Cas12a mutant protein, gene editing systems containing Cas12a mutant protein and their applications

Abstract

This invention relates to the field of gene editing technology, specifically to an Mb4Cas12a mutant protein, a CRISPR / Cas12a gene editing system using this mutant protein, and its applications. The complex formed by the Mb4Cas12a mutant protein and crRNA of this invention can precisely target DNA sequences and induce cleavage, causing double-strand breaks in the target sequence. It exhibits high specificity, reduces off-target rates in gene editing performed in cells or in vitro, and can distinguish single-base differences at target sites, thus possessing broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, specifically to a Cas12a mutant protein, a CRISPR / Cas12a gene editing system containing the mutant protein, and its related applications. Background Technology

[0002] The CRISPR / Cas system is an acquired immune system evolved by bacteria and archaea to defend against invasion by exogenous viruses or plasmids. CRISPR / Cas9 and CRISPR / Cas12 systems have been developed as gene editing tools. These two systems can be further divided into several subclasses. The CRISPR / Cas12a system belongs to a subclass of CRISPR / Cas12, relying on a complex formed by crRNA (CRISPR-derived RNA) and Cas12 to function, and does not contain tracrRNA (trans-activating RNA). When DNA breaks occur, two main DNA damage repair mechanisms in the cell are responsible for repair: non-homologous end-joining (NHEJ) and homologous recombination (HR). NHEJ repair results in base deletions or insertions, which can be used for gene knockout; given a homologous template, HR repair can be used for site-specific gene insertion and precise base substitution.

[0003] CRISPR / Cas12a holds broad promise for applications in basic research and gene therapy. CRISPR / Cas12a exhibits higher specificity than CRISPR / Cas9, making it less prone to off-target effects. However, there is still room for improvement in the specificity of CRISPR / Cas12a. CRISPR / Cas12a can tolerate single-base mismatches between crRNA and the target sequence. When two alleles in the genome differ by only one base, it is not possible to knock out only one allele. Many dominant mutations are caused by single-base mutations; if the mutated allele could be specifically knocked out, a therapeutic effect could be achieved. This requires the CRISPR / Cas12a system to be able to distinguish single-base mutations, which is precisely what most current CRISPR / Cas12a systems cannot do. Summary of the Invention

[0004] Through repeated research, the inventors identified mutation sites related to the cleavage specificity of the wild-type Mb4Cas12a protein, thereby obtaining a series of Cas12a mutant proteins, all of which can form a CRISPR / Cas12a gene editing system with enhanced cleavage specificity for effective gene editing with single-stranded guide RNA, thus completing this invention.

[0005] In summary, in a first aspect of the present invention, a Cas12a mutant protein is provided, the Cas12a mutant protein comprising a mutation at one or more amino acid residues corresponding to G257, N276, K291 and F370 of the wild-type Mb4Cas12a protein.

[0006] In a second aspect, the present invention provides a conjugate comprising:

[0007] a) The Cas12a mutant protein described in the first aspect;

[0008] b) Modified parts; and

[0009] c) An optional adapter for connecting the Cas12a mutant protein to the modified portion.

[0010] In a third aspect, the present invention provides a fusion protein comprising:

[0011] a) The Cas12a mutant protein described in the first aspect;

[0012] b) Other proteins and peptides; and

[0013] c) Optional adapters for connecting the Cas12a mutant protein to the other proteins and peptides.

[0014] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following:

[0015] a) The Cas12a mutant protein described in the first aspect;

[0016] b) The conjugate described in the second aspect; or

[0017] c) The fusion protein described in the third aspect.

[0018] In a fifth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the following:

[0019] a) The Cas12a mutant protein described in the first aspect;

[0020] b) The conjugate described in the second aspect; or

[0021] c) The fusion protein described in the third aspect.

[0022] In a sixth aspect, the present invention provides a CRISPR / Cas12a gene editing system comprising:

[0023] 1) Protein components, which include:

[0024] a) The Cas12a mutant protein described in the first aspect;

[0025] b) The conjugate described in the second aspect; or

[0026] c) The fusion protein described in the third aspect;

[0027] 2) A single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence and a CRISPR spacer sequence;

[0028] Furthermore, the protein component and the nucleic acid component combine with each other to form a complex.

[0029] In a seventh aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule described in the fourth aspect, or the carrier described in the fifth aspect.

[0030] In an eighth aspect, the present invention provides a method for gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the intracellular or in vitro environment:

[0031] (1) The Cas12a mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and the single-stranded guide RNA;

[0032] (2) The isolated nucleic acid molecules described in the fourth aspect and, as appropriate, the isolated nucleic acid molecules containing a nucleic acid sequence encoding a single-stranded guide RNA capable of being coupled with the Cas12a mutant protein described in the first aspect;

[0033] (3) The vector described in the fifth aspect, and, as appropriate, a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein described in the first aspect; and

[0034] (4) The CRISPR / Cas12a gene editing system described in the sixth aspect;

[0035] The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

[0036] The Cas12a mutant protein, the conjugate, or the fusion protein recognizes their respective protospacer adjacent sequence (PAM), which is located at the 5' end of the target sequence and has the sequence 5'-YYN.

[0037] In a ninth aspect, the present invention provides a kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising:

[0038] a) Choose any one of (1) to (4) below:

[0039] (1) The Cas12a mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0040] (2) The isolated nucleic acid molecules described in the fourth aspect and, as appropriate, the isolated nucleic acid molecules containing nucleic acid sequences encoding single-stranded guide RNAs capable of being coupled with the Cas12a mutant protein described in the first aspect;

[0041] (3) The vector described in the fifth aspect, and, as appropriate, a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein described in the first aspect; and

[0042] (4) The CRISPR / Cas12a gene editing system described in the sixth aspect;

[0043] as well as

[0044] b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment;

[0045] The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

[0046] The inventors of this invention have developed various Cas12a mutant proteins based on the wild-type Mb4Cas12a protein. These mutant proteins contain mutations at one or more amino acid residues corresponding to G257, N276, K291, and F370 of the wild-type Mb4Cas12a protein. For example, they include one or more point mutations selected from G257A, N276A, K291A, and F370A, such as two, three, or four point mutations, thereby achieving higher cleavage specificity. Furthermore, due to having a relatively small number of amino acids, the Mb4Cas12a mutant proteins of this invention can form complexes with crRNA for gene editing.

[0047] The gene editing tool using the Cas12a mutant protein of this invention can recognize very simple PAM sequences, namely YYN, and exhibits high editing efficiency and specificity. Furthermore, due to the small molecular weight of the protein, it can be easily packaged into vectors such as adeno-associated viruses, making it highly suitable for future development as a gene therapy tool. More importantly, the gene editing system using the Mb4Cas12a mutant protein and sgRNA of this invention overcomes the limitation of existing CRISPR / Cas systems in distinguishing single-base mutations. It can differentiate single-base differences at target sites, thereby enabling the knockout of mutated alleles. This provides an important foundation for clinical gene therapy using CRISPR / Cas gene editing systems. Therefore, this invention further expands the scope of gene editing and has broad application prospects in the field of gene editing. Attached Figure Description

[0048] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below.

[0049] Figure 1 This diagram illustrates a comparison of the specificity detection results of the CRISPR / Mb4Cas12a-G257A gene editing system and the CRISPR / Mb4Cas12a gene editing system in the HEK293T cell line of the GFP reporter system.

