Use of HMGCL as a glioma diagnosis / prognosis marker and a therapeutic target
By detecting the expression level of HMGCL, products and systems for glioma diagnosis and prognosis evaluation are developed, and malignant growth of glioma cells is inhibited by regulating the expression of HMGCL, which solves the shortcomings in the diagnosis and treatment of gliomas in the prior art, and achieves efficient diagnosis and potential therapeutic targets for gliomas.
Patent Information
- Application Number
- CN202311278780.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-28
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2043-09-28
AI Technical Summary
The prior art has shortcomings in the diagnosis, prognostic evaluation and treatment of gliomas, especially with few studies on the potential biomarkers and targets of HMGCL.
By detecting the expression levels of HMGCL-encoded genes and their expression products, products and systems for glioma diagnosis and prognosis evaluation are developed, and malignant growth and invasion of glioma cells are inhibited by regulating the expression of HMGCL.
The expression of HMGCL is negatively correlated with the degree of malignancy and survival of glioma, indicating that it can be used for the diagnosis and prognosis of glioma. By regulating the expression of HMGCL, the proliferation and colony formation ability of glioma cells can be significantly reduced, providing a potential therapeutic target.
Smart Images

Figure CN117248020B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of disease diagnosis and treatment and molecular biology, and particularly relates to the application of HMGCL as a glioma diagnosis / prognosis marker and a therapeutic target. Background Art
[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and it is not necessarily to be regarded as an admission or any form of implication that this information constitutes the prior art already known to those of ordinary skill in the art.
[0003] Glioma is the most common primary malignant tumor of the central nervous system (CNS). 50% of patients present with the most aggressive type, namely glioblastoma (GBM). Despite recent progress in chemotherapy and surgery, the overall survival (OS) of GBM has not significantly improved in the past few decades, and the median survival rate remains generally low. Molecular etiological studies on glioma have elucidated various gene alterations involved in cell survival and DNA repair pathways. However, targeted therapies against these pathways are not very effective. Recent studies have revealed 14 hallmarks of tumors, and the revelation of these tumor hallmarks summarizes the history of tumor research and also represents a new direction for tumor treatment strategies. Among them, developing new targets based on the metabolic reprogramming of tumors and designing new targeted drugs provide new ideas for the drug treatment of tumors.
[0004] Compared with normal cells, the lipid metabolism of glioma is abnormally regulated, and the expression of lipid-related genes such as SREBP1 and FAS changes, resulting in changes in lipid composition and lipogenesis to keep up with energy demands. GBM tumors also accumulate more fatty acids than the surrounding normal brain tissue. These lipid stores can serve as energy reservoirs, which can support the proliferation of GBM cells and also affect the pathways related to tumor malignant progression. Targeting molecules related to glioma lipid metabolism contributes to the treatment of glioma. The applicant previously screened lipid metabolism genes specifically expressed in glioma through database bioinformatics analysis. Among them, HMGCL was used as a candidate gene, and its expression differed significantly in gliomas of different grades. In addition, there are few research reports on HMGCL, and there is no report in glioma. Summary of the Invention
[0005] In view of the deficiencies of the prior art, the present invention provides the application of HMGCL as a glioma diagnosis / prognosis biomarker and a therapeutic target. The present invention for the first time demonstrates that the expression of HMGCL increases with the malignancy of glioma and is negatively correlated with the survival rate of glioma patients, thus indicating that it can be used for the diagnosis and prognostic evaluation of glioma. At the same time, by regulating the expression of HMGCL, the malignant growth and invasion ability of glioma cells can be controlled, thus indicating that it can be used as a therapeutic target for glioma. Based on the above research results, the present invention is completed.
[0006] Specifically, the present invention relates to the following technical solutions:
[0007] In the first aspect of the present invention, there is provided the application of a reagent for detecting an HMGCL-encoding gene and its expression product in the preparation of a product for glioma diagnosis and / or prognosis.
[0008] The product can diagnose, detect, monitor or predict the progression of glioma (early or assistantly) by detecting the expression level of the HMGCL-encoding gene and / or the expression product of the HMGCL-encoding gene; experiments have proved that HMGCL is correlated with glioma grade, IDH mutation status, etc., and the expression level of HMGCL increases with the increase of glioma grade (malignancy), and high expression can predict poor prognosis; at the same time, the expression level of HMGCL in glioma cell lines and glioma stem cell lines is higher than that in normal astrocytes. Therefore, the HMGCL-encoding gene and its expression product can be used as glioma diagnosis and / or prognosis biomarkers.
