Exosomal microRNA novel-3 and its application

Abstract

The present invention discloses an exosome microRNA novel-3 and its application; the nucleotide sequence of novel-3 is ucaggccaggcugggaggaugc. The present invention summarizes the relationship between the expression of novel-3 derived from plasma exosomes and the stability of atherosclerotic plaques, uses the plasma exosome novel-3 level to assist in determining whether a patient suffers from large artery atherosclerosis-type acute ischemic stroke, assists in the differential diagnosis of different types of ischemic stroke, and provides guidance for the prognosis stratification of large artery atherosclerosis-type acute ischemic stroke.

Description

Technical Field

[0001] The present invention relates to the field of medical detection, and in particular to an exosome microRNA novel-3 and applications thereof. Background Art

[0002] Atherosclerosis can affect arteries throughout the body, including coronary arteries, cerebral arteries, peripheral arteries, and aorta, and is the main cause of ischemic cardiovascular and cerebrovascular events. Its pathological characteristics are that the lesions of the affected arteries begin with local thickening of the intima, accompanied by accumulation of lipid-rich macrophages (foam cells) and extracellular matrix, fibrosis and calcification, plaque formation in the arterial wall, and stenosis of the lumen of the affected blood vessels, leading to the onset of ischemic events. In recent years, the stability of atherosclerotic plaques has gradually been paid attention to. Plaques with poor stability are often accompanied by intra-plaque hemorrhage and rupture, which are more likely to cause symptomatic ischemic events. Therefore, the judgment of the stability of atherosclerotic plaques has very important clinical value. However, the current evaluation of the stability of plaques is mainly assessed by arterial ultrasound, which is limited by the diagnosis and treatment level of ultrasound physicians, ultrasound examination instruments and equipment, and whether the location and size of blood vessels can be judged by ultrasound. Therefore, it is particularly important to develop universal detection technology based on peripheral blood and to find biomarkers that can accurately judge the stability of plaques.

[0003] On the other hand, large artery atherosclerosis-type ischemic stroke (LAA) is an important subtype of cerebral infarction. It has severe clinical symptoms, high recurrence rate, and poor therapeutic benefits for this type of cerebral infarction such as acute vascular recanalization. Therefore, there is an urgent need for an optimized, sensitive, and clinically operable biomarker for early and accurate diagnosis and prognostic intervention of ischemic stroke caused by atherosclerosis.

[0004] Exosomes are microvesicles with a diameter of 40-150nm and a phospholipid bilayer membrane structure. They can be secreted by a variety of cells and are widely present in the extracellular matrix and body fluids. Exosomes can mediate cell-to-cell communication by carrying substances such as proteins, lipids, metabolites and nucleic acids. Exosomes contain a variety of RNA molecules, among which microRNA (miRNA) with coding information is an endogenous small RNA. Its expression level varies greatly between normal and pathological states, so it has the potential to be a biomarker for disease diagnosis and prognosis.

[0005] At present, there are related reports and patents proposing that changes in blood exosome-derived miRNA in patients with acute ischemic stroke can be used as potential diagnostic markers. The Chinese invention patent with publication number CN105925677A discloses the application of serum exosome miR-9-3p and miR-124-3p as diagnostic markers for acute cerebral infarction, and uses them as markers to judge the degree of cerebral ischemic damage. The Chinese invention patent with publication number CN 111534584A discloses the application of serum exosome miR-410-3p as a diagnostic marker for acute cerebral infarction and its detection method. The Chinese invention patent with publication number CN108070650A discloses that serum exosome miR-155-5p and miR-93-5p can be used as markers to significantly distinguish cardiogenic from non-cardiogenic ischemic stroke for auxiliary diagnosis. These published patents reflect the feasibility of exosomal miRNA as a biomarker for cerebral infarction, but there are no patents publicly reporting the use of exosomal miRNA to assist in the diagnosis or judgment of the prognosis of large artery atherosclerotic cerebral infarction; at the same time, the Chinese invention patent with publication number CN115112877A discloses a serum metabolic marker and its application in assessing the stability of intracranial arterial plaques, but there are no patents publicly reporting the use of exosome-derived miRNA to efficiently and clearly predict the stability of atherosclerotic plaques.

