and treatment of pancreatitis.

Benefits of technology

miR-494-3p can significantly inhibit the occurrence and development of acute pancreatitis. By increasing miR-494-3p expression or using its mimics, it can reduce cell necrosis, lower the level of inflammatory factors, protect pancreatic tissue, and provide an effective means of diagnosis and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003439934300000031
    Figure BDA0003439934300000031
  • Figure BDA0003439934300000111
    Figure BDA0003439934300000111
  • Figure BDA0003439934300000161
    Figure BDA0003439934300000161
Patent Text Reader

Abstract

This invention relates to miRNAs and their uses in diagnosis and treatment, specifically providing the use of agents such as miR-494-3p or variants thereof, or analogs thereof, in the preparation of pharmaceutical compositions for the prevention or treatment of diseases induced by necrosis and apoptosis. This invention demonstrates that miRNAs directly participate in the occurrence of diseases induced by necrosis and apoptosis and can be used for the treatment of these diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine. Specifically, it relates to microRNAs for diagnostic and therapeutic purposes. Background Technology

[0002] Acute pancreatitis (AP) is a common acute abdominal condition in clinical practice. It is defined as an inflammatory disease characterized by acute inflammation and necrosis of the pancreatic parenchyma, and is classified according to severity into mild, moderate-to-severe, and severe acute pancreatitis. Its etiology and pathogenesis are complex, and its mortality rate remains high. Epidemiological data shows that AP patients account for approximately 0.27% of hospitalized patients during the same period, with a male-to-female ratio of 1.29:1 and a mean age of onset of 53.7 ± 23.3 years. Both adults and children can be affected. Currently, the treatment of acute pancreatitis remains challenging, characterized by high mortality, high disability rates, and high costs.

[0003] The causes of acute pancreatitis are complex, including biliary tract diseases, long-term excessive alcohol consumption, hyperlipidemia, overeating, medications, surgery and trauma, and parasitic infections. Alcohol and biliary factors are the main contributors, with approximately 80% of acute pancreatitis cases related to excessive alcohol consumption and gallstones. In my country, biliary pancreatitis is predominant, while in Europe and the United States, alcoholic pancreatitis is more common, possibly due to dietary differences between countries and regions. Smoking is a common risk factor for acute pancreatitis, with heavy smokers having more than twice the risk. Furthermore, the risk of acute pancreatitis is significantly increased in individuals using hormone replacement therapy, those with heart disease, and those with hypertension. With the increasing prevalence of obesity, the number of patients with acute pancreatitis caused by hyperlipidemia is also gradually increasing.

[0004] MicroRNAs (miRs or miRNAs) are a class of single-stranded RNA molecules, approximately 18-26 bases in length, widely found in higher eukaryotes. They can specifically bind to target sites on certain mRNAs through base pairing principles, causing degradation or translational repression of the target mRNA, thereby regulating target genes at the post-transcriptional level.

[0005] microRNAs originate from the initial transcription product of long RNA chains approximately 1000 bp in length (Pri-miRNA). In the cell nucleus, Pri-miRNA is cleaved by the Drosha enzyme to form a stem-loop miRNA precursor (Pre-miRNA) approximately 60-80 nt in length. After Pre-miRNA is transported to the cytoplasm, it is further cleaved by the Dicer enzyme to form a double-stranded miRNA approximately 22 nt in length. Once the double-stranded miRNA unwinds, the mature miRNA enters the RNA-induced gene silencing complex, where it pairs completely or incompletely with complementary mRNAs, degrading the target mRNA or inhibiting its expression. Although microRNAs constitute a small proportion of total cellular RNA, their efficient regulatory effects on all mRNAs with target sites make their role in organismal development, inflammatory responses, and the development and progression of inflammation-related tumors undeniable.

[0006] Currently, very little is known about microRNAs associated with acute pancreatitis and acute pancreatitis-related pancreatic cancer. Therefore, there is an urgent need in this field to explore the role of microRNAs in acute pancreatitis and acute pancreatitis-related pancreatic cancer in order to develop effective therapeutic drugs. Summary of the Invention

[0007] The purpose of this invention is to provide a microRNA, miR-494-3p, for the detection and treatment of pancreatitis.

[0008] A first aspect of the present invention provides the use of a reagent in the preparation of a pharmaceutical composition for the prevention or treatment of diseases induced by necrosis and apoptosis; wherein the reagent is selected from the group consisting of:

[0009] (a) miR-494-3p or its variants, or their analogues;

[0010] (b) The precursor of miR-494-3p;

[0011] (c) A polynucleotide that can be transcribed into a precursor of miR-494-3p as described in (b), or can be processed in the host into miR-494-3p as described in (a);

[0012] (d) Nucleic acid constructs, wherein the nucleic acid constructs contain (a), (b) or (c);

[0013] (e)(a) agonists.

[0014] In one or more embodiments, the cell necrosis and apoptosis is Tyro3 / MLKL signaling pathway-related cell necrosis and apoptosis.

[0015] In one or more embodiments, the cell necrosis and apoptosis are MLKL oligomerization-induced cell necrosis and apoptosis.

[0016] In one or more embodiments, the disease is one that benefits from downregulation of Tyro3 protein levels.

[0017] In one or more embodiments, the disease is one that benefits from downregulation of the phosphorylation level of Tyr376 in MLKL.

[0018] In one or more embodiments, the disease is pancreatitis. In one or more embodiments, the pancreatitis is pancreatitis caused by downregulation of miR-494-3p expression; preferably, the pancreatitis includes acute pancreatitis.

[0019] In one or more embodiments, the variant is a variant having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with miR-494-3p.

[0020] In one or more embodiments, the analogue is a derivative, preferably a modified derivative.

[0021] In one or more embodiments, the derivative is an RNA-induced silencing complex (RISC), miR-494-3pagomir, or miR-494-3p mimic.

[0022] In one or more embodiments, the precursor of miR-494-3p is a precursor miRNA or a primary miRNA.

[0023] In one or more embodiments, the nucleotide sequence of miR-494-3p is shown in SEQ ID NO:20.

[0024] In one or more embodiments, the miR-494-3p is derived from human or non-human mammals.

[0025] In one or more embodiments, the non-human mammal is a rat or a mouse.

[0026] In one or more embodiments, the host is a human or a rodent (e.g., a rat or a mouse).

[0027] In one or more embodiments, the nucleic acid construct is an expression vector or integration vector, including but not limited to: plasmids or viral vectors; more preferably, the viral vector is an adenovirus vector or an adenovirus-associated vector.

[0028] In one or more embodiments, the polynucleotide or nucleic acid construct has the structure shown in formula (I):

[0029] Seq 正向 -X-Seq 反向 (I)

[0030] In equation (I), Seq 正向 This is a nucleotide sequence that can be processed into miR-494-3p in the host;

[0031] Seq 反向 To be with Seq 正向 Nucleotide sequences that are essentially complementary or completely complementary;

[0032] X is located at Seq 正向 and Seq 反向 The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 They are not complementary.

[0033] In one or more embodiments, the structure shown in formula (I) forms the secondary structure shown in formula (II) in the cell:

[0034]

[0035] In equation (II), Seq 正向 Seq 反向 The definition of X is as described above, and || represents the expression in Seq. 正向 and Seq 反向 The complementary base pairing relationship between them.

[0036] In one or more embodiments, the miR-494-3p agonist is selected from the group consisting of substances that promote miR-494-3p expression and substances that enhance miR-494-3p activity.

[0037] In one or more embodiments, the sequence of the precursor miRNA is shown in SEQ ID NO:21.

[0038] In one or more embodiments, the precursor miRNA is derived from human.

