A molecular marker for detecting wheat leaf rust resistance gene LrN4B or LrN3B and application thereof
By constructing genetic linkage maps and molecular markers, molecular markers LrN4B-1 and LrN3B-1 were developed, solving the problem of difficulty in identifying wheat leaf rust resistance genes in existing technologies, realizing rapid and accurate genotyping detection, and improving breeding efficiency.
Patent Information
- Application Number
- CN202310757982.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-26
- Publication Date
- 2026-06-19
- Estimated Expiration
- 2043-06-26
AI Technical Summary
Existing technologies make it difficult to quickly and effectively identify the leaf rust resistance genes LrN4B and LrN3B in wheat, especially when multiple resistance genes exist in the same material. Phenotypic selection makes it difficult to determine their presence or absence, resulting in low breeding efficiency.
Genetic linkage maps and molecular markers were constructed, molecular markers LrN4B-1 and LrN3B-1 were developed, and primer combinations were designed for rapid identification of these genes. Genotypic differences were detected by PCR amplification and polyacrylamide gel electrophoresis. Kits and detection methods are provided.
It enables accurate differentiation and screening of wheat leaf rust resistance genes, improves breeding selection efficiency, simplifies operation procedures, reduces costs, and is suitable for batch operations.
Smart Images

Figure CN116790789B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a molecular marker for detecting wheat leaf rust resistance genes LrN4B or LrN3B and its application. Background Technology
[0002] Wheat leaf rust is a disease caused by *Puccinia triticina* Eriks., which is more susceptible than stem rust and stripe rust, and is widely distributed in all wheat-growing regions. Genetic resistance is the preferred method to reduce yield loss caused by leaf rust, and more than 100 leaf rust resistance genes have been discovered and named. Most leaf rust genes confer race-specific resistance in wheat through gene-to-gene interactions. Currently, the most economical and environmentally friendly method for controlling wheat leaf rust is breeding resistant varieties. However, varieties relying on race-specific resistance often lose their resistance due to variations in the leaf rust fungus species, especially wheat with a single resistance source. Integrating multiple resistance genes in a single material can, to some extent, maintain durable resistance in wheat production. Determining the presence or absence of resistance genes through phenotypic selection in breeding is very difficult, especially when there is more than one resistance gene in the same material.
[0003] LrN4B and LrN3B are very rare known dominant complementary resistance genes for leaf rust. Wheat containing this gene combination can express resistance at the adult stage, achieving a resistance level of "0" or "0" level immunity. Studies have found that this gene combination may be related to broad-spectrum resistance in wheat, and in addition to being effective against leaf rust, it may also be effective against powdery mildew and stripe rust, thus possessing potential application value in breeding. Summary of the Invention
[0004] To address the problems existing in the prior art, this invention provides a molecular marker for detecting wheat leaf rust resistance genes LrN4B or LrN3B and its application.
[0005] This invention obtains molecular markers linked to wheat leaf rust resistance genes LrN4B and LrN3B by constructing genetic linkage maps and screening and locating molecular markers. These markers can quickly and effectively identify wheat leaf rust resistance genes LrN4B and LrN3B.
[0006] In a first aspect, the present invention provides a molecular marker LrN4B-1, located on chromosome 4BL 578-585Mb, with a polymorphism of C / G.
[0007] The present invention further provides a molecular marker LrN3B-1, located in the 4-8Mb region of chromosome 3BS, with a polymorphism of T / C.
[0008] The present invention further provides a molecular marker combination, including the molecular marker LrN3B-1 and the molecular marker LrN4B-1.
[0009] Secondly, the present invention provides a primer combination, the primer combination comprising any one or more primer pairs as follows:
[0010] i) Primer combination 1:
[0011] F1: TCCAGGTGGTTCTCATCG
[0012] F2: ACGACTCAATTCCAGGTGGTTCTCATCC,
[0013] R: TCGTGTTCTTCATGTGCCTA;
[0014] ii) Primer combination 2:
[0015] F1: GGCACCAAGTACCTACGCCA
[0016] F2: ACGACTCAATGGCACCAAGTACCTACGCCG
[0017] R: GAAGCGAGCCACCACGG.