[0050] Figure 2 This diagram illustrates a comparison of the specificity detection results of the CRISPR / Mb4Cas12a-N276A gene editing system and the CRISPR / Mb4Cas12a gene editing system in the HEK293T cell line of the GFP reporter system.

[0051] Figure 3 This diagram illustrates a comparison of the specificity detection results of the CRISPR / Mb4Cas12a-K291A gene editing system and the CRISPR / Mb4Cas12a gene editing system in the HEK293T cell line of the GFP reporter system.

[0052] Figure 4 This diagram illustrates a comparison of the specificity detection results of the CRISPR / Mb4Cas12a-F370A gene editing system and the CRISPR / Mb4Cas12a gene editing system in the HEK293T cell line of the GFP reporter system.

[0053] Figure 5 The results show the editing efficiency of the gene editing system containing CRISPR / Mb4Cas12a-K291A at target sites containing single nucleotide polymorphisms (SNPs).

[0054] Figure 6 The results show the editing efficiency of the gene editing system containing CRISPR / Mb4Cas12a-F370A at target sites containing single nucleotide polymorphisms (SNPs). Detailed Implementation

[0055] The present invention will be described in detail below with reference to the accompanying drawings. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0056] definition

[0057] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0058] In cases where numerical ranges are provided, such as concentration ranges, percentage ranges, or ratio ranges, it should be understood that, unless the context explicitly specifies otherwise, all intermediate values ​​between the upper and lower limits of the range, up to one-tenth of the lower limit unit, and any other values ​​or intermediate values ​​within the range are included in the subject matter. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, limited by any specific excluded limit values ​​within the range. Where the range includes one or two limit values, the range excluding any one or both of those included limit values ​​is also included in the subject matter.

[0059] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of." The expressions "comprising," "including," or "basically / mainly composed of" are generally understood as open-ended expressions, indicating that they include not only the elements, components, parts, or method steps specifically listed after the expression, but also other elements, components, parts, or method steps. However, in this document, the expressions "comprising," "including," or "basically / mainly composed of" can also be understood as closed-ended expressions in certain cases, indicating that they only include the elements, components, parts, or method steps specifically listed after the expression, and do not include any other elements, components, parts, or method steps. In this case, the expression is equivalent to the expression "composed of."

[0060] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0061] The terms "Cas12a protein," "Cas12a," and "Cas" as used herein are interchangeable and refer to RNA-guided nucleases, including the Cas12a protein or its functionally active fragments. The Cas12a protein is a protein component of the CRISPR / Cas12a genome editing system that, guided by single-stranded guide RNA (gRNA), targets and cleaves DNA target sequences, forming DNA double-strand breaks (DSBs). DNA double-strand breaks can activate the cell's inherent repair mechanisms of non-homologous end joining (NHEJ) and homologous recombination (HR), thereby repairing DNA damage in the cell. During the repair process, the specific DNA sequence is edited at specific sites.

[0062] The terms “guide RNA,” “gRNA,” “sgRNA,” or “mature crRNA” as used herein are interchangeable and have the meanings commonly understood by those skilled in the art. Generally, a single-stranded guide RNA may comprise a scaffold sequence and a guide sequence, also referred to herein as guide RNA (or gRNA). In the context of an endogenous CRISPR system, the guide sequence is also referred to as a spacer sequence. In some cases, the guide sequence is any polynucleotide sequence that is sufficiently similar to a target sequence to hybridize with said target sequence and guide the specific binding of the CRISPR / Cas12a complex to said target sequence. In some embodiments, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimal alignment is achieved. Determining optimal alignment is within the capabilities of those skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan. As used herein, the term "CRISPR / Cas12a complex" refers to a complex formed by the binding of a single-stranded guide RNA or mature crRNA to the Cas12a protein, containing a guide sequence capable of hybridizing to a target sequence and thereby enabling the Cas12a protein to bind to said target sequence. This complex is capable of recognizing and cleaving polynucleotides that hybridize to mature crRNA.

[0063] Therefore, in the formation of the CRISPR / Cas12a complex, the "target sequence" refers to a polynucleotide targeted by a guide sequence designed to be targeted, such as a sequence complementary to the guide sequence, where hybridization between the target sequence and the guide sequence will promote the formation of the CRISPR / Cas12a complex. Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of the CRISPR / Cas complex. The target sequence can include any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In other cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast.

[0064] As used herein, the term "target sequence" or "target polynucleotide" can refer to any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM). The precise sequence and length requirements for the PAM vary depending on the Cas protein used, but the PAM is typically a 2-5 base sequence adjacent to the protospacer sequence (target sequence). Those skilled in the art can identify the PAM sequence used with a given Cas protein.

[0065] The terms “polynucleotide,” “nucleic acid sequence,” “nucleotide sequence,” or “nucleic acid fragment” used herein are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0066] In the sequences used in this invention, degenerate bases are sometimes used to represent bases at one or more positions. Degenerate bases can be represented by the letters R, Y, M, K, S, W, H, B, V, D, and N, where R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents C / G, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0067] The terms “polypeptide,” “peptide,” and “protein” as used herein are used interchangeably to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and also to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.

[0068] The terms “identity,” “consistency,” or “homology” used in this article have the generally accepted meanings in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using publicly available techniques. Sequence identity can be measured along the full length of a polynucleotide or polypeptide or along a region of the molecule (see, for example, Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While many methods exist for measuring the identity between two polynucleotides or peptides, the term "identity" is known to those skilled in the art to refer to conserved amino acid substitutions in peptides or proteins that can generally be performed without altering the biological activity of the resulting molecule. Typically, those skilled in the art recognize that a single amino acid substitution in a non-essential region of a peptide does not substantially alter its biological activity (see, for example, Watson et al., Molecular Biology of the Gene, 4). th Edition, 1987, The Benjamin / Cummings Pub. co., p. 224).

[0069] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. A vector is called an expression vector when it enables the expression of a protein encoded by the inserted polynucleotide, or when it enables transcription of the inserted polynucleotide (e.g., to generate mRNA or functional RNA). Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to, plasmid vectors and viral vectors. Vectors may also contain various regulatory sequences that regulate expression. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein, referring to a nucleotide sequence located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that affects transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. These regulatory sequences may originate from different sources or from the same source but arranged in a manner different from what is typically found naturally. Additionally, vectors may contain a replication initiation site.

[0070] As used herein, the term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the invention, a promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it originates from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.

[0071] As used in this article, the term "constitutive promoter" refers to a promoter that generally causes gene expression in most cell types and under most conditions. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to promoters that are primarily, but not necessarily, expressed specifically in a single tissue or organ, and may also be expressed in a specific cell type. "Developmental regulatory promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoter" selectively expresses a manipulated DNA sequence in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0072] "Introducing" nucleic acid molecules (such as plasmids, linear nucleic acid fragments, RNA, etc.) or proteins into an organism refers to transforming the cells of an organism with the nucleic acid or protein, enabling the nucleic acid or protein to function within the cell. The term "transformation" as used in this invention includes both stable transformation and transient transformation.

[0073] As used in this article, the term "stable transformation" refers to the introduction of a foreign nucleotide sequence into the genome, resulting in the stable inheritance of the foreign gene. Once stable transformation occurs, the foreign nucleic acid sequence is stably integrated into the genome of the organism and its subsequent generations.

