Du1 mutant, coding gene, detection primer combination and application thereof
By developing the du1-KASP primer combination and utilizing PCR detection technology, the problem of high-throughput rapid identification of du1 gene mutants was solved, enabling early rapid identification of fresh corn quality improvement and effective utilization of germplasm resources.
Patent Information
- Application Number
- CN202310329973.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-30
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2043-03-30
AI Technical Summary
The lack of high-throughput and rapid detection methods for identifying du1 gene mutants in current technology increases the difficulty of their application in fresh corn breeding, especially the identification of double or multiple recessive mutants, which affects the effective utilization of corn germplasm resources.
A du1-KASP primer combo was developed. Using PCR detection technology, specific fluorescent reporter groups are used to identify du1 gene mutants. This enables high-throughput, rapid, and accurate identification of different maize types, including du1du1, du1Du1, and Du1Du1. The primers were designed with the detection needs of different genetic backgrounds in mind.
This technology enables early and rapid identification of du1 gene mutant maize, improves the efficiency of quality breeding, promotes the improvement of fresh maize quality, and simplifies the screening and application of germplasm resources.
Smart Images

Figure BDA0004154634110000061 
Figure BDA0004154634110000071 
Figure BDA0004154634110000072
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the du1 mutant and its encoding gene, detection primer combinations, and applications. Background Technology
[0002] The corn endosperm stores abundant carbohydrates, providing ample nutrition and energy for corn seed germination. Homozygous mutations in carbohydrate-related genes can alter the composition, properties, structure, and quantity of carbohydrates, leading to significant changes in corn kernel phenotypes and laying the genetic foundation for breeding diverse sweet corn varieties. For example, starch auxotrophic mutant genes su1 (sweetness 1) and sh2 (wrinkled 2) limit starch synthesis by reducing substrate supply and increasing levels of reducing sugars, sucrose, or water-soluble polysaccharides, making them important germplasm resources for sweet corn breeding. Mutations in starch modification genes wx (waxy) and ae (amylose extension) alter the ratio of amylose to amylopectin in starch, representing important germplasm resources for the genetic improvement of starch quality.
[0003] Researching new carbohydrate-related genes or mutants can enrich maize breeding resources, and developing new and effective detection methods for them can facilitate the efficient utilization of resources. Summary of the Invention
[0004] The purpose of this invention is to provide a novel gene mutant related to corn sweetness and its detection method.
[0005] This invention identifies and clones the du1 gene mutant, analyzes its function and sequence variation characteristics, and successfully develops a primer set for detecting gene function using KASP based on key sequence variation sites (large fragment insertions).
[0006] Specifically, the present invention provides a natural mutant of the starch synthase du1 gene, the DNA sequence of which is shown in SEQ ID No: 1-3 in sequence. It also provides a KASP primer combination du1-KASP for detecting the du1 gene mutant, which can detect a 5839bp (TGTTATNACCAGT / TGTTATNACCAGT) insertion mutation in du1du1 homozygous mutant maize, detect no insertion (- / -) in Du1Du1 wild-type maize, and detect both no insertion and insertion mutation (- / TGTTATNACCAGT) in du1Du1 heterozygous maize.
[0007] In this invention, TGTTAT refers to the first 6 bases of the 5839bp inserted in the du1 mutant, ACCAGT refers to the last 6 bases, and the remaining large intermediate base sequences are represented by N.
[0008] In the process of selecting and breeding fresh-eating corn, a new type of sweet corn with shrunken grains and an obvious appearance different from the su1 and sh2 genotypes was discovered, named XT sweet corn. The sugar content of its mature and naturally dried grains is between that of ordinary corn and su1su1 homozygous mutant sweet corn. XT sweet corn was reciprocally crossed with the ordinary corn inbred lines Jing 2416 and Jing 724 respectively and then self-crossed to construct 4 F2 segregation populations. BSR-seq mapping of the 4 segregation populations mapped the candidate gene to the interval of 24 Mb - 68 Mb on chromosome 10 (B73 RefGen_v3). According to the gene function annotation in this region of the maize B73 reference genome, GRMZM2G141399 (Du1) was speculated to be the candidate gene, which encodes starch synthase SSII. PCR sequencing analysis found that a large fragment of 5839 bp was inserted after 1455 bp in the third exon of the du1 mutant gene. Analysis by the CENSOR software found that this inserted sequence is a Gypsy-like LTR retrotransposon. cDNA sequence analysis found that the large fragment insertion in the third exon of the du1 gene in XT sweet corn was transcribed, resulting in abnormal amino acid coding of the du1 gene, which is the reason for the loss of function of the dul gene in XT sweet corn. In view of this insertion mutation, the present invention designed KASP primers and developed a du1 mutation site-specific primer combination du1-KASP, and used it to genotype XT sweet corn and its 3 selected lines, 4 waxy corn inbred lines, 3 ordinary corn inbred lines, and 20 su1su1sh2sh2 double-gene homozygous mutant micro-endosperm corn inbred lines. The test results were consistent with the expectations, indicating that the KASP-du1 primer combination can rapidly and highly-throughput identify du1 mutant corn.