[0006] Therefore, there is an urgent need to develop an exosome-derived miRNA based on peripheral blood as a biomarker for the judgment of atherosclerotic plaque stability and for the diagnosis and prognosis evaluation of ischemic stroke caused by atherosclerosis. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a new exosomal miRNA novel-3 detection method and clinical application. The present invention develops an optimized, clear, sensitive, and clinically operable peripheral blood exosomal miRNA novel-3 as a biomarker for determining the stability of atherosclerotic plaques, assisting in the diagnosis of the risk of ischemic stroke caused by atherosclerosis, the severity of the disease, and the prognosis, which has important clinical application value.

[0008] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0009] The present invention provides an exosomal miRNA novel-3, whose nucleotide sequence is ucaggccaggcugggaggaugc, as shown in SEQ ID NO:1.

[0010] The present invention also provides a primer sequence for reverse transcription of exosomal miRNA novel-3, whose nucleotide sequence is gtcgtatcgactgcagggtccgaggtattcgcagtcgatacgacgcatcc, as shown in SEQ ID NO: 2; and the structure of the primer sequence is a stem-loop structure.

[0011] The present invention also provides a primer pair for detecting exosomal miRNA novel-3: the primer pair is a novel-3-H primer pair or a novel-3-M primer pair; wherein

[0012] The novel-3-H primer pair is:

[0013] novel-3-H upstream sequence: 5'-gctcaggccaggctggga-3',

[0014] novel-3-H downstream sequence: 5′-actgcagggtccgaggtatt-3′;

[0015] The novel-3-M primer pair is:

[0016] novel-3-M upstream primer: 5'-tcaggccaggctggga-3',

[0017] novel-3-M downstream primer: 5'-actgcagggtccgaggtatt t-3'.

[0018] The present invention also provides an application of the above primer pair in detecting plasma exosome novel-3 in patients with large artery atherosclerosis-type ischemic stroke (LAA-AIS).

[0019] The present invention also provides a use of the exosomal miRNA novel-3 as a biomarker in the preparation of a detection and analysis reagent or kit for the stability of atherosclerotic plaques.

[0020] The present invention also provides a use of the exosomal miRNA novel-3 as a biomarker in the preparation of a reagent or a kit for predicting large artery atherosclerosis-type acute ischemic stroke.

[0021] The present invention also provides a use of the exosomal miRNA novel-3 in preparing a product for predicting the prognosis of patients with large artery atherosclerosis-type acute ischemic stroke.

[0022] The present invention also provides a kit, which comprises the above-mentioned primer pair; the purpose of the kit is as follows:

[0023] (1) Used for the detection of atherosclerotic plaque stability;

[0024] (2) Used for the diagnosis of acute ischemic stroke caused by large artery atherosclerosis;

[0025] (3) Used to predict the prognosis of patients with acute ischemic stroke due to large artery atherosclerosis.

[0026] Furthermore, the kit also includes 5× PrimeScript RT Master Mix, enzyme-free water, the primer sequence for reverse transcription novel-3 and Yeason qPCR SYBR Green Master Mix.

[0027] The present invention also provides a use of the above-mentioned kit in detecting, analyzing or predicting large artery atherosclerosis-type acute ischemic stroke (LAA-AIS).

[0028] Beneficial effects of the present invention:

[0029] The present invention determines the sequence detection method of plasma exosomal miRNA novel-3, and proves the important role of plasma exosomal miRNA novel-3 in the risk prediction, differential diagnosis and clinical prognosis of large artery atherosclerotic acute ischemic stroke.

