A method for preparing an (r)-tebuconazole epoxide intermediate using an epoxide hydrolase mutant
By utilizing the recombinant strain E. coli/RpehM, a Parudigerum red yeast epoxyhydrolase mutant RpEHM, to catalyze the racemic tebuconazole epoxide intermediate, combined with organic solvent extraction, the problem of the difficulty in efficiently preparing chiral pure (R)-tebuconazole epoxide intermediate in the prior art has been solved, and an efficient and low-cost preparation method has been achieved.
Patent Information
- Application Number
- CN202310879769.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-18
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2043-07-18
AI Technical Summary
Existing technologies are insufficient for the efficient preparation of chiral pure (R)-tebuconazole epoxy intermediates, chemical methods are difficult to achieve highly stereoselective synthesis, and research on bioenzymatic methods has not yet been reported.
Using the epoxide hydrolase mutant RpEHM derived from Parudigan red yeast, the racemic tebuconazole epoxide intermediate was catalyzed by recombinant strain E. coli/RpehM and then extracted with organic solvent to achieve asymmetric resolution, thus preparing the (R)-tebuconazole epoxide intermediate.
This paper presents a green and efficient method for preparing (R)-tebuconazole epoxy intermediates. Compared with expensive chiral chromatographic separation methods, it is environmentally friendly, simple in process, and low in cost, and has high application prospects.
Smart Images

Figure CN117089537B_ABST
Abstract
Description
Technical Field
[0001] Specifically, this invention relates to a method for preparing (R)-tebuconazole epoxide intermediates using an epoxide hydrolase mutant, belonging to the field of biocatalysis technology. Background Technology
[0002] Triazole fungicides are a class of broad-spectrum, highly effective, low-residue, long-lasting, systemic fungicides with both protective and curative effects. They are widely used in crop disease control due to their good control efficacy against fungal diseases. Triazole fungicides are organic heterocyclic compounds, characterized by the presence of hydroxyl (ketone) groups, substituted phenyl groups, and 1,2,4-triazole groups on their main chain. Most triazole fungicides possess a chiral center, classifying them as chiral pesticides. Currently, there are 31 commercially available triazole fungicides, 26 of which are chiral pesticides. Numerous studies have shown that triazole fungicides exhibit significant stereoselectivity differences in target bioactivity, ecotoxicity, and environmental accumulation among their enantiomers. For example: ( R The biological activity of tebuconazole is ( S It has more than 100 times the activity of tebuconazole. S Tebuconazole has a significant effect on regulating plant growth; in cucumbers and test soil samples ( R )-Tebuconazole degrades faster. Although the proportion of chiral pesticides sold as single enantiomers is gradually increasing, due to constraints in separation, asymmetric synthesis methods, preparation levels, and costs, most triazole fungicides, except for tebuconazole and uniconazole which have achieved commercial application as optically pure monomers, are sold and used in racemic form.
[0003] Asymmetric catalysis mediated by chiral epoxy intermediates is one of the most efficient methods for obtaining optically active monomers of some triazole fungicides, and its green, efficient, and inexpensive synthesis is of great significance. Stereohedral 2,2-disubstituted ethylene oxides are key epoxy intermediates in the synthesis of some important triazole fungicides (such as tebuconazole, hexaconazole, cyproconazole, and trimethoprim). However, the steric hindrance effect of the steric groups makes it difficult to achieve high stereoselectivity in their synthesis using chemical methods. Asymmetric enzymatic catalysis has attracted attention due to its advantages of high stereoselectivity, broad substrate spectrum, and environmental friendliness. Epoxide hydrolases (EHs) are a class of hydrolases that catalyze the stereoselective ring-opening hydrolysis of epoxides, retaining a single configuration epoxide and generating the corresponding ortho-diol, making them ideal biocatalysts for the synthesis of chiral epoxy intermediates. Although numerous EHs have been reported and studied, for (… R) -tebuconazole epoxy intermediate (CAS: 80443-63-6: 2-[2-(4-chlorophenyl)ethyl]-2-(1,1-dimethylethyl)-oxirane) has not been reported. SUMMARY
[0004] The purpose of the present application is to provide a method for preparing a (R) -tebuconazole epoxy intermediate using an epoxy hydrolase mutant. R The method comprises the following steps:
[0005] A recombinant bacterium containing a recombinant epoxy hydrolase mutant is prepared. E. coli / Rpeh M A substrate solution containing a racemic tebuconazole epoxy intermediate is added, and the reaction is carried out at a constant temperature and shaken. After the reaction is completed, an organic solvent extractant is added, shaken thoroughly, and the supernatant (extracted (R) -tebuconazole epoxy intermediate) is collected. R The (R) -tebuconazole epoxy intermediate is obtained after the reaction, and the (S) -diol is left in the water phase, achieving a separation effect. S The mixture of the prepared (R) -tebuconazole epoxy intermediate and the corresponding (S) -diol is obtained after rotary evaporation. R S
[0006] In an embodiment of the present application, the epoxy hydrolase mutant Rp EH M is a mutant gene constructed using the gene of Parodiomyces rubiginosus epoxy hydrolase (GenBank accession number MK748445) as a template.