[0018] Primer combination 1 was used to identify the molecular marker LrN4B-1, which is to detect the wheat leaf rust resistance gene LrN4B; primer combination 2 was used to identify the molecular marker LrN3B-1, which is to detect the wheat leaf rust resistance gene LrN3B.
[0019] Furthermore, the primer combination was used to detect wheat leaf rust resistance genes LrN4B and LrN3B.
[0020] The present invention further provides a kit comprising the molecular marker LrN3B-1, or the molecular marker LrN4B-1, or the combination of molecular markers, or the combination of primers.
[0021] The present invention further provides the application of the molecular marker LrN3B-1, or the molecular marker LrN4B-1, or the combination of molecular markers, or the combination of primers, or the kit in detecting the LrN4B gene or the LrN3B gene.
[0022] The present invention further provides the use of the molecular marker LrN3B-1, or the molecular marker LrN4B-1, or the combination of molecular markers, or the combination of primers, or the kit in any of the following:
[0023] i) Application in detecting wheat resistance to leaf rust;
[0024] ii) Breed transgenic wheat resistant to leaf rust.
[0025] Thirdly, the present invention provides a method for detecting the resistance of wheat to leaf rust, comprising:
[0026] The wheat to be tested is detected using the primer combination or the kit described above, and the resistance of the wheat to leaf rust is determined based on the test results.
[0027] Furthermore, the judgment criteria are as follows:
[0028] If primer combination 1 detects a 178bp band, the wheat to be tested contains the LrN4B gene; if primer combination 1 detects a 188bp band, the wheat to be tested does not contain the LrN4B gene.
[0029] If primer combination 2 detects a 249bp band, the wheat to be tested contains the LrN3B gene; if primer combination 2 detects a 244bp band, the wheat to be tested does not contain the LrN3B gene.
[0030] The present invention has the following beneficial effects:
[0031] This invention obtains two molecular markers through the construction of a genetic linkage map and the screening and localization of molecular markers. LrN4B-1 is tightly linked to the LrN4B gene, and LrN3B-1 is tightly linked to the LrN3B gene. The molecular markers LrN4B-1 and LrN3B-1 provided by this invention can accurately distinguish the LrN4B+LrN3B disease-resistant genotype, screen for wheat lines containing this disease-resistant type, improve selection efficiency, accelerate the process of wheat disease-resistant breeding, and achieve the aggregation breeding of multiple disease-resistant genes.
[0032] The two molecular markers provided by this invention are low in cost, simple to operate, have high resolution and repeatability, and can easily achieve batch operation. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0034] Figure 1 This is the genetic linkage map of the LrN4B gene provided in Example 1 of the present invention.
[0035] Figure 2This is the genetic linkage map of the LrN3B gene provided in Example 1 of the present invention.
[0036] Figure 3 This is a schematic diagram of the genotyping results of molecular markers LrN4B-1 and LrN3B-1 provided by the present invention; where A is the genotyping result of molecular marker LrN4B-1 and B is the genotyping result of molecular marker LrN3B-1. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0038] Example 1
[0039] 1. Genetic analysis
[0040] This invention uses experimental materials derived from the F2 population of Nongda 189 / Nongda 4503 (containing 472 individual plants) and the F2 population derived from Nongda 189 / Shi 4185 (containing 416 individual plants) to conduct phenotypic identification of the individual plants of the two populations in the field. The identification criteria are based on Table 1.
[0041] Table 1. Grading Standards for Leaf Rust Disease
[0042]
[0043]
[0044] The results showed that in the Nongda 189 / Nongda 4503F2 population, 263 individual plants were resistant and 209 individual plants were susceptible, while in the Nongda 189 / Shi 4185F2 population, 216 individual plants were resistant and 200 individual plants were susceptible.