[0039] In one or more embodiments, the reagent works by inhibiting the Tyro3 / MLKL signaling pathway, or by downregulating Tyro3 protein levels, inhibiting MLKL oligomerization, or downregulating the phosphorylation level of Tyr376 in MLKL.

[0040] Another aspect of the present invention provides a method for diagnosing diseases induced by necrosis and apoptosis, the method comprising: detecting the levels of miR-494-3p in a test sample and a control sample respectively; if the level of miR-494-3p in the test sample is significantly reduced compared with the control sample, it is a potential disease sample for necrosis and apoptosis-induced disease; wherein the control sample shows normal miR-494-3p levels or miR-494-3p levels of healthy individuals.

[0041] In one or more embodiments, the significant reduction means that the expression level of miR-494-3p is reduced by ≥10%, preferably ≥20%, preferably ≥50%, more preferably ≥80%, and most preferably ≥100% compared with the control sample.

[0042] In one or more embodiments, the detection is not intended to obtain a disease diagnosis result.

[0043] In one or more embodiments, the detection method further includes: comparing the test sample and the control sample with one or more of the following: Tyro3 protein level, MLKL oligomerization level, and MLKL Tyr376 phosphorylation level, wherein if the Tyro3 protein level is increased and / or the MLKL oligomerization level is increased and / or the MLKL Tyr376 phosphorylation level is increased, then the test sample is a potential disease sample induced by necrosis and apoptosis.

[0044] In another aspect of the invention, the use of a reagent for detecting miR-494-3p in the preparation of a kit for diagnosing diseases induced by necrosis and apoptosis is provided.

[0045] In one or more embodiments, the reagent is a specific antibody, a specific probe, or a specific primer for detecting miR-494-3p.

[0046] In one or more embodiments, the kit further includes reagents for detecting one or more of the following: Tyro3 protein level, MLKL oligomerization level, and MLKL Tyr376 phosphorylation level.

[0047] In one or more embodiments, the kit may further include other reagents required for immunological detection, nucleic acid hybridization, or nucleic acid amplification, such as buffers, divalent ions, dNTPs, or polymerases.

[0048] In another aspect of the invention, a method is provided for screening potential substances for the prevention or treatment of diseases induced by necrosis and apoptosis, the method comprising:

[0049] (1) Treat the system expressing miR-494-3p with the candidate substance; and

[0050] (2) The expression of miR-494-3p in the system was detected;

[0051] If the candidate substance can increase the expression of miR-494-3p, it indicates that the candidate substance is a potential substance for the prevention or treatment of diseases induced by necrosis and apoptosis.

[0052] In another preferred embodiment, step (1) includes: in the test group, adding the candidate substance to the system expressing miR-494-3p; and / or

[0053] Step (2) includes: detecting the expression of miR-494-3p in the test group system and comparing it with the control group, wherein the control group is a system expressing miR-494-3p without the addition of the candidate substance;

[0054] If the expression of miR-494-3p in the test group is statistically higher than (preferably significantly higher, such as more than 20%, better than 50%, and even better than 80%) the control group, it indicates that the candidate is a potential substance for the prevention or treatment of diseases induced by necrosis and apoptosis.

[0055] In one or more embodiments, the method further includes detecting Tyro3 expression, MLKL oligomerization, or MLKL Tyr376 phosphorylation in the test group system and comparing it with a control group, wherein the control group is the same system as the test group without the candidate substance added.

[0056] In one or more embodiments, the system is selected from: cell systems (such as cells expressing miR-494-3p) (or cell culture systems), subcellular systems, solution systems, tissue systems, organ systems, or animal systems.

[0057] In one or more embodiments, the method further includes: conducting further cell experiments and / or animal experiments on the obtained potential substances to further select and identify substances useful for the prevention or treatment of diseases induced by necrosis and apoptosis from the candidate substances.

[0058] In another aspect of the invention, a method for preventing and treating diseases induced by necrosis and apoptosis is provided, comprising administering to a subject a pharmaceutical composition containing a reagent and a pharmaceutically acceptable excipient, said reagent being selected from one or more of the following:

[0059] (a) miR-494-3p or its variants, or their analogues;

[0060] (b) The precursor of miR-494-3p;

[0061] (c) A polynucleotide that can be transcribed into a precursor of miR-494-3p as described in (b), or can be processed in the host into miR-494-3p as described in (a);

[0062] (d) Nucleic acid constructs, wherein the nucleic acid constructs contain (a), (b) or (c);

[0063] (e)(a) agonists.

[0064] In one or more implementations, the object includes a person.

[0065] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Attached Figure Description

[0066] The accompanying drawings are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0067] Figure 1 The miR-494-3p knockout itself does not affect the pancreatic tissue structure of mice. (a) The relative level of miR-494-3p in the pancreatic tissue of miR-494-3p knockout mice (miR-494-3p- / -) is significantly lower than that of wild-type mice (WT), therefore miR-494-3p knockout was successful; (b) The pancreatic tissue structure of 8-week-old miR-494-3p knockout mice is similar to that of age-matched wild-type mice. Scale bar: 50 μm; ***P<0.001 in the figures above.

[0068] Figure 2In the L-Arg / salicylic acid-induced acute pancreatitis model, miR-494-3p- / - mice exhibited more severe acute pancreatitis than wild-type mice. (a) and (d) show the construction diagrams of the two acute pancreatitis models. (b) shows that 48 h after intraperitoneal injection of L-Arg, miR-494-3p- / - mice expressed higher serum amylase activity than wild-type mice; (c) shows that the pancreatic tissue structure of miR-494-3p- / - mice showed more severe edema, necrosis, and inflammatory factor infiltration than that of wild-type mice, scale bar: 50 μm. (e) shows that 24 h after intraperitoneal injection of salicylic acid, the pancreatic tissue structure of miR-494-3p- / - mice showed more severe edema, congestion, inflammatory factor infiltration, and necrosis than that of wild-type mice, scale bar: 50 μm. (f), (g), and (i) show that intraperitoneal injection of L-Arg or taurine significantly reduced miR-494-3p levels in pancreatic tissues of wild-type mice / rats; (h) shows that, in clinical samples provided by the hospital, the level of miR-494-3p in plasma samples from patients with acute pancreatitis was significantly lower than that in healthy individuals; *P<0.05, **P<0.01, ***P<0.001 in the figures above.

[0069] Figure 3 The results show that necroptosis is involved in the development and progression of acute pancreatitis in L-Arg or taurine-induced acute pancreatitis models. (a) and (b) show that the protein levels of p-RIPK3 (the activated form of RIPK3) and p-MLKL (the active form of MLKL) are significantly increased in both models; (c) shows that in the taurine model, mice treated with intraperitoneal injection of the RIPK1 inhibitor Nec-1 showed that the degree of pancreatic tissue damage was significantly reduced, (d) shows that the degree of pancreatic tissue damage was significantly reduced, scale bar: 50 μm; (e) shows that the protein level of p-MLKL (the activated form of MLKL) in pancreatic tissue was significantly reduced.

[0070] Figure 4The miR-494-3p mimicry was shown to inhibit necroptosis and significantly promote cell survival in in vitro induced apoptosis. (a), (b), and (c) show that transfection with miR-494-3p mimic in MEF, L929, and HT-29 cells to increase miR-494-3p expression significantly inhibited cell necrosis and apoptosis induced by the combined treatment of mTNFa, z-VAD, and Smac (TSZ), and improved cell survival. (d) shows that miR-494-3p mimic also significantly inhibited cell necrosis and apoptosis induced by the combined treatment of mTNFa, CHX, and z-VAD (TCZ) in MEF cells, and improved cell survival. (e) and (f) show that transfection with a miR-494-3p inhibitor in MEF cells to inhibit miR-494-3p function significantly reduced cell survival under the combined treatment of TSZ / TCZ. In the figures above, *P<0.05, **P<0.01, and ***P<0.001.

