A transgenic animal model and its construction method and application

By constructing Axin1flox/flox transgenic mice and mating them with Agc1-CreER transgenic mice and inducing them with tamoxifen, a transgenic animal model of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis was established. This solved the problem of model establishment in the existing technology and enabled systematic research and drug screening of related diseases.

CN117223679BActive Publication Date: 2026-05-15SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210634382.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-07
Publication Date
2026-05-15
Estimated Expiration
2042-06-07

AI Technical Summary

Technical Problem

Current technologies cannot effectively establish animal models of multiple diseases, especially models of growth plate chondrocyte hypertrophy, heterotopic ossification, and osteoarthritis, which limits the research and development of treatments for these diseases.

Method used

By crossing Axin1flox/flox transgenic mice with Agc1-CreER transgenic mice, Axin1Agc1ER conditional knockout mice were generated. A transgenic animal model with growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis pathological characteristics was established through tamoxifen induction.

Benefits of technology

A transgenic animal model with similar clinical pathological features was successfully established to study the pathogenesis of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis, and to provide an effective tool for drug screening of related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117223679B_ABST
    Figure CN117223679B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and particularly relates to a transgenic animal model and a construction method and application thereof. flox / flox The transgenic mouse is mated with the Agc1-CreER transgenic mouse to generate the Axin1 Agc1ER Conditional knockout mouse, and then Axin1 Agc1ER The conditional knockout mouse Axin1 expression is down-regulated, and a disease combined model with pathological characteristics of growth plate chondrocyte hypertrophy, ectopic ossification and knee joint articular cartilage degeneration is successfully established; the Axin1 Agc1ER Conditional knockout mouse animal model has growth plate chondrocyte hypertrophy, ectopic ossification and osteoarthritis characteristics similar to the related pathological characteristics in clinic, and can be used for systematically researching the pathogenesis of growth plate chondrocyte hypertrophy, ectopic ossification and osteoarthritis and further screening drugs for treating related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a transgenic animal model, its construction method and application, and particularly to a transgenic animal model of growth plate chondrocyte hypertrophy, ectopic ossification and osteoarthritis, its construction method and application. Background Technology

[0002] Skeletal development in mammals begins with the formation of hyaline cartilage during the embryonic period. Osteoblasts from the periosteum distribute around the hyaline cartilage, forming dense bone, including the diaphysis and spongy bone, known as primary ossification centers. Osteoclasts from the hematopoietic system destroy the spongy bone, forming the medullary cavity. With the continued formation of the medullary cavity (calcification), secondary ossification centers form at the two poles (epithels) of the posterior primary hyaline cartilage after birth in mammals. After the formation of secondary ossification centers, the cartilage is replaced by spongy bone, but intact articular cartilage and the growth plate (epithelial plate) composed of chondrocytes are retained. Continuous chondrocyte proliferation and hypertrophy lead to postnatal skeletal calcification and development. Unlike humans, chondrocyte proliferation and calcification in the mouse growth plate do not terminate. Therefore, we have the opportunity to investigate the role of the growth plate in mouse skeletal development and postnatal skeletal growth.

[0003] Heterotopic ossification (HO) is the process of bone formation in extraskeletal muscles and soft tissues, commonly seen in patients with neurological paralysis. Clinically, HO is frequently seen in traumatic heterotopic ossification (traumatic myositis ossification), progressive fibrous ossifying dysplasia (FOP), and progressive osteophyte formation (POH). Patients experience warm, soft, firm swelling of the muscles, and a reduced range of motion in the joints served by the affected muscles. The incidence varies depending on the cause, and the specific molecular pathological mechanism is unclear. Currently, there is no definitive treatment other than anti-inflammatory drugs, surgical resection, and radiation therapy.

