An experimental puppy food and its preparation method

By adding inactivated probiotics and Eucommia ulmoides leaf extract to the experimental puppy food, and optimizing the nutritional composition and preparation process, the problem of high diarrhea rate in experimental puppies was solved, and the intestinal health and immunity were improved, meeting the standards for experimental animal feed.

CN117179177BActive Publication Date: 2026-05-26XIETONG BIO-ENG (YANGZHOU) CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIETONG BIO-ENG (YANGZHOU) CO LTD
Filing Date
2023-10-25
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The experimental puppies had a high rate of diarrhea. Existing technologies for antibiotic treatment have problems such as decreased immunity and drug resistance. The addition of probiotics carries the risk of exceeding the total bacterial count limit. Traditional Chinese medicine has no significant preventive effect and cannot meet the drug addition restrictions in experimental animal feed. Furthermore, there is a lack of effective methods to prevent and improve intestinal health.

Method used

Using inactivated probiotics and plant extracts, the nutritional composition and preparation process of puppy food are optimized. Probiotics such as Peptococcus lactis and Eucommia ulmoides leaf extract are added, combined with puffing and vacuum spraying of goat milk powder to optimize the hardness and nutrient retention of the dog food. Nitrogen packaging is used to maintain freshness.

Benefits of technology

It reduced the diarrhea rate in puppies, improved immune function and intestinal microecological balance, met the standards for laboratory animal feed, improved nutrient digestibility and palatability, and reduced stress response during feeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004512411850000081
    Figure BDA0004512411850000081
  • Figure BDA0004512411850000091
    Figure BDA0004512411850000091
  • Figure BDA0004512411850000111
    Figure BDA0004512411850000111
Patent Text Reader

Abstract

This invention relates to an experimental puppy food, comprising: 10-30 parts puffed corn, 1-5 parts puffed soybean meal, 15-30 parts puffed rice flour, 25-40 parts chicken meal, 3-10 parts olive oil, 3-10 parts duck fat, 0.5-1 part limestone powder, 0.02-0.05 parts choline chloride, 0.1-0.3 parts sodium chloride, 1-4 parts chicken liver powder, 4-8 parts beef flavoring agent, 4-8 parts milk powder, and 3-4 parts multivitamin and mineral premix; it also includes inactivated probiotics, with 1-6g of inactivated probiotics added per kg of puppy food, the inactivated probiotics including Pediococcus lactis CGMCC No. 23551; and it also includes Eucommia ulmoides leaf extract, with 4-12g of Eucommia ulmoides leaf extract added per kg of puppy food. The experimental puppy food mentioned above was fortified with inactivated probiotics and plant extracts to improve the intestinal microecological balance of the experimental dogs, increase the digestibility and utilization of the dog food, and enhance the stress resistance of the puppies. The prepared dog food has low hardness, making it easy for puppies to eat during the weaning transition period and reducing stress. The milk powder uses an external spray coating process to enhance the immune function of the experimental puppies, and nitrogen packaging helps to preserve the feed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of laboratory animal feed technology, and in particular to a laboratory puppy diet and its preparation method, which is used to reduce the diarrhea rate in puppies. Background Technology

[0002] Among laboratory animals, larger animals such as laboratory dogs and cats have a higher rate of diarrhea compared to laboratory mice. Therefore, in addition to providing basic nutrition, laboratory dog ​​feed also needs to reduce or even eliminate diarrhea. However, due to differences in animal habits (e.g., cats are carnivorous, while dogs are omnivorous with a preference for meat) and nutritional requirements (protein, fat, fiber, calcium, phosphorus, etc.), there are significant differences in the composition and nutritional indicators of various feed ingredients.

[0003] Weaning diarrhea is a common clinical symptom in experimental dogs, with a high incidence rate. Severe cases can even affect the dog's growth, development, and subsequent experimental results. Its causes are numerous and difficult to diagnose and treat, including viruses, bacteria, parasites, maternal factors, stress, food poisoning, and nutritional deficiencies. Studies have shown that diarrhea caused by different etiologies has the same impact on the canine gut microbiota. Currently, the prevention and treatment of puppy diarrhea mainly involve the following approaches: 1) Antibiotics: Antibiotics are widely used to treat various diseases due to their rapid effectiveness. However, excessive use of antibiotics can lower the animal's immunity, easily disrupt the balance of the intestinal microecology, and long-term use can lead to drug resistance, which is very detrimental to future disease control. 2) Probiotics: Diarrhea and gut microbiota imbalance are interrelated. Most cases of canine diarrhea are caused by changes in the feeding environment and dog food, leading to an imbalance in the gut microbiota. Currently, four types of probiotics are widely used in animal husbandry: lactic acid bacteria (such as Lactobacillus reuteri, Lactobacillus acidophilus, Bifidobacterium, etc.), Bacillus (such as Enterococcus faecalis, Bacillus cereus, Bacillus licheniformis, etc.), yeasts (such as Saccharomyces cerevisiae, Saccharomyces petroleum jelly, etc.), and photosynthetic bacteria. 3) Traditional Chinese medicine prevention and treatment: Traditional Chinese medicine has the advantages of no drug residues, low risk of drug resistance, safety, and wide availability, making it one of the superior alternatives to antibiotics. The above treatment measures are feasible in experimental dog breeding bases, but prevention is worse than treatment. Alleviating stress through dog food and improving gastrointestinal health helps reduce weaning diarrhea in puppies, ensuring stable physical condition, and facilitating subsequent experiments on the experimental dogs.

