Preparation method and application of pH-driven aggregation death receptor 5 combined enzyme cascade DNA nanospring
By preparing pH-driven DNA nanosprings and utilizing enzyme cascade reactions to activate the DR5 receptor in the microacidic environment of tumors, the problem of insufficient DR5 expression in existing technologies has been solved, enabling highly efficient treatment of various tumor diseases.
Patent Information
- Application Number
- CN202310440653.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-23
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2043-04-23
AI Technical Summary
Existing technologies cannot effectively respond to pH changes to aggregate death receptor 5 and promote its expression, leading to resistance of tumor cells to binding to ligand-DR5 and limiting the therapeutic effect of anticancer drugs.
We prepared a pH-driven aggregation DNA nanospring of death receptor 5 combined with an enzyme cascade. We modified DR5TP, glucose oxidase and horseradish peroxidase through biotin-streptavidin interaction. The DNA nanospring encoding i-motif aggregated in the microacidic environment of the tumor, activated the DR5 receptor and promoted apoptosis through an enzyme cascade reaction.
It achieves precise activation of the DR5 receptor in the microacidic environment of tumors, enhancing the apoptosis effect of tumor cells. It is applicable to a variety of tumor diseases such as breast cancer and colorectal cancer, and has broad applicability and high efficiency.
Smart Images

Figure CN116747313B_ABST
Abstract
Description
I. Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a method for preparing and applying a pH-driven aggregation of death receptor 5 combined with an enzyme cascade DNA nanospring. II. Background Technology
[0002] In recent years, apoptosis has become a key focus of cancer treatment research. Members of the tumor necrosis factor receptor superfamily (TNFRSF) can be specifically activated to induce apoptosis in cancer cells or regulate the proliferation and activation of immune cells. Although the structural information of the TNFRSF receptor and its corresponding ligands is well understood, effective molecular tools or drugs for triggering TNFRSF signaling are still lacking. A typical example is the tumor necrosis factor-associated apoptosis-inducing ligand (TRAIL). The naturally occurring TRAIL in vivo is a trimer that recognizes and activates death receptor 5 (DR5) in the TNFRSF superfamily. Trimerization of DR5 induces tumor cells to generate a death-inducing signaling cascade (DISC), thereby activating cysteine protease 8 (capase 8) and leading to apoptosis through both endogenous and exogenous pathways. Based on the unique antitumor activity of TRAIL, recombinant TRAIL proteins, DR4 / 5 agonist monoclonal antibodies, or death receptor 5-targeting peptides (DR5TP) have been investigated as anticancer drugs. However, the therapeutic effects in these trials have been unsatisfactory, and several challenges limit their application. For example, insufficient DR5 aggregation and tumor cell resistance to ligand-DR5-induced tumor cell apoptosis.
[0003] Studies have shown that the transmembrane domain of DR5 aggregates to form higher-order structures, and only the formation of DR5 trimers activates apoptosis signals; insufficient DR5 aggregation fails to trigger the signal. To address this, reports have described the development of graphene oxide nanoscaffolds and dextran scaffolds, covalently polymeric TRAIL recombinant protein and DR5TP, respectively, utilizing DR5 clustering to effectively activate the DR5 receptor in tumor cells and induce apoptosis. However, these two scaffolds cannot precisely control the nanoscale spatial presentation of proteins, and the limited space does not allow for higher protein binding densities, which significantly restricts DR5 activation. Furthermore, tumor cells resist ligand-DR5 binding-induced apoptosis by downregulating DR5 expression, which also inhibits therapeutic efficacy.