[0007] In an embodiment of the present application, the recombinant epoxy hydrolase mutant Rp EH M is obtained by inducing culture in an expression host bacterium of the pET series of plasmids as an expression vector in Escherichia coli E. coli such as Escherichia coli E. coli BL21, E. coli TOP10, and preferably E. coli BL21. E. coli / Rpeh M .
[0008] In an embodiment of the present application, the induction expression condition is 0.05~1 mM IPTG inducer in LB liquid medium at 16~28℃ for 8~12h to induce the expression of the epoxy hydrolase mutant. Rp EH M .
[0009] In an embodiment of the present application, the concentration of the recombinant bacterium in the reaction system is 10~200 mg / mL.
[0010] In one embodiment of the present application, the pH of the reaction system is 6.5-9.0. In one embodiment of the present application, the reaction temperature is 20-45°C, further preferably 20-40°C, and more preferably 20-30°C.
[0011] In one embodiment of the present application, the concentration of the solution of the racemic tebuconazole epoxide intermediate substrate in the reaction system is 100-500 mM, and the ratio of the amount of the substrate to the recombinant bacteria E. coli / Rpeh M is 2:1-10:1 (w / w).
[0012] In one embodiment of the present application, the extractant is one or a mixture of several reagents selected from the group consisting of cyclohexane, n-hexane, n-heptane, n-octane, iso-octane, and petroleum ether with a boiling range of 60-90°C.
[0013] The present application also provides a gene encoding the above-mentioned epoxide hydrolase mutant. The epoxide hydrolase mutant is a mutant in which isoleucine I at position 194 of the amino acid sequence shown in SEQ ID NO. 1 is mutated to aspartic acid D.
[0014] The present application also provides a recombinant bacteria comprising the gene of the above-mentioned epoxide hydrolase mutant.
[0015] The present application also provides a recombinant bacteria E. coli / Rpeh M for use in the preparation of chiral epoxide intermediate products.
[0016] The present application also provides the use of the above-mentioned method in the field of chiral pesticides, chiral drugs, and the like.
[0017] The present application has the following beneficial effects: The present application uses a recombinant bacteria E. coli / Rpeh M for asymmetric resolution of high-concentration racemic tebuconazole to prepare R tebuconazole epoxide intermediate. The method disclosed in the present application provides a new method for green and efficient preparation of R tebuconazole epoxide intermediate. Compared with the expensive chiral chromatographic separation method, the method disclosed in the present application has the advantages of environmentally friendly preparation conditions, simple process flow, low production cost, and high application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 pH effect on the enzyme activity and stability of the recombinant bacteria E. coli / Rpeh M
[0019] Figure 2 temperature effect on the enzyme activity and stability of the recombinant bacteria E. coli / Rpeh M Effects on enzyme activity and stability
[0020] Figure 3 Recombinant bacteria E. coli / Rpeh M Reaction progress of resolving high concentration racemic tebuconazole epoxy intermediate. DETAILED DESCRIPTION
[0021] Chiral gas chromatography conditions: 7820B Agilent gas chromatograph, flame ionization detector, injection port and detection port temperature of 250℃, from 100℃ to 220℃ at 5℃ / min program, isothermal 2 min; chiral gas chromatography column CYCLOSIL-B (30 m x 0.25 mm x 0.25 μm. R Retention time of (-) and (+) tebuconazole epoxy intermediate is 20.835 and 20.920 min, respectively. S
[0022] Reversed phase HPLC chromatography conditions: 1260 Infinity II Agilent high performance liquid chromatograph, ProntoSIL C18 column (150 x 4.6mm), detection column temperature is 30℃, mobile phase flow rate is 0.8 mL / min, mobile phase is methanol: water = 90:10, ultraviolet detector at 220 nm monitoring, retention time of tebuconazole epoxy intermediate and corresponding vicinal diol is 3.115 and 5.162 min, respectively.