[0009] Specifically, the present invention provides the following technical solutions:
[0010] In the first aspect, the present invention provides a du1 gene mutant having a nucleotide sequence shown by the sequential connection of SEQ ID No: 1-3.
[0011] The nucleotide sequence of the du1 gene mutant of the present invention contains 17,418 bases, wherein the 1st - 2474 bp is as shown in SEQ ID No: 1, the 2475 - 8313 bp is as shown in SEQ ID No: 2, and the 8314 - 17418 bp is as shown in SEQ ID No: 3.
[0012] In the second aspect, the present invention provides a du1 protein mutant having an amino acid sequence shown by SEQ ID No: 4.
[0013] Thirdly, the present invention provides a KASP primer combination for detecting du1 gene mutants, comprising two specific primers and two universal primers, wherein the sequences of the specific primers are shown in SEQ ID NO. 5-6, and the sequences of the universal primers are shown in SEQ ID NO. 7-8; the two specific primers are respectively labeled with fluorescent reporter groups that produce different fluorescent colors; the du1 gene mutant has a nucleotide sequence as shown in SEQ ID No: 1-3 connected in sequence.
[0014] The fluorescent reporter group is any one of FAM, HEX, JOE, TET, CY3, CY5, ROX, and Texas.
[0015] The du1 gene mutant in maize has significant value in the genetic improvement of sweet maize quality. Due to the interaction between gene mutation and genetic background, it is sometimes difficult to identify starch synthesis-related mutant genes through kernel phenotype, especially for double or multiple recessive mutants. Molecular marker-assisted selection can improve the efficiency of quality breeding. However, currently, there are no usable primer combinations for detecting the du1 mutant gene, severely limiting the identification of du1 maize germplasm and its application in sweet maize breeding. The lack of high-throughput, rapid identification methods for the du1 gene not only restricts the screening and identification of du1 gene mutant maize germplasm but also greatly increases the difficulty of its widespread application in sweet maize improvement breeding.
[0016] In designing detection primers, besides general primer design rules, when the mutation site involves multiple deleted or inserted bases, using bases at different positions of the inserted or deleted fragments as the 3' end of the specific primer significantly impacts the detection performance without a consistent pattern. Furthermore, to detect maize materials from different sources, primer design must also consider the detection requirements of maize materials with different genetic backgrounds. All of these factors contribute to the difficulty in developing primer combinations with high sensitivity and specificity.
[0017] The du1-KASP developed in this invention can rapidly and accurately identify different types of maize, such as du1du1, du1Du1, and Du1Du1, through high throughput. It can be applied to the identification and breeding of du1 maize through molecular marker-assisted breeding, which will accelerate the application of the dul mutant gene in the breeding of fresh maize for quality improvement.
[0018] Fourthly, the present invention provides a detection reagent or kit for detecting du1 gene mutants, comprising the above-described KASP primer combination; the du1 gene mutant has a nucleotide sequence as shown in SEQ ID No: 1-3 in sequence.
[0019] Fifthly, the present invention provides a method for detecting maize, which uses the genomic DNA of the maize sample to be tested as a detection template and performs PCR detection using a KASP primer combination, wherein the KASP primer combination is as described above;
[0020] If only the fluorescence signal carried by the specific primer shown in SEQ ID NO.5 is detected, it is determined that the maize sample to be tested contains a 5839bp insertion mutation after the 2474bp of the du1 gene, and the maize to be tested is a du1 gene mutant maize with a sugar content higher than that of ordinary maize inbred lines and waxy maize inbred lines.
[0021] If only the fluorescent signal carried by the specific primer shown in SEQ ID NO.6 is detected, it is determined that the maize sample to be tested does not contain a 5839bp insertion mutation after the 2474bp of the du1 gene, and the maize to be tested is wild-type maize of the Du1 gene.