[0045] This invention further utilizes SPSS to perform a chi-square test (goodness-of-fit test) on the phenotypic data. With an expected ratio of 9:7, the chi-square values are 0.05 and [missing data].
[0046] 3.16, P>0.05 (Table 2). It is speculated that the disease resistance gene in Nongda 189 conforms to the dominant-complementary inheritance model. Based on the BSA method, this invention selected 10 highly resistant and 10 highly susceptible individuals from two populations respectively to construct a mixed pool of resistant and susceptible individuals, and performed 90K microarray analysis (genome version: Chinese Spring v1.0). This invention found that the SNPs were mainly concentrated on chromosomes 4BL and 3BS, thus preliminarily determining the chromosomal location of the two genes. The two genes were named LrN4B and LrN3B.
[0047] Table 2. Genetic analysis of resistance to leaf rust PHT in adult plants of the F2 population derived from Nongda 189 / Nongda 4503 and Nongda 189 / Shi 4185.
[0048]
[0049] 2. Construction of genetic linkage maps and development of diagnostic markers
[0050] This invention further develops molecular markers in the context of the Nongda 189 / Nongda 4503 hybridization, using the offspring derived from this combination as the basis for localization. Several common markers with polymorphism between the two parents were screened from the SNP-rich regions of chromosomes 4BL and 3BS. Based on the marker genotyping results, two chromosomal loci were fixed and recombined into single-gene controlled segregating subpopulations (Table 3).
[0051] LrN4B molecular marker localization, such as Figure 1 As shown, this invention utilizes resequencing data to develop an indel marker encryption map within the marker regions gwm251 and gpw7390, using 314 F... 2:3 LrN4B was located in a 1.9 cM region between gwm251 and 4B96, and the common marker wmc652 co-segregated with the candidate gene. Then, 1305 F1 genes were screened using the markers gwm251 and 4B96. 3:4 Recombinant exchange single plants in the family were genotyped using five polymorphic markers within a specific interval, locating candidate genes between N4-351 and 4B679, within an interval of 0.82 cM. From F... 3:4 The remaining heterozygous lines were further selected from the pedigree, resulting in 1412 F lines. 4:5 Through pedigree analysis, the candidate gene was ultimately narrowed down to the interval between STA452 and STA382, where six markers co-segregated with the target gene. We selected LrN4B-1 from these six markers as the diagnostic marker for LrN4B.
[0052] LrN3B molecular marker localization, such as Figure 2 As shown, the present invention utilizes 310 F... 2:3LrN3B was located in a 1.5 cM region between gwm533 and 3B330, and the candidate gene co-segregated with 3B384. From heterozygous single plants within the gwm533 and 3B330 regions, 1328 F1 plants were derived. 3:4 For pedigree analysis, eight polymorphic indel markers were developed using parental resequencing data, further locating candidate genes within a 0.82 cM region, between markers N4-351 and 4B679. Using 1445 F... 4:5 In the pedigree, LrN3B was ultimately located in a 0.14 cM region between 3-97 and 3-13. Five markers co-segregated with the target gene within this region. This invention uses LrN3B-1 among these markers as a diagnostic marker for LrN3B.
[0053] Table 3. Monogenic segregating subpopulations derived from the 4N0461 / Agricultural University 4503F2 population.
[0054]
[0055] 3. Identification of 10 wheat samples using LrN4B-1 and LrN3B-1.
[0056] (1) DNA was extracted from leaf tissues of 10 wheat materials using the CTAB method. 800 μL of CTAB was added to the middle 1-2 cm section of a 6-leaf stage wheat leaf, vortexed, and incubated at 65°C for 45 min. 700 μL of phenol·chloroform·isoamyl alcohol (25:24:1) was added to the mixture, and the mixture was vortexed more than 30 times. After separation, the mixture was centrifuged at 12000 rpm for 10 min. 500 μL of the supernatant was transferred to an equal volume of pre-chilled isopropanol at 4°C and gently mixed. The mixture was incubated at -20°C for at least 20 min to ensure sufficient DNA precipitation. The mixture was centrifuged at 12000 rpm for 4 min, the supernatant was discarded, and the remaining precipitate was retained. 600 μL of 75% ethanol was added to the precipitate, the mixture was vortexed, centrifuged at 1000 rpm for 3 min at 4°C, the supernatant was discarded, and this process was repeated twice. The product was thoroughly dried in a clean bench, and then 200 μL of ddH2O was added and stored at -80℃ for later use.
