Three-lncRNA marker combination for screening tuberculosis patients and application thereof

Abstract

The application discloses a combination of three lncRNA markers for screening tuberculosis patients and application thereof. The application provides application of a substance for detecting marker 1, a substance for detecting marker 2 and a substance for detecting marker 3 in preparation of a kit for screening tuberculosis patients. The application also provides application of the marker 1, the marker 2 and the marker 3 as combined markers in development of a kit for screening tuberculosis patients. The marker 1 is lncRNA 046173 or a characteristic fragment of the lncRNA 046173. The marker 2 is lncRNA PRDM7-1:2 or a characteristic fragment of the lncRNA PRDM7-1:2. The marker 3 is lncRNA CHI3L1-2:3 or a characteristic fragment of the lncRNA CHI3L1-2:3. The three lncRNAs have more excellent performance as combined diagnostic markers. The application is very important for rapid diagnosis and early treatment of tuberculosis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of medical diagnosis, and particularly relates to a combination of three lncRNA markers for screening patients with tuberculosis and application thereof. BACKGROUND

[0002] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis (M.tb), which has the characteristics of wide prevalence and high mortality. About one-fourth of the world's population is infected with M.tb, which is a public health problem that needs to be solved urgently. According to the Global Tuberculosis Report of the World Health Organization (WHO) in 2022, there were 1060 million new tuberculosis patients in 2021, and the number of deaths due to tuberculosis or complications reached 1.6 million. Therefore, it is of great significance to realize rapid and accurate diagnosis of tuberculosis for relieving the pressure of public health. China is still a high-burden country of tuberculosis, and the situation of prevention and treatment is still very severe. The gold standard for existing tuberculosis diagnosis is etiology, among which smear method is the most basic detection method, although it is simple to operate and reliable in results, but the low positive rate in actual application cannot be ignored. Although the culture method has slightly improved sensitivity, it has problems such as long culture time and low positive rate. With the development of technology, molecular biology detection technology targeting M.tb is routinely used in clinical practice, which has improved the detection rate of tuberculosis to about 60%. However, nearly half of the patients in the clinic still cannot be accurately diagnosed due to the lack of etiological basis or no sputum specimens, so there are still difficulties in the diagnosis of tuberculosis in the clinic. In order to cut off the source of infection and transmission as soon as possible to avoid the spread of M.tb, the WHO also advocates the development of blood / hydraulic molecular detection technology based on host "non-sputum" specimens, so it is necessary to vigorously carry out identification and verification of new biomarkers from the host perspective to improve the diagnosis efficiency of tuberculosis.

[0003] Previous studies have found that non-coding RNA (ncRNA) is also involved in the anti-infection process after M.tb infects the host, among which lncRNA accounts for 80% of non-coding RNA. LncRNA is a kind of RNA composed of more than 200 nucleotides without protein coding ability, which can combine different biological macromolecules to play biological roles at the transcription level, post-transcriptional and translation stage. Previous research results show that it is involved in the pathophysiological process of various diseases including infectious diseases. Although its specific mechanism of action needs to be further studied and clarified or improved, it is undeniable that lncRNA has a very important regulatory role in the process of cell function and disease occurrence and development, which suggests its potential as a diagnostic marker. SUMMARY

[0004] The present application aims to provide a combination of three lncRNA markers for screening tuberculosis patients and application thereof.

[0005] The present application provides use of a substance for detecting Marker 1, a substance for detecting Marker 2 and a substance for detecting Marker 3 in the preparation of a kit for screening tuberculosis patients.

[0006] The present application also provides use of Marker 1, Marker 2 and Marker 3 as joint markers in the development of a kit for screening tuberculosis patients.

[0007] The present application also provides use of a substance for detecting Marker 1, a substance for detecting Marker 2 and a substance for detecting Marker 3 in the preparation of a kit for diagnosing or aiding in the diagnosis of tuberculosis.

[0008] The present application also provides use of Marker 1, Marker 2 and Marker 3 as joint markers in the development of a kit for diagnosing or aiding in the diagnosis of tuberculosis.

[0009] The present application also provides a kit comprising a substance for detecting Marker 1, a substance for detecting Marker 2 and a substance for detecting Marker 3.