[0004] The laboratory animal feed standard GB14924 stipulates that antibiotics, anthelmintics, preservatives, pigments, growth promoters, hormones, and other drugs and additives must not be added to laboratory animal feed, and it also has specific requirements for the total bacterial count of the product (≤5×10⁻⁶). 4(CFU / g). Based on the above requirements, adding live probiotics to experimental puppy food is not feasible, as it would increase the bacterial count in the food. Long-term use of medications for prevention in dog food is also impractical. For these reasons, treatment methods for diarrhea in experimental puppies are relatively fewer than for pet dogs, focusing more on maintaining the animals' overall health and stability. Therefore, a better approach is to reduce stress through dog food, improve the intestinal health and immune function of experimental puppies, reduce the incidence of diarrhea, and ensure stable physical condition in the later stages of experimentation. Therefore, there is an urgent need to develop a nutritionally complete experimental puppy food that can reduce the diarrhea rate. Summary of the Invention

[0005] To overcome at least one problem existing in the prior art, the present invention provides an experimental puppy food and its preparation method. This method optimizes the form and hardness of the puppy food, selectively adds inactivated probiotics and plant extracts to enhance immunity, and vacuum-coates raw materials such as goat milk powder to reduce the loss of internal vitamins and easily retain their nutritional components. Furthermore, the process of soaking the experimental dogs in goat milk, among other steps, improves the health of the puppies, increases the digestibility of the diet, and reduces the rate of diarrhea during feeding, facilitating subsequent experiments on the experimental dogs.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first objective of this invention is to provide an experimental puppy food, comprising, by weight: 10-30 parts puffed corn, 1-5 parts puffed soybean meal, 15-30 parts puffed rice flour, 25-40 parts chicken meal, 3-10 parts olive oil, 3-10 parts duck fat, 0.5-1 part limestone powder, 0.02-0.05 parts choline chloride, 0.1-0.3 parts sodium chloride, 1-4 parts chicken liver powder, 4-8 parts beef flavoring agent, 4-8 parts milk powder, and 3-4 parts multivitamin and mineral premix; wherein, the experimental puppy food further comprises inactivated probiotics, with 1-6g of inactivated probiotics added per kg of experimental puppy food.

[0008] Further, by weight, the experimental puppy food comprises: 12-20 parts puffed corn, 2-4 parts puffed soybean meal, 18-25 parts puffed rice flour, 25-32 parts chicken meal, 4-8 parts olive oil, 4-8 parts duck fat, 0.6-0.8 parts limestone powder, 0.04-0.05 parts choline chloride, 0.2-0.3 parts sodium chloride, 2-3 parts chicken liver powder, 4-6 parts beef flavoring agent, 4-6 parts milk powder, and 3-4 parts multivitamin and mineral premix; 2-4g (preferably 3g) of inactivated probiotics are added per kg of experimental puppy food.

[0009] Furthermore, the inactivated probiotics include Pediococcus acidilactici, which is COST, classified as Pediococcus acidilactici, with accession number CGMCC No. 23551, accession date of October 9, 2021, and deposited at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0010] Furthermore, the inactivated probiotics may also be a compound probiotic agent composed of Pediococcus lactis and other probiotics, such as Lactobacillus reuteri, Enterococcus faecalis, and Lactobacillus plantarum. Specifically, the inactivated probiotics are composed of Pediococcus lactis, Lactobacillus reuteri, Enterococcus faecalis, and Lactobacillus plantarum, wherein the preferred Lactobacillus reuteri, Enterococcus faecalis, and Lactobacillus plantarum are: Lactobacillus reuteri (trade number: CICC 6226), Enterococcus faecalis (trade number: CICC20419), and Lactobacillus plantarum (trade number: CICC 6009).

[0011] Further, the content ratio of *Pediococcus lactis*, *Lactobacillus reuteri*, *Enterococcus faecalis*, and *Lactobacillus plantarum* is 50-200:30-80:2-5:1-3. Preferably, the content ratio is 150-200:40-60:2-4:1-2. More preferably, the content ratio is 200:50:3:2. Specifically, the content of *Pediococcus lactis* is 2.0 × 10⁻⁶. 10 CFU / g, Lactobacillus reuteri content is 5.0×10 9 CFU / g, Enterococcus faecalis content was 3.0×10 8 CFU / g, Lactobacillus plantarum content is 2.0×10 8 CFU / g.

[0012] Furthermore, the experimental puppy food also includes plant extracts, specifically Eucommia ulmoides leaf extract; 4-12g of plant extract, preferably 6-10g, and more preferably 8g, are added per kg of experimental puppy food.

[0013] Furthermore, the Eucommia ulmoides leaf extract is a water-extracted and alcohol-extracted product, specifically as follows: fresh Eucommia ulmoides leaves are washed, crushed, boiled in water, and the water is filtered out to obtain the first filtrate; water is added again to boil to obtain the second filtrate; ethanol is added to suspend the extract, and the mixture is stirred and filtered to obtain the third filtrate; the three filtrates are mixed, concentrated, refrigerated, centrifuged to form a paste, dried under reduced pressure, and pulverized into powder.

[0014] Furthermore, the multivitamin and mineral premix consists of 1% compound vitamin premix, 1.5% compound trace element premix, 1% lysine, 2% taurine, 5% methionine, and carrier powder. It mainly contains VE 1200-1800 IU / kg, VB1 300-420 mg / kg, VB2 200-300 mg / kg, niacin 1000-1500 mg / kg, biotin 2-6 mg / kg, folic acid 30-60 mg / kg, choline 300-600 mg / kg, VB6 100-300 mg / kg, and VB... 12 500-700 mg / kg, VA 200000-400000 IU / kg, VD 60000-80000 IU / kg, iron 1.5-3.0 g / kg, copper 25-50 mg / kg, manganese 500-800 mg / kg, zinc 800-1200 mg / kg, selenium 0.8-2.0 mg / kg. It is understood that other premixes conventionally used in this field can be used for the multi-dimensional and multi-mineral premix.

[0015] In one specific embodiment, the experimental puppy food comprises: 15 parts puffed corn, 3 parts puffed soybean meal, 20.55 parts puffed rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix; wherein, 3g of inactivated probiotics (Pediococcus lactis) are added to each kg of experimental puppy food.

[0016] In one specific embodiment, the experimental puppy food comprises: 15 parts puffed corn, 3 parts puffed soybean meal, 20.55 parts puffed rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix; wherein, 8g of Eucommia ulmoides leaf extract and 3g of inactivated probiotics (Pediococcus lactis) are added per kg of experimental puppy food.