[0074] The term "transient transformation" as used in this article refers to the introduction of nucleic acid molecules or proteins into cells to perform their functions without the stable inheritance of the foreign gene. In transient transformation, the foreign nucleic acid sequence does not integrate into the genome.

[0075] As used herein, the term "complementarity" refers to the ability of one nucleic acid sequence to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. The complementarity percentage indicates the percentage of residues in one nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with another nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementarity out of 10). "Complete complementarity" means that all consecutive residues in one nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in another nucleic acid sequence. As used herein, “substantially complementary” refers to a complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% in a region having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.

[0076] As used in this paper, the hybridization-related term "strict condition" refers to conditions under which a nucleic acid complementary to a target sequence hybridizes primarily with that target sequence and substantially does not hybridize to non-target sequences. Strict conditions are typically sequence-dependent and depend on many factors. Generally, the longer the sequence, the higher the temperature at which it specifically hybridizes to its target sequence. A non-limiting example of a strict condition is described in Tijssen, 1993, *Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization With Nucleic Acid Probes*, Section I, Chapter II, "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, New York.

[0077] As used herein, the term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of these nucleotide residues. Hydrogen bonds can occur via Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can consist of two strands forming a duplex, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization can be a step in a broader process, such as the initiation of PCR or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is called the "complement" of that given sequence.

[0078] Cas12a mutant protein

[0079] In a first aspect of the invention, a Cas12a mutant protein is provided, the Cas12a mutant protein comprising a mutation at one or more amino acid residues of G257, N276, K291 and F370 corresponding to the wild-type Mb4Cas12a protein.

[0080] The wild-type Mb4Cas12a protein used in this paper has the amino acid sequence shown in SEQ ID NO:1.

[0081] In one specific implementation, the mutation includes one or more point mutations selected from G257A, N276A, K291A, and F370A.

[0082] In a preferred embodiment, the mutation is G257A, N276A, K291A, or F370A.

[0083] In yet another specific implementation, the Cas12a mutant protein corresponding to the wild-type Mb4Cas12a protein may include multiple point mutations from G257A, N276A, K291A, and F370A, wherein the multiple point mutations may be two, three, or four point mutations.

[0084] In one specific implementation, the Cas12a mutant protein has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even higher (e.g., 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 99.99%) sequence identity with the wild-type Mb4Cas12a protein.

[0085] Derivatized proteins

[0086] The Cas12a mutant protein can be derivatized, for example, by linking it to another molecule (e.g., another protein or peptide). Generally, protein derivatization (e.g., labeling) does not adversely affect the protein's desired activity (e.g., its activity in binding to single-stranded guide RNA, its endonuclease activity, its activity in binding to and cleaving a target sequence at a specific site guided by the guide RNA). Therefore, the Cas12a mutant protein of the present invention is also intended to include such derivatized forms. For example, the Cas12a mutant protein of the present invention can be functionally linked (by chemical coupling, gene fusion, non-covalent linkage, or other means) to one or more other molecular moieties, such as another protein or peptide, a detectable label, a pharmaceutical reagent, etc.

[0087] Specifically, the Cas12a mutant protein can be linked to other functional units. For example, it can be linked to a nuclear localization signal (NLS) sequence to enhance the protein's ability to enter the cell nucleus. For example, it can be linked to a targeting moiety to make the Cas12a mutant protein of the present invention targeted. For example, it can be linked to a detectable tag to facilitate the detection of the Cas12a mutant protein of the present invention. For example, it can be linked to an epitope tag to facilitate the expression, detection, tracing, and / or purification of the Cas12a mutant protein of the present invention.

[0088] Therefore, in a second aspect, the present invention provides a conjugate comprising:

[0089] a) The Cas12a mutant protein described in the first aspect;

[0090] b) Modified parts; and

[0091] c) An optional adapter for connecting the Cas12a mutant protein to the modified portion.

[0092] It is understandable that, in addition to the Cas12a mutant protein itself, the Cas12a mutant protein can also be combined with other substances, such as other proteins or tagged objects, to give it other functions.

[0093] Therefore, in one specific implementation, the modified portion may be another protein or polypeptide, a detectable label, or a combination thereof.

[0094] In a further specific embodiment, the additional protein or polypeptide is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal (NLS) sequences, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressor KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

[0095] Epitope tags are well known to those skilled in the art, and examples include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select an appropriate epitope tag according to the desired purpose (e.g., purification, detection, or tracing).

[0096] Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, and BFP.

[0097] Detectable markers are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0098] The Cas12a mutant protein of the present invention can be coupled, conjugated, or fused to the modified moiety via a linker, or it can be directly linked to the modified moiety without a linker. Linkers are well known in the art, and examples of them may include, but are not limited to, linkers containing 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0099] In a third aspect, the present invention provides a fusion protein comprising:

[0100] a) The Cas12a mutant protein described in the first aspect;

[0101] b) Other proteins and peptides; and

[0102] c) Optional adapters for connecting the Cas12a mutant protein to the other proteins and peptides.

[0103] Similar to the second aspect of the invention, the additional protein or polypeptide may be selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal (NLS) sequences, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressor KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

[0104] Epitope tags are well known to those skilled in the art, and examples include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select an appropriate epitope tag according to the desired purpose (e.g., purification, detection, or tracing). Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0105] Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, and BFP.

[0106] Detectable markers are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0107] The Cas12a mutant protein of the present invention can be coupled, conjugated, or fused to the other proteins or peptides via a linker, or can be directly linked to the other proteins or peptides without a linker. Linkers are well known in the art, and examples include, but are not limited to, linkers containing 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0108] The Cas12a mutant protein of this invention, comprising mutations at one or more amino acid residues of G257, N276, K291, and F370 corresponding to the wild-type Mb4Cas12a protein, has a relatively small number of amino acids, enabling it to form complexes with sgRNA or crRNA for precise gene editing, and can perform gene editing in a eukaryotic environment. More specifically, gene editing tools incorporating the Cas12a mutant protein of this invention can recognize very simple PAM sequences, i.e., YYN (e.g., TTN such as TTT, CCN, CTN, TCN), and all exhibit high editing efficiency and specificity. Furthermore, due to their small molecular weight, they can be easily packaged into vectors such as adeno-associated viruses, making them highly suitable for later development as gene therapy tools. This invention expands the scope of gene editing and has broad application prospects in the field of gene editing.

[0109] Nucleic acid encoding and vectors

[0110] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following:

[0111] a) The Cas12a mutant protein described in the first aspect;

[0112] b) The conjugate described in the second aspect; or

[0113] c) The fusion protein described in the third aspect.

[0114] In one specific implementation, the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein, the single-stranded guide RNA comprising a scaffold sequence and a CRISPR spacer sequence.

[0115] In a further specific embodiment, the stent sequence is the stent sequence shown in SEQ ID NO: 2.

[0116] In a further specific implementation, the CRISPR spacer sequence is a sequence of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that can be complementary to the target sequence.

[0117] In a preferred embodiment, the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

[0118] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 5' end of the spacer sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0119] The single-stranded guide RNA can bind to the aforementioned Cas12a mutant protein, conjugate, or fusion protein to form a complex. This complex can recognize the PAM sequence (i.e., YYN) and thereby bind to the target sequence, thus achieving the cleavage of the target sequence or gene editing.