[0010] The kit is used as follows (a) or (b):

[0011] (a) screening tuberculosis patients;

[0012] (b) diagnosing or aiding in the diagnosis of tuberculosis.

[0013] The kit further comprises a carrier with the following content recorded thereon:

[0014] (1) detecting the relative expression amount of Marker 1, the relative expression amount of Marker 2 and the relative expression amount of Marker 3 in the peripheral blood mononuclear cells (PBMCs) of a subject;

[0015] (2) converting the relative expression amount of Marker 1, the relative expression amount of Marker 2 and the relative expression amount of Marker 3 in the PBMCs of a subject into an interpretation result by a J48 decision tree model, wherein the interpretation result refers to a tuberculosis patient or a healthy person.

[0016] The kit further comprises a carrier with the following content recorded thereon:

[0017] (1) detecting the relative expression amount of Marker 1, the relative expression amount of Marker 2 and the relative expression amount of Marker 3 in the PBMCs of a subject;

[0018] (2) judging according to the following process:

[0019] Firstly, judging according to the relative expression amount of marker 1; when the relative expression amount of marker 1 is > 0.000155, proceeding to the second step; when the relative expression amount of marker 1 is ≤ 0.000075, judging as a healthy person; when the relative expression amount of marker 1 is ≤ 0.000155 and the relative expression amount of marker 1 is > 0.000075, proceeding to the third step;

[0020] Secondly, judging according to the relative expression amount of marker 2; when the relative expression amount of marker 2 is > 0.000704, judging as a tuberculosis patient, and when the relative expression amount of marker 2 is ≤ 0.000704, judging as a healthy person;

[0021] Thirdly, judging according to the relative expression amount of marker 3; when the relative expression amount of marker 3 is > 0.000123, judging as a tuberculosis patient; when the relative expression amount of marker 3 is ≤ 0.000049, judging as a tuberculosis patient; and when the relative expression amount of marker 3 is ≤ 0.000123 and the relative expression amount of marker 3 is > 0.000049, judging as a healthy person.

[0022] The kit further comprises a carrier recording the following contents:

[0023] (1) detecting the relative expression amount of marker 1, the relative expression amount of marker 2 and the relative expression amount of marker 3 in PBMCs of a subject;

[0024] (2) converting the relative expression amount of marker 1, the relative expression amount of marker 2 and the relative expression amount of marker 3 in PBMCs of a subject into a judgment result by a random tree model, wherein the judgment result refers to a tuberculosis patient or a healthy person.

[0025] The application further provides a system for screening a tuberculosis patient, comprising a detection system and a judgment system;

[0026] The detection system is used for detecting the relative expression amount of marker 1, the relative expression amount of marker 2 and the relative expression amount of marker 3 in PBMCs of a subject;

[0027] The judgment system is used for converting the relative expression amount of marker 1, the relative expression amount of marker 2 and the relative expression amount of marker 3 in PBMCs of a subject into a judgment result, wherein the judgment result refers to a tuberculosis patient or a healthy person.

[0028] The marker 1 is lncRNA 046173 or a characteristic fragment of lncRNA 046173.

[0029] The marker 2 is lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2.

[0030] The marker 3 is lncRNA CHI3L1-2:3 or a characteristic fragment of lncRNA CHI3L1-2:3.

[0031] The substance for detecting the marker 1 comprises a primer pair for detecting the marker 1. The substance for detecting the marker 1 further comprises a primer pair for detecting a reference gene. Specifically, detecting the marker 1 refers to detecting the relative expression amount of the marker 1 in human PBMCs. Specifically, detecting the marker 1 refers to detecting the relative expression amount of the marker 1 in human PBMCs by fluorescence quantitative PCR.

[0032] The substance for detecting the marker 2 comprises a primer pair for detecting the marker 2. The substance for detecting the marker 2 further comprises a primer pair for detecting a reference gene. Specifically, detecting the marker 2 refers to detecting the relative expression amount of the marker 2 in human PBMCs. Specifically, detecting the marker 2 refers to detecting the relative expression amount of the marker 2 in human PBMCs by fluorescence quantitative PCR.