[0004] Osteoarthritis (OA) affects over 100 million people in my country, severely impacting the quality of life for the elderly. OA is a degenerative joint disease primarily characterized by cartilage degeneration, resulting from the interaction of systemic predisposing factors and local mechanical factors. The main clinical manifestations of OA include pain, swelling, deformity, and limited range of motion in the affected joints. Imaging features include narrowing of the joint space and periosteal osteophyte formation. Current treatments for OA are mainly limited to passive, conservative, or even invasive surgical treatments aimed at relieving symptoms and correcting deformities. This is primarily due to a limited understanding of the molecular mechanisms of OA, resulting in a lack of effective etiological anti-OA therapies.

[0005] Due to ethical constraints, medical research cannot be conducted on patients with knee osteoarthritis; therefore, animal research plays an important role. Summary of the Invention

[0006] The purpose of this invention is to overcome the problem that existing technologies cannot establish models for multiple complex diseases.

[0007] Therefore, the present invention provides a method for constructing a transgenic animal model, comprising the following steps:

[0008] S1, Construct Axin1 flox / flox Transgenic mice and Agc1-CreER transgenic mice;

[0009] S2, Select adult Axin1 flox / flox Mice were mated with Agc1-CreER mice, and the resulting mating produced Axin1. Agc1ER Conditional knockout mice;

[0010] S3, Axin1 for adults Agc1ER Conditional knockout mice were injected intraperitoneally with tamoxifen for 5 consecutive days.

[0011] S4. Periodically check Axin1 during modeling. Agc1ER Biochemical parameters of conditional knockout mice were analyzed, and histological and histomorphometric analyses were performed.

[0012] S5. When mice simultaneously exhibit growth plate chondrocyte hypertrophy, ectopic ossification, and knee joint cartilage degeneration, the transgenic animal model is obtained.

[0013] Specifically, step S2 above involves: taking an adult female Axin1... flox / flox Transgenic mice were mated with male Agc1-CreER transgenic mice, or adult male Axin1 mice were mated. flox / flox Transgenic mice were mated with female Agc1-CreER transgenic mice. When the newborn mice were 2-3 weeks old, 1-3 mm of the tail tip was taken for genotyping. Lysis buffer was added to the tissue to be lysed, vortexed, and incubated in a water bath. After thorough mixing, the supernatant was collected to obtain the lysis products. Axin1 and CreER in the lysis products were amplified by PCR. Newborn mice corresponding to the lysis products showing Axin1 and CreER amplification bands were identified by agarose gel electrophoresis; these mice were classified as Axin1 transgenic mice. Agc1ER Conditional knockout mice.

[0014] Specifically, the lysis buffer includes 2 μl of Tris-HCl at pH 7.5, 20 μl of 0.5 M EDTA at pH 8.0, 6 μl of 5 M NaCl, 20 μl of SDS at a mass-to-volume ratio of 10%, and 1 μL of proteinase K at a concentration of 10 mg / ml.

[0015] Specifically, the primers used in the above PCR amplification include the Axin1 forward primer, the Axin1 reverse primer, the CreER forward primer, and the CreER reverse primer; the Axin1 forward primer sequence is TGAACTCTTGATCA GGTCTTG; the Axin1 reverse primer sequence is TATGACTTTGGTCCTTTCTG; the CreER forward primer sequence is CTGGTCTGGACACAGTGCCCG; and the CreER reverse primer sequence is TGCCAGGTTGGTCAGTAAGCC.

[0016] Specifically, in step S3 above, the dosage of tamoxifen injection is based on Axin1. Agc1ER Conditional knockout mice were weighed and injected with 1 mg per 10g of weight.

[0017] Specifically, the biochemical indicators in step S4 above include the expression levels of Ainx1, Aixn2, β-catenin, COl-X, MMP13, and Ki-67 in mice.

[0018] Specifically, the histomorphometric analysis in step S4 above includes the appearance of mouse micro-CT and TRAP staining.

[0019] In addition to the above-mentioned testing indicators and methods, those skilled in the art may select other testing indicators and methods according to actual needs, and all of them fall within the scope of protection of this application.