[0071] Figure 5 The miR-494-3p mimic significantly inhibited MLKL oligomerization during necroptosis. (a), (b), and (c) show that in MEF cells, L929 cells, and HT-29 cells, TSZ induced necroptosis, and after transfection of cells with miR-494-3p mimic to induce miR-494-3p overexpression, non-reducing PAGE results showed that the oligomerization level of MLKL was significantly inhibited; (d) shows that immunofluorescence results in L929 cells also indicated that miR-494-3p mimic could significantly inhibit MLKL oligomerization.

[0072] Figure 6 The results show that miR-494-3p targets and regulates Tyro3. (a) The miR-494-3p and Tyro3 mRNA 3'UTR sequences are complementary; (b) In dual-luciferase reporter gene assays, miR-494-3p mimic significantly inhibited the fluorescence signal of Tyro3 mRNA 3'UTR, but had no effect on the fluorescence signal of its mutant sequence; (c) In MEF cells and L929 cells, miR-494-3p mimic significantly downregulated Tyro3 protein expression in inducing necrotizing apoptosis; (d) In L929 cells, miR-494-3p mimic significantly downregulated MLKL (Tyr376) expression; *P<0.05 in the figures above.

[0073] Figure 7Overexpression of Tyro3 significantly inhibited the effect of miR-494-3p on cell survival. (a) Inducing necrotizing apoptosis in L929 cells, overexpression of Tyro3 significantly inhibited the downregulation of MLKL oligomerization by miR-494-3p; (b) Inducing necrotizing apoptosis in L929 cells, overexpression of Tyro3 significantly inhibited the cell survival-promoting effect of miR-494-3p; In the figures above, **P<0.01, ***P<0.001.

[0074] Figure 8 The results showed that miR-494-3p agomir protected pancreatic tissue in mice in L-Arg or taurine-induced acute pancreatitis models. (a) and (e) show the experimental design of miR-494-3pagomir tail vein injection in L-Arg or taurine-induced acute pancreatitis models, respectively; (b) and (f) show that miR-494-3pagomir tail vein injection significantly increased miR-494-3p expression in pancreatic tissue in L-Arg or taurine-induced acute pancreatitis models, respectively; (c) and (g) show that miR-494-3p agomir treatment significantly decreased serum amylase activity in mice; (d) and (h) show that miR-494-3p agomir treatment significantly reduced the degree of pancreatic tissue damage in mice; (i) shows that miR-494-3p agomir treatment significantly downregulated the level of inflammatory factors in mouse pancreatic tissue in taurine-induced acute pancreatitis models; (j) and (k) show that miR-494-3p... Following agomir treatment, Tyro3 was significantly downregulated at both protein and mRNA levels in mouse pancreatic tissue; (l) showed that necrotizing apoptosis was induced in isolated primary mouse pancreatic acinar cells, and MLKL oligomerization was significantly downregulated in mice with pancreatic-specific overexpression of miR-494-3p; *P<0.05, **P<0.01, ***P<0.001 in the figures above. (d) Scale bar: 100µm.

[0075] Figure 9The results showed that long-term overexpression of miR-494-3p in the mouse pancreas did not cause significant toxic side effects in mice. (a) The relative level of miR-494-3p in the pancreatic tissue of miR-494-3p pancreatic-specific overexpression mice was significantly higher than that in miR-494-3p flox / flox mice, indicating successful miR-494-3p overexpression; (b) Under the same feeding conditions, there was no significant difference in serum amylase levels between 52-week-old miR-494-3p pancreatic-specific overexpression mice and age-matched miR-494-3p flox / flox mice; (c) Under the same feeding conditions, the pancreatic tissue structure of miR-494-3p pancreatic-specific overexpression mice was similar to that of age-matched miR-494-3p flox / flox mice; (d) Under the same feeding conditions, there were no significant differences in body weight, liver / body weight ratio, spleen / body weight ratio, and colon length between miR-494-3p pancreatic-specific overexpression mice and age-matched miR-494-3p flox / flox mice; *P<0.05 in the figures above. Detailed Implementation

[0076] Through extensive and in-depth research, the inventors have discovered that miRNA: miR-494-3p or its variants or analogs are directly involved in the occurrence and development of diseases induced by necrosis and apoptosis (such as pancreatitis); miR-494-3p is downregulated during the occurrence of pancreatitis; and administration of miR-494-3p mimics can alleviate pancreatitis. The inventors also found that miR-494-3p, by inhibiting Tyro3 expression, can downregulate Tyr376 phosphorylation of MLKL, thereby inhibiting MLKL oligomerization, blocking the Tyro3 / MLKL signaling pathway, and thus inhibiting necrosis and apoptosis. Therefore, miR-494-3p can serve as a diagnostic or therapeutic target for pancreatitis and diseases induced by necrosis and apoptosis.

[0077] miRNA and its precursors

[0078] As used herein, “miRNA” refers to an RNA molecule derived from transcripts that can form miRNA precursors. Mature miRNAs typically have 18-26 nucleotides (nt) (preferably about 19-22 nt), but miRNA molecules with other numbers of nucleotides are not excluded. miRNAs can usually be detected by Northern blotting. miRNAs can be isolated from cells.

[0079] miRNA precursors include primary miRNAs (Pri-mRNA) and precursor miRNAs (Pre-miRNA). The formation of miRNAs involves: first, a relatively long primary miRNA is transcribed in the cell nucleus; then, it is processed into precursor miRNA by Drosha; with the help of a transport complex, it is transported out of the nucleus; in the cytoplasm, it is cleaved by Dicer into mature miRNA; and then it is integrated into the RNA-induced silencing complex (RISC, a complex formed by miRNA, Argonaute protein, and Dicer enzyme), regulating gene expression based on complete or incomplete pairing with the mRNA. The precursor miRNA can fold into a stable stem-loop (hairpin) structure, typically 50-100 bp in length. The stem of the stem-loop structure contains two substantially complementary sequences on either side. The precursor miRNA can be natural or synthetically produced.

[0080] Precursor miRNAs can be cleaved to generate miRNAs that are substantially complementary to at least a portion of the sequence of the mRNA encoding a gene. As used herein, “substantially complementary” means that the nucleic acid sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures (e.g., stem-loop structures). Typically, two “substantially complementary” nucleotide sequences are complementary to each other by at least 70% of their nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Generally, two sufficiently complementary molecules may have up to 40 mismatched nucleotides; preferably, up to 30; more preferably, up to 20; and even more preferably, up to 10, such as 1, 2, 3, 4, 5, 8, or 11 mismatched nucleotides.

[0081] As used herein, a "stem-loop" structure, also known as a hairpin structure, refers to a nucleotide molecule that can form a secondary structure including a double-stranded region (stem) formed by two regions of the nucleotide molecule (located on the same molecule), flanking the double-stranded portion; it also includes at least one "loop" structure, comprising a non-complementary nucleotide molecule, i.e., a single-stranded region. Even if the two regions of the nucleotide molecule are not perfectly complementary, the double-stranded portion of the nucleotide remains double-stranded. For example, insertions, deletions, substitutions, etc., can lead to a small region being non-complementary or that small region itself forming a stem-loop structure or other forms of secondary structure; however, the two regions can still be substantially complementary and interact in a predictable manner to form a double-stranded region of a stem-loop structure. Stem-loop structures are well known to those skilled in the art, and typically, after obtaining a nucleotide sequence with a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

[0082] The miRNAs described in this invention include miR-494-3p or variants thereof, and analogs (e.g., derivatives) thereof. The nucleotides of miR-494-3p are as shown in SEQ ID NO:20. The variants differ from the miR-494-3p sequence by one or more nucleotides but retain the function of miR-494-3p, for example, variants having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with miR-494-3p while retaining the function of miR-494-3p. The variants also contain a DNA counterpart of the RNA.