[0033] The substance for detecting the marker 3 comprises a primer pair for detecting the marker 3. The substance for detecting the marker 3 further comprises a primer pair for detecting a reference gene. Specifically, detecting the marker 3 refers to detecting the relative expression amount of the marker 3 in human PBMCs. Specifically, detecting the marker 3 refers to detecting the relative expression amount of the marker 3 in human PBMCs by fluorescence quantitative PCR.

[0034] The application also provides use of the substance for detecting lncRNA CHI3L1-2:3 or a characteristic fragment of lncRNA CHI3L1-2:3 in the preparation of a kit.

[0035] The use of the kit is as follows (a) or (b):

[0036] (a) screening tuberculosis patients;

[0037] (b) diagnosing or assisting in the diagnosis of tuberculosis.

[0038] The application also provides use of lncRNA CHI3L1-2:3 or a characteristic fragment of lncRNA CHI3L1-2:3 as a marker in the development of a kit for screening tuberculosis patients.

[0039] The application also provides application of the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 as a marker in development of a kit for diagnosing or assisting in diagnosing tuberculosis.

[0040] The application also provides a kit comprising a substance for detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3.

[0041] The kit is used as follows (a) or (b):

[0042] (a) screening tuberculosis patients;

[0043] (b) diagnosing or assisting in diagnosing tuberculosis.

[0044] The kit further comprises a carrier with the following content:

[0045] (1) detecting the relative expression amount of the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 in PBMCs of a subject;

[0046] (2) judging as a tuberculosis patient if the relative expression amount is greater than or equal to a threshold value, and judging as a healthy person if the relative expression amount is less than the threshold value.

[0047] Specifically, the threshold value is 0.000120130.

[0048] The substance for detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 comprises a primer pair for detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3. The substance for detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 further comprises a primer pair for detecting a reference gene. Specifically, detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 refers to detecting the relative expression amount of the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 in human PBMCs. Specifically, detecting the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 refers to detecting the relative expression amount of the lncRNA CHI3L1-2:3 or the characteristic fragment of the lncRNA CHI3L1-2:3 in human PBMCs by fluorescence quantitative PCR.

[0049] Specifically, the lncRNA 046173 is as shown in sequence 1 of the sequence listing.

[0050] The characteristic fragment of the lncRNA 046173 is as shown in positions 1105-1170 of sequence 1 of the sequence listing.

[0051] Specifically, the lncRNA PRDM7-1:2 is as shown in sequence 2 of the sequence listing.

[0052] The characteristic fragment of the lncRNA PRDM7-1:2 is as shown in positions 2797-2858 of sequence 2 of the sequence listing.

[0053] Specifically, the lncRNA CHI3L1-2:3 is as shown in sequence 3 of the sequence listing.

[0054] The characteristic fragment of the lncRNA CHI3L1-2:3 is as shown in positions 338-409 of sequence 3 of the sequence listing.

[0055] Specifically, the primer pair for detecting the marker 1 consists of the primer as shown in sequence 4 of the sequence listing and the primer as shown in sequence 5 of the sequence listing.

[0056] Specifically, the primer pair for detecting the marker 2 consists of the primer as shown in sequence 6 of the sequence listing and the primer as shown in sequence 7 of the sequence listing.

[0057] Specifically, the primer pair for detecting the marker 3 consists of the primer as shown in sequence 8 of the sequence listing and the primer as shown in sequence 9 of the sequence listing.

[0058] Specifically, the primer pair for detecting the characteristic fragment of the lncRNA CHI3L1-2:3 consists of the primer as shown in sequence 8 of the sequence listing and the primer as shown in sequence 9 of the sequence listing.

[0059] Specifically, the screening of any one of the above is screening from healthy persons.

[0060] Specifically, the internal reference gene of any one of the above is GAPDH gene.

[0061] Specifically, the primer pair for detecting the internal reference gene consists of the primer as shown in sequence 10 of the sequence listing and the primer as shown in sequence 11 of the sequence listing.

[0062] The calculation method of the relative expression level is as follows:

[0063] △Ct = Ct 标志物 -Ct 内参基因 ;

[0064] Relative expression level (Relative expression level) = 2 -△Ct .