[0030] At the same time, the present invention summarizes the relationship between the expression level of plasma exosome novel-3 and the stability of atherosclerotic plaques (i.e., the expression level of novel-3 in unstable plaques is significantly higher than that in potentially stable plaques), and uses the level of plasma exosome novel-3 to assist in judging the stability of atherosclerotic plaques, providing guidance for the stratified diagnosis of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The volcano plot shows differential miRNA analysis of plasma exosomes in patients with different subtypes of acute ischemic stroke;

[0032] Figure 2 This is a Venn diagram of differential miRNAs in plasma exosomes of patients with different subtypes of acute ischemic stroke;

[0033] Figure 3 This is the expression level of plasma exosome novel-3 in patients with different subtypes of acute ischemic stroke;

[0034] Figure 4 ROC curves of plasma exosome novel-3 expression levels in LAA-AIS patients, healthy subjects, and patients with other subtypes of acute ischemic stroke;

[0035] Figure 5ROC diagram of plasma exosome novel-3 levels in LAA-AIS patients and mRS scores after 3 months;

[0036] Figure 6 This is a graph showing the expression of novel-3 in plaques and plasma exosomes of atherosclerotic mice and their control group;

[0037] Figure 7 This is the expression level of novel-3 in large artery atherosclerotic plaques of different stability levels;

[0038] Figure 8 This is the expression level of plasma exosome novel-3 in patients with different stable grades of LAA-AIS;

[0039] Fig. 9 This is the primer structure diagram for reverse transcription novel-3.

[0040] Fig.10 This is the amplification curve of the primer sequence used to detect plasma exosome novel-3;

[0041] Fig.11 This is the dissolution curve of novel-3 in plasma exosomes detected using primer sequences;

[0042] Fig.12 This is an analysis chart of the expression of novel-3 in plasma exosomes of patients with different subtypes of acute ischemic stroke using a kit;

[0043] Fig.13 The ROC curve of the expression of plasma exosome novel-3 in LAA-AIS patients compared with healthy subjects and other subtypes of ischemic stroke patients was verified by using the kit;

[0044] Fig.14 ROC curve of novel-3 expression level in LAA-AIS patients and mRS score after 3 months;

[0045] Fig.15 This is the ROC curve of novel-3 expression level and atherosclerotic plaque stability in patients with atherosclerosis. DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0047] Example 1 Discovery and sequence analysis of plasma exosomal miRNA novel-3

[0048] The subjects in the embodiment include patients with different subtypes of acute ischemic stroke, including patients with large artery atherosclerosis (LAA), cardioembolic (CES) and small artery occlusion (SVO), as well as age- and sex-matched healthy subjects (HC).

[0049] After collecting venous blood from patients, the total plasma exosomes were extracted using the classic exosome extraction method, differential ultracentrifugation, and miRNA sequencing was performed. By analyzing the differential miRNAs in exosomes of patients with different subtypes of acute ischemic stroke, it was found that LAA patients had a group of significantly upregulated miRNAs compared with HC subjects, CES patients, and SVO patients ( Figure 1 ).

[0050] Subsequently, all differentially expressed upregulated miRNAs in LAA patients compared with the other groups were intersected in a Venn diagram ( Figure 2 ), there is only one miRNA novel-3 (abbreviated as novel-3) that is significantly overexpressed in LAA patients. The nucleotide sequence of novel-3 obtained by sequencing analysis is as follows: ucaggccaggcugggaggaugc, as shown in SEQ ID NO:1.

[0051] Example 2 Plasma exosomal miRNA novel-3 is used for the diagnosis and differential diagnosis of patients with different subtypes of acute cerebral infarction

[0052] A quantitative analysis of novel-3 in the plasma of patients with the above-mentioned different subtypes of acute ischemic stroke was performed, including 12 LAA, 12 CES, 12 SVO and 8 age- and sex-matched healthy subjects (HC). The expression level of novel-3 in plasma was detected by high-throughput sequencing.

[0053] The results showed that novel-3 expression levels showed significant differences in patients with different subtypes of acute ischemic stroke. Compared with their controls, CES patients, and SVO patients, the relative expression level of novel-3 in LAA patients was significantly increased ( Figure 3 ); The sensitivity was plotted against 1-specificity to establish the ROC curve for predictive evaluation of LAA and HC and other subtypes of acute ischemic stroke.

[0054] The results showed that the area under the curve (AUC) of the LAA group was 0.8125 and p value was 0.02068 compared with the HC group; the AUC of the LAA group was 0.8125 and p value was 0.009402 compared with the SVO group; the AUC of the LAA group was 0.8125 and p value was 0.009402 compared with the CES group. This indicates that the plasma exosome novel-3 can be used as a biomarker with good potential for distinguishing LAA-type acute ischemic stroke (LAA-AIS). Figure 4 ).