[0022] If a fluorescent signal carried by a specific primer as shown in SEQ ID NO.5-6 is detected simultaneously, the maize sample to be tested is determined to be a heterozygous maize of the Du1du1 gene.
[0023] In this invention, common corn refers to corn that is harvested at full maturity and is mainly used as feed, as is known in the art. It is different from fresh corn (which includes sweet corn, waxy corn and sweet-waxy corn) that is harvested at the milk stage and can be eaten fresh.
[0024] In a sixth aspect, the present invention provides the application of the du1 protein mutant or its encoding gene, or biological materials containing its encoding gene, or the above-mentioned KASP primer combination, or detection reagent or kit, or method in identifying maize sweetness, identifying maize germplasm resources, improving or molecular marker-assisted breeding; the du1 mutant protein has an amino acid sequence as shown in SEQ ID No: 4.
[0025] In the application of this invention, the biological material is an expression cassette, vector, host cell, or recombinant bacteria.
[0026] The coding gene has a nucleotide sequence as shown in SEQ ID No: 1-3 linked together.
[0027] The beneficial effects of this invention are as follows:
[0028] This invention provides a novel mutant of the starch synthase du1 gene, which is associated with the sweetness of maize and can be applied to maize genetic improvement. This invention also provides a primer combination capable of high-throughput, rapid, and accurate identification of different types of maize, including du1du1, du1Du1, and Du1Du1. The du1-KASP primer combination is suitable for early and rapid identification, which is beneficial for accelerating the selection of du1 maize germplasm and its application in the quality improvement of fresh maize; the KASP marker is expressed in DNA form and exists in various maize tissues, making it convenient to obtain samples. Attached Figure Description
[0029] Figure 1 Phenotypes of sweet corn kernels from varieties T9, SH251, and XT. Scale bar = 1 cm.
[0030] Figure 2 The BSR-seq mapping results for the regulatory genes of XT sweet corn.
[0031] Figure 3 The results show the comparison of the Du1 gene DNA sequence in XT sweet corn and common corn B73. In the figure, A shows the comparison of the fragment size differences of the Du5F / Du5R primer amplification products in exon 3 (XT, XT1, XT2, and XT3 are XT sweet corn and their three selected lines, respectively); B is a schematic diagram of the 5839bp Gypsy-like LTR retrotransposon insertion in exon 3 of XT sweet corn.
[0032] Figure 4 This figure shows the comparison results of cDNA amplification products of the Du1 gene in XT sweet corn and common corn B73. In the figure, A is a schematic diagram showing the position of the cDNA amplification primers on the du1 gene. B shows the comparison results of the differences in cDNA amplification products.
[0033] Figure 5 The results of genotyping of different maize inbred lines using the du1-KASP primer combination are shown; the two dots near the origin in the figure represent template-free controls. Detailed Implementation
[0034] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0035] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels. The maize inbred lines used in the present invention are all from the germplasm resource bank of the Maize Research Institute of Beijing Academy of Agriculture and Forestry Sciences, and those skilled in the art can obtain them according to conventional methods.
[0036] Example 1 Phenotype of XT Sweet Corn and BSR-Seq Mapping of Its Regulatory Genes
[0037] su1 and sh2 genotype sweet corns are the main types currently used in the breeding of sweet corn or sweet plus waxy fresh-eating corn. The mature naturally air-dried grains of su1su1 genotype sweet corn (T9) are semi-transparent, and the mature naturally air-dried grains of sh2sh2 genotype sweet corn (SH251) are sunken and shriveled. During the breeding process of fresh-eating corn, the present invention discovered a new type of sweet corn with an appearance significantly different from su1 and sh2 genotypes, named XT sweet corn (which can be obtained from the germplasm resource bank of the Maize Research Institute of Beijing Academy of Agriculture and Forestry Sciences), and its mature naturally air-dried grains are shrunken and opaque (see Figure 1 ). XT sweet corn is sweeter when eaten tender, and sweet and waxy when eaten slightly older, with a unique flavor. The sugar content of the mature naturally air-dried grains was measured and found that the sugar content of XT sweet corn was 62.82 ± 0.11 mg / g, which was between that of the common maize inbred line Jing724 (19.32 ± 0.11 mg / g) and the su1su1 homozygous mutant sweet corn inbred line Tianjing724 (110.9 ± 0.30 mg / g). Three biological replicates were performed for each sample measurement.