[0065] Specifically, the tuberculosis mentioned in any of the above is pulmonary tuberculosis.

[0066] Specifically, the healthy person mentioned in any of the above refers to a non-tuberculosis patient.

[0067] In order to identify potential differentially expressed lncRNAs for tuberculosis diagnosis and reveal the pathological and physiological processes involved in the occurrence and development of tuberculosis, the inventors of the present application carried out a whole genome RNA chip screening, completed the comparative analysis of lncRNA expression profiles in PBMCs from tuberculosis patients and healthy people, and initially obtained a large number of differentially expressed lncRNAs.

[0068] Further, the inventors verified the initially obtained lncRNAs in another group of independent samples by qPCR, screened 3 lncRNAs (lncRNA CHI3L1-2:3, lncRNA 046173, lncRNA PRDM7-1:2) whose expression trends between groups were consistent with the chip results, and the expression of the 3 lncRNAs in the tuberculosis patient group was significantly higher than that in the healthy person group, and the difference was statistically significant.

[0069] Further, the inventors analyzed the diagnostic performance of the 3 lncRNAs as single markers and joint diagnostic markers in new populations. Receiver operating characteristic curve (ROC) analysis showed that the area under the curve (AUC) of the ROC curve of the 3 lncRNAs independently used for tuberculosis diagnosis was greater than 0.70, and the 3 lncRNAs as joint diagnostic markers had better performance. The present application is very important for rapid diagnosis and early treatment of tuberculosis. BRIEF DESCRIPTION OF DRAWINGS

[0070] Figure 1 Relative expression amount of three lncRNAs in PBMCs of all subjects in Example 4.

[0071] Figure 2 ROC curve of three lncRNAs independently used as diagnostic markers in Example 4.

[0072] Figure 3 Judgment process and results of using J48 decision tree model to screen tuberculosis patients in Example 4.

[0073] Figure 4 ROC curve of using J48 decision tree model to screen tuberculosis patients in Example 4.

[0074] Figure 5 Judgment process and results of using random tree model to screen tuberculosis patients in Example 4.

[0075] Figure 6 ROC curve of screening tuberculosis patients using random tree model in Example 4. DETAILED DESCRIPTION

[0076] The application will be further described in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0077] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. Fc (fold change): fold difference.

[0078] Receiver operator characteristic curve (ROC curve): a curve plotted with sensitivity as the ordinate and (1-specificity) as the abscissa. The area under the ROC curve (AUC) is between 1.0 and 0.5. When AUC > 0.5, the closer AUC is to 1, the better the diagnostic effect. When AUC is between 0.5 and 0.7, it indicates low accuracy. When AUC is between 0.7 and 0.9, it indicates certain accuracy. When AUC is ≥ 0.9, it indicates high accuracy. When AUC = 0.5, it indicates that the diagnostic method is completely ineffective and has no diagnostic value. AUC < 0.5 does not conform to the true situation and rarely occurs in practice.

[0079] The tuberculosis patients in the examples are all pulmonary tuberculosis patients.

[0080] Inclusion criteria for pulmonary tuberculosis patients: according to the pulmonary tuberculosis diagnosis standard (WS 288-2017), the patient has clinical manifestations (symptoms and signs) of tuberculosis and has imaging features of tuberculosis and at least one of the following conditions: ① positive sputum Mycobacterium tuberculosis culture; ② positive sputum acid-fast staining; ③ positive sputum Xpert MTB / RIF detection; ④ lung biopsy pathology found Mycobacterium tuberculosis and / or positive acid-fast staining and / or caseous granulomatous lesions.

[0081] Exclusion criteria for TB patients: 1. Having received anti-tumor therapy or anti-tuberculosis therapy for more than 2 weeks; 2. Having other immune diseases; 3. Less than 18 years old; 4. Pregnant or lactating; 5. Having HIV, syphilis or other infectious diseases; 6. Having a history of tuberculosis or tuberculosis contact history.

[0082] Inclusion criteria for healthy subjects: No obvious respiratory disease related clinical symptoms, normal imaging examination, no history of tuberculosis or tuberculosis contact history, and negative tuberculosis infection T cell detection.