[0020] The transgenic animal model constructed by the method provided in this invention exhibits downregulated Axin1 gene expression and develops longplate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis. This model can be used to screen drugs for the treatment of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis. It can also be used for systematic research on the pathogenesis of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] The method for constructing this transgenic animal model provided by this invention utilizes Axin1 flox / flox Axin1 was produced by mating transgenic mice with Agc1-CreER transgenic mice. Agc1ER Conditional knockout mice were used, and Axin1 was induced by tamoxifen. Agc1ER Conditional knockout mice showed downregulated Axin1 expression, successfully establishing a disease-linked model with pathological features of "growth plate chondrocyte hypertrophy, ectopic ossification, and knee joint articular cartilage degeneration." The Axin1 expression model constructed using the method provided in this invention... Agc1ERThe growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis characteristics of the conditional knockout mouse animal model are similar to the relevant pathological features in clinical practice. This model can be used to systematically study the pathogenesis of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis, and to further screen drugs for the treatment of related diseases.

[0023] The present invention will now be described in further detail with reference to the accompanying drawings. Attached Figure Description

[0024] Figure 1 Axin1 in Embodiment 1 of the present invention Agc1ER Genotyping results of condition knockout mice.

[0025] Figure 2 It is the 6-month-old Axin1 in Embodiment 1 of the present invention. Agc1ER Histological and histomorphometric results of conditional knockout mice.

[0026] Figure 3 It is the 6-month-old Axin1 in Embodiment 1 of the present invention. Agc1ER Immunohistochemical analysis results of Axin1, β-catenin, and Axin2 protein expression in conditional knockout mice.

[0027] Figure 4 It is the 6-month-old Axin1 in Embodiment 1 of the present invention. Agc1ER Osteoclast detection results in conditional knockout mice.

[0028] Figure 5 It is the 6-month-old Axin1 in Embodiment 1 of the present invention. Agc1ER Changes in chondrocyte proliferation, differentiation, and apoptosis in conditional knockout mice. Detailed Implementation

[0029] The technical solutions of the present invention will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Although representative embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents.

[0030] The experimental reagents and other materials used in the embodiments of this invention are all commercially available conventional experimental materials.

[0031] Example 1:

[0032] Among traditional animal models of knee osteoarthritis, the mouse knee osteoarthritis model is a classic and widely used in knee osteoarthritis research. In this example, mice are used as experimental subjects.

[0033] I. Constructing a transgenic animal model

[0034] The method for constructing transgenic animal models includes the following steps:

[0035] S1、Axin1 flox / flox The transgenic mice were donated by Professor Shu Bing (Shanghai University of Traditional Chinese Medicine), and the Agc1-CreER transgenic mice were purchased from Jackson Laboratories in the United States.

[0036] S2, Select adult Axin1 flox / flox Mice were mated with Agc1-CreER mice;

[0037] When the newborn mice are 2-3 weeks old, the tail tip of the mice (1-3 mm) is taken for genotyping. 51 μl of lysis buffer [Tris-HCl (pH 7.5) 2 μl, 0.5 M EDTA (pH 8.0) 20 μl, 5 M NaCl 6 μl, 10% (M / V) SDS 20 μl, 10 mg / ml proteinase K 1 μL] is added to the tissue to be lysed. After vortexing, the sample is incubated in a 55°C water bath for 20 min. Then, the sample is heated in a 95°C or boiling water bath for 5 min. The lysis products are thoroughly mixed by vortexing, and the supernatant is collected to obtain the lysis products.

[0038] Axin1 and CreER in the lysis products were amplified by PCR. The lysis products, H2O, 2X Taq Plus MasterMix (Dye Plus), primers (forward), and primers (reverse) were prepared in a ratio of 2.5:8:12.5:1:1 (μl), and PCR amplification was performed according to the program of 94℃ for 5 min, [94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 30 sec / kb], 72℃ for 7 min, and 4℃. The forward primer sequence of Axin1 was TGAACTCTTGATCAGGTCTTG; the reverse primer sequence of Axin1 was TATGATCTTGGTCCTTTCTG; the forward primer sequence of CreER was CTGGTC TGGACACAGTGCCCG; and the reverse primer sequence of CreER was TGCCAGGTTGGTCAGTAAGCC.