[0120] After the isolated nucleic acid molecules of the present invention are transfected into the corresponding cells using certain tools known in the art, such as expression vectors, the isolated nucleic acid molecules of the present invention can express the Cas12a mutant protein, its conjugates or fusion proteins, and / or the single-stranded guide RNA described above, and perform the corresponding functions, such as gene editing.

[0121] In addition, the isolated nucleic acid molecules of the present invention can express Cas12a mutant protein, its conjugates or fusion proteins, and single-stranded guide RNA individually or separately, or they can express the expression products together, depending on the specific circumstances.

[0122] Furthermore, the expressed product has the corresponding effects and / or functions described above, which will not be repeated here for the sake of brevity.

[0123] In a fifth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the following:

[0124] a) The Cas12a mutant protein described in the first aspect;

[0125] b) The conjugate described in the second aspect; or

[0126] c) The fusion protein described in the third aspect.

[0127] In one specific implementation, the vector can be a plasmid vector, such as a pUC19 vector, an applicator vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

[0128] In yet another specific embodiment, the vector further comprises a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein, the single-stranded guide RNA comprising a scaffold sequence and a CRISPR spacer sequence.

[0129] In a further specific embodiment, the stent sequence is the stent sequence shown in SEQ ID NO: 2.

[0130] In a further specific implementation, the CRISPR spacer sequence is a sequence of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that can be complementary to the target sequence.

[0131] In a preferred embodiment, the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

[0132] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 5' end of the spacer sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0133] The single-stranded guide RNA can bind to the aforementioned Cas12a mutant protein, conjugate, or fusion protein to form a complex. This complex can recognize the PAM sequence (YYN) and thereby bind to the target sequence, thus achieving the cleavage of the target sequence or gene editing.

[0134] As described above, after the vector of the present invention is transfected into cells, the coding sequence cloned in the vector can be expressed as a Cas12a mutant protein, its conjugate or fusion protein, and / or the single-stranded guide RNA described above, and perform corresponding functions, such as gene editing.

[0135] Alternatively, multiple vectors, such as two vectors, can be transfected into cells, one vector expressing the Cas12a mutant protein, its conjugates, or fusion proteins, while the other vector expresses the single-stranded guide RNA. Subsequently, the expressed Cas12a mutant protein, its conjugates, or fusion proteins combine with the expressed single-stranded guide RNA to form a complex, which then performs its corresponding function, such as gene editing.

[0136] Alternatively, the nucleic acid sequence encoding the Cas12a mutant protein, its conjugate or fusion protein, and the nucleic acid sequence encoding the single-stranded guide RNA can be cloned into a vector, so that after the vector is transfected into cells, it expresses both the Cas12a mutant protein, its conjugate or fusion protein, and the single-stranded guide RNA, and performs the corresponding functions, such as gene editing.

[0137] CRISPR / Cas12a gene editing system

[0138] In a sixth aspect, the present invention provides a CRISPR / Cas12a gene editing system comprising:

[0139] 1) Protein components, which include:

[0140] a) The Cas12a mutant protein described in the first aspect;

[0141] b) The conjugate described in the second aspect; or

[0142] c) The fusion protein described in the third aspect;

[0143] as well as

[0144] 2) A single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence and a CRISPR spacer sequence;

[0145] Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex.

[0146] In one specific implementation, the stent sequence is the stent sequence shown in SEQ ID NO: 2.

[0147] In a further specific implementation, the CRISPR spacer sequence is a sequence of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that can be complementary to the target sequence.

[0148] In a preferred embodiment, the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

[0149] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 5' end of the spacer sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0150] The CRISPR / Cas12a gene editing system of the present invention can be directly constructed from the Cas12a mutant protein, its conjugate or fusion protein, and the single-stranded guide RNA described herein, or it can be constructed from the expression product obtained by expression using the vector described herein. The CRISPR / Cas12a gene editing system of the present invention achieves the recognition, localization, cleavage, and gene editing of target sequences through the combined action of the Cas12a mutant protein and the single-stranded guide RNA contained therein.

[0151] The CRISPR / Cas12a gene editing system of this invention can precisely locate the target sequence. "Precisely located" has two meanings: first, the CRISPR / Cas12a gene editing system itself can recognize and bind to the target sequence; second, the CRISPR / Cas12a gene editing system can bring other proteins fused with the Cas12a mutant protein or proteins that specifically recognize the sgRNA to the location of the target sequence.

[0152] The CRISPR / Cas12a gene editing system of the present invention has low tolerance for non-target sequences. In this document, "low tolerance" means that the CRISPR / Cas12a gene editing system of the present invention is substantially or completely unable to recognize and bind to non-target sequences, or substantially or completely unable to bring other proteins fused with the Cas12a mutant protein or proteins that specifically recognize the sgRNA to the location of the non-target sequence.

[0153] The CRISPR / Cas12a gene editing system of the present invention can target more DNA sequences in the genome because the PAM sequence (YYN) on the target sequence recognized by the Cas12a protein contained therein is simpler.

[0154] More importantly, as mentioned above, the CRISPR / Cas12a gene editing system of the present invention overcomes the deficiency of existing CRISPR / Cas systems in being unable to distinguish single-base mutations. It can distinguish single-base differences at target sites, thereby enabling the knockout of mutated alleles. This provides an important foundation for the clinical gene therapy using this type of gene editing system.

[0155] cell

[0156] In a seventh aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule described in the fourth aspect, or the carrier described in the fifth aspect.

[0157] As an example, the cell can be a prokaryotic cell or a eukaryotic cell. For the eukaryotic cell, as an example, it can be a plant cell or an animal cell. For the animal cell, as an example, it can be a mammalian cell, such as a human cell.

[0158] method

[0159] In an eighth aspect, the present invention provides a method for gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the intracellular or in vitro environment:

[0160] (1) The Cas12a mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0161] (2) The isolated nucleic acid molecules described in the fourth aspect and, as appropriate, the isolated nucleic acid molecules containing a nucleic acid sequence encoding a single-stranded guide RNA capable of being coupled with the Cas12a mutant protein described in the first aspect;

[0162] (3) The vector described in the fifth aspect, and, as appropriate, a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein described in the first aspect; and

[0163] (4) The CRISPR / Cas12a gene editing system described in the sixth aspect;

[0164] The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

[0165] The Cas12a mutant protein, the conjugate, or the fusion protein recognizes a protospacer adjacent sequence (PAM) located at the 5' end of the target sequence and having the sequence 5'-YYN.

[0166] Regarding items (2) and (3) above, as can be understood from the above description, the isolated nucleic acid molecule described in the fourth aspect of the present invention and the vector described in the fifth aspect may, in some cases, contain only a nucleic acid sequence encoding a Cas12a mutant protein or its conjugates or fusion proteins, and in other cases, may contain a nucleic acid sequence encoding a Cas12a mutant protein or its conjugates or fusion proteins and a nucleic acid sequence encoding a single-stranded guide RNA that can be conjugated with the Cas12a mutant protein or its conjugates or fusion proteins. Therefore, depending on the circumstances, the isolated nucleic acid molecule or the vector may contain a nucleic acid sequence encoding a single-stranded guide RNA that can be conjugated with the Cas12a mutant protein described in the first aspect.