[0083] Example 1: Preliminary screening of markers for tuberculosis screening using high-throughput microarray chips

[0084] Test samples: 19 peripheral blood samples from 19 tuberculosis patients (referred to as TB group samples) and 9 peripheral blood samples from 9 healthy subjects (referred to as HC group samples). Each test sample was subjected to steps 1 to 5.

[0085] 1. Obtaining PBMCs from the test sample.

[0086] 2. RNA extraction

[0087] The total RNA was extracted using miRNeasy Mini Kit (Cat# 217004, QIAGEN, GmBH, Germany) according to the instructions, and the extracted total RNA was electrophoresed and qualified by Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, CA, US) for standby use.

[0088] 3. cRNA labeling

[0089] The total RNA was amplified and labeled using the Agilent expression profile chip kit (Cat. #5190-2305, Agilent technologies, Santa Clara, CA, US) according to the instructions, and then the labeled cRNA was purified using RNeasy minikit (Cat. #74106, QIAGEN, GmBH, Germany).

[0090] 4. Chip hybridization

[0091] According to the hybridization standard procedure and kit provided by Agilent Gene Expression Hybridization Kit (Cat. #5188-5242, Agilent technologies, Santa Clara, CA, US), hybridization was performed in a Hybridization Oven (Cat. #G2545A, Agilent technologies, Santa Clara, CA, US) at 65°C with 10 rpm for 17 hours. The amount of cRNA loaded was 1.65 μg. The chips were washed in staining dishes (Cat. #121, Thermo Shandon, Waltham, MA, US) using Gene Expression Wash Buffer Kit (Cat. #5188-5327, Agilent technologies, Santa Clara, CA, US).

[0092] 5. Chip scanning

[0093] The hybridized chips were scanned using an Agilent Microarray Scanner (Cat. #G2565CA, Agilent technologies, Santa Clara, CA, US) with the following software settings: Dye channel: Green, Scan resolution = 3 μm, PMT 100%, 20 bit. The data were read using Feature Extraction software 10.7 (Agilent technologies, Santa Clara, CA, US), and finally normalized using the limma package in R software with the Quantile algorithm.

[0094] 6. Comparative analysis of the lncRNA profiles in the PBMCs of the TB group and the HC group was performed to screen for differentially expressed lncRNAs (P < 0.05, Fold change > 2).

[0095] The results of the chip analysis of the three exemplary lncRNAs (the three lncRNAs were subsequently verified as effective markers) are shown in Table 1.

[0096] Table 1

[0097]

[0098] Note: P value is the comparison result of TB group and HC group normalized signal value, p<0.05 is statistically significant.

[0099] Example 2, further screening effective markers

[0100] Using cell models and new clinical grouping samples (i.e. TB group samples and HC group samples), further screening was carried out among the differentially expressed lncRNAs obtained in the preliminary screening of Example 1, and 3 effective markers were obtained.

[0101] The 3 effective markers are lncRNA 046173, lncRNA PRDM7-1:2 and lncRNA CHI3L1-2:3.

[0102] The lncRNA 046173 is as shown in Sequence 1 of the sequence listing.

[0103] The lncRNA PRDM7-1:2 is as shown in Sequence 2 of the sequence listing.

[0104] The lncRNA CHI3L1-2:3 is as shown in Sequence 3 of the sequence listing.

[0105] Example 3, establishment of a method for screening tuberculosis patients using a single marker or a combination of markers

[0106] Another batch of independent clinical samples (i.e. TB group samples and HC group samples) was included.

[0107] I. Detecting the relative expression amount of each marker

[0108] 1. Peripheral blood (4 ml) of the subject was collected using an EDTA anticoagulation blood collection tube, and PBMCs were obtained by separation.

[0109] 2. The PBMCs obtained in step 1 were washed with PBS buffer, cell lysis was performed using QIAzol Lysis Reagent (QIAGEN, item number 79306), and then RNA extraction was performed using miRNeasy Mini Kit (QIAGEN, item number 217004).

[0110] 3. The RNA obtained in step 2 was prepared in a 0.2 ml PCR tube according to Table 2 to prepare a 20 μl reaction system, and then reverse transcription was performed.