[0038] XT sweet corn was reciprocally crossed with the common maize inbred lines Jing2416 and Jing724 and then self-crossed to construct four F2 segregation populations: XT sweet corn × Jing2416, XT sweet corn × Jing724, Jing2416 × XT sweet corn, and Jing724 × XT sweet corn. It was found that the F2 grains of the four segregation populations were all separated into two types: plump grains and shrunken grains. For each segregation population, 30 plump grains and 30 shrunken grains were germinated respectively, and the total RNA was extracted from the equal amounts of single-plant leaves after mixing using a total RNA extraction kit (Tiangen Biochemical Technology Co., Ltd.) to prepare two RNA pools of plump grains and shrunken grains, and BSR-seq analysis was performed on the mixed pools. BSR-seq was carried out according to the standard experimental procedures of Data2Bio company. The BSR-seq mapping of the four segregation populations simultaneously showed that more than 90% of the SNPs with a linkage probability greater than 0.05 were located on chromosome 10. These SNPs were scanned using the sliding window method (window size: 20 SNPs; step size: 5 SNPs) to narrow the mapping interval, and the mapping results of the four segregation populations were intersected. Finally, the candidate gene was mapped to the interval of 24 Mb - 68 Mb on chromosome 10 (B73 RefGen_v3) (see Figure 2Based on the gene function annotation in this region of the maize B873 reference genome, GRMZM2G141399(Du1) is speculated to be a candidate gene that encodes starch synthase SSII. Mutations in this gene will lead to the accumulation of glycogen in plants.
[0039] Example 2: Analysis of du1 gene DNA and cDNA sequences
[0040] Genomic DNA was extracted from leaves of XT sweet corn and common maize inbred line B73 using a DNA extraction kit (Tiangen Biotech Co., Ltd.). The full-length DNA sequence of the Du1 gene in XT sweet corn and common maize B73 was amplified in segments. Differential analysis revealed that the primer pairs Du5F:TCCAATCCGTTGCTGGCTAT (SEQ ID NO. 9) and Du5R:GCCACAGCTGATAGATCACGA (SEQ ID NO. 10) located in the third exon of the Du1 gene amplified 1105 bp in common maize B73, while the amplification product in XT sweet corn was approximately 8 kb. This indicates a large insertion mutation in the third exon of the du1 gene in XT sweet corn (see...). Figure 3 (A in the text). Sequencing analysis of the PCR product revealed a 5839bp insertion in the du1 mutant gene after 1455bp in the third exon (see A in the text). Figure 3 The insertion (B) in the du1 gene contains a 5839bp insertion after the 2474th bp mark. Analysis using CENSOR software (https: / / www.girinst.org / censor / index.php) revealed that this insertion sequence is a Gypsy-type LTR retrotransposon.
[0041] The nucleotide sequence of the du1 gene mutant is shown in SEQ ID NO. 1-3 linked together, and the amino acid sequence is shown in SEQ ID NO. 4.
[0042] Total RNA was extracted from leaves of XT sweet corn and B73 using a total RNA extraction kit (Tiangen Biotech Co., Ltd.). The RNA was then analyzed using PrimeScript. TM II. The 1st Strand cDNA Synthesis Kit (Takara) reverse transcription kit was used to convert RNA into cDNA. The full-length cDNA sequence of the Du1 gene in XT sweet corn and common corn B73 was amplified in segments (primers used are shown in Table 1). Gel electrophoresis and sequencing of the PCR products both revealed that a large insertion sequence in the third exon of the du1 gene in XT sweet corn was transcribed (see Table 1). Figure 4 The presence of A and B in the Du1 gene will inevitably lead to abnormal amino acid coding, which is the reason for the loss of function of the dul gene in XT sweet corn.
[0043] Table 1
[0044]
[0045]
[0046] Example 3: Development and Application of Molecular Markers for the du1 Mutant Gene
[0047] To target the large 5839 bp insertion of the du1 gene in exon 3 of XT sweet corn, KASP primers were designed, and a du1-KASP primer combination (Table 2) was developed for the specific detection of the du1 mutation site. AlleleX (SEQ ID NO.5) and Common2 (SEQ ID NO.8) are a pair that can detect the du1 mutant gene of this invention; AlleleY (SEQ ID NO.6) and Common1 (SEQ ID NO.7) are a pair that can detect the non-mutated du1 gene.