[0017] In one specific embodiment, the experimental puppy food comprises: 15 parts puffed corn, 3 parts puffed soybean meal, 20.55 parts puffed rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix; wherein, 8g of Eucommia ulmoides leaf extract and 3g of inactivated probiotics (composed of Pediococcus lactis, Lactobacillus reuteri, Enterococcus faecalis, and Lactobacillus plantarum in a ratio of 200:50:3:2) are added per kg of experimental puppy food.

[0018] A second aspect of the present invention is to provide a method for preparing experimental puppy food according to any of the first aspects of the present invention, comprising the steps of:

[0019] S1) The predetermined weight proportions of corn, soybean meal, and rice are sequentially mixed, crushed, pre-ripened, and crushed a second time to obtain the first mixture;

[0020] S2) The first mixture is mixed a second time with a predetermined weight of chicken powder, stone powder, sodium chloride, choline chloride, multivitamin and mineral premix, and inactivated probiotics to obtain a second mixture. If plant extracts are contained, they are also added in this step.

[0021] S3) The second mixture is conditioned, and a predetermined weight of duck fat and olive oil is added during the conditioning process. The mixture is then puffed, granulated, and dried to obtain the third mixture.

[0022] S4) Spray the third mixture with a predetermined weight proportion of goat milk powder and beef flavoring agent to obtain the experimental puppy food.

[0023] Further, step S3 specifically includes: conditioning the second mixture at 130°C and 0.5 MPa steam, and adding a mixture of duck fat and olive oil during the conditioning process; after the material temperature reaches 92°C, puffing and pelleting are performed with a ring die hole diameter of 7 mm; after forming, the pellets are dried at 120°C for 10 minutes and then at 60°C for 10 minutes. The added oil is to reduce the hardness of the dog food, eliminating the need to soak the dog food before feeding it to puppies.

[0024] Furthermore, the dog food is packaged with nitrogen after cooling following the spraying process.

[0025] A third aspect of the present invention is the application of any of the experimental puppy foods described in the first aspect of the present invention or any of the preparation methods described in the second aspect of the present invention in reducing the diarrhea rate in experimental puppies.

[0026] Furthermore, in the above applications, the experimental dogs were fed twice a day, with the amount being 2.5%-3.5% of the dog's body weight.

[0027] Compared with the prior art, the present invention, by adopting the above technical solution, has the following beneficial effects:

[0028] The experimental puppy food prepared by this invention meets GB14924.1 and GB14924.2. Through optimization of feed nutritional composition and preparation process, it reduces weaning stress in experimental puppies, improves their immune function and intestinal microecological balance, reduces the incidence of diarrhea in experimental puppies during feeding, and ensures the stability of the experimental puppies' physical condition.

[0029] This invention incorporates inactivated probiotics (single or compound) into puppy food, offering the following advantages: 1) High safety: Extensive use of live probiotics may cause bacterial infections, harmful metabolites, and hypersensitivity reactions. In contrast, inactivated probiotics, due to their loss of activity, are in a more stable state and will not grow or multiply within the host, thus offering higher safety. 2) High stability: Live probiotics have strict requirements for storage, transportation, and shelf life. Currently, most live probiotics on the market require low-temperature (4°C) transportation and storage, with a shelf life of only a few days to a dozen days. Furthermore, once in the digestive tract, they are easily affected by stomach acid, bile, and digestive enzymes, preventing them from reaching the intestines to exert their effects. In contrast, inactivated probiotic products do not have these requirements. 3) Convenience: Live bacteria preparations typically require a certain number of live bacteria to achieve therapeutic effects, compensating for the consumption of live bacteria during passage through the gastrointestinal tract and providing sufficient live cells to colonize the host's intestines. However, excessive addition may cause some adverse reactions, so the amount of live probiotic preparations is difficult to control. In contrast, there is no limit to the number of bacteria in inactivated probiotic preparations during use.

[0030] This invention incorporates plant extracts—Eucommia ulmoides leaf extract—into the experimental puppy food. Eucommia ulmoides leaf extract possesses certain antioxidant capacity, immunomodulatory capacity, broad-spectrum antibacterial effect, free radical scavenging, and immunity-enhancing effects, which can alleviate and resolve animal diarrhea caused by stress and decreased resistance to a certain extent.

[0031] This invention uses extruded raw materials to pre-cook grains such as corn, soybean meal, and rice, reducing anti-nutritional factors and improving nutrient absorption. Specifically: 1) High digestibility: The extrusion process pre-treats the raw materials, breaking down and softening the cell walls in the fiber structure, increasing starch gelatinization, and improving feed digestibility; 2) Low total bacterial count: Harmful bacteria such as Salmonella and Escherichia coli generated during the extrusion process are killed, and the total bacterial count of the raw materials themselves is reduced, significantly improving the hygiene indicators of dog food; 3) Good extrusion degree: Using extruded raw materials further improves the extrusion degree of dog food, improves crispness, and enhances palatability.

[0032] This invention produces puppy food with low hardness, facilitating the transition of puppies to solid foods. It employs an internal oil (duck fat and olive oil) process to reduce the hardness of the puppy food and prevent the internal oil from sticking together in the mixer. By internalizing all the oils, the hardness of the puppy food is reduced, and it can be crushed with slight force, facilitating the transition from liquid to solid during weaning and reducing stress during food change. In terms of process equipment, the die holes on the mold are staggered to prevent sticking during discharge, and a dehumidification device is installed at the discharge port of the extruder to the drying oven section to extend the shelf life of the puppy food.

[0033] This invention involves spraying goat milk powder onto the dried material. The milk powder provides nutrition and alleviates the stress of weaning puppies. At the same time, the external spraying of milk powder can also prevent the milk powder from deteriorating under high temperature and high pressure, which would affect nutrient absorption. The above measures can avoid the loss of nutrients and easy deterioration of milk powder under high temperature and high pressure. Through vacuum negative pressure spraying, some goat milk powder can be absorbed into the dog food, and some can stick to the surface, increasing the aroma and palatability.