[0111] Table 2

[0112]

[0113] 5xRT Buffer, Enzyme Mix, Primer Mix, which are components in ReverTra Ace qPCR RT Kit (TOYOBO Co., Ltd., Catalog No. FSQ-101).

[0114] The reaction procedure of reverse transcription is as follows: 37 °C for 15 min, 95 °C for 5 min, and 4 °C storage.

[0115] 4、After step 3 is completed, 20 μl reaction system is prepared in the 96-well plate according to Table 3, and then PCR amplification is performed.

[0116] Table 3

[0117] Components volume PowerUp TM SYBR Green premix 10 μl Primer working solution 2 μl Product of step 3 2 μl ddH2O 6μl

[0118] PowerUp TM SYBR Green premix: American ABI Co., Ltd., Catalog No. A25742.

[0119] The effective components provided by the primer working solution are upstream primers and downstream primers for detecting targets. The concentrations of the upstream primers and the downstream primers in the primer working solution are both 10 μM.

[0120] ABI QuantStudio 7FLEX fluorescent quantitative PCR instrument is used for PCR amplification. The reaction procedure of PCR amplification is as follows: 50 °C for 2 min, 95 °C for 10 min; 95 °C for 15 s, 60 °C for 1 min, 40 cycles.

[0121] When lncRNA 046173 gene expression is detected, the primers used for PCR amplification are as follows:

[0122] lncRNA 046173 upstream primer (sequence 4 in the sequence table): GGGAAGTTCCAGAATCGAGAGA;

[0123] lncRNA 046173 downstream primer (sequence 5 in the sequence table): TCTTCAGGAGGCTCACTCTATGG.

[0124] When lncRNA PRDM7-1:2 gene expression is detected, the primers used for PCR amplification are as follows:

[0125] lncRNA PRDM7-1:2 upstream primer (sequence 6 in the sequence table): CCATGGGTTCTACGTGTTTCTTG;

[0126] lncRNA PRDM7-1:2 downstream primer (sequence 7 in the sequence table): CATTCCTGGTGCCCATTCTG.

[0127] The primers used for PCR amplification when detecting the expression of lncRNA CHI3L1-2:3 gene are as follows:

[0128] lncRNA CHI3L1-2:3 upstream primer (sequence 8 of the sequence listing): CACTACTCTCCCAAGCCCTTCTAT;

[0129] lncRNA CHI3L1-2:3 downstream primer (sequence 9 of the sequence listing): GAAGGACTAATGGCTGGACACTAATAT.

[0130] The primers used for PCR amplification when detecting the expression of the internal reference gene (GAPDH gene) are as follows:

[0131] GAPDH upstream primer (sequence 10 of the sequence listing): TGACTTCAACAGCGACACCCA;

[0132] GAPDH downstream primer (sequence 11 of the sequence listing): CACCCTGTTGCTGTAGCCAAA.

[0133] The primers are synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.

[0134] ΔCt = Ct lncRNA -Ct GAPDH ;

[0135] Relative expression level = 2 -△Ct .

[0136] II. Setting the threshold for screening tuberculosis patients using a single effective marker

[0137] The threshold is set according to the clinical grouping and the relative expression level data of the marker.

[0138] When lncRNA 046173 is used as a marker, the threshold is set to 0.000199589, and greater than or equal to the threshold is judged to be a tuberculosis patient, and less than the threshold is judged to be a healthy person.

[0139] When lncRNA PRDM7-1:2 is used as a marker, the threshold is set to 0.001008514, and greater than or equal to the threshold is judged to be a tuberculosis patient, and less than the threshold is judged to be a healthy person.

[0140] When lncRNA CHI3L1-2:3 is used as a marker, the threshold is set to 0.000120130, and greater than or equal to the threshold is judged to be a tuberculosis patient, and less than the threshold is judged to be a healthy person.

