Kit for detecting biomarker and differentiating histological subtypes of non-small cell lung cancer
Through high-throughput sequencing and site-directed methylation fluorescence quantitative PCR, the methylation of specific chromosomal segments of non-small cell lung cancer is detected, solving the problem of distinguishing lung adenocarcinoma and lung squamous cell carcinoma, and achieving early precision treatment.
Patent Information
- Application Number
- CN202310625771.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-30
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2043-05-30
AI Technical Summary
The prior art is difficult to efficiently identify the histological subtypes of non-small cell lung cancer through molecular biological methods, especially lung adenocarcinoma and lung squamous cell carcinoma, which leads to difficulty in selecting treatment options.
Through high-throughput sequencing and site-directed methylation fluorescence quantitative PCR methods, the degree of methylation in specific segments of the human chromosome was detected, and primers and probes were designed to distinguish methylated gene sequences of lung adenocarcinoma and lung squamous cell carcinoma.
The histological subtypes of non-small cell lung cancer were achieved with high sensitivity and high specificity from alveolar lavage fluid, reducing patient pain and improving the accuracy of the treatment plan.
Smart Images

Figure CN116656823B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of disease detection, and particularly to detection markers and a kit for differentiating histological subtypes of non-small cell lung cancer. Background Art
[0002] The incidence and mortality rates of lung cancer rank among the top in China. The histological types of lung cancer are divided into small cell lung cancer and non-small cell lung cancer. Among them, non-small cell lung cancer accounts for the vast majority, about 85% of the proportion of lung cancer. Non-small cell lung cancer is divided into squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Among them, squamous cell carcinoma and adenocarcinoma are the two main histological subtypes of non-small cell lung cancer, accounting for the vast majority of non-small cell lung cancer. There are obvious differences in their biological behaviors and prognoses, and there are also significant differences in their clinical treatments. For example, targeted drug therapy has a better effect on lung adenocarcinoma, so gene detection is recommended for patients with lung adenocarcinoma. Lung squamous cell carcinoma has a better effect on immunotherapy, so PDL-1 protein detection is recommended. Currently, clinically, to distinguish the histological type of lung cancer, it is necessary to surgically remove the tumor tissue from a patient diagnosed with lung cancer and then identify the lung cancer type through pathological hematoxylin-eosin staining (HE). If molecular biological methods can be used to distinguish lung adenocarcinoma and lung squamous cell carcinoma through a small amount of cancer cells in bronchoalveolar lavage fluid or biopsy tissue, it can reduce the pain of patients and identify the histological type of lung cancer earlier and more precisely to accurately guide the treatment of lung cancer patients. Existing research shows that there are differences in gene methylation in tumors of different histological types. For example, the RASSF1A gene is methylated in squamous cell carcinoma of cervical cancer but not in adenocarcinoma of cervical cancer. Summary of the Invention
[0003] In the present invention, a detection marker is provided, which includes detecting the methylation degree of one or more of human chromosomes chr20:47444720-47444924, chr20:47444217-47444339, or chr20:47444014-47444136 and their combinations.
[0004] In one embodiment, the present invention provides the application of the above detection marker in the preparation of a product for detecting whether non-small cell lung cancer is squamous cell carcinoma or adenocarcinoma.
[0005] In one embodiment, the present invention provides primers, probes, or their combinations, using the above detection marker as the amplified target fragment.
[0006] In one embodiment, a kit for differentiating histological subtypes of non-small cell lung cancer is provided. The kit is used to identify whether the non-small cell lung cancer is squamous cell carcinoma or adenocarcinoma, and the kit is used to identify the methylation of the chromosomal region where the PREX1 gene promoter is located.
[0007] In one embodiment, the kit is a kit for identifying whether human chromosomes chr20:47444720-47444924, chr20:47444217-47444339 or / and chr20:47444014-47444136 are methylated.
[0008] In one embodiment, the kit is a kit for identifying whether human chromosome chr20:47444734-47444813 is methylated.