[0004] As is well known, one of the characteristics of the tumor microenvironment, distinct from normal tissue, is its low pH. Responding to the tumor microenvironment in releasing drugs can reduce drug toxicity to normal tissues and improve therapeutic efficacy. DNA nanomaterials, with their good biocompatibility, biodegradability, programmability, and stimulus-responsiveness, are ideal materials for constructing drug delivery systems. Previous work has shown that DNA hydrogels encoding i-motifs can undergo a gel-sol transition in response to the acidic environment of the tumor microenvironment to release encapsulated drugs. However, how to respond to pH to aggregate DR5 while simultaneously promoting DR5 expression has not yet been publicly reported. III. Summary of the Invention
[0005] In view of the above situation and to overcome the shortcomings of the prior art, the purpose of this invention is to provide a method for preparing and applying a pH-driven aggregation of DNA nanosprings in conjunction with the death receptor 5 and an enzyme cascade, which can effectively solve the problem that the prior art cannot respond to pH aggregation of DR5 while promoting DR5 expression.
[0006] The technical solution provided by this invention is that the DNA nanospring comprises DR5TP (death receptor 5 targeting peptide), glucose oxidase (GOX), and horseradish peroxidase (HRP); different DNA strands are annealed and hybridized and ligated with T4 DNA ligase to synthesize DNA nanosprings encoding i-motifs; DR5TP, GOX, and HRP are modified through biotin-streptavidin interaction to obtain pH-responsive DNA nanosprings that aggregate death receptor 5 in conjunction with an enzyme cascade, specifically including the following steps:
[0007] 1) Cyclic reaction
[0008] 5' phosphorylated linear DNA strand L1 and ligation primer were added to a mixture of 4 μL 10×T4 DNA ligase buffer and 0 μL–36 μL ultrapure water at a ratio of 1:4. The mixture was pipetted and heated at 95 °C for 5 min to denature the DNA strand. Then, it was incubated at 25 °C for 1 h to hybridize L1 with the ligation primer. Then, 2 μL T4 DNA ligase (5 U / μL) was added to the mixture and incubated at 25 °C for 3 h. After the cyclization reaction was completed, 1 μL Exo I (20 U / μL) and Exo III (200 U / μL) were added to the mixture. The primer was cleaved at 37 °C for 40 min and then inactivated at 80 °C for 20 min to obtain individual C1 loops.
[0009] 2) Synthesis of DNA nanospring mixture
[0010] The C1 loop (1 μM), 5' phosphorylated linear DNA strand L2 (10 μM), and 5' phosphorylated linear DNA strand L3 (10 μM) obtained in step 1) were added to 4 μL of 10×T4 DNA ligase buffer and 0 μL to 36 μL of ultrapure water in proportions of 1:4:4, 1:10:10, and 1:20:20, respectively. The mixture was then pipetted and heated at 90 °C for 10 min, then cooled to 50 °C and incubated for 30 min. The mixture was then rapidly cooled to 25 °C, and 2 μL of T4 DNA ligase (5 U / μL) was added. The mixture was incubated at 25 °C for 1 h, and then heated at 65 °C for 10 min to inactivate the enzyme, thus obtaining the synthetic DNA nanospring mixture.
[0011] 3) Add complementary sequences
[0012] The cDNA sequence complementary to i-motif (50 μM) was heated at 95 °C for 5 min and then rapidly added to the DNA nanospring synthesis solution to a final concentration of 4 μM, thus obtaining the synthesized DNA nanospring encoding i-motif.
[0013] 4) Connect DR5TP
[0014] DR5TP-biotin (10 μM) and streptavidin (20 μM) were added to 0 μL to 100 μL of PBS buffer at a ratio of 2:1. After mixing by pipetting, the mixture was incubated at room temperature for 30 min. Then, streptavidin and the synthesized DNA nanosprings encoding i-motif obtained in step 3) were mixed at a ratio of 1:1 and incubated at room temperature for 30 min. The DNA nanosprings encoding i-motif could be successfully linked to DR5TP, thus obtaining the synthesized DNA nanosprings modified with DR5TP.