[0141] III. Establishing a decision tree model for joint screening of tuberculosis patients with three effective markers

[0142] According to the clinical grouping and the relative expression data of the markers, the J48 decision tree model is established, and the judgment is made according to the following process:

[0143] First, according to the relative expression of lncRNA 046173, when the relative expression of lncRNA 046173 is > 0.000155, proceed to the second step; when the relative expression of lncRNA 046173 is ≤ 0.000075, judge as healthy; when the relative expression of lncRNA 046173 is ≤ 0.000155 and the relative expression of lncRNA 046173 is > 0.000075, proceed to the third step.

[0144] Second, according to the relative expression of lncRNA PRDM7-1:2, when the relative expression of lncRNA PRDM7-1:2 is > 0.000704, judge as tuberculosis patient, when the relative expression of lncRNA PRDM7-1:2 is ≤ 0.000704, judge as healthy.

[0145] Third, according to the relative expression of lncRNA CHI3L1-2:3, when the relative expression of lncRNA CHI3L1-2:3 is > 0.000123, judge as tuberculosis patient; when the relative expression of lncRNA CHI3L1-2:3 is ≤ 0.000049, judge as tuberculosis patient; when the relative expression of lncRNA CHI3L1-2:3 is ≤ 0.000123 and the relative expression of lncRNA CHI3L1-2:3 is > 0.000049, judge as healthy.

[0146] IV. Establishing a random tree model for joint screening of tuberculosis patients with three effective markers

[0147] According to the clinical grouping and the relative expression data of the markers, data mining is carried out based on Weka platform, a random tree diagnosis model is constructed, and finally a complete complex tree classifier composed of different nodes is trained for disease diagnosis.

[0148] 1. Define column variables and input data;

[0149] (1) Diagnosis classification value or detection result (test): multiple diagnostic tests are defined as test1, test2,...;

[0150] (2) Gold standard category (group): 1 = case group, 0 = control group;

[0151] (3) Frequency (freq), need to perform the second step further;

[0152] 2. Specify the frequency variable path: Data\Weight Case..., options: Weight case by, fill in the table: Freqency Variable (freq);

[0153] 3. ROC analysis: path: Grahps\Roc Curve... fill in the table: Test Variable (test), StateVariable (group), Value of state variable, options include:

[0154] (display) ROC Curve, with diagonal reference line (opportunity line), standard error and confidence interval (area of standard error and confidence interval), Coordinate points of the ROC curve (ROC curve coordinate points), options: test direction (if the test value is small, it needs to be selected), cofidence level (%): need to define the confidence level other than 95%, which can be defined here.

[0155] Example 4, verify the use of three lncRNAs as tuberculosis patient screening markers in a new independent sample population

[0156] Subjects: A total of 102 subjects; 70 tuberculosis patients constitute the tuberculosis patient population (TB group), and 32 healthy people constitute the healthy person population (HC group).

[0157] I. Detect the relative expression amount of each marker

[0158] Each subject was detected respectively, and the method was the same as step I of example 3.

[0159] The relative expression amounts of the three lncRNAs obtained by the above steps of 32 healthy people and 70 tuberculosis patients are shown in Figure 1 . Since the relative expression data is small, in order to facilitate display, multiply the relative expression value by 100000 to obtain the relative expression display value. The relative expression display value of each target in the PBMCs of 32 healthy people is shown in Table 4. The relative expression display value of each target in the PBMCs of 70 tuberculosis patients is shown in Table 5.

[0160] Table 4

[0161]

[0162]

[0163] Table 5

[0164]

[0165]

[0166]

[0167] The relative expression of the three targets in the PBMCs of the TB group subjects (average of the group) and the relative expression of the three targets in the PBMCs of the HC group subjects (average of the group) and the analysis of the expression difference are shown in Table 6.

[0168] Table 6

[0169] Fc(TB / HC) P-value lncRNA 046173 12.321 <0.000 lncRNA PRDM7-1:2 3.816 <0.000 lncRNA CHI3L1-2:3 1.563 <0.001

[0170] II. Screening of TB patients using a single effective marker

[0171] Using the relative expression of the three targets obtained in step one, the judgment was performed according to step two of Example 3.

[0172] The performance evaluation was performed according to the judgment result and the actual grouping.

[0173] The ROC curve of the three lncRNAs as diagnostic markers is shown in Figure 2 The performance evaluation data of the three lncRNAs as diagnostic markers are shown in Table 7.