[0023] Rp EH M Construction and induced expression of
[0024] pET28a- Rpeh Mutant primer I194D-F: GG TGACTGGGGGTCTGATACGGCGCGCTGCCTA, using whole plasmid PCR method to construct mutant recombinant plasmid, after PCR product was digested by Dpn I enzyme, transformed E. coli Bl 21 competent cells, coated Kna resistant plate to screen positive clones, pick single colony sequencing correct recombinant bacteria as E. coli / Rpeh M .
[0025] Genetically engineered bacteria are E. coli / Rpeh M , inoculated into LB liquid medium containing 0.1 g / L kanamycin, 37°C, 220 rpm shaking culture for 12 h, then the culture was inoculated into fresh LB medium containing 0.1 g / L kanamycin at 2% inoculation amount, 37°C, 220 rpm shaking culture for 3 h, then 0.2 mM IPTG was added, 25°C, 220 rpm shaking culture for 8 h, and the bacterial cells were collected by centrifugation. The obtained bacterial cells were resuspended in deionized water to prepare a bacterial suspension to 50 and 200 mg / mL wet bacterial cells.
[0026] E. coli / Rpeh M Method for determining specific activity of catalyzing rac- tebuconazole epoxy intermediate
[0027] In a 1.5 mL EP tube, 50 μL of 50 mg / mL E. coli / Rpeh M bacterial suspension (to a final concentration of 5 mg / mL wet bacterial cells in the system) and 400 μL of potassium phosphate buffer (100 mM, pH = 7.0) were preheated at 25°C for 5 min; 50 μL of 200 mM rac- tebuconazole epoxy intermediate (to a final concentration of 20 mM) was added, and after 10 min of reaction, 100 μL was added to 900 μL of methanol, mixed well, and passed through a 0.22 μm organic membrane for reverse phase HPLC chromatographic analysis. The enzyme activity unit was defined: the amount of wet bacterial cells required to consume 1 μmol of tebuconazole epoxy intermediate per minute under the above determination conditions was defined as 1 epoxy hydrolase activity unit (U). Under the above conditions, the specific activity of the recombinant bacteria E. coli / Rpeh M was 50.6 U / g wet bacterial cells.
[0028] E. coli / Rpeh M Optimum pH and pH stability of catalyzing rac- tebuconazole epoxy intermediate
[0029] Optimum pH determination: 50 μL of 200 mM substrate tebuconazole epoxy intermediate (to a final concentration of 5 mg / mL wet bacterial cells) was added to 450 μL of potassium phosphate buffer with different pH values (100 mM, pH 5.5~9.0), and preheated at 25°C for 5 min; 50 μL of bacterial suspension incubated at different pH values was added, and after 10 min of reaction, 100 μL was added to 900 μL of methanol, mixed well, and passed through a 0.22 μm organic membrane for reverse phase HPLC chromatographic analysis to determine the specific activity of the recombinant bacteria E. coli / Rpeh M . E. coli / Rpeh M
[0030] pH stability determination: 100 μL of 50 mg / mLE. coli / Rpeh M The bacterial suspension was incubated in different pH (20 mM, pH 5.5~9.0) potassium phosphate buffer for 1 h; 50 μL of the bacterial suspension incubated at different pH was immediately taken and added to 900 μL methanol, mixed well, and filtered through a 0.22 μm organic membrane for reverse phase HPLC chromatographic analysis to determine the residual specific activity of the recombinant bacteria E. coli / Rpeh M The bacterial suspension was added to 450 μL of potassium phosphate buffer (100 mM, pH=7.5) and preheated at 25°C for 5 min; 50 μL of 200 mM substrate tebuconazole epoxy intermediate (to a final concentration of 5 mg / mL wet bacteria) was added, and after 10 min of reaction, 100 μL was added to 900 μL methanol, mixed well, and filtered through a 0.22 μm organic membrane for reverse phase HPLC chromatographic analysis to determine the residual specific activity of the recombinant bacteria E. coli / Rpeh M The specific activity of the recombinant bacteria E. coli / Rpeh M was defined as 100% to calculate the relative enzyme activity.