[0015] 5) Modify GOX and HRP
[0016] GOX-biotin and HRP-biotin, along with streptavidin, were added to 0-100 μL of PBS buffer at a 2:1 ratio. After mixing by pipetting, the mixture was incubated at room temperature for 30 min. Then, GOX-streptavidin and DNA short chain 1 (DNA S1) were mixed at a 1:1 ratio and incubated at room temperature for 30 min. HRP-streptavidin and DNA short chain 2 (DNA S2) were mixed at a 1:1 ratio and incubated at room temperature for 30 min. This yielded the ligase nucleic acid chains GOX-DNA S1 and HRP-DNA S2. Finally, GOX-DNA S1 and HRP-DNA S2 were added together to the DR5TP-modified DNA nanospring solution obtained in step 4) and incubated at 37°C for 1 h. The enzyme ligated to C1 via nucleic acid hybridization, yielding the final product, the DNA nanospring.
[0017] In step 1), the linear DNA strand L1 sequence is: TATACAGACGTTTTTTTTTTTTTTTCGATTATGACCAGTCTCACATTTTTTTTTTTTTTTTTCGA TCCTG AC, as shown in SEQ ID NO:1.
[0018] In step 1), the primer sequence is: TCTGTATAGTCAGGAT, as shown in SEQ ID NO:2.
[0019] In step 1), the 10×T4 DNA ligase buffer contains 50mM Tris-HCl, 10mM MgCl2, 10mM DTT and 1mM ATP.
[0020] In step 2), the linear DNA strand L2 sequence is: GTCATAATCGTTTTTCCCCCCCCTTTCCCCCCCCTTTTTCGTCTGTATAGTCAGGATCGTTT TTCCC CCCCCTTTCCCCCCCCTTTTTTGTGAGACTG, as shown in SEQ ID NO:3.
[0021] In step 2), the linear DNA strand L3 sequence is: TATACAGACGTTTTTCCCCCCCCTTTCCCCCCCCTTTTTCGATTATGACCAGTCTCACATT TTTCCC CCCCCTTTCCCCCCCCTTTTTCGATCCTGAC, as shown in SEQ ID NO:4.
[0022] In step 3), the cDNA sequence is: GGGGGGGGAAAGGGGGGGG, as shown in SEQ ID NO:5.
[0023] In step 5), the DNA short chain 1 sequence is: TTTTTTTTTAAAAAAAAAACGTCTGTATA, as shown in SEQ ID NO:6.
[0024] In step 5), the DNA short chain 2 sequence is: GTCAGGATCGAAAAAAAAAATTTTTTTTTT, as shown in SEQ ID NO:7.
[0025] The pH-driven aggregation death receptor 5-enzyme cascade DNA nanosprings described above have a long linear structure with a length reaching micrometers.
[0026] The application of the pH-driven aggregation death receptor 5 combined with enzyme cascade DNA nanosprings in drugs that induce specific regulation of tumor cell apoptosis.
[0027] The tumors mentioned are breast cancer and colorectal cancer.
[0028] The preparation method of this invention is simple, easy to operate, and rapid to synthesize. Based on a pH-responsive nucleic acid self-delivery strategy, it induces tumor cell apoptosis signal activation by regulating the ligand spacing and achieves effective activation of the DR5 receptor by contracting in response to the tumor's microacidic environment. Furthermore, it cleverly combines enzyme cascade reactions to promote cell apoptosis. It is applicable to various tumor diseases, such as breast cancer, colorectal cancer, and leukemia, and has a wide range of applications. It is an innovation in DNA nanomaterials. IV. Description of the attached drawings
[0029] Figure 1 This is a schematic diagram illustrating the principle of preparing a pH-driven aggregation of death receptor 5-coupled enzyme cascade DNA nanosprings according to the present invention.
[0030] Figure 2 This is a gel electrophoresis diagram of the synthesis of iDNS using natural polyacrylamide, as described in this invention.
[0031] Figure 3 The image shows the iDNS-D diagram of natural polyacrylamide gel electrophoresis and atomic force characterization of this invention.