[0039] Dissolve 1.5g of agarose in 100ml of TAE solution and heat in a 1000W microwave oven for 3 minutes to prepare an agarose gel. Then add 10μl of nucleic acid dye to the solution. After the gel solidifies, add the amplification products to the gel, and then perform gel electrophoresis at 160V for 30 minutes to detect the size of the PCR product bands. The newborn mice corresponding to the lysis products of the Axin1 and CreER amplification bands detected by agarose gel electrophoresis are identified as Axin1. Agc1ER Conditional knockout mice.

[0040] S3, for 2-month-old Axin1 Agc1ER Conditional knockout mice were intraperitoneally injected with tamoxifen, the injection dose being based on Axin1. Agc1ER Conditional knockout mice were weighed and injected with 1 mg per 10g of mice for 5 consecutive days.

[0041] S4. Periodically check Axin1 during modeling. Agc1ER Biochemical parameters of conditional knockout mice were analyzed, and histological and histomorphometric analyses were performed.

[0042] S5. Axin1 was induced by tamoxifen. Agc1ER Conditional knockout mice exhibited growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis symptoms at 6 months of age, thus obtaining a transgenic animal model.

[0043] II. Analysis of transgenic animal models

[0044] The control group Cre consisted of mice from the same littermate that did not express Agc1ER.

[0045] For 6-month-old Axin1 Agc1ER Histological, micro-CT, and TRAP analyses were performed on conditional knockout mice and control Cre mice, as detailed below.

[0046] Mice knee joints were immobilized using 10% neutral buffered formalin (VWR, 16004-128). Then, using a μCT-35 cone-beam scanner (Scanco Medical) with a 55 kVp source and a 145-resolution 10 mA current, 100 proximal slices were scanned, starting from the location where complete tibial condyle fusion was found. Reconstructed 3D images of each sample were evaluated at the same threshold.

[0047] The knee joints of mice were fixed, decalcified, and dehydrated using graded ethanol and xylene, and then embedded in paraffin. Starting from the medial side of the knee joint, 3 μm thick midsagittal sections were cut at three different horizontal angles (50°) with a spacing of μm. The mouse knee joints were then subjected to Alcian blue / Orange G staining for morphological analysis.

[0048] Axin1Agc1ER Genotyping results of condition knockout mice are as follows Figure 1 As shown, where Figure 1 A is Axin1 Agc1ER Axin1 expression results in mice, Axin1 flox / flox The strip size is 600bp, while the WT strip size is approximately 500bp; Figure 1 B represents the expression result of Agc1ER.

[0049] Histological and histomorphometric changes in mice, such as Figure 2 As shown, where Figure 2 A and Figure 2 B represents the comparison results of bone mass changes in mice. Figure 2 C and Figure 2 D represents the results of bone volume (BV) and trabecular bone number (Tb.N.) measurements in mice. Figure 2 E represents the beam thickness (Tb.Th.) measurement result. Figure 2 F and Figure 2 G represents trabecular separation (Tb.Sp.) and structural model index (SMI) in mice. Compared with the control group, 6-month-old Axin1 mice showed... Agc1ER Conditional knockout mice showed increased bone volume and trabecular bone number (Tb.N.), no significant difference in trabecular thickness (Tb.Th.), and decreased trabecular separation (Tb.Sp.) and structural model index (SMI). Figure 2 Figures H and I show Alcinin Blue / Orange G staining, indicating 6-month-old Axin1 Agc1ER Mild articular cartilage degeneration was observed in the growth plates of the femur and tibia in conditional knockout mice. The medial femoral condyle was analyzed at three levels of the joint, and the total OARSI score for the entire joint was given. Results are as follows: Figure 2 As shown in J, 6-month-old Axin1 Agc1ER The OARSI total score of condition knockout mice was significantly higher than that of the control group. Figure 2 K represents the average tibial growth plate width in mice, and Axin1 at 6 months of age. Agc1ER The average tibial growth plate width of condition knockout mice was significantly wider than that of the control group.