[0031] The results showed that the recombinant bacteria E. coli / Rpeh M had an optimal reaction pH of 7.5 and maintained high catalytic activity in a neutral pH environment (pH 7.0~8.5) with a relative enzyme activity of more than 80%, and the enzyme activity rapidly decreased when the pH was <6.0. Under the optimal pH 7.5 and reaction temperature of 25°C, the specific activity of the recombinant bacteria E. coli / Rpeh M was 60 U / g wet bacteria. The recombinant bacteria E. coli / Rpeh E. coli / Rpeh M had high pH stability at pH 7.0~8.0 with a residual relative enzyme activity of more than 98%. The above results showed that: E. coli / Rpeh EH M had high catalytic activity and stability in a neutral pH range ( E. coli / Rpeh ).
[0032] E. coli / Rpeh M Optimal temperature and temperature stability of the recombinant bacteria
[0033] Optimal reaction stability determination: 50 μL of 200 mM racemic tebuconazole epoxy intermediate (to a final concentration of 20 mM) and 450 μL of potassium phosphate buffer (100 mM, pH=7.0) were added to a 1.5 mL EP tube, and preheated at 20~50°C for 5 min; 50 μL of the recombinant bacteria E. coli / Rpeh MThe bacterial suspension (to a final concentration of 5 mg / mL wet bacteria) was reacted at different temperatures of 20-50 °C for 10 min, 100 μL of which was added to 900 μL of methanol, mixed, and filtered through a 0.22 μm organic membrane for reverse-phase HPLC chromatographic analysis to determine the relative enzyme activity of the recombinant bacteria E. coli / Rpeh M Initial reaction rate.
[0034] Temperature stability determination: 100 μL of 50 mg / mL E. coli / Rpeh M The bacterial suspension was incubated at 20-50 °C for 1 h, and then cooled in an ice bath; 50 μL of the bacterial suspension incubated at different temperatures was added to 450 μL of a potassium phosphate buffer (100 mM, pH = 7.0) in an EP tube, and the mixture was incubated at 25 °C for 5 min; 50 μL of a 200 mM racemic tebuconazole epoxy intermediate (to a final concentration of 20 mM) was added, and the mixture was reacted for 10 min; 100 μL of the mixture was added to 900 μL of methanol, mixed, and filtered through a 0.22 μm organic membrane for reverse-phase HPLC chromatographic analysis to determine the relative enzyme activity of the recombinant bacteria after incubation E. coli / Rpeh E. coli / Rpeh M The bacterial suspension (to a final concentration of 5 mg / mL wet bacteria) and 450 μL of a potassium phosphate buffer (100 mM, pH = 7.0) were preheated at 25 °C for 5 min; 50 μL of a 200 mM racemic tebuconazole epoxy intermediate (to a final concentration of 20 mM) was added, and the mixture was reacted for 10 min; 100 μL of the mixture was added to 900 μL of methanol, mixed, and filtered through a 0.22 μm organic membrane for reverse-phase HPLC chromatographic analysis to determine the relative enzyme activity of the recombinant bacteria after incubation E. coli / Rpeh M Residual specific activity, the specific activity of the untreated E. coli / Rpeh M The specific activity of the bacterial suspension was defined as 100% relative enzyme activity.