[0032] Figure 4 The image shows the iDNS-GH diagram for the experimental characterization of the magnetic beads of this invention.
[0033] Figure 5 The diagram shows the iDNS-D-GH enzyme cascade reaction analyzed using a microplate spectrophotometer according to the present invention.
[0034] Figure 6This is a fluorescence analysis diagram of the iDNS response to a slightly acidic environment, representing the reversible shrinkage pattern of the iDNS response.
[0035] Figure 7 This is a laser confocal imaging image of the iDNS-D targeting breast cancer cells according to the present invention.
[0036] Figure 8 This is a laser confocal imaging image of the contraction of breast cancer cell membrane surface in response to the tumor microacid environment by iDNS-D according to the present invention.
[0037] Figure 9 This is a graph showing the cell viability detection using the MTT assay of the present invention. V. Detailed Implementation Methods
[0038] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0039] Example 1
[0040] In specific implementations of this invention, such as Figure 1 As shown, the specific steps include:
[0041] 1) Cyclic reaction
[0042] 5' phosphorylated linear DNA strand L1 and ligation primer were added to a mixture of 4 μL 10×T4 DNA ligase buffer and 0 μL–36 μL ultrapure water at a ratio of 1:4. The mixture was pipetted and heated at 95 °C for 5 min to denature the DNA strand. Then, it was incubated at 25 °C for 1 h to hybridize L1 with the ligation primer. Then, 2 μL T4 DNA ligase (5 U / μL) was added to the mixture and incubated at 25 °C for 3 h. After the cyclization reaction was completed, 1 μL Exo I (20 U / μL) and Exo III (200 U / μL) were added to the mixture. The primer was cleaved at 37 °C for 40 min and then inactivated at 80 °C for 20 min to obtain individual C1 loops.
[0043] 2) Synthesis of DNA nanospring mixture
[0044] The C1 loop (1 μM), 5' phosphorylated linear DNA strand L2 (10 μM), and 5' phosphorylated linear DNA strand L3 (10 μM) obtained in step 1) were added to 4 μL of 10×T4 DNA ligase buffer and 0 μL to 36 μL of ultrapure water in proportions of 1:4:4, 1:10:10, and 1:20:20, respectively. The mixture was mixed by pipetting, heated at 90°C for 10 min, then cooled to 50°C and incubated for 30 min. The mixture was then rapidly cooled to 25°C, 2 μL of T4 DNA ligase (5 U / μL) was added, and the mixture was incubated at 25°C for 1 h. Finally, it was heated at 65°C for 10 min to inactivate the enzyme, resulting in a mixed solution of synthesized DNA nanosprings.
[0045] 3) Add complementary sequences
[0046] The cDNA sequence complementary to i-motif (50 μM) was heated at 95 °C for 5 min and then rapidly added to the DNA nanospring synthesis solution to a final concentration of 4 μM, thus obtaining the synthesized DNA nanospring encoding i-motif.
[0047] 4) Connect DR5TP
[0048] DR5TP-biotin (10 μM) and streptavidin (20 μM) were added to 0 μL to 100 μL of PBS buffer at a ratio of 2:1. After mixing by pipetting, the mixture was incubated at room temperature for 30 min. Then, streptavidin and the synthesized DNA nanosprings encoding i-motif obtained in step 3) were mixed at a ratio of 1:1 and incubated at room temperature for 30 min. The DNA nanosprings encoding i-motif were successfully linked to DR5TP, thus obtaining the synthesized DNA nanosprings modified with DR5TP.