[0048] Genotyping was performed on XT sweet maize and its three selected lines (XT1, XT2, and XT3), four waxy maize inbred lines (Jingke Nuo 219F, Jingke Nuo 219M, Jing 6, and BN2), three common maize inbred lines (Jing 724, Jing 2416, and B73), and 20 micro-endosperm maize inbred lines carrying homozygous mutations of the su1su1sh2sh2 gene (Huada122, Huada164, Huada165, Huada180, Huada227, Huada254, Huada415, Huada491, Huada512, Huada515, Huada517, Huada534, Huada536, Huada548, Huada595, Huada599, Huada600, Huada618, HuajianF, and HuajianM) using the du1-KASP primer combination. Genotyping was performed according to LGC's standard laboratory procedures.
[0049] The test results revealed the insertion of TTGTTATNACCAGT / TGTTATNACCAGT in XT sweet corn and its three selected lines (XT1, XT2, and XT3), while other maize inbred lines showed no insertion mutation (see genotyping results for details). Figure 5 This is consistent with the actual situation of the material, indicating that the KASP-du1 molecular marker can identify maize carrying the du1 mutation in a high-throughput and rapid manner.
[0050] This embodiment tested the sugar content of mature, naturally dried kernels from the above-mentioned common maize inbred lines, waxy maize inbred lines, and du1 gene mutant maize. Specific results are shown in Table 3 (three biological replicates per group). Based on the genotyping results and the sugar content determination results of mature, naturally dried kernels, it can be concluded that the method of this invention can effectively screen for maize with higher sweetness (du1 gene mutant maize) from common maize inbred lines, waxy maize inbred lines, and du1 gene mutant maize.
[0051] Table 2 Information on du1-KASP primer combinations
[0052]
[0053]
[0054] Table 3 Sugar content of corn kernels after natural drying at maturity
[0055]
[0056] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A du1 gene mutant, characterized in that, The nucleotide sequences are shown as SEQ ID No: 1-3 linked together.
2. A du1 protein mutant, characterized in that, The amino acid sequence is shown in SEQ ID No:
4.
3. A KASP primer combination for detecting du1 gene mutants, characterized in that, It includes two specific primers and two universal primers, wherein the sequences of the specific primers are shown in SEQ ID NO. 5-6, and the sequences of the universal primers are shown in SEQ ID NO. 7-8; the two specific primers are respectively labeled with fluorescent reporter groups that produce different fluorescent colors; the nucleotide sequences of the du1 gene mutant are shown in SEQ ID No: 1-3 connected in sequence.
4. The KASP primer combination according to claim 3, characterized in that, The fluorescent reporter group is any one of FAM, HEX, JOE, TET, CY3, CY5, ROX, and Texas.
5. A detection reagent or kit for detecting du1 gene mutants, characterized in that, The mixture comprises the KASP primer combination as described in claim 3 or 4; the nucleotide sequence of the du1 gene mutant is shown in SEQ ID No: 1-3 in sequence.
6. A method for detecting corn, characterized in that, Using the genomic DNA of the maize sample to be tested as a detection template, PCR detection was performed using a KASP primer combination, wherein the KASP primer combination is as described in claim 3 or 4; If only the fluorescence signal carried by the specific primer shown in SEQ ID NO.5 is detected, it is determined that the maize sample to be tested contains a 5839 bp insertion mutation after the 2474 bp of the du1 gene, and the maize to be tested is a du1 gene mutant maize with a sugar content higher than that of ordinary maize inbred lines and waxy maize inbred lines. If only the fluorescence signal carried by the specific primer shown in SEQ ID NO.6 is detected, it is determined that the maize sample to be tested does not contain a 5839 bp insertion mutation after the 2474 bp of the du1 gene, and the maize to be tested is a wild-type maize of the Du1 gene. If a fluorescent signal carried by a specific primer as shown in SEQ ID NO.5-6 is detected simultaneously, the maize sample to be tested is determined to be a heterozygous maize of the Du1du1 gene.
7. The application of the du1 protein mutant or its encoding gene, or biological material containing its encoding gene, or the KASP primer combination as described in claim 3 or 4, or the detection reagent or kit as described in claim 5, or the method described in claim 6 in identifying maize sweetness, identifying maize germplasm resources, improving or molecular marker-assisted breeding; the amino acid sequence of the du1 mutant protein is shown in SEQ ID No:
4.
8. The application according to claim 7, characterized in that, The biological material is an expression cassette, vector, host cell, or recombinant bacteria.
9. The application according to claim 7 or 8, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID No: 1-3 linked together.