[0035] The results showed that the recombinant bacteria E. coli / Rpeh M The optimal reaction temperature was 35 °C, and the recombinant bacteria had high catalytic activity at 25-30 °C, with a relative enzyme activity of more than 80%; under the optimal temperature of 35 °C and the optimal pH of 7.5, the recombinant bacteria E. coli / Rpeh M The specific activity of the bacterial suspension was 86.7 U / g wet bacteria, which was 71% higher than the initial 50.6 U / g wet bacteria. The recombinant bacteria E. coli / Rpeh E. coli / Rpeh M The recombinant bacteria had high thermal stability below 30 °C, with a residual relative enzyme activity of more than 98%, but the residual relative enzyme activity was only 61% after incubation at 35 °C for 1 h. The above results showed that although the recombinant bacteria E. coli / Rpeh M The optimal temperature was 35 °C, but the stability was low. Therefore, 30 °C was selected as the optimal reaction temperature in the subsequent catalytic reaction E. coli / Rpeh ).
[0036] E. coli / Rpeh MResolution of 20 mM racemic tebuconazole epoxide intermediate
[0037] In 2 mL reaction system, containing 20 mM racemic tebuconazole epoxide intermediate and 200 μL of appropriate 100 mg / mL E. coli / Rpeh M Recombinant bacteria (to a final concentration of 10 mg / mL) and 1.6 mL of potassium phosphate buffer (100 mM, pH 7.5), and respectively at 10°C, 20°C, 25°C and 30°C, the reaction was oscillated for 3-6 h, 100 μL was taken at a fixed time and added into 800 μL of ethyl acetate to remove, dried through 0.22 μm organic membrane, and chiral gas chromatography analysis was carried out.
[0038] The results showed that: recombinant bacteria E. coli / Rpeh M Catalyze S )-tebuconazole epoxide intermediate preferentially hydrolyzed to S )-diol, and R )-tebuconazole epoxide intermediate was retained. The conversion time was 6 h, 5 h, 3 h and 3 h at 10°C, 20°C, 25°C and 30°C respectively; the enantiomeric excess of R )-tebuconazole epoxide intermediate was retained E. coli / Rpeh The values were 44.1%, 83.8%, 85.9% and 93.4% respectively; the yield of R )-tebuconazole epoxide intermediate was 16.2%, 42.8% and 45.2% respectively. Therefore, the recombinant bacteria E. coli / Rpeh M Resolution of 20 mM racemic tebuconazole epoxide intermediate at 30°C to prepare R )-tebuconazole epoxide intermediate E. coli / Rpeh The value was 93.4% and the yield was 45.2%, and the enantiomeric purity was improved from 82.6.4% E. coli / Rpeh of the wild-type recombinant bacteria to 93.4%. E. coli / Rpeh
[0039] E. coli / Rpeh M Catalyze racemic tebuconazole epoxide intermediate
[0040] In 500 μL of reaction system, containing 50-250 mg / mL of recombinant bacteria E. coli / Rpeh M and different concentrations of racemic tebuconazole epoxide intermediate (100-500 mM), wherein the weight ratio of racemic tebuconazole epoxide intermediate to recombinant bacteria wet bacteria is 2:1 (concentration mM, mass mg / mL), under the condition of 30℃ and 1000 rpm shaking constant temperature metal bath for 12 h, 50 μL is taken and added into 1 mL ethyl acetate for extraction, dried through 0.22 μm organic membrane, and chiral gas chromatography analysis is carried out. The results show that, under the initial substrate concentrations of 100 mM, 200 mM, 300 mM, 400 mM and 500 mM, the retention of (R)-tebuconazole epoxide intermediate is 59.7%, 79.5%, 83.7%, 77.1% and 24.8% respectively, and the recombinant bacteria R )-tebuconazole epoxide intermediate E. coli / Rpeh The retention of (R)-tebuconazole epoxide intermediate is 59.7%, 79.5%, 83.7%, 77.1% and 24.8% respectively, and the recombinant bacteria E. coli / Rpeh M The resolution of 300 mM racemic tebuconazole epoxide intermediate is used to prepare (R)-tebuconazole epoxide intermediate R The retention of (R)-tebuconazole epoxide intermediate is 59.7%, 79.5%, 83.7%, 77.1% and 24.8% respectively, and the recombinant bacteria E. coli / Rpeh The retention of (R)-tebuconazole epoxide intermediate is 59.7%, 79.5%, 83.7%, 77.1% and 24.8% respectively, and the recombinant bacteria