[0055] Example 3 Plasma exosome novel-3 is used to predict the clinical prognosis of LAA-AIS patients

[0056] In this example, a total of 10 LAA-AIS patients were included. Blood samples were collected from patients during the acute attack period, and plasma exosomes were extracted by differential-ultracentrifugation. High-throughput sequencing was used to quantify plasma exosome novel-3. The modified Rankin scale (mRS) was used to evaluate the clinical prognosis of LAA-AIS patients at 3 months. The mRS score, also known as the modified Rankin score scale, is a scale used to evaluate the neurological function recovery status of stroke patients. It is divided into seven levels:

[0057] Grade 0: Completely asymptomatic.

[0058] Grade 1: Despite symptoms, the patient has no significant disability and can perform all usual tasks and activities.

[0059] Level 2: Mild disability, unable to complete all work and activities, but can handle personal affairs without the help of others.

[0060] Level 3: Moderate disability, requiring help from others, to the point where the person can walk without assistance.

[0061] Level 4: Severe disability, unable to walk without help from others and unable to take care of own needs.

[0062] Level 5: Severe disability, bedridden, incontinent, requires constant care, and needs to be looked after by others multiple times 24 hours a day.

[0063] Level 6: Death.

[0064] It is generally believed that mRS 3 points and above indicate a poor outcome, and 2 points and below indicate a good functional outcome. The ROC curve was used to predict the functional outcome of patients with LAA-AIS at baseline by comparing the level of novel-3 in the sequencing results with the mRS score at 3 months.

[0065] The results showed that the area under the ROC curve (AUC) between the expression of novel-3 in the baseline period of LAA-AIS patients and the functional outcome of the patients at 3 months was 0.9167, p = 0.03305, which suggested that the plasma exosome novel-3 level of LAA-AIS patients could well predict the clinical functional prognosis of patients 3 months later, and it was feasible and reliable to use the plasma exosome novel-3 level to predict the clinical prognosis of LAA patients ( Figure 5 ).

[0066] Example 4 The expression of exosome novel-3 in atherosclerotic plaques and plasma is significantly increased

[0067] A classic method was used to construct an atherosclerotic mouse (AS) model and a control group (Con), that is, ApoE knockout mice were fed with a high-fat diet and a normal diet for 12 weeks. Blood samples and atherosclerotic plaque tissues of the two groups of mice were collected, and exosomes were extracted by ultracentrifugation after differential centrifugation. The miRNeasy Micro purification kit (Qiagen, 217084) was used to extract total RNA containing miRNA according to the instructions, and reverse transcribed into cDNA (primer sequence: 5'-gtcgtatcgactgcagggtccgaggtattcgcagtcgatacgacgcatcc-3'), and the expression of novel-3 was detected by real-time fluorescence quantitative PCR. The PCR primer pair was novel-3-M primer pair:

[0068] novel-3-M upstream primer: 5'-tcaggccaggctggga-3', as shown in SEQ ID NO:5;

[0069] novel-3-M downstream primer: 5′-actgcagggtccgaggtattt-3′, as shown in SEQ ID NO:6.

[0070] The results showed that the expression of novel-3 in plaques and plasma exosomes of AS mice was significantly higher than that of Con group mice; thus, novel-3, as a biomarker, has an auxiliary diagnostic value for atherosclerosis ( Figure 6 ).

[0071] Example 5 Expression of novel-3 in plaques and peripheral blood of patients with atherosclerosis and its correlation with plaque stability

[0072] Atherosclerotic plaque tissue and blood samples were collected from patients undergoing carotid endarterectomy. Histochemical staining was analyzed according to the Lovett gold standard semi-quantitative classification method. For each plaque, the presence and / or quantity of features such as fibrous cap rupture, lipid core size, nodular calcification, neovascularization, inflammatory infiltration, fibrous cap infiltration, fibrous tissue ratio, intraplaque hemorrhage and surface thrombus were used for grading. The stability of atherosclerotic plaques was divided into three grades:

[0073] (I) may stabilize plaques,

[0074] (II) Possible unstable plaque,

[0075] (III) Unstable plaque.