[0050] TRAP staining was performed on 3 μm thick midsagittal slides, n≥4. First, the slides were baked overnight at 60°C, then dewaxed and rehydrated. Next, the slides were incubated with TRAP staining buffer (sodium acetate, sodium tartrate, solid red violet LB salt, naphthol AS-MX, dimethylformamide, MnCl2) in the dark at 37°C for 1 hour. The sections were then counterstained with CAT hematoxylin (Biocare Medical, CATHE-GL) and covered with glycerol gelatin (Sigma, GG1-15ML). The results of the TRAP detection are shown below. Figure 4As shown in Figure A, osteoclasts beneath the growth plate were measured using OsteoMeasure software (OsteoMetrics, Inc., Atlanta, GA, USA), and the results were expressed using bone perimeter (N.Oc / B.Pm) as a reference. Figure 4 B and Figure 4 As shown in C. 6-month-old Axin1 Agc1ER Conditional knockout mice showed reduced osteoclast formation and ectopic bone, and OPG expression was significantly increased in Axin1-deficient BMS cells.

[0051] For 6-month-old Axin1 Agc1ER Immunohistochemical (IHC) and immunofluorescence (IF) analyses were performed on conditional knockout mice and control Cre mice, as detailed below.

[0052] This invention proposes to detect IHC and IF indicators in a mouse model, including the expression of Ainx1, Aixn2, β-catenin, COl-X, MMP13, and Ki-67 in 6-month-old Axin1Agc1ER conditional KO mice. IHC and IF were also performed on a 3 μm thick midsagittal slide, n≥3. First, the slides were baked overnight at 60°C, then dewaxed and rehydrated. Next, the slides were incubated with an antigen unmasking solution (95°C, 5-10 min), 30% hydrogen peroxide (10 min), 0.5% Triton 100 (15 min), primary antibody (12 h), and secondary antibody (1 h), followed by DAB staining (10-300 s), counterstaining with hematoxylin and ammonia, soaking in alcohol and xylene, and mounting with neutral resin.

[0053] Figure 3 Immunohistochemical (IHC) analysis results of Axin1, β-catenin, and Axin2 protein expression; *P<0.05, **P<0.01, n=3 mice / group. Figure 3 A-3C indicates that Axin1 in a 6-month-old infant is... Agc1ER In conditional knockout mice, Axin1 protein levels were eliminated in both articular cartilage and growth plate cartilage (Axin1+ cells). Meanwhile, from... Figure 3 D-3F indicates that Axin1 in a 6-month-old infant... Agc1ER The levels of β-catenin in the articular cartilage and growth plate cartilage (β-catenin+ cells) of conditional knockout mice were elevated. Figure 3 G- Figure 3 I 6-month-old Axin1 Agc1ER The Axin2 protein level was elevated in the growth plate cartilage and articular cartilage (Axin2+ cells) of conditional knockout mice.

[0054] 6-month-old Axin1 Agc1ER Changes in chondrocyte proliferation, differentiation, and apoptosis in conditional knockout mice are as follows: Figure 5 (*P<0.05, **P<0.01, n=3 mice / group) as shown. 6-month-old Axin1 Agc1ER The number of Ki67-positive cells was significantly increased in the expanded growth plate of conditional knockout mice. Figure 5 A- Figure 5 B); ColX protein expression is increased in the growth plate cartilage. Figure 5 C- Figure 5 D); Increased MMP-13 protein expression in articular cartilage and growth plate cartilage (Figure 5E- Figure 5 F); there was no significant change in TUNEL-positive apoptotic cells in the expanded growth plate (F). Figure 5 G- Figure 5 H).