[0034] The puppy food of this invention uses nitrogen packaging, which effectively prevents the dog food from being squeezed and deformed, maintains the freshness of the dog food, and improves palatability; nitrogen packaging has a certain preservation and anti-squeezing effect, and due to the low hardness of the puppy food, it prevents it from being squeezed and deformed during transportation and storage.

[0035] The experimental puppy food described in this invention uses nutritionally complete and balanced raw materials that are highly safe and easily digestible and absorbable. In particular, it contains inactivated probiotics and plant extracts, which improve the intestinal microecological balance of the experimental dogs, increase the digestibility and utilization rate of the dog food, and enhance the stress resistance of the puppies. At the same time, the dog food has low hardness, making it easy for puppies to eat during the weaning transition period, avoiding a direct transition from liquid to solid and reducing stress. In addition, the milk powder coating process reduces the step of soaking the dog food in goat milk for the production company, reducing labor input, enhancing the immune function of the experimental puppies, maintaining the health of the experimental dogs, and nitrogen packaging helps to preserve the feed and extend its shelf life. Detailed Implementation

[0036] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0037] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to specific embodiments, but this is not intended to limit the scope of the invention.

[0038] Example 1 - Isolation, Identification and Properties of Pediococcus lactis

[0039] In this embodiment, a strain of *Pediococcus lactis* was isolated from canine feces. The isolation and identification steps included:

[0040] I. Isolation of bacterial strains

[0041] (1) The test method for fecal samples is based on Bergey's Manual of Bacteriological Identification (9th Edition). The specific operation method is as follows: Weigh 0.5g of fecal sample and mix it evenly with 5mL of sterile physiological saline. Use a vortex mixer to mix thoroughly. Take 1mL of the mixture and serially dilute it tenfold in a sterile EP tube. Take 100μL of each of the 10 dilution gradients. 4 10 5 10 6 (2) Collect 5 mL of water from the bottom of the fish tank, mix thoroughly, and then directly take 100 μL and spread it evenly on the surface of the MRS agar plate. (3) Wash the surface of the collected handmade pickled vegetables with 10 mL of sterile physiological saline, retain the saline solution after washing, mix thoroughly, and then serially dilute it tenfold. Take 100 μL of the dilution gradient. 4 (4) Dilute 1 drop of handmade yogurt with 1 mL of sterile saline, mix thoroughly, and then dilute 10 times three times. Take 100 μL of each of the different dilution gradients and spread them evenly on the surface of the MRS agar plate.

[0042] After incubating the MRS medium coated above at 37°C for 48 hours, single colonies of different shapes and sizes were picked and inoculated into 10 mL of MRS broth medium and labeled. After incubating at 37°C for 24 hours, a sterile inoculating loop was used to dab the bacterial solution onto an MRS agar plate for purification. The above steps were repeated three times to obtain the purified strain.

[0043] II. Identification of Strains

[0044] The bacterial strain was inoculated at 4% in MRS broth medium and incubated at 37°C for 24 h. After vortexing to mix the bacterial suspension, 1 mL of the suspension was transferred to an EP tube and centrifuged at 5000 rpm for 10 min. The supernatant was discarded. This process was repeated three times. DNA was extracted from the isolates according to the instructions of the bacterial DNA extraction kit. The concentration and purity of the extracted samples were measured using NanoDrop, and the samples were stored at -80°C. The obtained isolate DNA was subjected to polymerase chain reaction (PCR) using 16S rDNA universal primers. The PCR reaction system (25 μL) included: 9 μL ddH2O, 12.5 μL 2×HieffRobust PCR Master Mix (WithDye), 1.25 μL forward primer (10 μM), 1.25 μL reverse primer (10 μM), and 1.0 μL bacterial genomic DNA. The PCR cycling parameters were: 94℃ for 4 min; 94℃ for 10 s, 55℃ for 20 s, 72℃ for 30 s, for 34 cycles; 72℃ for 5 min. The primer sequences used were: upstream primer 27F (AGAGTTTGATCCTGGCTCAG) and downstream primer 1492R (GGTTACCTTTGTTACGACTT).

[0045] The DNA amplification products of the isolate were subjected to 1% agarose gel electrophoresis to detect the band size and sample purity. The amplified target fragment was approximately 1500 bp. The isolate was then sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing. The 16S rDNA sequence obtained from the sequencing was compared with relevant sequences in the GenBank database. Multiple alignment was performed using the Blast program, and the isolated strain was identified as Pediococcus lactis COST. The isolate was deposited with the accession number CGMCC No. 23551.

[0046] III. Acid and bile salt resistance, high temperature resistance, antibacterial ability, and antiviral ability.

[0047] Acid and bile salt tolerance tests: Under aseptic conditions, 100 μL of *Pediococcus lactis* COST was inoculated into MRS broth at pH 1.5, 2.0, and 3.5, and into MRS broth containing 0.1%, 1%, 2%, and 3% bile salts, respectively. The initial viable count of *Pediococcus lactis* COST was 1 × 10⁻⁶. 8CFU / mL, incubated at 37℃. Samples were taken at 0h and 2h, spread on plates, and viable bacterial counts were calculated. Results showed that at pH 2 (the pH of canine gastric fluid), the survival rate of *Pediococcus lactis* COST after 2h of incubation was approximately 89%, indicating that this strain of COST has high acid resistance, can tolerate gastric acid, and can successfully reach the intestines to exert its function. The survival rate of *Pediococcus lactis* COST after 2h of treatment in media containing 0.1%, 1%, 2%, and 3% bile salts was approximately 73%, indicating that this strain of COST has high bile salt tolerance, can tolerate bile salts in intestinal fluid, maintains its viability, and can exert its function.

[0048] High-temperature resistance test: 10 mL of *Pediococcus lactis* COST fermentation broth was placed in a test tube and treated in an 85℃ water bath for 30 min. The activity (live bacteria count) before and after treatment was measured, and the survival rate was calculated. The results showed that the survival rate of *Pediococcus lactis* COST reached 85%, indicating strong high-temperature resistance.