[0076] The expression of novel-3 in plaques was quantitatively analyzed by fluorescent in situ hybridization probe (sequence: 5'-gcauccucccagccuggccuga-3'), and the expression level difference (density) of novel-3 in the above different types of atherosclerotic plaques was analyzed. The results showed that the expression of novel-3 in unstable plaques was significantly higher than that in possible stable plaques, suggesting that novel-3 produced by plaques can reflect the stability of plaques ( Figure 7 ).

[0077] The plasma exosomes of the corresponding patients were extracted and the expression of novel-3 in the exosomes was detected. It was found that the expression of novel-3 in the plasma of patients with unstable plaques was also significantly higher than that in the plasma of patients with possible stable plaques, which was consistent with the trend of novel-3 expression in plaques, suggesting that the expression level of plasma exosome miRNA novel-3 can reflect the stability of plaques ( Figure 8 ).

[0078] In summary, novel-3, as an exosome-related biomarker that can be stably detected in plasma, has a certain predictive significance for the stability of plaques in patients with atherosclerosis.

[0079] Example 6 Design and verification of primer sequences for detecting novel-3

[0080] (1) The primer sequence for reverse transcription of novel-3 is:

[0081] 5'-gtcgtatcgactgcagggtccgaggtattcgcagtcgatacgacgcatcc-3', such as

[0082] As shown in SEQ ID NO:2; the stem-loop structure of the primer is Fig. 9 shown.

[0083] (2) Primer pair sequence detection for novel-3

[0084] novel-3-H upstream sequence: 5'-gctcaggccaggctggga-3', which is shown in SEQ ID NO: 3;

[0085] novel-3-H downstream sequence: 5′-actgcagggtccgaggtatt-3′, which is shown in SEQ ID NO:4.

[0086] (3) Verify the effectiveness and specificity of primers

[0087] After reverse transcription of RNA to obtain cDNA using stem-loop primers (concentration of 2 μM), RT qPCR was used to detect the expression of novel-3. The -ΔCT analysis method was used for relative quantitative analysis of novel-3. By verifying its amplification curve ( Fig.10 ) and melting curves ( Fig.11 ) to determine the effectiveness and specificity of the primers.

[0088] The amplification curve has a flat baseline phase, a distinct exponential phase, a gradually flattened linear phase, a basically flat platform phase, and a smooth overall curve, indicating that the amplification efficiency of the primer is good. The melting curve has a single peak between 80 and 90°C, indicating that the PCR product has good specificity and this primer pair has good specificity.

[0089] The above data confirm that the primer sequence in this example can well and specifically amplify novel-3 in circulating exosomes, and can be used to prepare a detection kit for detecting novel-3 in plasma.

[0090] Example 7 Preparation of novel-3 detection kit for diagnosis of LAA-AIS

[0091] The kit includes 5× PrimeScript RT Master Mix, enzyme-free water, the above-mentioned stem-loop structure primer, Yeason qPCR SYBR Green Master Mix, the above-mentioned novel-3-H upstream primer, and the above-mentioned novel-3-H downstream primer;

[0092] Plasma was collected from patients in the validation cohort, including 20 cases of LAA, CES and SVO, as well as 20 cases of age- and sex-matched healthy subjects (HC). Exosomal miRNAs were extracted from plasma of different groups, and the expression level of novel-3 was detected using the novel-3 detection kit.

[0093] The test data from the kit showed that the expression of novel-3 in the plasma of LAA patients was significantly upregulated compared with the control group and other subtypes of stroke patients ( Fig.12 ).

[0094] ROC curves were drawn for novel-3 expression levels in the LAA group and those in the HC group, SVO group, and CES group. The results showed that compared with the HC group, the area under the curve (AUC) of the LAA group was 0.8263, with a p value of 0.0004192; compared with the SVO group, the AUC of the LAA group was 0.8788, with a p value of <0.0001; compared with the CES group, the AUC of the LAA group was 0.8800, with a p value of <0.0001 ( Fig.13 ); This indicates that the kit has good potential for identifying LAA-type acute ischemic stroke.