[0049] 5) Modify GOX and HRP
[0050] GOX-Biotin and HRP-Biotin were added to streptavidin at a ratio of 2:1 in 0-100 μL of PBS buffer. After mixing by pipetting, the mixture was incubated at room temperature for 30 min. Then, GOX-streptavidin and DNA short chain 1 (DNA S1) were mixed at a ratio of 1:1 and incubated at room temperature for 30 min. HRP-streptavidin and DNA short chain 2 (DNA S2) were mixed at a ratio of 1:1 and incubated at room temperature for 30 min. The nucleic acid chains GOX-DNA S1 and HRP-DNA S2 of the ligase were obtained. Finally, GOX-DNA S1 and HRP-DNA S2 were added together to the DNA nanospring solution modified with DR5TP obtained in step 4) and incubated at 37°C for 1 h. The enzyme was ligated to C1 by nucleic acid hybridization, and the final product DNA nanospring was obtained.
[0051] The basic principle of this invention is as follows: DNA nanosprings are formed by linking C1 and two other DNA strands with complementary sequences through annealing hybridization and T4 DNA ligase to create a loop-within-a-loop DNA nanostructure. This design can efficiently load DR5TP, achieving effective targeting of DR5. By responding to the slightly acidic environment of the tumor microenvironment, the DNA nanosprings contract to bring the DR5TP spacing closer, placing the spacing within the effective range for DR5 activation, thereby regulating DR5 activation on the tumor cell membrane surface. Simultaneously, C1-modified GOX and HRP amplify glucose consumption at the tumor site through an enzyme cascade reaction, inducing endoplasmic reticulum stress in tumor cells and promoting DR5 expression. This achieves DR5 aggregation combined with DR5 expression upregulation to enhance tumor cell apoptosis and tumor killing. The pH-responsive aggregation of death receptor 5 combined with enzyme cascade DNA nanosprings prepared by the method of this invention has been experimentally verified to be highly effective. Taking Example 1 as an example, the quantitative experiments in the following experiments were all repeated three times, and the results were averaged. Unless otherwise specified, the experimental methods used in the experiments were conventional methods. Unless otherwise specified, all experimental materials, reagents, and equipment in the examples can be obtained through conventional purchasing channels. The relevant experimental data are as follows:
[0052] I. Characterization of iDNS by Natural Polyacrylamide Gel Electrophoresis
[0053] (1) Clean the vertical electrophoresis gel plate, and after clamping the gel plate, check for leaks with ultrapure water for 15 minutes.
[0054] (2) Preparation of 12% natural polyacrylamide gel: Add 8 mL of Acr-Bis acrylamide (30%) solution, 2 mL of 10×TBE solution, 10 mL of ultrapure water, 100 μL of 10% APS initiator, and 10 μL of TEMED to a 50 mL EP tube, and vortex to mix. Quickly fill the vertical electrophoresis gel plate with the solution, then insert the comb evenly and let it stand at room temperature for 30–50 min to allow the gel to solidify.
[0055] (3) Prepare the sample by adding 2 μL of 6× nucleic acid loading buffer to every 10 μL of sample and pipetting it evenly.
[0056] (4) After the gel solidifies, loosen the gel plate, place the gel plate into the vertical electrophoresis tank, pour in 1×TBE buffer until the liquid level covers the wells, then remove the comb and load the sample. 150V voltage for 40-100 minutes.
[0057] (5) After electrophoresis, the gel was stained with Gelgreen 1× green nucleic acid staining solution for 15 min and then analyzed by gel imaging system.
[0058] Analysis of the band positions confirmed the successful synthesis of the C1 loop and the high molecular weight DNA product, such as... Figure 2 As shown.
[0059] II. Natural Polyacrylamide Gel Electrophoresis and Atomic Force Characterization of iDNS-DR5TP
[0060] The method and steps are the same as those in Experiment 1 above.
[0061] By comparing the stripe positions, the successful synthesis of iDNS-D was confirmed, such as... Figure 3 As shown in a.
[0062] Atomic force analysis confirmed the successful synthesis of long linear DNA nanosprings, such as... Figure 3 As shown in b.
[0063] Analysis of the cross-sectional height using a nanoscope revealed an increase in cross-sectional height, demonstrating successful streptavidin binding. Figure 3 As shown in b.