[0009] In one embodiment, the kit is a kit for identifying whether human chromosome chr20:47444257-47444317 is methylated.
[0010] In one embodiment, the kit is a q-PCR kit for identifying whether human chromosome chr20:47444720-47444924 is methylated. The kit includes an upstream primer sequence SEQ ID NO.7: GCGCGGTTTCGGATTTTCGG, a downstream primer sequence SEQ ID NO.8: ACGCCTCCGTCGAAAACT, and a probe sequence SEQ ID NO.9: TTTCGCGGGGTTTTTTCGGAGGT.
[0011] In one embodiment, the kit is a q-PCR kit for identifying whether human chromosome chr20:47444217-47444339 is methylated. The kit includes an upstream primer sequence SEQ ID NO.10: GCGGCGTTTAGTTTCGGT, a downstream primer sequence SEQ ID NO.11: CAACTAACGCTCGAACTCCC, and a probe sequence SEQ ID NO.12: TTCGGTTCGTGCGCGGTC.
[0012] In one embodiment, the kit is a q-PCR kit for identifying whether human chromosome chr20:47444014-47444136 is methylated. The kit includes an upstream primer sequence SEQ ID NO.13: TTCGTTTCGTTGCGGTT, a downstream primer sequence SEQ ID NO.14: CGACAACTCTAAAAAAACTCGA, and a probe sequence SEQ ID NO.15: TTCCGCGCGCCCTACGA.
[0013] The present invention is dedicated to solving the problem of clinically differentiating histological subtypes of non-small cell lung cancer by molecular biological methods, and can be used to identify whether the non-small cell lung cancer is squamous cell carcinoma or adenocarcinoma. In the present invention, through high-throughput sequencing and quantitative fluorescence PCR for site-directed methylation, methylation gene sequences that can distinguish lung adenocarcinoma and squamous cell carcinoma are discovered. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0015] Figure 1 It is a schematic diagram of the reaction curves of the target fragment (dotted line part) on the PREX1 gene and the internal reference Actb gene (solid line part) in lung adenocarcinoma;
[0016] Figure 2 It is a schematic diagram of the reaction curves of the target fragment (dotted line part) on the PREX1 gene and the internal reference Actb gene (solid line part) in lung squamous cell carcinoma. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0017] In order to enable those skilled in the art to better understand the technical solutions in the present application, the following will further illustrate the present invention in combination with the following embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present application.
[0018] Example 1. High-throughput Sequencing of Methylation in the Chromosomal Region Where the PREX1 Gene Promoter Is Located
[0019] In order to discover the methylation differential sites between lung adenocarcinoma and lung squamous cell carcinoma, we designed 3 pairs of methylation primers for PCR amplification, using the genomic DNA after bisulfite conversion as the template.
[0020]
[0021]
[0022] After the products amplified by methylation PCR using the above three pairs of primers were purified by magnetic beads, the concentration and purity were measured using NANODROP ONE (ThermoFisher Scientific, USA). The 3' end of the purified PCR products was added with A (adenine base) through an enzyme reaction system, specifically: 2.5 μL of 10×Klenow buffer, 0.15 mM dATP, 2 μL of Klenow Fragment (3'→5' exo-), 2 μL of T4 Polynucleotide kinase, with a total volume of 25 μL, incubated at 37 °C for 30 min. The PCR products with A added at the 3' end were purified and used as templates to ligate barcode adapters by incubating with T4 DNA ligase at 23 °C for 1 h or overnight at 16 °C. After the ligation products were determined by agarose gel electrophoresis to have the target fragments at 300 - 400 bp, they were purified and recovered as templates for P5 / P7 universal primer amplification and amplified using a T100TM Thermal Cycle (BIO-RAD, USA) (pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, 17 cycles). The amplified products were purified and enriched after quality inspection by agarose electrophoresis, the concentration was measured using a Qubit 2.0 Fluorometer, and sequencing was performed using an Illumina NovaSeq sequencer (Illumina, USA). The sequencing results are shown in Table 1, Table 2, and Table 3.