[0057] (2) Use the PAGE plus method to synthesize the primers in Table 4. Use the DNA extracted in 5.3.1 as a template for PCR amplification.
[0058] Prepare a primer mixture using competing primers F1, F2, and reverse primer R in a 1:1:2 ratio. The PCR reaction volume was 10 μL: template DNA (100 ng / μL) -1 1.0 μL of 2×Taq PCR Master Mix (Sangon Biotech, Beijing), 5 μL of primer mixture, and 3 μL of ddH2O.
[0059] The PCR amplification reaction program used Touch Down. Pre-denaturation: 94℃ for 3 min. Stage 1: 94℃ denaturation for 30 s; 65℃ annealing for 30 s, decreasing by one degree Celsius per cycle; 72℃ extension for 45 s; 10 cycles in total. Stage 2: 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s; 25 cycles in total.
[0060] This invention further utilizes polyacrylamide gel electrophoresis (PAGE) to detect PCR products. STARP markers are created by artificially adding fragments of different lengths to two competing primers. Due to different genotypes, different competing primers can bind, resulting in differences in the length of the amplified fragments. Genotyping can be performed based on these length differences.
[0061] The materials used for evaluation were: Nongda 4503, Nongda 189, Mingxian 169, Liangxing 99, Nongda 3331, Xinmai 26, Zhongguochun, Zhoumai 16, Zhoumai 47, and Shi 4185. Nongda 189 showed resistance to leaf rust at the mature stage, while Nongda 4503, Mingxian 169, Liangxing 99, Nongda 3331, Xinmai 26, Zhongguochun, Zhoumai 16, Zhoumai 47, and Shi 4185 were susceptible to leaf rust.
[0062] The results are as follows Figure 3 As shown, LrN4B-1 and LrN3B-1 can be clearly genotyped in 10 wheat materials. Nongda 189 and Zhongguochun are LrN4B resistant haplotypes, which can amplify a 178bp band, while other susceptible haplotypes can amplify a 188bp band. Because there are indels between the resistant and susceptible LrN3B haplotypes, the band difference between different genotypes is not an artificially introduced 10bp; only Nongda 189 is an LrN3B resistant haplotype, which can amplify a 249bp band, while the other materials show a 244bp band. This invention further validates the gene sequences using first-generation sequencing, and the results are consistent with the haplotype results detected by STARP markers.
[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of primer combinations or kits in detecting wheat resistance to leaf rust; The sequences of the primer combination are shown below: F1: GGCACCAAGTACCTACGCCA; F2: ACGACTCAATGGCACCAAGTACCTACGCCG; R: GAAGCGAGCCACCACGG; The kit includes the primer combination; The applications include: If the primer combination detects a 249 bp band, then the wheat being tested is disease resistant. If the primer combination detects a 244bp band, the wheat being tested is susceptible to disease.
2. A method for detecting wheat resistance to leaf rust, characterized in that, include: The wheat to be tested was tested using primer combinations or kits, and the resistance of the wheat to leaf rust was determined based on the test results; The sequences of the primer combination are shown below: F1: GGCACCAAGTACCTACGCCA; F2: ACGACTCAATGGCACCAAGTACCTACGCCG; R: GAAGCGAGCCACCACGG; The kit includes the primer combination; The judgment criteria are as follows: If the primer combination detects a 249 bp band, the wheat being tested is resistant to disease; if the primer combination detects a 244 bp band, the wheat being tested is susceptible to disease.
Citation Information
Patent Citations
Molecular marker closely linked with wheat stem height and spike length character major QTL and application thereof
CN108588272A