[0064] III. Magnetic Bead Experimental Characterization of iDNS-GH
[0065] (1) Take an appropriate amount of streptavidin-modified magnetic beads and wash them twice with binding buffer.
[0066] (2) Add an excess of biotin-modified capture strand to the binding buffer environment and incubate at 1000 rpm for 30 min.
[0067] (3) Remove the supernatant on the magnetic rack, add iDNS-GH solution, and incubate at 37℃ and 1000rpm for 30min.
[0068] (4) Remove the supernatant on a magnetic rack, add glucose solution (final concentration 100mM) and ABTS solution (final concentration 10mM), and react at 37℃ for 30 min. Take the supernatant and measure the absorbance at 410nm using an ELISA reader, then record the color change of the solution.
[0069] Observation of solution changes revealed that only the iDNS-GH group exhibited a significant color change; absorbance measurements confirmed the successful synthesis of iDNS-GH. Figure 4 As shown.
[0070] IV. Microplate Spectrophotometry Analysis of iDNS-D-GH Enzyme Cascade
[0071] Following Example 1, iDNS, iDNS-DG, and iDNS-D-GH solutions were synthesized. Glucose solution (final concentration 10 mM) and ABTS solution (final concentration 10 mM) were added sequentially, and the solutions were incubated at 37°C for 30 min. The absorption spectra were scanned using a microplate spectrophotometer. The results confirmed that iDNS-D-GH possesses excellent enzyme cascade activity, such as... Figure 5 As shown.
[0072] V. Fluorescence Analysis: iDNS Reversible Shrinkage in Slightly Acidic Environments
[0073] The i-motif of the DNA nanospring is modified with the fluorescent group TAMRA at its 5' end, and the cDNA sequence complementary to the i-motif is modified with the fluorescent quencher group BHQ2 at its 3' end. The pH of the solution in the EP tube was adjusted to 6.5 by adding hydrochloric acid (0.1M), and then sodium hydroxide (0.1M) was added to restore the pH to 7.4, repeated for 5 cycles. After each pH adjustment, 150 μL of the solution was added to a 96-well plate, and the absorbance was measured using a microplate reader at an excitation wavelength of 542 nm and an emission wavelength of 580 nm. The specific pH value was measured using a pH microelectrode, such as... Figure 6 As shown.
[0074] VI. iDNS-D Targeted Breast Cancer Cell Laser Confocal Imaging
[0075] First, follow the pattern of 2×10 per hole. 4 Cells were seeded at a density of 10 cells / well in laser confocal microscopy plates and cultured overnight. Then, the cells were incubated with iDNS-DR5TP labeled with the fluorescent dye TAMRA for 2 hours. After washing the cells with PBS, the cell membrane was stained with CellMask fluorescent dye and the nuclei with Hoechst fluorescent dye. Finally, the images were imaged using a Zeiss LSM 800 laser confocal microscope. The results confirmed that iDNS-D could successfully target the cell membrane, such as... Figure 7 As shown.
[0076] VII. iDNS-D-responsive laser confocal imaging of tumor microacidic environment on breast cancer cell membrane surface contraction
[0077] According to 2×10 per hole 4Cells were seeded at a density of 1 cell / well in laser confocal microscopy plates and cultured overnight. The i-motif of the DNA nanospring was modified with the fluorescent groups Cy3 and FAM at the 5' and 3' ends, respectively, and the cDNA sequence complementary to the i-motif was modified with the fluorescence quencher BHQ2 at the 3' end. iDNS-DR5TP was incubated with cells for 2 hours to allow binding to the cell surface. Then, the medium was replaced with lactated medium at pH 6.5 and incubated for 30 minutes. After washing the cells with PBS, the cell membrane was stained with CellMask fluorescent dye and the nucleus with Hoechst fluorescent dye. Finally, imaging was performed using a Zeiss LSM 800 laser confocal microscope. Cy3 fluorescence quenching occurred at pH 7.4, but fluorescence recovery occurred at pH 6.5, confirming that iDNS-D can respond to low pH contraction at the cell membrane surface. Figure 8 As shown.