[0049] Antibacterial assay: The viable count was 10... 6 CFU / mL Escherichia coli, Bacillus subtilis, Staphylococcus aureus, and Salmonella were inoculated at 10 mL / L and mixed separately with LB agar medium. The medium was then punched using the Oxford cup method, and 10 CFU / mL of Pietrocarpa was collected. 8 CFU / mL 0.0 μL was injected into each well, and after static diffusion at 4℃ for 2 h, it was incubated at 37℃ for 24 h, and the diameter of the inhibition zone was measured. Uninoculated MRS medium was used as a control. The results showed that *Pediococcus lactis* COST had inhibitory effects on *Escherichia coli*, *Bacillus subtilis*, *Staphylococcus aureus*, and *Salmonella* (inhibition zone diameter ≥13 mm), and its inhibitory effect on *Escherichia coli* and *Salmonella* was stronger.

[0050] Antiviral assay: A murine norovirus (MNV) infection system was used. Mouse monocyte / macrophage RAW264.7 cells were placed in DMEM medium containing 10% FBS, counted, and then aliquoted into T25 cell culture flasks. The culture medium was replenished, and RAW264.7 cells (10T) were cultured. 4 ( / well) Inoculate into a culture plate, and add 100 μL of DMEM medium containing 2% FBS to each well of the culture plate. *Pediococcus lactis* COST fermentation broth (10... 8The MNV virus solution (CFU / mL) was mixed with MNV virus solution at a 1:1 volume ratio and incubated at room temperature for a certain period of time. Then, 100 μL of MNV virus solution, 100 μL of MNV virus solution + live Pediococcus lactis COST, and 100 μL of MNV virus solution + inactivated Pediococcus lactis COST were inoculated into culture plates. After cytopathic effects appeared, the cells were observed for 7 days, and cell viability was calculated using the CCK-8 assay. The results showed that compared to the MNV virus solution control group (viability approximately 12%), treatment with inactivated Pediococcus lactis COST increased the survival rate of RAW264.7 cells after MNV infection (approximately 21%), indicating that it has a certain ability to reduce norovirus infectivity. However, its effect was not as good as that of live Pediococcus lactis COST (viability approximately 28%). Considering all factors, compared to live Pediococcus lactis, inactivated probiotics are in a more stable state due to the loss of activity, thus offering higher safety and being more suitable for experimental puppies.

[0051] Example 2 - Preparation of Experimental Puppy Food

[0052] This embodiment describes some preferred experimental puppy foods and their preparation. The composition of each experimental puppy food is shown in the table below:

[0053]

[0054]

[0055] In the aforementioned experimental puppy diet, the multivitamin and mineral premix consisted of 1% compound vitamin premix, 1.5% compound trace element premix, 1% lysine, 2% taurine, 5% methionine, and carrier powder. It mainly contained VE 1600 IU / kg, VB1 380 mg / kg, VB2 230 mg / kg, niacin 1200 mg / kg, biotin 4 mg / kg, folic acid 50 mg / kg, choline 500 mg / kg, VB6 200 mg / kg, and VB... 12 595mg / kg, VA 300000IU / kg, VD 72000IU / kg, iron 2.3g / kg, copper 35mg / kg, manganese 655mg / kg, zinc 1000mg / kg, selenium 1.4mg / kg.

[0056] A preferred preparation process for the above-mentioned experimental puppy food includes the following steps:

[0057] (1) Preparation of inactivated probiotics

[0058] Selection of strains: *Pediococcus lactis* (preservation number CGMCC No. 23551) has certain antibacterial ability against *Escherichia coli*, *Salmonella*, *Shigella*, and *Campylobacter jejuni*, and has good acid and bile salt tolerance and stress resistance; *Lactobacillus reuteri* (trade number: CICC 6226), *Enterococcus faecalis* (trade number: CICC 20419), and *Lactobacillus plantarum* (trade number: CICC6009) all have excellent acid resistance, antibacterial ability, and stress resistance. The above strains are all suitable for preparing inactivated probiotics and adding them to animal feed;

[0059] Preparation of bacterial culture: 3 wt% single colonies of Pediococcus lactis, Enterococcus faecalis, Lactobacillus plantarum, and Lactobacillus reuteri were picked and inoculated into a culture medium containing 2.5% corn starch, 3% soybean meal, and 2% glucose. The culture was carried out at an initial pH of 5.5, a volume of 30 mL, and a temperature of 37 °C. After 12 h of culture, the bacterial concentration was adjusted by the colony plate counting method.

[0060] Preparation of solid probiotics: Bentonite and mannan oligosaccharide were used as drying carriers. The carriers and bacterial suspensions were mixed in a ratio of 2:3 and dried at 50°C for 6 hours to obtain solid probiotic inoculum.

[0061] Preparation of solid-state inactivated probiotics: Solid probiotic agents were inactivated by CO60 irradiation at 45 kGy to obtain solid-state inactivated probiotic agents.

[0062] (2) Preparation of Eucommia ulmoides leaf extract

[0063] The collected fresh Eucommia leaves were washed, crushed, and boiled in 8 times the amount of water for 20 minutes. The water was filtered out to obtain the first filtrate. Then, 4 times the amount of water was added and boiled for 30 minutes. The water was filtered out to obtain the second filtrate. The leaves were suspended in 3 times the amount of ethanol, and the pH was adjusted to 3. The mixture was stirred and filtered. The pH of the filtrate was adjusted to neutral and filtered to obtain the third filtrate. The three filtrates were mixed, concentrated, and refrigerated. The mixture was then centrifuged at 2000 r / min for 35 minutes to obtain a paste. The paste was dried under reduced pressure and pulverized into powder using conventional methods.

[0064] (3) Feed preparation: The production process of experimental dog food mainly consists of raw material receiving and cleaning, coarse crushing, batching, mixing, expansion, secondary crushing, secondary mixing, conditioning, puffing, drying, spraying, cooling, conveying, grading, cleaning, and finished product packaging. The process of crushing first and then batching is adopted.