[0174] III. Screening of TB patients using J48 decision tree model

[0175] Using the relative expression of the three targets obtained in step one, the judgment was performed according to step three of Example 3.

[0176] The schematic diagram of the judgment process and the result is shown in Figure 3 .

[0177] The performance evaluation was performed according to the judgment result and the actual grouping.

[0178] The ROC curve of the J48 decision tree model is shown in Figure 4 . The performance evaluation data of the J48 decision tree model are shown in Table 7.

[0179] IV. Screening of TB patients using random tree model

[0180] Using the relative expression of the three targets obtained in step one, the judgment was performed according to step four of Example 3.

[0181] The schematic diagram of the judging process and result is shown in Figure 5 .

[0182] The performance evaluation was made according to the judging result and the actual grouping.

[0183] The ROC curve of the random tree model is shown in Figure 6 The performance evaluation data of the random tree model is shown in Table 7.

[0184] Table 7

[0185]

[0186] The present application has been described in detail. For those skilled in the art, the present application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the present application and without unnecessary experiments. Although the present application gives special examples, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by using conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Use of a substance for detecting expression level of Marker 1, a substance for detecting expression level of Marker 2 and a substance for detecting expression level of Marker 3 in the preparation of a kit for screening patients with tuberculosis; the Marker 1 is lncRNA 046173, the sequence of which is shown as sequence 1 in the sequence listing; the Marker 2 is lncRNA PRDM7-1:2, the sequence of which is shown as sequence 2 in the sequence listing; the Marker 3 is lncRNA CHI3L1-2:3, the sequence of which is shown as sequence 3 in the sequence listing.

2. Use of Marker 1, Marker 2 and Marker 3 as joint markers in the development of a kit for screening patients with tuberculosis; the Marker 1 is lncRNA 046173, the sequence of which is shown as sequence 1 in the sequence listing; the Marker 2 is lncRNA PRDM7-1:2, the sequence of which is shown as sequence 2 in the sequence listing; the Marker 3 is lncRNA CHI3L1-2:3, the sequence of which is shown as sequence 3 in the sequence listing.

3. Use of a substance for detecting expression level of Marker 1, a substance for detecting expression level of Marker 2 and a substance for detecting expression level of Marker 3 in the preparation of a kit for diagnosing or aiding in the diagnosis of tuberculosis; the Marker 1 is lncRNA 046173, the sequence of which is shown as sequence 1 in the sequence listing; the Marker 2 is lncRNA PRDM7-1:2, the sequence of which is shown as sequence 2 in the sequence listing; the Marker 3 is lncRNA CHI3L1-2:3, the sequence of which is shown as sequence 3 in the sequence listing.

4. Use of Marker 1, Marker 2 and Marker 3 as joint markers in the development of a kit for diagnosing or aiding in the diagnosis of tuberculosis; the Marker 1 is lncRNA 046173, the sequence of which is shown as sequence 1 in the sequence listing; the Marker 2 is lncRNA PRDM7-1:2, the sequence of which is shown as sequence 2 in the sequence listing; the Marker 3 is lncRNA CHI3L1-2:3, the sequence of which is shown as sequence 3 in the sequence listing.

5. A system for screening patients with tuberculosis, comprising a detection system and an interpretation system; the detection system is used to detect the relative expression amount of Marker 1, the relative expression amount of Marker 2 and the relative expression amount of Marker 3 in PBMCs of a subject; the interpretation system is used to determine whether the subject has tuberculosis. The interpretation system is used for converting the relative expression amount of the marker 1, the relative expression amount of the marker 2 and the relative expression amount of the marker 3 in the PBMCs of the subject into an interpretation result, which refers to a tuberculosis patient or a healthy person; The marker 1 is lncRNA 046173, the sequence of the lncRNA 046173 is shown as sequence 1 in the sequence table; The marker 2 is lncRNA PRDM7-1:2, the sequence of the lncRNA PRDM7-1:2 is shown as sequence 2 in the sequence table; The marker 3 is lncRNA CHI3L1-2:3, the sequence of the lncRNA CHI3L1-2:3 is shown as sequence 3 in the sequence table.

Images