[0167] In one specific implementation, the cell is a prokaryotic cell or a eukaryotic cell, the eukaryotic cell being, for example, a plant cell or an animal cell, the animal cell being, for example, a mammalian cell such as a human cell.

[0168] In yet another specific implementation, the gene editing includes one or more of the following: gene knockout of a target sequence, site-specific base alteration, site-specific insertion, regulation of gene transcription, regulation of DNA methylation, DNA acetylation modification, histone acetylation modification, single-base conversion, and chromatin imaging tracking. For example, the single-base conversion includes adenine to guanine, cytosine to thymine, or cytosine to uracil.

[0169] In a further specific embodiment, the stent sequence may be the stent sequence shown in SEQ ID NO: 2.

[0170] In a more specific implementation, the CRISPR spacer sequence can be a sequence of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that can be complementary to the target sequence.

[0171] In a preferred embodiment, the CRISPR spacer sequence may be a 24-nucleotide sequence that is complementary to the target sequence.

[0172] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 5' end of the spacer sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0173] In yet another specific implementation, the CRISPR spacer sequence of the single-stranded guide RNA forms a completely complementary base pairing structure with the target sequence, while forming an incomplete complementary base pairing structure with the non-target sequence.

[0174] In this document, the incomplete base pairing structure refers to a structure that includes a portion of base pairing and a portion of non-base pairing, wherein the non-base pairing includes, for example, base mismatch and / or base bulge.

[0175] In a further specific embodiment, the incomplete base complementary pairing structure includes one or more, for example, two or more base mismatches.

[0176] Therefore, the Cas12a mutant protein of the present invention can cleave the target site on the target sequence, and under the cleavage action of the Cas12a mutant protein, a double-strand break occurs in the target sequence. Furthermore, when the method is performed intracellularly, the cleaved target sequence can be repaired through intracellular non-homologous end joining repair or homologous recombination repair pathways, thereby achieving gene editing of the target sequence.

[0177] In the CRISPR / Cas12a gene editing system and gene editing method of the present invention, the Cas12a mutant protein of the present invention has been experimentally found to form a complex with sgRNA or crRNA for gene editing, with an editing efficiency of 4%-6%, and its mismatch-containing guide RNA has a near-zero error tolerance. Therefore, these gene editing systems can edit target genes with high specificity, and have the characteristics of high editing efficiency and low off-target rate, and can be widely used in gene editing in cells or in vitro environments.

[0178] Reagent test kit

[0179] In a ninth aspect, the present invention provides a kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising:

[0180] a) Choose any one of (1) to (4) below:

[0181] (1) The Cas12a mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0182] (2) The isolated nucleic acid molecules described in the fourth aspect and, as appropriate, the isolated nucleic acid molecules containing nucleic acid sequences encoding single-stranded guide RNAs capable of being coupled with the Cas12a mutant protein described in the first aspect;

[0183] (3) The vector described in the fifth aspect, and, as appropriate, a vector containing a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein described in the first aspect; or

[0184] (4) The CRISPR / Cas12a gene editing system described in the sixth aspect;

[0185] as well as

[0186] b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment;

[0187] The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

[0188] Regarding items (2) and (3) above, as can be understood from the above description, the isolated nucleic acid molecule described in the fourth aspect of the present invention and the vector described in the fifth aspect may, in some cases, contain only a nucleic acid sequence encoding a Cas12a mutant protein or its conjugates or fusion proteins, and in other cases, may contain a nucleic acid sequence encoding a Cas12a mutant protein or its conjugates or fusion proteins and a nucleic acid sequence encoding a single-stranded guide RNA that can be conjugated with the Cas12a mutant protein or its conjugates or fusion proteins. Therefore, depending on the circumstances, the isolated nucleic acid molecule or the vector may contain a nucleic acid sequence encoding a single-stranded guide RNA that can be conjugated with the Cas12a mutant protein described in the first aspect.

[0189] In a further specific embodiment, the stent sequence may be the stent sequence shown in SEQ ID NO: 2.

[0190] In a more specific implementation, the CRISPR spacer sequence can be a sequence of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that can be complementary to the target sequence.

[0191] In a preferred embodiment, the CRISPR spacer sequence may be a 24-nucleotide sequence that is complementary to the target sequence.

[0192] In a further embodiment, the single-stranded guide RNA further includes a terminator at the 5' end of the spacer sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0193] Of course, those skilled in the art will understand that the kit of the present invention may also contain other reagents that facilitate gene editing.

[0194] A brief description of the sequence involved in this invention.

[0195] SEQ ID NO:1: Protein sequence of wild-type Mb4Cas12a;

[0196] SEQ ID NO:2: Scaffold sequence of single-stranded guide RNA;

[0197] SEQ ID NO:3: The coding sequence of wild-type Mb4Cas12a protein;

[0198] SEQ ID NO:4: Encoding DNA sequence of the scaffold sequence for single-stranded guide RNA.

[0199] Example

[0200] The invention will now be described with reference to the following embodiments, which are intended to be illustrative and not limiting. Those skilled in the art will understand that the embodiments provided herein are for the purpose of describing the invention in detail only and are not intended to limit the scope of protection claimed by the invention.

[0201] Unless otherwise specified, the experiments and methods described in the examples were generally performed according to conventional methods well known in the art and described in the various references. Furthermore, for conditions not specifically specified in the examples, conventional conditions or conditions recommended by the manufacturer were followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0202] Example 1:

[0203] (1) Constructing plasmid pAAV2_Mb4Cas12a_ITR

[0204] Based on the gene search number (WP_078273923.1) of the wild-type Mb4Cas12a protein, its amino acid sequence was downloaded. The amino acid sequence of the wild-type Mb4Cas12a protein is shown in SEQ ID NO: 1.

[0205] The coding nucleic acid sequence of the wild-type Mb4Cas12a protein was codon-optimized to obtain the gene sequence of Mb4Cas12a protein that is highly expressed in human cells. The optimized gene sequence of the wild-type Mb4Cas12a protein is shown in SEQ ID NO: 3.

[0206] The highly expressed gene sequence of the Mb4Cas12a protein shown in SEQ ID NO: 3 obtained above was used to synthesize the gene and construct it into the slugCas9 backbone plasmid (Addgene platform, catalog#163793) to obtain the plasmid pAAV2_Mb4Cas12a_ITR.

[0207] (2) Construction of Mb4Cas12a point mutant plasmid

[0208] Circular PCR was performed using pAAV2_Mb4Cas12a_ITR plasmid as a template. Primer sequences are shown in Table 1 below:

[0209] Table 1: PCR primers for constructing the Mb4Cas12a point mutant

[0210]

[0211] The reaction system is as follows:

[0212]

[0213] The PCR procedure is as follows:

[0214]

[0215] PCR products were electrophoresed on a 1% agarose gel at 120V for 30 min. The target DNA fragment was purified using a gel extraction kit following the manufacturer's instructions. DNA concentration was measured using a NanoDrop™ Lite spectrophotometer (Thermo Scientific). T4 PNK and T4 DNA ligase treatments were then performed. The reaction system is as follows:

[0216]

[0217] The reaction conditions are as follows:

[0218]

[0219] Add 1 μL of T4 DNA ligase (NEB) to the reaction system, vortex to mix, and incubate at room temperature for 2 h. Add the ligation product to E. coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42℃ for 1 min, incubate on ice for 2 min, add 900 μL of LB medium, and incubate at 37℃ for 1 h to activate and revive E. coli DH5α competent cells.