[0065] Before being received, feed ingredients undergo sampling and quality inspection, ensuring their nutritional content, color, and taste meet acceptance standards and are free from mold. The feed is then lifted to the raw material silo via a bucket elevator. Before entering the silo, it passes through a primary cleaning screen and a permanent magnetic drum to remove impurities such as loose threads, dust, gravel, and iron filings. Understandably, the total feed preparation volume can be adjusted based on the actual equipment capacity, but the weight fraction of each component remains unchanged.

[0066] The automatically weighed corn, soybean meal, and rice are transferred by an elevator to a primary mixer and mixed for 5 minutes. Then, they are transferred to a grinding chamber for further grinding. After grinding, the particle size is 0.7-0.8 mm, resulting in the first mixture. This first mixture is then fed into an extruder for pre-maturation. The extruder has a screw and sleeve. After entering the extrusion chamber, the second mixture is subjected to compression, friction, and shearing between the screw and sleeve, causing the internal pressure to continuously increase, reaching a maximum of 4 MPa, and the temperature to continuously rise, reaching a maximum of 140℃. Within 3-7 minutes, the temperature and pressure rise rapidly, changing the structure of the second mixture, breaking down coarse fibers, and killing harmful bacteria such as Salmonella. The high-temperature, high-pressure mixture exits from the outlet, where the pressure is suddenly released, some moisture is released through flash evaporation, and after cooling, the material has a loose, porous structure. The entire pre-maturation process takes 10 minutes.

[0067] The matured raw materials are then pulverized a second time, and the remaining raw material components—chicken powder compound premix, stone powder, sodium chloride, choline chloride, inactivated probiotics, and Eucommia ulmoides leaf extract—are added. This mixture is then mixed for 2.5 minutes to obtain a second mixture. The second mixture is then tempered at 130℃ and 0.5 MPa steam, with a mixture of duck oil and olive oil added during the tempering process. Once the material temperature reaches 92℃, it is puffed and granulated using a ring die with a 7mm diameter. After forming, it is dried at 120℃ for 10 minutes and then at 60℃ for 10 minutes. It is then sprayed with goat milk powder and beef flavoring agent, cooled, and packaged with nitrogen.

[0068] The probiotic ratio in the experimental puppy food prepared above can be adjusted according to actual conditions. For example, the ratio of *Pediococcus lactis*, *Lactobacillus reuteri*, *Enterococcus faecalis*, and *Lactobacillus plantarum* can be 50–200:30–80:2–5:1–3. Preferably, the *Pediococcus lactis* content in the inactivated probiotics of each puppy food listed in the table above is 2.0 × 10⁻⁶. 10 CFU / g, Lactobacillus reuteri content is 5.0×10 9 CFU / g, Enterococcus faecalis content was 3.0×10 8 CFU / g, Lactobacillus plantarum content is 2.0×10 8 CFU / g.

[0069] Example 3 - Performance Verification of Experimental Puppy Food with Added Inactivated Probiotics

[0070] This embodiment verifies the performance of dog food prepared by adding inactivated probiotics and optimizing the preparation process. Beagles were fed ordinary feed and puppy food 1 and puppy food 1 prepared in Example 2, respectively, serving as the control group and experimental group. During the feeding period, the growth curves, apparent nutrient digestibility, fecal formation, and mental state of the Beagles were evaluated.

[0071] Control group 1 (without Eucommia ulmoides leaf extract and inactivated probiotics, prepared by the method of Example 2): Feed prepared by the method of Example 2 without Eucommia ulmoides leaf extract and inactivated probiotics (15 parts extruded corn, 3 parts extruded soybean meal, 20.55 parts extruded rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix).

[0072] Control group 2 (without Eucommia ulmoides leaf extract, containing inactivated probiotics, prepared by conventional methods): The feed composition is the same as puppy food 1, and the dog food is prepared by conventional methods (containing inactivated probiotics (Pediococcus lactis), without the use of extruded raw materials, external oil coating, and internal sheep milk powder / VB, etc.);

[0073] Experimental group 1 (puppy food 1 prepared in Example 2): feed without Eucommia ulmoides leaf extract and containing inactivated probiotics (Pediococcus lactis);

[0074] Experimental Group 2 (Puppy Food 2 prepared in Example 2): Feed without Eucommia ulmoides leaf extract and containing inactivated probiotics (a compound probiotic agent of four kinds).

[0075] The dry matter, crude protein, crude fiber, crude fat, crude ash, calcium, and phosphorus content of the five dog food groups are basically the same.

[0076] Table 1 - Nutritional Information of Beagle Puppy Food

[0077] project Control group 1 Control group 2 Experimental group 1 Experimental group 2 Dry matter, % 90.0 90.7 91.8 92.8 Crude protein, % 30.8 30.5 30.9 31.0 Crude fiber, % 2.3 2.4 2.4 2.3 Crude fat, % 19.8 20.5 20.6 20.3 Coarse ash content, % 5.2 5.3 5.3 5.2 calcium,% 1.25 1.27 1.28 1.29 phosphorus,% 1.01 0.98 1.03 1.05

[0078] Animal grouping and feeding: This embodiment evaluates the effects of the experimental puppy food and regular feed on the growth and apparent nutrient digestibility of weaned Beagles by feeding them with these two feeds. Twelve Beagles (six males and six females) (initial weight 2.3-2.6 kg) were tested for each feed, one per cage, for a period of two months (2-4 months of age). During this period, the puppies were fed twice a day, once in the morning and once in the afternoon, with the feeding amount adjusted according to 2.5%-3.5% of their visually estimated body weight.

[0079] The methods and main instruments used for testing are as follows: crude protein determination (nitrogen determination method, Kjeldahl nitrogen analyzer); crude fiber determination (drying method, crude fiber analyzer); crude fat determination (drying method, crude fat analyzer). The testing methods are conducted in accordance with the relevant national standards for feed testing. Specifically: the determination of crude protein in feed is based on GB / T6432-1994, and the determination of crude fat in feed is based on GB / T6433-1994.