[0083] Analogs (e.g., derivatives) of miR-494-3p or its variants can be agents that increase the content of miR-494-3p or its variants. Typically, they are expressed in vivo as miR-494-3p or its variants. As a type of derivative, those skilled in the art can modify miR-494-3p or its variants using common methods, including (but not limited to): hydrocarbon modification, glycosylation modification, nucleic acid modification, peptide modification, lipid modification, halogen modification, methylation modification, methoxylation modification, thiolation modification, cholesterol modification, alkyl modification, locked nucleic acid modification, peptide nucleic acid modification, and / or modification in which the phosphate backbone is replaced by a phospholipid linker. Glycosylation groups include: 2-methoxy-glycosyl, hydrocarbon-glycosyl, cyclic glycosyl, etc. To improve the stability or other properties of the miRNA, at least one protective base, such as "TT", may be added to at least one end of the miRNA. Exemplary derivatives include miR-494-3p analogs: miR-494-3p agomir and miR-494-3p mimic.

[0084] The modified derivatives mentioned above (also referred to herein as modified variants) can also be monomers or polymers having the structure of formula (III):

[0085] Equation (III) is (X)n-(Y)m

[0086] Wherein, X is miR-494-3p or a variant thereof with a sequence as shown in SEQ ID NO:20; n is a positive integer selected from 1 to 50 (preferably 1 to 20, such as 5, 10, 15); for example, n is 1, 2, 3, or 5; Y is a modification that promotes the stability of miRNA administration, which is covalently linked to, coupled to, or attached to X; m is a positive integer from 1 to 1500, preferably 1 to 200, such as 10, 20, 50, 100, 150.

[0087] In another preferred embodiment, Y includes, but is not limited to: cholesterol, steroids, sterols, alcohols, organic acids, fatty acids, esters, monosaccharides, polysaccharides, amino acids, polypeptides, mononucleotides, and polynucleotides.

[0088] Derivatives of miR-494-3p can also be RNA-induced silencing complexes containing miR-494-3p.

[0089] Polynucleotides and nucleic acid constructs

[0090] Based on the miRNA sequence provided by this invention, polynucleotides that, upon introduction, can be processed into miRNAs that affect the expression of the corresponding miRNAs, i.e., the polynucleotides can upregulate the amount of the corresponding miRNAs in vivo. Therefore, this invention provides an isolated polynucleotide that can be transcribed into a precursor miRNA by cells (e.g., animal cells), and the precursor miRNA can be processed into the miRNA by a host (e.g., human cells). In this document, the sequence of the precursor miRNA miR-494-3p is shown in SEQ ID NO:21.

[0091] In a preferred embodiment of the present invention, the miR-494-3p polynucleotide contains the structure shown in formula (I):

[0092] Seq 正向 -X-Seq 反向 (I)

[0093] In equation (I), Seq 正向 A nucleotide sequence that can be processed into miR-494-3p in the host; Seq 反向 To be with Seq 正向 Essentially complementary or perfectly complementary nucleotide sequences; X is located in Seq 正向 and Seq 反向The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 They are not complementary.

[0094] The structure shown in formula (I) transforms into the secondary structure shown in formula (II) after being transferred into cells:

[0095]

[0096] In equation (II), Seq 正向 Seq 反向 The definition of X is as described above, and || represents the expression in Seq. 正向 and Seq 反向 The complementary base pairing relationship between them.

[0097] Typically, the polynucleotide is located on a nucleic acid construct, such as an expression vector or an integration vector. Therefore, the present invention also includes a vector containing the miRNA or the polynucleotide. The nucleic acid construct (e.g., an expression vector) typically also contains a promoter, a replication origin, and / or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed host cells, such as resistance to kanamycin, gentamicin, hygromycin, and ampicillin.

[0098] Pharmaceutical compositions and pharmaceutical preparation

[0099] This invention provides a pharmaceutical composition for treating diseases induced by necrosis and apoptosis, comprising a pharmaceutically acceptable excipient or an effective amount of one or more active ingredients selected from the group consisting of: (a) miR-494-3p or a variant thereof, or analogues thereof (e.g., derivatives); (b) a precursor of miR-494-3p; (c) a polynucleotide transcribed into a precursor of miR-494-3p as described in (b), or processed in a host into miR-494-3p as described in (a); (d) a nucleic acid construct containing (a), (b), or (c); and (e) an agonist of (a). The nucleic acid construct, in one or more embodiments, has the active ingredient having a structure as shown in formula (II) or (III) as previously described.

[0100] The inventors discovered that miR-494-3p, by inhibiting Tyro3 expression, downregulates Tyr376 phosphorylation of MLKL, thereby inhibiting MLKL oligomerization and blocking the Tyro3 / MLKL signaling pathway. Therefore, the pharmaceutical composition described herein can treat diseases induced by necrosis and apoptosis caused by the Tyro3 / MLKL signaling pathway, particularly those benefiting from downregulation of Tyro3 protein levels or downregulation of Tyr376 phosphorylation of MLKL, such as pancreatitis (acute pancreatitis). Acute pancreatitis is an inflammatory disease caused by downregulation of miR-494-3p expression.

[0101] As a preferred embodiment of the present invention, the miR-494-3p is derived from humans or non-human mammals (e.g., rats, mice).

[0102] The agonists described herein can stimulate the expression of miR-494-3p or its variants and enhance miR-494-3p activity. This invention includes any miR-494-3p agonists known in the art. As used herein, the terms "effective amount" or "effective dose" refer to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals.

[0103] As used in this article, a “pharmaceuticalally acceptable” ingredient is a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and reactions), i.e., a substance with a reasonable benefit / risk ratio.

[0104] The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredient of the present invention and pharmaceutically acceptable excipients. The term "pharmaceutically acceptable excipients" refers to excipients used for the administration of therapeutic agents, including various excipients and diluents. Such excipients include (but are not limited to): saline, buffer solutions, glucose, water, glycerol, ethanol, and combinations thereof. Typically, pharmaceutical formulations are matched to the route of administration; the dosage forms of the pharmaceutical compositions of the present invention are injections, oral formulations (tablets, capsules, oral liquids), transdermal formulations, and sustained-release formulations. For example, they are prepared using physiological saline or aqueous solutions containing glucose and other excipients by conventional methods. Pharmaceutically acceptable excipients of the present invention include those suitable for nucleic acid delivery, particularly miRNA or its precursors or polynucleotides. The pharmaceutical compositions are preferably manufactured under aseptic conditions.

[0105] The active ingredient of this invention can vary depending on the administration method and the severity of the disease to be treated. The preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include (but are not limited to): the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration. Generally, satisfactory results are obtained when the active ingredient of this invention is administered daily at a dose of approximately 0.00001 mg to 50 mg / kg animal body weight (preferably 0.0001 mg to 10 mg / kg animal body weight). For example, due to the urgency of the treatment condition, several separate doses may be administered daily, or the dose may be reduced proportionally.

[0106] The pharmaceutically acceptable excipients described in this invention include (but are not limited to): liposomes, cellulose, and nanogel carriers. The selection of these carriers should be matched with the route of administration, and these are well known to those skilled in the art.