[0220] The revived Escherichia coli DH5α competent cells were plated on LB solid plates containing ampicillin resistance and incubated upside down in a 37°C incubator. The resulting Escherichia coli DH5α monoclonal cells were verified by Sanger sequencing.

[0221] Sequencing and verifying the correct ligation of the E. coli DH5α clone, then shaking the culture to extract the plasmid, thus obtaining the point mutant plasmid, can be used for later use or stored at -20℃ for long-term preservation.

[0222] (3) Linearization preparation of plasmid psk-BbsI-Cas12a-crRNA1

[0223] The pBluescriptSKII + U6-sgRNA(F+E) empty plasmid (commercially available from Addgene platform, catalog #74707) was digested with BbsI and XhoI restriction endonucleases. The digestion system consisted of: 1 μg pBluescriptSKII + U6-sgRNA(F+E) empty plasmid, 5 μL 10×CutSmart buffer (NEB), 1 μL BbsI and 1 μL XhoI restriction endonuclease (NEB), and water to a final volume of 50 μL. The digestion was incubated at 37°C for 1 hour.

[0224] Then, the enzyme digestion products were electrophoresed on a 1% agarose gel at 120V for 30 minutes.

[0225] A 3017 bp DNA fragment was excised from an agarose gel and recovered using a gel recovery kit (Tiangen Biotech (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions. Finally, the fragment was eluted with ultrapure water.

[0226] Based on the repetitive sequence on the genome where the Cas12a protein is located, the truncated repetitive sequence (its DNA sequence is SEQ ID NO: 4) was synthesized and constructed on the linearized pBluescriptSKII + U6-sgRNA(F+E)empty backbone to obtain the plasmid psk-BbsI-Cas12a-crRNA1.

[0227] The psk-BbsI-Cas12a-crRNA1 plasmid was digested using the BbsI restriction endonuclease (NEB). The reaction mixture consisted of 2 μg of plasmid psk-BbsI-Cas12a-crRNA1, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction endonuclease (purchased from NEB), and water to a final volume of 50 μL. The digestion was carried out at 37°C for 2 hours.

[0228] Then, the enzyme digestion products were electrophoresed on a 1% agarose gel at 120V for 30 min.

[0229] DNA fragments were excised from the agarose gel and recovered using a gel recovery kit (Tiangen Biotech (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions. Finally, the fragments were eluted with ultrapure water.

[0230] The DNA concentration of the recovered linearized fragment psk-BbsI-Cas12a-crRNA1 was determined using a NanoDrop™ Lite spectrophotometer (Thermo Scientific) and stored for later use or at -20°C for long-term preservation.

[0231] (4) Construction of plasmid psk-BbsI-Cas12a-crRNA1-on / off target gRNA

[0232] The sequences of on-target and off-target gRNAs were designed, and their corresponding oligonucleotide single-stranded DNA sequences are shown in Table 2 below:

[0233] The oligonucleotide single-stranded DNA corresponding to the obtained on / off target gRNA was annealed. The annealing reaction system consisted of 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After vortexing and mixing the annealing system, it was placed in a PCR instrument and the annealing program was run as follows: 95℃_5 min, 85℃_1 min, 75℃_1 min, 65℃_1 min, 55℃_1 min, 45℃_1 min, 35℃_1 min, 25℃_1 min, and stored at 4℃ with a cooling rate of 0.3℃ / s. After annealing, the resulting product was ligated into the obtained linearized psk-BbsI-Cas12a-crRNA1 plasmid using DNA ligase (purchased from NEB).

[0234]

[0235] 1 μL of the obtained ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat-shocked at 42℃ for 1 min, incubated on ice for 2 min, and then 900 μL of LB medium was added. The cells were cultured at 37℃ for 1 h to activate and reactivate Escherichia coli DH5α competent cells.

[0236] The revived Escherichia coli DH5α competent cells were plated on LB solid plates containing the corresponding antibiotics and incubated upside down in a 37°C incubator. The resulting Escherichia coli DH5α monoclonal cells were verified by Sanger sequencing.

[0237] After sequencing and verifying the correct ligation of the E. coli DH5α clone, the plasmid was extracted to obtain the plasmid psk-BbsI-Cas12a-crRNA1-on / off target gRNA expressing the above on / off target gRNA sequence, which was then ready for use.

[0238] The plasmids expressing the Cas12a point mutant protein were co-transfected with psk-BbsI-Cas12a-crRNA1-on / off target gRNA into a GFP reporter system HEK293T cell line library containing the target sequence (GGATATGTTGAAGAACACCATGAC) using liposomes.

[0239] The HEK293T cell line containing the target sequence of the GFP reporter system was obtained as follows: a PAM sequence and a specific target sequence were inserted between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation. This mutation was then integrated into HEK293T cells via lentiviral infection, resulting in the HEK293T cell line containing the target sequence of the GFP reporter system. After the gene editing system cuts the target sequence, the cells' self-repair system causes some cells to recover the GFP reading frame, producing green fluorescence. Flow cytometry analysis of the GFP-positive cell ratio can be used to assess the editing capability and specificity of the gene editing system.

[0240] The above transfection process includes the following steps:

[0241] On day 0, the HEK293T cell line containing the target sequence of the GFP reporter system was seeded in 48-well plates as required for transfection, with the cell density controlled at 30%.

[0242] The HEK293T cell line containing the target sequence of the GFP reporter system contains the nucleotide sequence CMV-ATG-PAM-target site-GFP, where the PAM sequence is GTTTT and the target site sequence is GGATATGTTGAAGAACACCATGAC.

[0243] Day 1, transfection was performed. The transfection process is as follows:

[0244] Take 0.5 μg of the plasmid expressing the Cas12a point mutant protein to be transfected and add 0.3 μg of psk-BbsI-Cas12a-crRNA1-on / off target gRNA to 17.5 μL of Opti-MEM medium (purchased from Gibco) and gently pipette to mix.

[0245] Gently mix polyethyleneimine (PEI, purchased from Polysciences), add 0.8 μL of PEI to 17.5 μL of Opti-MEM medium, mix gently, and let stand at room temperature for 5 min.

[0246] The diluted plasmid and diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 15 min, and then added to the culture medium of the HEK293T cell line containing the target sequence of the GFP reporter system. The cell line was then placed in a 37°C, 5% CO2 incubator for further culture.

[0247] Flow cytometry was used to analyze the editing efficiency of the Cas12a point mutant on the target sequence.

[0248] Specifically, HEK293T cell lines cultured in a CO2 incubator for 5 days were collected, and their specificity was detected using flow cytometry (BDBiosciences FACS Calibur). The GFP positivity rate was analyzed and plotted using FlowJo analysis software.