[0080] 1) Apparent digestibility of feed nutrients (at the end of the experiment, 4 months of age)

[0081] Table 2 - Nutritional digestibility of Beagle puppy food

[0082]

[0083]

[0084] During the two-month trial, compared with the control group 2 of feed prepared by conventional methods, it was observed that puppies found it easier to chew and had a better taste when eating dog food prepared by the optimized process in Example 1 (experimental group 1 and experimental group 2), and their digestibility and utilization were also better. Compared with the dog food control group 1 without sterilized probiotics, the dog food (experimental group 1 and experimental group 2) with added sterilized probiotics and lower hardness was more conducive to the absorption of nutrients, with the feed containing four kinds of probiotic compound agents showing the best effect.

[0085] 2) Stool consistency

[0086] Table 3 - Stool Scoring Criteria

[0087]

[0088] Table 4 - Stool scores of Beagle puppies during the trial period

[0089] project Control group 1 Control group 2 Experimental group 1 Experimental group 2 Day 0 3.61±0.27 3.61±0.59 3.62±0.21 3.63±0.18 Day 12 3.53±0.94 3.73±0.87 3.59±0.38 3.64±0.45 Day 24 3.60±0.53 3.67±0.48 3.69±0.42 3.70±0.35 Day 36 3.66±0.43 3.66±0.53 3.88±0.31 3.92±0.26 Day 48 3.70±0.35 3.57±0.56 3.91±0.23 4.02±0.15 Day 60 3.74±0.34 3.83±0.38 3.99±0.19 4.05±0.12

[0090] The above experimental results show that the fecal formation of experimental groups 1 and 2 was not much different from that of the control group in the first 20 days, but after more than 30 days, their fecal scores were significantly better than those of the control group. That is, the feed with added inactivated probiotics is more conducive to fecal formation and reduces the occurrence of soft stools. The feed with added four kinds of probiotic compound agents has the best effect.

[0091] 3) Diarrhea rate

[0092] Table 5 - Diarrhea rate (including soft stools) in Beagle puppies during the trial period

[0093]

[0094]

[0095] The above experimental results demonstrate that the effect of the experimental group feed differs from that of ordinary feed. During the experiment, it was observed that the experimental group feed could significantly suppress diarrhea and soft stools, and the feed with four probiotic compound agents added had the best effect.

[0096] 4) Intestinal flora testing: Fecal samples were taken monthly from puppies (both experimental dog food group 1 and control dog food group 1) for intestinal flora testing until they were 4 months old. The table below shows the results of measuring and counting Escherichia coli in puppies' feces.

[0097] Table 6 - Escherichia coli content (CFU / g) in the intestines of puppies

[0098] Group Initial detection 3 months old 4 months old Experimental group 1 9.18±0.13 8.58±0.08 7.99±0.06 Experimental group 2 9.16±0.12 8.53±0.09 7.94±0.07 Control group 1 9.19±0.18 8.64±0.07 8.31±0.05 Control group 2 9.27±0.14 8.74±0.07 8.08±0.08

[0099] The experimental results showed that the experimental group had a significant inhibitory effect on the content of Escherichia coli in the puppies' intestines, and could significantly reduce the content of E. coli (especially the feed with four kinds of probiotic compound agents). In contrast, the dog food without sterilized probiotics (control group 1) had almost no change in the content of E. coli in the intestines. This indicates that adding sterilized probiotic compound agents can regulate the content of intestinal flora and optimize the intestinal flora ecology.

[0100] 5) Weight gain record

[0101] Table 7 - Growth and Development Results of Puppies (Weight Measurement Results)

[0102] Group Initial weight 3 months old 4 months old Experimental group 1 2.43±0.21kg 4.18±0.15kg 5.20±0.31kg Experimental group 2 2.42±0.20kg 4.23±0.16kg 5.35±0.24kg Control group 1 2.44±0.24kg 4.15±0.18kg 4.92±0.39kg Control group 2 2.43±0.22kg 3.91±0.14kg 4.87±0.42kg

[0103] During the feeding period, the experimental group puppies showed virtually no weaning stress symptoms such as diarrhea and exhibited good weight gain. The control group showed slower improvement in weaning stress and relatively less weight gain. The results indicate that the experimental group dog diets all had good weight gain and growth effects, while the control group 1 and control group 2 dog diets showed relatively slower growth.

[0104] Example 3 - Optimization of bacterial count of inactivated probiotics

[0105] This embodiment optimizes the bacterial content of inactivated probiotics in puppy food formula, including the following steps:

[0106] (1) Optimization of bacterial count of *Pediococcus lactis* (CGMCC No. 23551)

[0107] Preliminary optimization of the bacterial count of *Pediococcus lactis* in inactivated probiotics: 10 11 10 10 10 9 10 8 CFU / g.

[0108] The bacterial counts prepared were 1011 10 10 10 9 10 8 Test dog diets with CFU / g (named Test Dog Diets 1-4 sequentially) were used to construct a diarrhea-inducing puppy system (4 puppies per group, half male and half female) through a senna leaf induction test. The antidiarrheal effects of the dog diets at different bacterial counts were tested, and the results are shown in Table 8 below:

[0109] Table 8 - Antidiarrheal effects at different bacterial counts

[0110] Group Depression Watery diarrhea Decreased appetite Change in body weight Test dog food 1 1 1 2 0 Test dog food 2 0 0 0 +10% Test dog food 3 0 0 1 +2% Test dog food 4 1 2 2 -4%

[0111] Experiments have shown that 10 10 A bacterial count of CFU / g yields the best results.

[0112] Further optimization: bacterial count was 1×10 10 2×10 10 4×10 10 6×10 10 8×10 10 CFU / g was tested. This demonstrates a concentration of 1×10⁻⁶. 10 -4×10 10 Both CFU / g showed good efficacy, with 2×10⁻⁶ CFU / g being particularly effective. 10 CFU / g is the most effective.