[0107] The present invention also provides the use of the above-mentioned active ingredients in the preparation of a medicament for treating diseases induced by necroptosis, such as diseases induced by necroptosis caused by the Tyro3 / MLKL signaling pathway, particularly those benefiting from downregulation of Tyro3 protein levels or from downregulation of the phosphorylation level of Tyr376 in MLKL.

[0108] Diagnostic methods and reagent kits

[0109] This invention also provides a method for diagnosing diseases induced by necrosis and apoptosis. In a preferred embodiment, the method includes the steps of: detecting the expression levels of miR-494-3p in a test sample and a control sample, respectively. If the expression level of miR-494-3p in the test sample is significantly reduced compared to the control sample, it is a potential disease sample for necrosis and apoptosis-induced disease. The control sample exhibits normal miR-494-3p expression levels or miR-494-3p expression levels of healthy individuals. Preferably, a significant reduction means that the expression level of miR-494-3p is reduced by ≥10%, preferably ≥20%, more preferably ≥50%, more preferably ≥80%, and most preferably ≥100% compared to the control sample. This invention also provides a kit for diagnosing diseases induced by necrosis and apoptosis, comprising reagents for detecting miR-494-3p, wherein the reagents are specific antibodies, specific probes, or specific primers for detecting miR-494-3p. The kit also includes other reagents required for immunological detection, nucleic acid hybridization, or nucleic acid amplification, such as buffers, divalent ions, dNTPs, or polymerases.

[0110] The detection method may further include comparing the test sample and a control sample with one or more of the following: Tyro3 protein level, MLKL oligomerization level, and MLKL Tyr376 phosphorylation level, wherein if the Tyro3 protein level is elevated and / or the MLKL oligomerization level is elevated and / or the MLKL Tyr376 phosphorylation level is increased, the test sample is a potential disease sample induced by necrosis and apoptosis. Therefore, the above-mentioned detection kit may also include reagents for detecting one or more of the following: Tyro3 protein level, MLKL oligomerization level, and MLKL Tyr376 phosphorylation level. Reagents required for performing these detections are known in the art. For example, reagents for detecting protein levels include antibodies and buffers required for immunoassays; reagents for detecting oligomerization and phosphorylation levels include phosphorylation-specific antibodies, ELISA-based detection reagents, flow cytometry detection reagents, etc.

[0111] Drug screening

[0112] Knowing the close association between miR-494-3p and diseases induced by necrosis and apoptosis, substances that upregulate miR-494-3p expression can be screened based on this characteristic. Potential substances useful for the prevention or treatment of diseases induced by necrosis and apoptosis (such as acute pancreatitis) can be found among these substances.

[0113] Therefore, the present invention provides a method for screening potential substances for the prevention or treatment of diseases induced by necroptosis, the method comprising: (1) treating a system expressing miR-494-3p with a candidate substance; and (2) detecting the expression of miR-494-3p in the system; wherein, if the candidate substance can increase the expression of miR-494-3p, it indicates that the candidate substance is a potential substance for the prevention or treatment of diseases induced by necroptosis (e.g., acute pancreatitis). The method may further comprise detecting the expression of Tyro3, ​​MLKL oligomerization, or phosphorylation of Tyr376 of MLKL in the test group system, and comparing it with a control group.

[0114] The system expressing miR-494-3p can be, for example, a cell (or cell culture) system, wherein the cells can be endogenously expressing miR-494-3p; or they can be recombinant cells expressing miR-494-3p. The system expressing miR-494-3p can also be a subcellular system, a solution system, a tissue system, an organ system, or an animal system (such as an animal model, preferably a non-human mammalian animal model, such as a mouse, rabbit, sheep, or monkey).

[0115] In a preferred embodiment of the present invention, during screening, a control group may be set up to more easily observe changes in miR-494-3p expression. The control group may be the same system as the test group without the addition of the candidate substance.

[0116] As a preferred embodiment of the present invention, the method further includes: conducting further cell experiments and / or animal experiments on the obtained potential substances to further select and identify substances that are truly useful for the prevention or treatment of diseases induced by necrosis and apoptosis.

[0117] This invention does not impose any particular limitations on the detection methods for the expression, activity, presence, or secretion of miR-494-3p. Conventional quantitative or semi-quantitative detection techniques can be used.

[0118] On the other hand, the present invention also provides potential substances for the prevention or treatment of diseases induced by necrosis and apoptosis obtained using the aforementioned screening method. These initially screened substances can constitute a screening library, from which substances useful for upregulating the expression and activity of miR-494-3p, thereby preventing or treating diseases induced by necrosis and apoptosis, can ultimately be screened.

[0119] The main advantages of this invention are:

[0120] (1) This invention reveals the regulatory role of miRNA in L-Arg or taurine-induced acute pancreatitis in mice, and proves that miRNA directly participates in the occurrence of acute pancreatitis, directly linking miRNA and the occurrence of acute pancreatitis.

[0121] (2) In the mouse model of acute pancreatitis induced by L-Arg or taurine, the expression level of miR-494-3p in tissues decreased as acute pancreatitis progressed.

[0122] (3) In L-Arg or taurine-induced acute pancreatitis models in mice, miR-494-3p knockout mice showed more severe inflammatory responses (including pancreatic tissue edema, congestion, infiltration of inflammatory factors, and more severe necrosis) and activation of the Tyro3 / MLKL signaling pathway than wild-type mice.

[0123] (4) In the L-Arg or taurine-induced mouse acute pancreatitis model, intravenous injection of miR-494-3p mimics into the tail vein of mice can significantly inhibit the development of acute pancreatitis and the activation of the Tyro3 / MLKL signaling pathway.

[0124] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0125] Example

[0126] Materials and Methods

[0127] miR-494-3p- / - mouse embryonic stem cells with C57BL / 6 background were purchased from MMRRC (Mutant Mouse Resource & Research Centers) in the United States, and Southern Model Biotechnology Co., Ltd. was entrusted with the embryo thawing and embryo transfer. C57BL / 6 was purchased from Shanghai Lingchang Biotechnology Co., Ltd.

[0128] The primer sequences for identifying the miR-494-3p knockout mouse genotype are shown in Table 1.

[0129] Table 1

[0130] SEQ ID NO: Primer direction Primer sequence (5'-3') 1 positive GGTCGCTTCTCATCACCCAC 2 Reverse 1 AGTAGAAGGTGGCGCGAAGG 3 Reverse 2 GGGAAGCAGCCAATGATTTG

[0131] The primers for Q-PCR are shown in Table 2.

[0132] Table 2

[0133]

[0134]

[0135] Establishment of miR-494-3p knockout mice (miR-494-3p- / -)

[0136] C57BL / 6 background miR-494-3p- / - mouse embryonic stem cells were purchased from MMRRC (Mutant Mouse Resource & Research Centers) in the United States. In short, the targeting vector LoxP-F3-PGK-EM7-PuroΔtk-bpA-LoxP-FRT was transfected into wild-type mouse embryonic stem cells (ES cells). The sequence of the targeting vector replaced the miR-494 sequence in the wild-type mouse embryonic stem cells through homologous recombination, thus obtaining targeted ES cells. The targeted embryonic stem cells can express puromycin / thymidine kinase activity under the action of the EM7 / PGK promoter, thus successfully resisting puromycin selection. The purchased embryonic stem cells were entrusted to Shanghai Southern Model Biotechnology Co., Ltd. to construct gene knockout mice: First, the embryonic stem cells were microinjected into the blastocyst cavity of mice, and then the injected blastocysts were transplanted into the uterus of pseudopregnant mice to obtain chimeric mice. Male chimeric mice were then mated with wild-type female mice to obtain gene knockout mice.