[0078] 8. MTT assay for cell viability
[0079] (1) Seed cells in 96-well plates at a density of 5000 cells per well with 100 μL of culture medium and incubate in a cell culture incubator for 24 h.
[0080] (2) After the cells were treated with different preparations, they were incubated for 2 hours, and then the acidic culture medium was replaced and the cells were incubated for another 24 hours.
[0081] (3) After 24 hours of incubation, the supernatant was removed, and 90 μL of blank culture medium was added to each well of a 96-well plate, followed by 10 μL of MTT solution (5 mg / mL). The plates were then incubated at 37°C for 2-4 hours. The absorbance was measured at 490 nm using a microplate reader. Cell viability was calculated using the formula: (A preparation group - A blank) / (A control - A blank) × 100%.
[0082] The results showed that iDNS-D was inefficient at killing tumor cells, such as Figure 9 As shown in a, iDNS-D-GH effectively inhibits cell survival, such as Figure 9 As shown in b.
[0083] The above experimental results show that the preparation method of the present invention is simple and easy to operate, and has the following advantages compared with the prior art:
[0084] 1. This invention modulates the nanoscale space of cell membrane surface receptors by precisely controlling the ligand spacing, providing a promising new strategy for controlling cell surface receptor distances in current nanotechnology.
[0085] 2. This invention achieves effective activation of the DR5 receptor by contracting in response to the tumor's acidic microenvironment, and cleverly combines enzyme cascade reactions to promote apoptosis;
[0086] 3. This invention utilizes DNA nanotechnology to encode a variety of stimulus-responsive nucleic acid sequences, forming long linear DNA nanostructures through annealing hybridization and enzyme catalysis, which is simple to operate and rapid to synthesize.
[0087] 4. This invention is applicable to various tumor diseases, such as breast cancer, colorectal cancer, and leukemia, and has a wide range of applications and significant economic and social benefits.
[0088] It should be noted that the above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Any person skilled in the art who can make changes or modifications to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention shall fall within the protection scope of the present invention.
Claims
1. A method for preparing a pH-driven aggregation death receptor 5 combined enzyme cascade DNA nanospring, characterized in that, Comprising the following steps: 1) Looping reaction 5' phosphorylated linear DNA chain L1 and ligation primer are added to 4 μL 10×T4 DNA ligase buffer and 0 μL~36 μL of ultrapure water mixed solution in a ratio of 1:4, respectively, and mixed well with a pipette gun. Heat at 95℃ for 5 min to denature the DNA chain, then incubate at 25℃ for 1 h to hybridize L1 with the ligation primer. Then add 2 μL T4 DNA ligase to the mixed solution and incubate at 25℃ for 3 h. After the looping reaction is completed, 1 μL Exo I and Exo III are added to the mixed solution, respectively, and incubated at 37℃ for 40 min to cut the primer, and then inactivated at 80℃ for 20 min. The C1 loop is obtained separately; 2) Synthesis of DNA nanospring mixed solution C1 loop obtained in step 1), 5' phosphorylated linear DNA chain L2, and 5' phosphorylated linear DNA chain L3 are added to 4 μL 10×T4 DNA ligase buffer and 0 μL~36 μL of ultrapure water mixed solution in a ratio of 1:4:4, 1:10:10 and 1:20:20, respectively, and