[0249] The editing efficiency results of the four Cas12a point mutants in the HEK293T cell line containing the target sequence of the GFP reporter system are shown in the figure. Figure 1-4 When the Cas12a point mutant cuts the target sequence, the cell's own repair system allows some cells to recover the GFP reading frame, producing green fluorescence. Figure 1-4 In the graph, the Y-axis represents the percentage of GFP-positive cells (%), the X-axis represents the on-target and off-target gRNA sequences, and NC represents the negative control group (without transfected plasmid). Figure 1-4As can be seen, the Cas12a point mutant edited all target sites in the HEK293T cell line of the GFP reporter system, with fewer edits at off-target sites compared to the wild-type Mb4Cas12a protein, and the Cas12a point mutant protein showed better specificity.

[0250] Example 2:

[0251] (1) Linearization construction of plasmid psk-BbsI-Cas12a-crRNA1

[0252] The pBluescriptSKII + U6-sgRNA(F+E) empty plasmid was digested with BbsI and XhoI restriction endonucleases. The digestion system consisted of 1 μg of pBluescriptSKII + U6-sgRNA(F+E) empty plasmid, 5 μL of 10×CutSmart buffer (NEB), 1 μL of BbsI and 1 μL of XhoI restriction endonucleases (NEB), and water to a final volume of 50 μL. The digestion was incubated at 37°C for 1 hour.

[0253] Then, the enzyme digestion products were electrophoresed on a 1% agarose gel at 120V for 30 minutes.

[0254] A 3017 bp DNA fragment was excised from an agarose gel and recovered using a gel recovery kit (Tiangen Biotech (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions. Finally, the fragment was eluted with ultrapure water.

[0255] Based on the repeat sequence on the genome containing the Cas12a protein, the truncated repeat sequence (its DNA sequence is SEQ ID NO: 4) was synthesized and constructed on a linearized pBluescriptSKII + U6-sgRNA(F+E)empty backbone to obtain the plasmid psk-BbsI-Cas12a-crRNA1.

[0256] The psk-BbsI-Cas12a-crRNA1 plasmid was digested using the BbsI restriction endonuclease (NEB). The reaction mixture consisted of 2 μg of plasmid psk-BbsI-Cas12a-crRNA1, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction endonuclease (purchased from NEB), and water to a final volume of 50 μL. The digestion was carried out at 37°C for 2 hours.

[0257] Then, the enzyme digestion products were electrophoresed on a 1% agarose gel at 120V for 30 min.

[0258] DNA fragments were excised from the agarose gel and recovered using a gel recovery kit (Tiangen Biotech (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions. Finally, the fragments were eluted with ultrapure water.

[0259] The DNA concentration of the recovered linearized fragment psk-BbsI-Cas12a-crRNA1 was determined using a NanoDrop™ Lite spectrophotometer (Thermo Scientific) and stored for later use or at -20°C for long-term preservation.

[0260] (2) Construction of plasmid psk-BbsI-Cas12a-crRNA1-gRNA

[0261] The designed gRNA sequences and their corresponding oligonucleotide single-stranded DNA sequences are shown in Table 3 below:

[0262] Table 3: gRNA and its DNA sequence

[0263]

[0264] Note: The lowercase letters (i.e., the first four letters in Oligo-F and Oligo-R) indicate viscous end segments.

[0265] Oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system consisted of 1 μL of 100 μM oligo-F, 1 μL of 100 μM oligo-R, and 28 μL of water. After vortexing and mixing the annealing system, it was placed in a PCR instrument and the annealing program was run as follows: 95℃_5 min, 85℃_1 min, 75℃_1 min, 65℃_1 min, 55℃_1 min, 45℃_1 min, 35℃_1 min, 25℃_1 min, and stored at 4℃ with a cooling rate of 0.3℃ / s. After annealing, the obtained product was ligated into the linearized psk-BbsI-Cas12a-crRNA1 plasmid obtained in step (1) using DNA ligase (purchased from NEB).

[0266] 1 μL of the obtained ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat-shocked at 42℃ for 1 min, incubated on ice for 2 min, and then 900 μL of LB medium was added. The cells were cultured at 37℃ for 1 h to activate and reactivate Escherichia coli DH5α competent cells.

[0267] The revived Escherichia coli DH5α competent cells were plated on LB solid plates containing the corresponding antibiotics and incubated upside down in a 37°C incubator. The resulting Escherichia coli DH5α monoclonal cells were verified by Sanger sequencing.

[0268] After sequencing and verifying the correct ligation of the E. coli DH5α clone, the plasmid was extracted to obtain the plasmid psk-BbsI-Cas12a-crRNA1-gRNA expressing the above sgRNA sequence, which can be used for later use.

[0269] (3) Plasmids expressing Mb4Cas12a-K291A and Mb4Cas12a-F370A proteins were respectively compared with plasmids expressing sgRNA. Transfection of HEK293T cell line with psk-BbsI-Cas12a-crRNA1-gRNA

[0270] On day 0, HEK293T cells containing the target sequence were seeded in 24-well plates as needed for transfection, with a cell density of approximately 30%.

[0271] Day 1, transfection was performed. The transfection process is as follows:

[0272] Take 0.5 μg of plasmids expressing Mb4Cas12a-K291A and Mb4Cas12a-F370A proteins (construction method as in Example 1), and add them together with 0.3 μg of plasmid psk-BbsI-Cas12a-crRNA1-gRNA into 25 μL of Opti-MEM medium (purchased from Gibco), and gently pipette to mix.

[0273] Gently mix the transfection reagents Lipofectamine® 2000 (purchased from Invitrogen) or polyethyleneimine (hereinafter referred to as PEI) (purchased from Polysciences). Add 1.6 μL of Lipofectamine® 2000 or PEI to 25 μL of Opti-MEM medium (purchased from Gibco), mix gently, and let stand at room temperature for 5 min.

[0274] Mix the diluted transfection reagent and diluted plasmid, gently pipette to mix, let stand at room temperature for 20 min, then add to the culture medium containing HEK293T cells to be transfected, and then place the cells in a 37℃, 5% CO2 incubator for 5 days.

[0275] (4) Preparation of next-generation sequencing libraries

[0276] HEK293T cells were collected 5 days after editing, and genomic DNA was extracted using a DNA kit (Tiangen Biotech (Beijing) Co., Ltd., DP304) according to the instructions provided with the DNA kit.

[0277] The first round of PCR for library preparation was performed using 2×Q5 Master mix. The PCR primers are shown in Table 4 below.

[0278] Table 4: List of primers for first-round PCR in next-generation sequencing

[0279]

[0280] The reaction system is as follows:

[0281]

[0282] The PCR procedure is as follows:

[0283]

[0284] For the second round of PCR to prepare the sequencing library, 2×Q5 Master mix was used for the PCR reaction. The PCR primers are shown below:

[0285] F2 primer: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC;

[0286] R2 primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTG.

[0287] The reaction system is as follows:

[0288]

[0289] The PCR procedure is as follows:

[0290]

[0291] The second-round PCR products were purified using a gel extraction kit according to the manufacturer's instructions, resulting in a 300-400 bp DNA fragment. This completed the preparation of the next-generation sequencing library.

[0292] (5) Analysis of second-generation sequencing results

[0293] The prepared next-generation sequencing library was subjected to paired-end sequencing on the high-throughput sequencer HiseqXTen (Illumina).