[0137] miR-494-3p analogue

[0138] miR-494-3p mimics include miR-494-3p agomir (product number miR40003182-4-5) and miR-494-3p mimic (product number miR10003182-1-5), both synthesized and modified by Ribobio.

[0139] The miR-494-3p agomir sequence is: UGAAACAUACACGGGAAACCUC (SEQ ID NO:18), which has been methylated and modified with cholesterol.

[0140] The control agomir sequence is: UCACAACCUCCUAGAAAGAGUAGA (SEQ ID NO:19), which has been methylated and modified with cholesterol.

[0141] L-Arg-induced acute pancreatitis / severe acute pancreatitis model

[0142] Acute pancreatitis model: Male mice aged 6-8 weeks were marked and their weight recorded. Each group consisted of 8-10 mice. Mice were fasted and fed 0.9% saline. Based on mouse weight, 10% L-Arg was injected intraperitoneally at a dose of 4 g / kg, 1 hour apart, for a total of two injections. Mice were anesthetized at 48 h and 72 h, and blood and pancreatic tissue were collected.

[0143] Severe acute pancreatitis model: Approximately 200g male SD rats were marked and their weight recorded. Each group consisted of 10-12 rats. The rats were fasted and fed 0.9% saline. Based on the rats' weight, 10% L-Arg was injected intraperitoneally at a dose of 4g / kg, with 1-hour intervals, for a total of two injections. Rats were anesthetized at 24h, 48h, and 72h, and blood and pancreatic tissue were collected.

[0144] Acute pancreatitis model induced by taurine

[0145] Male mice aged 6-8 weeks were marked and their weight recorded. Each group consisted of 8-10 mice. The mice were fasted and fed with 0.9% saline. Based on the mice's weight, bacitracin was administered intraperitoneally at a dose of 50 μg / kg, with 1-hour intervals for 12 consecutive hours. The mice were anesthetized 24 hours after the first injection, and blood and pancreatic tissue were collected.

[0146] Isolation and culture of primary mouse pancreatic acinar cells

[0147] Under sterile conditions, mouse pancreatic tissue was removed and placed in a new sterile HBSS solution. The pancreas was cut into 4-5 mm pieces using sterile scissors. After washing three times with the same HBSS solution, the HBSS containing the pancreatic tissue was collected and centrifuged at 720 g for 2 min at 4 °C. The supernatant was removed, and the tissue pieces were placed in 5 ml of prepared HBSS containing collagenase and digested at 37 °C for 1 hour. After digestion, 5 ml of HBSS containing 5% FBS was added to stop digestion, and the mixture was centrifuged at 720 g for 2 min at 4 °C. The supernatant was carefully removed, and the tissue pieces were resuspended in 5 ml of HBSS containing 5% FBS. The mixture was centrifuged at 800 g for 2 min at 4 °C. This step was repeated twice. After resuspending in 5 ml of HBSS containing 5% FBS, the mixture was filtered. The filtered liquid was carefully added dropwise to 20 ml of HBSS containing 30% FBS, gently inverted to mix, and then centrifuged at 400 g for 2 min at 4 °C. Discard the supernatant and resuspend the precipitate in freshly prepared Way's media containing 10% FBS, 10% soybean trypsin inhibitor, 1% penicillin antibiotics, and 0.1% dexamethasone. After cell counting, transfer the cells to culture dishes and replace the medium with fresh medium 24 hours after cell adhesion for subsequent experiments.

[0148] Immunohistochemistry and photography

[0149] Immunohistochemistry of mouse pancreatic tissue was performed according to standard procedures. For better dewaxing, paraffin sections were pre-heated in a 65°C oven for 30 min–1 h. To obtain better antigen activity, all experiments used an autoclave for antigen retrieval. Immunohistochemical images were captured using the Vectra2 high-throughput biological tissue processing and analysis system.

[0150] Reverse transcription PCR (RT-PCR) and real-time quantitative PCR (Real-time Q-PCR)

[0151] Mouse pancreatic tissue was lysed using TRIzol reagent (TaKaRa), and total RNA was extracted according to the manufacturer's instructions. 1 μg of RNA from each sample was reverse transcribed using the PrimeScript™ RT reagent Kit (Prefect Real Time) (TaKaRa). Real-time quantitative PCR was performed using the Hieff™ qPCR SYBR Green Master Mix kit (Yisheng Biotechnology Co., Ltd.) on an Applied Biosystems 7900 sequence Detection System. The reaction volume was 10 μL, containing 2 μL of RT-PCR product, 0.5 μM primers, and 5 μL of Hieff™ qPCR SYBR Green Master Mix. The reaction conditions were 95°C for 5 minutes (95°C for 10 seconds, 60°C for 30 seconds) × 40. All reactions were repeated three times, using GAPDH as an internal control. U6 was used as an internal control for the quantification of miR-494-3p.

[0152] Immunoblotting analysis

[0153] Mouse pancreatic tissue or transfected cells were lysed using RIPA lysis buffer for 30 min, and the supernatant was collected after centrifugation at room temperature as protein lysis buffer. Protein quantification was followed by SDS-PAGE electrophoresis. After electrophoresis, the proteins were transferred to a nitrocellulose membrane, blocked with 5% skim milk for 2 hours, and then incubated overnight at 4°C with the corresponding primary antibody (diluted in 3% BSA-TBST). The next day, excess primary antibody was washed away, followed by incubation with secondary antibody for 1 hour, washing with TBST, and antibody signal detection was performed using ECL chemiluminescence buffer (Sigma) and X-ray film (Kodak).

[0154] Data statistics

[0155] The statistical data in this paper are the mean ± SD of three independent experiments. An unpaired student's t-test was used to examine the significance of experimental differences. * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001. Graphpad 5.0 software was used for significance testing and plotting.

[0156] Example 1: miR-494-3p knockout does not affect the pancreatic tissue structure in mice.

[0157] In this embodiment, qPCR was used to detect the relative levels of miR-494-3p in the pancreatic tissues of miR-494-3p- / - mice and wild-type mice, respectively, to ensure that miR-494-3p was successfully knocked out in mice. Figure 1 Next, pancreatic tissues were collected from 8-week-old miR-494-3p knockout mice and age-matched wild-type mice to determine whether miR-494-3p knockout induced spontaneous acute pancreatitis in mice. H&E staining results showed ( Figure 1 (b) The pancreatic tissue of miR-494-3p knockout mice was similar to that of normal mice, and no spontaneous pancreatitis was observed. Figure 1 The results showed that miR-494-3p knockout did not affect the pancreatic tissue structure in mice.

[0158] Example 2: miR-494-3p knockout promoted the development and progression of L-Arg / laminin-induced acute pancreatitis in mice.