[0113] (2) Optimization of the ratio of compound microbial agents

[0114] The content of Pediococcus lactis was determined to be 2 × 10⁻⁶. 10 The CFU / g ratio of *Pediococcus lactis* / *Lactobacillus reuteri* / *Enterococcus faecalis* / *Lactobacillus plantarum* was compared to further optimize the proportion of each strain in the compound inoculum. Results showed that the compound inoculum exhibited better efficacy when the ratio of *Pediococcus lactis* / *Lactobacillus reuteri* / *Enterococcus faecalis* / *Lactobacillus plantarum* was 150–200:40–60:2–4:1–2. The optimal combination was *Pediococcus lactis* 2.0 × 10⁻⁶. 10 CFU / g, Lactobacillus reuteri 5.0×10 9 CFU / g, Enterococcus faecalis 3.0×10 8 CFU / g, Lactobacillus plantarum 2.0×10 8 CFU / g.

[0115] Example 4 - Synergistic effect of Eucommia ulmoides leaf extract

[0116] This embodiment verifies the synergistic effect of Eucommia ulmoides leaf extract and its combination with inactivated probiotics. The experimental group used includes:

[0117] Experimental Group 2 (Puppy Food 2 prepared in Example 2): Feed without Eucommia ulmoides leaf extract and containing inactivated probiotics (a compound probiotic agent of four kinds);

[0118] Experimental group 3 (puppy food 3 prepared in Example 2): feed containing Eucommia ulmoides leaf extract and inactivated probiotics (a compound probiotic agent of four kinds);

[0119] Control group 1 (without Eucommia ulmoides leaf extract and inactivated probiotics, prepared by the method of Example 2): Feed prepared by the method of Example 1 without Eucommia ulmoides leaf extract and inactivated probiotics (15 parts extruded corn, 3 parts extruded soybean meal, 20.55 parts extruded rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix).

[0120] Control group 3 (containing Eucommia ulmoides leaf extract, without inactivated probiotics, prepared by the method in Example 2): Its feed composition is the same as that of puppy food 3, but without the addition of inactivated probiotics.

[0121] An experiment was conducted to treat diarrhea in puppies using the aforementioned feed. Sixteen healthy, uniformly sized weaned puppies aged four months were selected and divided into four groups of four. Diarrhea was induced in each group using senna leaves. The puppies were fed dog food in the experimental groups (group 2 and group 3), dog food in the control group (group 1 and group 3), respectively. The condition of the puppies was observed on days 2 and 3, and their weight changes were observed on day 5.

[0122] Table 9 - Puppy Condition on Day 2

[0123] Group Depression Watery diarrhea Decreased appetite Experimental group 2 2 2 1 Experimental group 3 0 0 0 Control group 1 4 4 4 Control group 3 3 2 3

[0124] Table 10 - Puppy condition on day 3 and weight change on day 5

[0125] Group Depression Watery diarrhea Decreased appetite Change in body weight Experimental group 2 0 0 0 +4% Experimental group 3 0 0 0 +6% Control group 1 3 4 4 -6% Control group 3 2 1 2 +1%

[0126] The results above indicate that adding Eucommia ulmoides leaf extract alone has a certain effect in reducing the diarrhea rate, but its effect is not as good as adding inactivated probiotics alone, and even less so than the combined use of inactivated probiotics and Eucommia ulmoides leaf extract. Experimental group 3 (with the simultaneous addition of four types of probiotics and Eucommia ulmoides leaf extract) showed a faster and better therapeutic effect on stress diarrhea, indicating that the combined use of Eucommia ulmoides leaf extract and the inactivated probiotic formulation can make the inactivated probiotic formulation take effect faster, exhibiting a synergistic effect.

[0127] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. An experimental puppy food, characterized in that, By weight, the experimental puppy food comprises 10-30 parts extruded corn, 1-5 parts extruded soybean meal, 15-30 parts extruded rice flour, 25-40 parts chicken meal, 3-10 parts olive oil, 3-10 parts duck fat, 0.5-1 part limestone powder, 0.02-0.05 parts choline chloride, 0.1-0.3 parts sodium chloride, 1-4 parts chicken liver powder, 4-8 parts beef flavoring agent, 4-8 parts milk powder, and 3-4 parts multivitamin and mineral premix. In this experiment, 1-6 g of inactivated probiotics were added to each kg of puppy food. The inactivated probiotics consisted of *Pediococcus lactis*, *Lactobacillus reuteri*, *Enterococcus faecalis*, and *Lactobacillus plantarum* in a ratio of 50-200:30-80:2-5:1-3. The *Pediococcus lactis* was classified as follows: Pediococcus acidilactici Its accession number is CGMCC No. 23551; Add 4-12 g of Eucommia ulmoides leaf extract to each kg of experimental puppy food.

2. The experimental puppy food according to claim 1, characterized in that, By weight, the experimental puppy food included 15 parts extruded corn, 3 parts extruded soybean meal, 20.55 parts extruded rice flour, 30 parts chicken meal, 7 parts olive oil, 7 parts duck oil, 0.8 parts limestone powder, 0.05 parts choline chloride, 0.3 parts sodium chloride, 2 parts chicken liver powder, 5 parts beef flavoring agent, 5 parts milk powder, and 4 parts multivitamin and mineral premix. In this experiment, each kg of puppy food contained 8 g of Eucommia ulmoides leaf extract and 3 g of inactivated probiotics. The inactivated probiotics consisted of Pediococcus lactis, Lactobacillus reuteri, Enterococcus faecalis, and Lactobacillus plantarum in a ratio of 200:50:3:

2.

3. The use of a laboratory puppy food as described in any one of claims 1 to 2 in the preparation of a product that reduces the diarrhea rate in laboratory puppies.

4. The application according to claim 3, characterized in that, The experimental puppies were fed twice a day, with the amount being 2.5%-3.5% of their body weight.

Citation Information

Patent Citations

  • CN106234806A

  • CN109007285A

  • CN116098238A

  • CN116158497A

  • CN116590172A