mixed well with a pipette gun. Heat at 90℃ for 10 min and then cool to 50℃ for 30 min. Then quickly cool the mixed solution to 25℃, add 2 μL T4 DNA ligase, and incubate at 25℃ for 1 h. Then heat at 65℃ for 10 min to inactivate the enzyme. The synthesis of DNA nanospring mixed solution is obtained; 3) Adding complementary sequence Heat the DNA sequence cDNA complementary to the i-motif at 95℃ for 5 min, then quickly add it to the synthesis of DNA nanospring mixed solution to make its final concentration 4 μM. The synthesis of DNA nanospring encoding i-motif is obtained; 4) Linking DR5TP Add DR5TP-biotin and streptavidin to PBS buffer with a volume of 0 μL~100 μL in a ratio of 2:1, mix well with a pipette gun, and incubate at room temperature for 30 min. Then mix streptavidin and the synthesis of DNA nanospring encoding i-motif obtained in step 3) in a ratio of 1:1, and incubate at room temperature for 30 min. The DNA nanospring encoding i-motif can successfully link DR5TP, and the synthesis of DNA nanospring modified with DR5TP is obtained; 5) Modification of GOX and HRP GOX-biotin, HRP-biotin and streptavidin were added to PBS buffer with a volume of 0-100 μL at a ratio of 2:1, respectively, and mixed by pipetting gun blowing, then incubated at room temperature for 30 min, then mixed GOX-streptavidin and DNA short chain 1 at a ratio of 1:1, and incubated at room temperature for 30 min; HRP-streptavidin and DNA short chain 2 were mixed at a ratio of 1:1, and incubated at room temperature for 30 min, to obtain the nucleic acid chain of ligase GOX-DNA S1 and HRP-DNA S2, finally, GOX-DNA S1 and HRP-DNA S2 were added to the DNA nanospring solution modified with DR5TP obtained in step 4), and incubated at 37℃ for 1 h, and the enzyme was connected to C1 through nucleic acid hybridization, to obtain the final product DNA nanospring; In step 1), the sequence of the linear DNA chain L1 is: TATACAGACGTTTTTTTTTTTTTTTCGATTATGACCAGTCTCACATTTTTTTTTTTTTTTCGATCCTG AC, as shown in SEQ ID NO: 1; In step 1), the sequence of the primer is: TCTGTATAGTCAGGAT, as shown in SEQ ID NO: 2; In step 1), the 10×T4 DNA ligase buffer comprises 50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT and 1 mM ATP; In step 2), the sequence of the linear DNA chain L2 is: GTCATAATCGTTTTTCCCCCCCCTTTCCCCCCCCTTTTTCGTCTGTATAGTCAGGATCGTTTTTCCCCCCCCTTTCCCCCCCCTTTTTTGTGAGACTG, as shown in SEQ ID NO: 3; In step 2), the sequence of the linear DNA chain L3 is: TATACAGACGTTTTTCCCCCCCCTTTCCCCCCCCTTTTTCGATTATGACCAGTCTCACATTTTTCCCCCCCCTTTCCCCCCCCTTTTTCGATCCTGAC, as shown in SEQ ID NO: 4; In step 3), the sequence of the cDNA is: GGGGGGGGAAAGGGGGGGG, as shown in SEQ ID NO: 5; In step 5), the sequence of the DNA short chain 1 is: TTTTTTTTTTAAAAAAAAAACGTCTGTATA, as shown in SEQ ID NO: 6; In step 5), the sequence of the DNA short chain 2 is: GTCAGGATCGAAAAAAAAAATTTTTTTTTT, as shown in SEQ ID NO:
7.
2. The use of the pH-driven aggregation death receptor 5 combined enzyme cascade DNA nanospring prepared by the method of claim 1 in the preparation of a drug for inducing specific regulation of tumor cell apoptosis. 3.The use of the pH-driven aggregation death receptor 5-associated enzyme cascade DNA nanospring of claim 2 in the preparation of a drug for inducing specific regulation of tumor cell apoptosis, characterized in that, The tumor is breast cancer or colorectal cancer.
Citation Information
Patent Citations
Method for assembling lycopene synthetic route by using DNA origami technology
CN114426963A
Triplex and quadruplex catalytic hybridization
US6911536B1