[0159] This embodiment attempts to examine whether miR-494-3p is associated with L-Arg / hypomorphin-induced acute pancreatitis. The inventors established L-Arg or hypomorphin-induced acute pancreatitis models in miR-494-3p- / - mice and wild-type mice. Figure 2 (a, d) Pancreatic tissue and serum were collected from mice for subsequent experiments. The inventors, by detecting and analyzing serum amylase activity and H&E staining of pancreatic tissue sections, found that acute pancreatitis in miR-494-3p- / - mice was more severe than in wild-type mice, and the difference was statistically significant. Figure 2 (b, c, e). On the other hand, in order to detect whether the expression level of miR-494-3p changed in the L-Arg or vicarin-induced acute pancreatitis model, the inventors used qPCR to detect the relative levels of miR-494-3p in the pancreatic tissues of wild-type mice injected with L-Arg or vicarin and mice injected with 0.9% saline or PBS, respectively. They found that miR-494-3p expression was significantly downregulated after L-Arg or vicarin-induced acute pancreatitis. Figure 2 Similarly, in a L-Arg-induced rat model of severe acute pancreatitis, the relative levels of miR-494-3p in pancreatic tissues of wild-type SD rats injected with L-Arg and rats injected with 0.9% saline were detected by qPCR. It was found that miR-494-3p expression was also significantly downregulated after L-Arg-induced severe acute pancreatitis. Figure 2More importantly, the inventors tested miR-494-3p in blood samples from healthy individuals (6 groups) and patients with acute pancreatitis (7 groups) provided by the hospital, and found that the level of miR-494-3p in the blood samples of patients with acute pancreatitis was also significantly downregulated. Figure 2 (h).

[0160] Example 3: Necrotizing apoptosis is involved in the development and progression of acute pancreatitis.

[0161] In this embodiment, the inventors detected necrotizing apoptosis signals in proteins extracted from pancreatic tissue in L-Arg- or taurine-induced acute pancreatitis models, respectively. Immunoblotting results showed that the expression levels of p-RIPK3 (the activated form of RIPK3) and p-MLKL (the activated form of MLKL) were significantly upregulated. Figure 3 (a, b). Additionally, in a mouse model of acute pancreatitis induced by taurine, the inventors intraperitoneally injected the RIPK1 inhibitor Nec-1 (a, b). Figure 3 c). Through H&E staining and Western blotting experiments of pancreatic tissue, it was found that Nec-1 significantly reduced pancreatic tissue damage. Figure 3 ,d), and significantly inhibited the expression level of p-MLKL (the activated form of MLKL) ( ,d). Figure 3 (e) indicates that necrotizing apoptotic signals are significantly activated in acute pancreatitis.

[0162] Example 4: In vitro overexpression of miR-494-3p inhibits programmed cell necrosis.

[0163] This embodiment aims to investigate the relationship between miR-494-3p and necrosis / apoptosis in in vitro experiments. The inventors transfected MEF cells, L929 cells, and HT-29 cells with miR-494-3p mimic to increase miR-494-3p levels. At multiple time points, combined treatment with TNFα, z-VAD, and Smac (TSZ) induced cell necrosis / apoptosis. Cell viability assays showed that overexpression of miR-494-3p significantly inhibited cell necrosis and promoted cell survival in various cell types. Figure 4 (a, b, c). In addition, the inventors also induced necrotizing apoptosis in MEF cells by treating them with a combination of TNFα, CHX, and z-VAD (TCZ), and found that overexpression of miR-494-3p also significantly promoted cell survival. Figure 4Correspondingly, the inventors also inhibited the function of miR-494-3p in MEF cells by transfecting them with a miR-494-3p inhibitor (Rabobio, product number miR20003182-1-5). Although the mechanism of action of the miR-494-3p inhibitor limits its efficacy, the inventors were still able to observe that in TSZ or TCZ-induced necrotizing apoptosis, the survival rate of MEF cells decreased along with the inhibition of miR-494-3p function by the miR-494-3p inhibitor. Figure 4 (e, f).

[0164] Example 5: In vitro overexpression of miR-494-3p inhibits MLKL oligomerization

[0165] In this embodiment, to clarify the mechanism by which miR-494-3p inhibits necroptosis and apoptosis, and to determine at which step miR-494-3p regulates necroptosis, the inventors examined the effect of miR-494-3p overexpression on key protein molecules in the necroptosis signaling pathway in MEF cells. In MEF cells, TSZ induced necroptosis. After transfection of cells with miR-494-3p mimic to induce miR-494-3p overexpression, Western blotting results showed no significant changes in the expression of p-RIPK1 (S166), p-RIPK3 (S232), and p-MLKL (S345). Non-reducing PAGE results showed that the oligomerization level of MLKL was significantly inhibited. Figure 5 Similarly, in L929 and HT-29 cells, miR-494-3p mimic also significantly inhibited MLKL oligomerization (a). Figure 5 (b, c).

[0166] To further confirm these experimental results, the inventors performed immunofluorescence staining on p-MLKL(S345) in L929 cells. Since the Western blot results confirmed that the p-MLKL(S345) level did not change after miR-494 overexpression, the signal of p-MLKL(S345) in the immunofluorescence staining reflects the level of MLKL oligomerization. L929 cells were treated with mTNFα for 6 hours to induce necrosis and apoptosis. The immunofluorescence results showed that the fluorescence signal of p-MLKL(S345) was weakened after miR-494-3p overexpression, indicating that MLKL oligomerization was significantly inhibited. Figure 5 (d). Therefore, it can be concluded that miR-494-3p promotes cell survival by inhibiting the formation of MLKL oligomers.

[0167] Example 6: miR-494-3p targets and regulates Tyro3

[0168] In this embodiment, the inventors searched and analyzed the Targetscan database and, through comparison, discovered a potential miR-494-3p target site on the 3'UTR of Tyro3 mRNA. Figure 6 (a) The inventors cloned the full-length Tyro3 mRNA 3'UTR sequence and the mutant Tyro3 mRNA 3'UTR sequence into a dual-luciferase reporter gene vector, respectively. Using a dual-luciferase reporter gene detection system, the inventors found that miR-494-3p mimic significantly inhibited the fluorescence signal of Tyro3 mRNA 3'UTR, while having no effect on the fluorescence signal of its mutant sequence. Figure 6 b), thus confirming that miR-494-3p can directly target the 3'UTR sequence of Tyro3 mRNA.

[0169] To further verify the targeting effect of miR-494-3p on Tyro3, ​​the inventors induced necrosis and apoptosis in MEF cells and L929 cells. The results of the Western blot experiment showed that miR-494-3p mimic significantly inhibited Tyro3 expression at the protein level. Figure 6 c).

[0170] Literature reports that Tyro3 regulates necrotizing apoptosis by affecting the oligomerization of MLKL (Tyr376) through phosphorylation. The inventors subsequently induced necrotizing apoptosis in L929 cells by treating them with mTNFα for 6 hours, overexpressing miR-494-3p, and transfecting MLKL-FLAG cells. Immunoprecipitation and Western blotting were used to detect the expression of MLKL Tyr376. The results show that miR-494-3p overexpression significantly inhibits MLKL (Tyr376) phosphorylation. Figure 6 ,d).

[0171] Example 7: In vitro overexpression of Tyro3 inhibits the cell survival-promoting effect of miR-494-3p.

[0172] To verify whether Tyro3 reintroduction in cells could block the effects of miR-494-3p, the inventors induced necrosis and apoptosis in L929 cells by treatment with mTNFα. They found that overexpression of Tyro3 could reverse the downregulation of MLKL oligomerization levels induced by miR-494-3p mimic. Figure 7 a) and the increase in cell viability ( Figure 7(b) This further confirms that miR-494-3p can indeed directly target the 3'UTR sequence of Tyro3 mRNA, significantly inhibiting Tyro3 expression. Based on the above experimental data, the inventors confirm that Tyro3 is indeed a target gene of miR-494-3p, and that miR-494-3p inhibits Tyro3 and further affects MLKL oligomerization by regulating Tyr376 phosphorylation.

[0173] Example 8: In an L-Arg or taurine-induced acute pancreatitis model, the miR-494-3p mimic alleviated the occurrence of acute pancreatitis.