[0095] Example 8 The above kit is used to evaluate the clinical prognosis of LAA-AIS patients.

[0096] Twenty LAA-AIS patients were screened clinically, and plasma exosome miRNA was extracted at baseline. The expression level of novel-3 was detected using the above kit, and the modified Rankin scale (mRS) was used to evaluate the clinical functional prognosis of LAA-AIS patients 3 months after onset. mRS 3 points and above were considered poor outcomes, and 2 points and below were considered good functional outcomes. The ROC curve was drawn to compare the baseline novel-3 expression level of LAA-AIS patients with their mRS scores (binary outcomes) at 3 months ( Fig.14 ).

[0097] The results showed that the area under the ROC curve between the expression of novel-3 in LAA patients at baseline and the mRS score at 3 months was 0.9798, p = 0.0003107. This indicates that the kit can better evaluate the clinical prognosis of LAA patients 3 months later by detecting the expression of novel-3 in LAA patients at baseline.

[0098] Example 9: Using the above kit to evaluate the stability of atherosclerotic plaques

[0099] Atherosclerotic plaque tissues and blood samples were collected from 40 patients undergoing carotid endarterectomy. According to the Lovett gold standard semi-quantitative classification method, the stability of atherosclerotic plaques was divided into 20 cases of potentially stable plaques and 20 cases of unstable plaques.

[0100] The plasma exosomes of the corresponding patients were extracted, and the expression of novel-3 in the exosomes was detected using the above kit. The expression level of novel-3 in patients with atherosclerosis was compared with the stability of atherosclerotic plaques to draw an ROC curve ( Fig.15 ).

[0101] The results showed that the area under the ROC curve of novel-3 expression in patients with atherosclerosis to predict the instability of atherosclerotic plaques was 0.8950, p<0.0001. This indicates that the kit can better evaluate the stability of atherosclerotic plaques by detecting the expression of plasma novel-3.

[0102] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Use of a primer pair for detecting exosomal miRNA novel-3 in the preparation of a detection and analysis reagent or kit for atherosclerotic plaque stability, characterized in that: The nucleotide sequence of the exosomal miRNA novel-3 is shown in SEQ ID NO: 1; the primer pair is a novel-3-H primer pair or a novel-3-M primer pair; wherein the novel-3-H primer pair is: novel-3-H upstream sequence: 5'-gctcaggccaggctggga-3', novel-3-H downstream sequence: 5′-actgcagggtccgaggtatt-3′; The novel-3-M primer pair is: novel-3-M upstream primer: 5'-tcaggccaggctggga-3', novel-3-M downstream primer: 5'-actgcagggtccgaggtatt t-3'.

2. Use of a primer pair for detecting exosomal miRNA novel-3 in the preparation of a reagent or kit for predicting large artery atherosclerosis-type acute ischemic stroke, characterized in that: The nucleotide sequence of the exosomal miRNA novel-3 is shown in SEQ ID NO: 1; the primer pair is a novel-3-H primer pair or a novel-3-M primer pair; wherein the novel-3-H primer pair is: novel-3-H upstream sequence: 5'-gctcaggccaggctggga-3', novel-3-H downstream sequence: 5′-actgcagggtccgaggtatt-3′; The novel-3-M primer pair is: novel-3-M upstream primer: 5'-tcaggccaggctggga-3', novel-3-M downstream primer: 5'-actgcagggtccgaggtatt t-3'.

3. A primer pair for detecting exosomal miRNA novel-3 is used in the preparation of a product for predicting the prognosis of patients with acute ischemic stroke due to large artery atherosclerosis, characterized in that: The nucleotide sequence of the exosomal miRNA novel-3 is shown in SEQ ID NO: 1; the primer pair is a novel-3-H primer pair or a novel-3-M primer pair; wherein the novel-3-H primer pair is: novel-3-H upstream sequence: 5'-gctcaggccaggctggga-3', novel-3-H downstream sequence: 5′-actgcagggtccgaggtatt-3′; The novel-3-M primer pair is: novel-3-M upstream primer: 5′-tcaggccaggctggga-3′, novel-3-M downstream primer: 5′-actgcagggtccgaggtatt t-3′.

Images