[0041] E. coli / Rpeh M The resolution of 200 mM racemic tebuconazole epoxide intermediate
[0042] In a 1.5 mL reaction system, 300 μL of 50 mg / mL recombinant bacteria is added into 1.2 mL of potassium phosphate buffer (100 mM, pH 7.5) containing 200 mM racemic tebuconazole epoxide intermediate E. coli / Rpeh M , under the condition of 30℃ and 1000 rpm shaking constant temperature metal bath for 12 h. 50 μL of reaction solution is taken and added into 1 mL ethyl acetate for extraction, and the organic phase is dried through 0.22 μm organic membrane, and chiral gas chromatography analysis is carried out. The conversion rate, retention of (R)-tebuconazole epoxide intermediate and yield are calculated, and the reaction progress curve is drawn. The results show that, with the extension of reaction time, the concentration of (R)-tebuconazole epoxide intermediate decreases rapidly, the concentration of (S)-tebuconazole epoxide intermediate decreases slowly, and the retention of (R)-tebuconazole epoxide intermediate increases with time. The conversion rate of recombinant bacteria E. coli / Rpeh S R E. coli / Rpeh The conversion rate of 200 mM racemic tebuconazole epoxide intermediate is 71.7%, and the retention of (R)-tebuconazole epoxide intermediate is 84% and the yield is 28.9% ( E. coli / Rpeh M The conversion rate of 200 mM racemic tebuconazole epoxide intermediate is 71.7%, and the retention of (R)-tebuconazole epoxide intermediate is 84% and the yield is 28.9% ( R E. coli / Rpeh E. coli / Rpeh
[0043] The present application provides a method for preparing (R)-tebuconazole epoxide intermediate by using a mutant of Parodiomyces rhodocarpus epoxide hydrolase E. coli / Rpeh EH M Method for preparing (R)-tebuconazole epoxy intermediate by catalytic hydrolysis kinetics resolution of racemic tebuconazole epoxy intermediate R Method for preparing (R)-tebuconazole epoxy intermediate, E. coli / Rpeh EH M The homology with the green bean epoxy hydrolase and mutant (publication number CN 108517319 A), bacillus megaterium epoxy hydrolase (publication number CN 102242085 A) and other plant bacterial source epoxy hydrolases is only less than 20%, E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpeh E. coli / Rpe EH M With higher enantioselectivity, high catalytic activity and high substrate tolerance, it has important application value for the industrial preparation of (R)-tebuconazole epoxy intermediate. R (R)-tebuconazole epoxy intermediate
[0044] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, which all belong to the scope of protection required by the present application.
Claims
1. An epoxide hydrolase mutant, characterized in that, The amino acid sequence of the said epoxy hydrolase mutant is shown as SEQ ID NO.
2.
2. A gene encoding the epoxy hydrolase mutant as claimed in claim 1.
3. A recombinant bacterium E. coli / Rpeh M Whole cells characterized in that: expressing the epoxy hydrolase mutant as claimed in claim 1.
4. A method for producing the epoxide hydrolase mutant according to claim 1, characterized by: The isoleucine at position 194 of the amino acid sequence of the epoxy hydrolase from Rhodopseudomonas palustris shown as SEQ ID NO. 1 is mutated to aspartic acid.
Citation Information
Patent Citations
Epoxide hydrolase mutant and application thereof in enantiomeric normalizing hydrolysis of epoxides
CN108517319A
Epoxy hydrolase, gene thereof and application thereof
CN102242085A
Method for preparing (R)-phenylglycol (PED) from racemic styrene oxide (rac-SO) under catalytic actions of double enzymes
CN106244637A