[0174] To further confirm the role of miR-494-3p in acute pancreatitis, the inventors administered miR-494-3p agomir via tail vein injection before L-Arg injection. Figure 8 (a) thereby overexpressing miR-494-3p in order to treat acute pancreatitis. It was confirmed that miR-494-3p is overexpressed in pancreatic tissue. Figure 8 After b), the serum amylase activity and pancreatic tissue structure of mice were detected and analyzed. Figure 8 (c, d) It was found that after treatment with miR-494-3p agomir, serum amylase levels decreased significantly, tissue structure was significantly restored, and acute pancreatitis in mice showed a significant trend of alleviation. Similarly, before injecting taurine, the inventors injected miR-494-3p agomir (c, d) via the tail vein. Figure 8 (e) to induce overexpression. It was confirmed that miR-494-3p was overexpressed in pancreatic tissue. Figure 8 After f), the serum amylase activity and pancreatic tissue structure of mice were detected and analyzed. Figure 8 (g, h) It was found that miR-494-3p agomir could also significantly alleviate the development of taurine-induced acute pancreatitis in mice. Furthermore, it was found that overexpression of miR-494-3p in pancreatic tissue significantly downregulated the levels of inflammatory factors in the tissue. Figure 8 The above results indicate that miR-494-3p agomir has a significant therapeutic effect in an acute pancreatitis model.

[0175] Furthermore, to confirm the molecular mechanism by which miR-494-3p functions in acute pancreatitis, the inventors examined the level of Tyro3 in pancreatic tissue after miR-494-3p overexpression in a taeniacin-induced model, finding that Tyro3 was significantly downregulated at both the protein and mRNA levels. Figure 8(j, k). Furthermore, necrotizing apoptosis was induced in isolated primary mouse pancreatic acinar cells, and MLKL oligomerization levels were significantly downregulated in miR-494-3p pancreatic-specific overexpression mice compared to flux / flox mice. Figure 8 ,l).

[0176] Example 9: Long-term stable overexpression of miR-494-3p in the pancreas showed no significant toxic side effects.

[0177] To demonstrate the safety of miR-494-3p mimics for clinical application, the inventors used long-term (approximately 52 weeks old) pancreas-specific overexpression miR-494-3p mice ( Figure 9 Both a) and miR-494-3p flox / flox mice were housed in the same environment and observed and tested. Serum and pancreatic tissue samples were collected from the mice. The results showed no significant difference in serum amylase levels between the two groups. Figure 9 b) H&E staining of pancreatic tissue showed that the pancreatic tissue structure of miR-494-3p pancreatic-specific overexpression mice was normal, and there was no significant difference between the pancreatic tissue of miR-494-3p flox / flox mice and those of miR-494-3p flox / flox mice. Figure 9 (c). Furthermore, there were no significant differences between the two groups in body weight, liver weight / body weight ratio, spleen / body weight ratio, and colon length. Figure 9 (d) indicates that long-term pancreatic-specific overexpression of miR-494-3p has no significant toxic side effects and has no significant impact on the normal life of mice, greatly improving the feasibility of its clinical application.

[0178] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations and modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. SEQUENCE LISTING <110> Shanghai Institute of Nutrition and Health, Chinese Academy of Sciences <120> microRNAs and their applications in diagnosis and treatment <130> 217952 <160> twenty one <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> first <400> 1 20. ggtcgcttct catcacccac <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> first <400> 2 agtagaaggt ggcgcgaagg <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> first <400> 3 gggaagcagc caatgatttg <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> first <400> 4 acactccagc tgggtgaaac attackcggga <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> first <400> 5 tggtgtcgtg gagtcg <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> first <400> 6 tgtaatgaaa gacggcacac c 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> first <400> 7 tcttctttgg gtattgcttg g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> first <400> 8 gatggatgct accaaactgg às 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> first <400> 9 ccaggtagct atggtactcc aga 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> first <400> 10 cctctagctg gaacacagtg c 21 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gcggttctca tctgtgtcg 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 agactccagc cacactccaa 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 tgacagcgca gctcattg 18 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cctggttcag aaaatcatcc a 21 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 cttccgttga gggacagc 18 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> first <400> 16 ctcgcttcgg cagcaca 17 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> first <400> 17 aacgcttcac gaatttgcgt 20 <210> 18 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> agomir <400> 18 ugaaacauac acgggaaacc uc 22 <210> 19 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> control <400> 19 ucacaaccuc cuagaaagag uaga 24 <210> 20 <211> 22 <212> RNA <213> Homo sapiens <400> 20 ugaaacauac acgggaaacc uc 22 <210> 21 <211> 85 <212> RNA <213> Homo sapiens <400> 21 uugauacuug aaggagaggu uguccguguu gucuucucuu uauuuagau gaacauaca 60 cgggaaaccu cuuuuuuagu aucaa 85

Claims

1. Use of the reagent in the preparation of pharmaceutical compositions for the prevention or treatment of pancreatitis; wherein, The reagents mentioned are selected from the following group: (a)miR-494-3p; (b) a precursor of miR-494-3p, which can be processed into miR-494-3p within a host; (c) A polynucleotide that can be transcribed into a precursor of miR-494-3p as described in (b), or can be processed in the host into miR-494-3p as described in (a); (d) Nucleic acid constructs, wherein the nucleic acid constructs contain (a), (b) or (c); (e) derivatives of miR-494-3p, said derivative being an RNA-induced silencing complex containing miR-494-3p, mir494-agomir, and / or miR-494-3p mimic.

2. The use as described in claim 1, characterized in that, The polynucleotide or nucleic acid construct has the structure shown in formula (I): Seq 正向 -X-Seq 反向 (I) In equation (I), Seq 正向 This is a nucleotide sequence that can be processed into miR-494-3p in the host; Seq 反向 To be with Seq 正向 Nucleotide sequences that are essentially complementary or completely complementary; X is located at Seq 正向 and Seq 反向 The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 They are not complementary.

3. The use as described in claim 1, characterized in that, The nucleic acid construct is an expression vector or an integration vector.

4. The use as described in claim 1, characterized in that, The sequence of miR-494-3p is shown in SEQ ID NO:20, and / or The precursor of miR-494-3p is a precursor miRNA or primary miRNA.

5. The use as described in claim 1, characterized in that, The sequence of the precursor miRNA is shown in SEQ ID NO:

21.

6. The use as described in claim 1, characterized in that, The reagent works by inhibiting the Tyro3 / MLKL signaling pathway, or by downregulating Tyro3 protein levels, inhibiting MLKL oligomerization, or downregulating the phosphorylation level of Tyr376 in MLKL.

7. A method for screening potential substances for the prevention or treatment of pancreatitis, the method comprising: (1) Treat the system expressing miR-494-3p with candidate substances; and (2) The expression of miR-494-3p in the system was detected; If the candidate substance can increase the expression of miR-494-3p, it indicates that the candidate substance is a potential substance for the prevention or treatment of pancreatitis.

8. The method of claim 7, further comprising detecting Tyro3 expression, MLKL oligomerization, or MLKL Tyr376 phosphorylation in the test group system and comparing it with a control group, wherein the control group is the same system as the test group without the candidate substance added.

9. The method as described in claim 7, characterized in that, Step (1) includes: in the test group, adding the candidate substance to the system expressing miR-494-3p; and / or Step (2) includes: detecting the expression of miR-494-3p in the test group system and comparing it with the control group system, wherein the control group system is a miR-494-3p expression system without the addition of the candidate substance; and / or If the expression of miR-494-3p in the test group is statistically higher than that in the control group, it indicates that the candidate is a potential substance for the prevention or treatment of pancreatitis.

Citation Information

Patent Citations

  • microRNA for detecting and treating inflammatory bowel diseases

    CN108403711A