[0294] Next-generation sequencing calculations yielded the efficiency of targeted editing applied to single nucleotide polymorphism (SNP) sites, such as... Figure 5 and Figure 6 As shown, the X-axis represents the target site (On) and allele sites (Off), and the Y-axis represents the editing efficiency (Indels%). From... Figure 5 and Figure 6As can be seen, both the Mb4Cas12a-K291A and Mb4Cas12a-F370A mutant proteins exhibit editing activity and specificity targeting genomic SNP sites, and are able to distinguish single-base differences at target sites. The inventors also verified that the mutant proteins Mb4Cas12a-G257A and Mb4Cas12a-N276A of this invention achieved similar technical effects, namely, the ability to distinguish single-base differences at target sites.

Claims

1. A Cas12a mutant protein, said Cas12a mutant protein containing only a mutation at one of the amino acid residues corresponding to G257, N276, K291 and F370 of the wild-type Mb4Cas12a protein as shown in SEQ ID NO:1: G257A, N276A, K291A or F370A.

2. A conjugate, said conjugate comprising: a) The Cas12a mutant protein of claim 1; b) Modified parts; c) A connector for linking the Cas12a mutant protein to the modified portion; The modified portion is selected from other proteins or peptides, detectable markers, or combinations thereof; The additional protein or polypeptide mentioned therein is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal sequences, cytosine deaminases, adenine deaminases, cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressors KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

3. The conjugate according to claim 2, wherein the linker is a linker with a length of 1-50 amino acids.

4. A fusion protein, said fusion protein comprising: a) The Cas12a mutant protein of claim 1; b) Other proteins and peptides; c) Connectors for linking the Cas12a mutant protein to the other proteins and peptides; The additional protein or polypeptide mentioned therein is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal sequences, cytosine deaminases, adenine deaminases, cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressors KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

5. The fusion protein according to claim 4, wherein the linker is a linker with a length of 1-50 amino acids.

6. An isolated nucleic acid molecule, said isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following: a) The Cas12a mutant protein of claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

7. The isolated nucleic acid molecule according to claim 6, wherein the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein, the single-stranded guide RNA comprising a scaffold sequence and a CRISPR spacer sequence.

8. The isolated nucleic acid molecule according to claim 7, wherein the scaffold sequence is the scaffold sequence shown in SEQ ID NO:

2.

9. The isolated nucleic acid molecule according to claim 7, wherein the CRISPR spacer sequence is a sequence of 18-28 nucleotides in length that is complementary to the target sequence.

10. The isolated nucleic acid molecule according to claim 7, wherein the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

11. A vector comprising a nucleic acid sequence encoding the following: a) The Cas12a mutant protein of claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

12. The vector according to claim 11, wherein the vector is a plasmid vector.

13. The vector according to claim 11, wherein the vector is a pUC19 vector, an applicator vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

14. The carrier according to any one of claims 11 to 13, wherein, The vector further comprises a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein, the single-stranded guide RNA comprising a scaffold sequence and a CRISPR spacer sequence.

15. The carrier according to claim 14, wherein the stent sequence is the stent sequence shown in SEQ ID NO:

2.

16. The vector according to claim 14, wherein the CRISPR spacer sequence is a sequence of 18-28 nucleotides in length that is complementary to the target sequence.

17. The vector according to claim 14, wherein the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

18. A CRISPR / Cas12a gene editing system, comprising: 1) Protein components, which include: a) The Cas12a mutant protein of claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5; as well as 2) A single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence and a CRISPR spacer sequence; Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex.

19. The CRISPR / Cas12a gene editing system according to claim 18, wherein the scaffold sequence is the scaffold sequence shown in SEQ ID NO:

2.

20. The CRISPR / Cas12a gene editing system of claim 18, wherein the CRISPR spacer sequence is a sequence of 18-28 nucleotides in length that is complementary to the target sequence.

21. The CRISPR / Cas12a gene editing system of claim 18, wherein the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

22. A cell comprising: an isolated nucleic acid molecule of any one of claims 6 to 10, or a vector of any one of claims 11 to 17.

23. The cell according to claim 22, wherein the cell is a prokaryotic cell or a eukaryotic cell, and the eukaryotic cell is an animal cell.

24. The cell of claim 23, wherein the animal cell is a mammalian cell.

25. A method for non-therapeutic gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: Contact any of the following (1) through (6) with the target sequence in the intracellular or in vitro environment: (1) The Cas12a mutant protein of claim 1, the conjugate of claim 2 or 3, or the fusion protein of claim 4 or 5, and single-stranded guide RNA; (2) The isolated nucleic acid molecule of claim 6 and the isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being coupled with the Cas12a mutant protein of claim 1; (3) The isolated nucleic acid molecule as described in claim 7; (4) The vector of claim 11 and the vector comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein of claim 1; (5) The carrier according to claim 14; and (6) The CRISPR / Cas12a gene editing system as described in claim 18; The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence. The Cas12a mutant protein, the conjugate, or the fusion protein recognizes a protospacer adjacent sequence (PAM) located at the 5' end of the target sequence and having the sequence 5'-YYN.

26. The method of claim 25, wherein the stent sequence is the stent sequence shown in SEQ ID NO:

2.

27. The method of claim 25, wherein the CRISPR spacer sequence is a sequence of 18-28 nucleotides in length that is complementary to the target sequence.

28. The method of claim 25, wherein the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

29. The method according to claim 25, wherein the cell is a prokaryotic cell or a eukaryotic cell, and the eukaryotic cell is an animal cell.

30. The method of claim 29, wherein the animal cell is a mammalian cell.

31. The method according to any one of claims 25 to 30, wherein the gene editing comprises one or more of the following: gene knockout of a target sequence, site-directed base alteration, site-directed insertion, regulation of gene transcription, regulation of DNA methylation, DNA acetylation modification, histone acetylation modification, single base conversion, and chromatin imaging tracking.

32. The method of claim 31, wherein the single base conversion includes adenine to guanine, cytosine to thymine, or cytosine to uracil.

33. The method of claim 25, wherein the CRISPR spacer sequence of the single-stranded guide RNA forms a completely complementary base pairing structure with the target sequence, and forms an incomplete complementary base pairing structure with the non-target sequence.

34. The method of claim 33, wherein the incomplete base complementary pairing structure comprises a structure with one or more base mismatches.

35. The method of claim 33, wherein the incomplete base complementary pairing structure comprises a structure with two or more base mismatches.

36. A kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising: a) Choose any one of (1) to (6) below: (1) The Cas12a mutant protein of claim 1, the conjugate of claim 2 or 3, or the fusion protein of claim 4 or 5, and single-stranded guide RNA; (2) The isolated nucleic acid molecule of claim 6 and the isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being coupled with the Cas12a mutant protein of claim 1; (3) The isolated nucleic acid molecule as described in claim 7; (4) The vector of claim 11 and the vector comprising a nucleic acid sequence encoding a single-stranded guide RNA capable of being conjugated with the Cas12a mutant protein of claim 1; (5) The carrier according to claim 14; or (6) The CRISPR / Cas12a gene editing system as described in claim 18; as well as b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment; The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

37. The kit according to claim 36, wherein the stent sequence is the stent sequence shown in SEQ ID NO:

2.

38. The kit according to claim 36, wherein the CRISPR spacer sequence is a sequence of 18-28 nucleotides in length that is complementary to the target sequence.

39. The kit of claim 36, wherein the CRISPR spacer sequence is a 24-nucleotide sequence that is complementary to the target sequence.

Images