[0023] The numbers in the table represent the methylation content. For example, for the first CpG island in the first segment (Table 1), the number in the first adenocarcinoma specimen is 0.412635, and the number in the first squamous cell carcinoma sample is 0.
[0024] The number in the first adenocarcinoma specimen is 0.412635. It can be understood that after NGS sequencing, at the location of the first CpG island, sequences of CG or TG will be detected. The CG represents the methylated sequence, and after bisulfite conversion, the CG remains the CG sequence. The TG represents the non-methylated sequence, and after bisulfite conversion, the original CG on the genomic DNA becomes TG; the ratio of the number of CG sequences to the number of (CG + TG) sequences is 0.412635.
[0025] Table 1
[0026]
[0027] Table 2
[0028]
[0029] Table 3
[0030]
[0031] Analysis of Three Hypermethylated Regions in Lung Adenocarcinoma
[0032] The first region is located at chr20:47444720-47444924, Human / hg19, Strand=minus
[0033]
[0034] Among them, chr20:47444734-47444813 is the preferred methylated region, where CpG islands are more enriched, and it is suitable for analysis by simple methods such as pyrosequencing or methylation fluorescence quantification.
[0035] The second region is located at chr20:47444217-47444339, Human / hg19, Strand=minus
[0036]
[0037] Among them, chr20:47444257-47444317 is the preferred methylated region, where CpG islands are more enriched, and it is suitable for analysis by simple methods such as pyrosequencing or methylation fluorescence quantification.
[0038] The third region is located at chr20:47444014-47444136, Human / hg19, Strand=minus
[0039]
[0040] Example 2 measures different case samples by q-PCR
[0041] At the boxed positions of the above three sequences, upstream primers and downstream primers are designed respectively, and probes are designed at the dark-colored positions; each primer and probe has at least 2 CpG island sequences to fully distinguish methylated CpG and non-methylated CpG; non-methylated CpG is converted into TG sequence after bisulfite treatment, while methylated CpG sequence remains CG sequence after bisulfite treatment.
[0042] The methylation amplification primers and probes designed for the three fragments are shown in Table 4 below:
[0043] Table 4
[0044]
[0045] For the above target fragment, both the probe fluorescent modification group and the quenching group are FAM-BHQ1. The primer and probe sequences of the internal reference gene Actb are as follows:
[0046] Actb - Forward primer 5’-GTGATGGAGGAGGTTTAGTAAGTT-3’(SEQ ID NO.16)
[0047] Actb - Reverse primer 5’-CCAATAAAACCTACTCCTCCCTTAA-3’(SEQ ID NO.17)
[0048] Actb - Probe 5’-ACCACCACCCAACACACAATAACAAACACA-3’(SEQ ID NO.18)
[0049] The probe fluorescent modification group and the quenching group of Actb are VIC-BHQ1
[0050] After bisulfite treatment, the above three sequences are converted into the following sequences, where the Y base represents either a C base or a T base.
[0051] The first segment is located at chr20:47444720 - 47444924, Human / hg19, Strand = minus
[0052]
[0053] The second segment is located at chr20:47444217 - 47444339, Human / hg19, Strand = minus
[0054]
[0055] The third segment is located at chr20:47444014 - 47444136, Human / hg19, Strand = minus
[0056]
[0057] The primer probes designed for the three sequences are mixed with the primer probes of the internal reference gene Actb in one tube for a duplex qPCR reaction. The reaction system uses the GoTaq reaction system produced by Promega Corporation. The specific reaction system is shown in Table 5 below:
[0058] Table 5
[0059] qPCR reaction system Composition 5×GoTaq buffer 4 μl Forward primer of target fragment 0.25 μM (final concentration) Reverse primer of target fragment 0.25 μM (final concentration) Methylation probe of target fragment 0.40 μM (final concentration) Forward primer of Actb 0.15 μM (final concentration) Reverse primer of Actb 0.15 μM (final concentration) Probe of Actb 0.20 μM (final concentration) Sulfite-converted DNA template 5 μl
[0060] Add 0.5 μl of GoTaq hot start enzyme and make up the volume to 20 ml
[0061] Reaction conditions:
[0062]
[0063] Collect fluorescence at 65°C. The experiment is successful when the Ct of the reference gene < 38; in this case, if the Ct value of qMS-PCR for any one target gene fragment < 40, it is considered positive for methylation detection.