Claims

1. A method for constructing a transgenic animal model of growth plate chondrocyte hypertrophy, ectopic ossification, and osteoarthritis, characterized in that, Includes the following steps: S1, Construction Axin1 flox / flox Transgenic mice and Agc1-CreER Transgenic mice; S2, Select adults Axin1 flox / flox Transgenic mice and Agc1-CreER Transgenic mice were mated to breed Axin1 Agc1ER Conditional knockout mice; S3, for adults Axin1 Agc1ER Conditional knockout mice were injected intraperitoneally with tamoxifen for 5 consecutive days. S4. Regularly check during modeling. Axin1 Agc1ER Biochemical parameters of conditional knockout mice were analyzed, and histological and histomorphometric analyses were performed. S5, when Axin1 Agc1ER The conditional knockout organism simultaneously exhibits growth plate chondrocyte hypertrophy, ectopic ossification, and knee cartilage degeneration, thus obtaining the transgenic animal model described above. The biochemical indicators in step S4 include Axin1 Agc1ER The expression levels of Ainx1, Aixn2, β-catenin, COlX, MMP13 and Ki-67 in conditional knockout mice; The histomorphometric analysis in step S4 includes Axin1 Agc1ER Micro-CT and TRAP staining patterns in conditional knockout mice showed reduced osteoclast formation, supporting the heterotopic ossification phenotype.

2. The method for constructing a transgenic animal model as described in claim 1, characterized in that: Step S2 specifically involves taking an adult female... Axin1 flox / flox Transgenic mice and males Agc1-CreER Transgenic mice are mated, or adult males are used. Axin1 flox / flox Transgenic mice and females Agc1-CreER Transgenic mice were mated; when the newborn mice were 2-3 weeks old, 1-3 mm of the mouse tail tip was taken for mouse genotyping. The lysis buffer was added to the tissue to be lysed, vortexed, and incubated in a water bath. After thorough vortexing, the supernatant was collected to obtain the lysis product. The lysis product was then analyzed for... Axin1 , CreER PCR amplification was performed, and agarose gel electrophoresis was used to detect the results. Axin1 , CreER The newborn mice corresponding to the lysis products of the amplified band are... Axin1 Agc1ER Conditional knockout mice.

3. The method for constructing a transgenic animal model as described in claim 2, characterized in that: The lysis buffer consists of 2 μl Tris-HCl at pH 7.5, 20 μl 0.5 M EDTA at pH 8.0, 6 μl 5 M NaCl, 20 μl SDS at a mass-volume ratio of 10%, and 1 μL proteinase K at a concentration of 10 mg / ml.

4. The method for constructing a transgenic animal model as described in claim 2, characterized in that: The primers used in the PCR amplification include Axin1 Forward primer, Axin1 Reverse primer, CreER Forward primer, CreER Reverse primer; Axin1 The forward primer sequence is TGAACTCTTGATCAGGTCTTG; Axin1 The reverse primer sequence is TATTGATCTTTGGTCCTTTCTG; CreER The forward primer sequence is CTGGTCTGGACACAGTGCCCG; CreER The reverse primer sequence is TGCCAGGTTGGTCAGTAAGCC.

5. The method for constructing the transgenic animal model according to claim 1, characterized in that: The amount of tamoxifen injected in step S3 is as follows: Axin1 Agc1ER Conditional knockout mice were weighed and injected with 1 mg per 10g of weight.

6. The application of the transgenic animal model obtained by the construction method according to any one of claims 1-5 in screening drugs for the treatment of growth plate chondrocyte hypertrophy, ectopic ossification and osteoarthritis.

7. The application of the transgenic animal model obtained by the construction method according to any one of claims 1-5 in the systematic study of the pathogenesis of growth plate chondrocyte hypertrophy, ectopic ossification and osteoarthritis.