[0064] Representative curve graphs of qMS-PCR for detecting lung adenocarcinoma and lung squamous cell carcinoma tissues based on the above target fragment sequences and Actb are as Figure 1 and Figure 2 . As Figure 1 shown, based on the reaction curves of the target fragment (dashed line part) on the PREX1 gene and the reference Actb gene (solid line part) in lung adenocarcinoma, the target sequence is highly methylated in adenocarcinoma, so the qPCR reaction is positive; while in Figure 2 , based on the reaction curves of the target fragment (dashed line part) on the PREX1 gene and the reference Actb gene (solid line part) in lung squamous cell carcinoma, the target sequence is demethylated in squamous cell carcinoma, so the qPCR reaction is negative.
[0065] The qMS-PCR designed for the above three fragments was used to test the alveolar lavage fluid of 51 patients with adenocarcinoma (LAC) in non-small cell lung cancer and 39 patients with squamous cell carcinoma (LSC) in non-small cell lung cancer. When the methylation detection of 1 out of the 3 fragments is positive, the specimen is judged as positive. The results are shown in Table 6 below,
[0066] Table 6
[0067]
[0068] Therefore, when the qMS-PCR for these three fragments is positive, the sensitivity for judging patients with adenocarcinoma in non-small cell lung cancer from alveolar lavage fluid is 94.1% (48 / 51), and the specificity is 95.8% (68 / 71).
[0069] It should be understood that the disclosed invention is not limited to the specific methods, protocols, and substances described, as these can vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the invention, which is limited only by the appended claims.
[0070] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. These equivalents are also included in the appended claims.
Claims
1. Use of a kit in the preparation of a product for detecting squamous cell carcinoma or adenocarcinoma in non-small cell lung cancer, characterized in that, The kit is used to detect the methylation levels of the combination of human chromosome hg19 chr20:47444720 - 47444924, hg19 chr20:47444217 - 47444339, and hg19 chr20:47444014 - 47444136.
2. The application according to claim 1, characterized in that, The kit is a q-PCR kit for identifying whether human chromosome hg19 chr20:47444720 - 47444924 is methylated. The kit includes upstream primer sequence SEQ ID NO.7: GCGCGGTTTCGGATTTTCGG, downstream primer sequence SEQ ID NO.8: ACGCCTCCGTCGAAAACT, and probe sequence SEQ ID NO.9: TTTCGCGGGGTTTTTTCGGAGGT. The kit is a q-PCR kit for identifying whether human chromosome hg19 chr20:47444217 - 47444339 is methylated. The kit includes upstream primer sequence SEQ ID NO.10: GCGGCGTTTAGTTTCGGT, downstream primer sequence SEQ ID NO.11: CAACTAACGCTCGAACTCCC, and probe sequence SEQ ID NO.12: TTCGGTTCGTGCGCGGTC; and the kit is a q-PCR kit for identifying whether human chromosome hg19 chr20:47444014 - 47444136 is methylated. The kit includes upstream primer sequence SEQ ID NO.13: TTCGTTTCGTTGCGGTT, downstream primer sequence SEQ ID NO.14: CGACAACTCTAAAAAAACTCGA, and probe sequence SEQ ID NO.15: TTCCGCGCGCCCTACGA.
Citation Information
Patent Citations
Methylated molecular marker or combination thereof for detecting benign and malignant pulmonary nodules and application of methylated molecular marker or combination thereof
CN113637745A
Methylated molecular marker or combination thereof for detecting benign and malignant pulmonary nodules and application of methylated molecular marker or combination thereof
CN113637746A