[0009] Among them, both the HMGCL-encoding gene and its expression product can be human-derived; the expression product of the HMGCL-encoding gene can obviously be the HMGCL protein, namely 3-hydroxy-3-methylglutaryl coenzyme A lyase.
[0010] In the second aspect of the present invention, there is provided a system for glioma diagnosis and / or prognosis evaluation, the system at least comprising:
[0011] An acquisition module, which is configured to: acquire the expression level of a biomarker of a subject;
[0012] An evaluation module, which is configured to: evaluate the disease condition of the subject according to the expression level of the biomarker obtained by the acquisition module;
[0013] Among them, the biomarker is the HMGCL-encoding gene and / or the expression product of the HMGCL-encoding gene (such as hydroxymethylglutaryl coenzyme A lyase).
[0014] In the third aspect of the present invention, there is provided a computer-readable storage medium, on which a program is stored, and when the program is executed by a processor, the functions of the system described in the second aspect of the present invention are implemented.
[0015] In the fourth aspect of the present invention, there is provided an electronic device, including a memory, a processor, and a program stored on the memory and executable on the processor. When the processor executes the program, the functions of the system described in the second aspect of the present invention are implemented.
[0016] In the fifth aspect of the present invention, there is provided the use of HMGCL as a target in the prevention and treatment of glioma and / or screening of glioma-related drugs.
[0017] In the sixth aspect of the present invention, there is provided the use of a substance that inhibits the expression of the HMGCL-encoding gene and its expression product and / or reduces its activity in the preparation of a product;
[0018] The functions of the product are any one or more of the following:
[0019] (a1) Inhibiting the proliferation of glioma cells;
[0020] (a2) Inhibiting the invasion and migration of glioma cells;
[0021] (a3) Promoting cell cycle arrest of glioma cells;
[0022] (a4) Inhibiting the colony formation of glioma cells;
[0023] (a5) Inhibiting the expression of histone acetylation modification in glioma cells;
[0024] (a6) Inhibiting the expression and transcriptional regulatory function of the cell cycle-related molecule FoxM1 in glioma cells;
[0025] (a7) Preventing and / or treating glioma.
[0026] The above product can be a drug or an experimental reagent, and the experimental reagent can be used for basic research, thus providing guarantee for basic research related to glioma.
[0027] The beneficial technical effects of the above one or more technical solutions:
[0028] The above technical solutions have first proved that the expression of HMGCL increases with the increase of the malignancy degree of glioma and is negatively correlated with the survival rate. At the same time, the HMGCL lentivirus can significantly reduce the expression level of HMGCL in glioma, and the knockdown of HMGCL inhibits the proliferation and colony formation of glioma cells, and can be used as an effective target for the prevention and / or treatment of glioma.
[0029] Furthermore, the above technical solutions have proved that specific knockdown of HMGCL can lead to a significant down-regulation of the histone acetylation modification level in GBM cells, suggesting the possibility of regulating epigenetic modification by metabolic means and promoting the related research on metabolism combined with epigenetics.
[0030] In summary, the discovery of HMGCL and its molecular mechanism in the above technical solutions will contribute to a deeper understanding of the pathogenesis of glioma, and will also help to provide potential biomarkers and therapeutic targets for the clinical diagnosis, prognosis evaluation, prevention and treatment of glioma. Therefore, it has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] The accompanying drawings forming a part of this invention are used to provide a further understanding of the invention. The schematic embodiments and descriptions thereof of the invention are used to explain the invention and do not constitute an improper limitation of the invention.
[0032] Figure 1 It shows the expression level and prognostic significance of HMGCL in glioma tissues in the embodiments of the present invention. Among them, Figure A shows the correlation between HMGCL and glioma grade and IDH mutation status; Figures B and C show the expression of HMGCL in the IDH wild-type group and the 1p / 19q non-codelletion group; Figure D shows the prognostic significance of HMGCL in three databases; Figure E shows the expression of HMGCL in the collected glioma cases (n = 20); Figure F shows the expression of HMGCL in glioma cell lines, glioma stem cells, and normal astrocytes.
[0033] Figure 2 It shows the inhibition diagram of the malignant phenotype of glioma cell lines by specifically interfering with HMGCL in the embodiments of the present invention. Among them, Figure A is the CCK-8 detection after lentiviral transfection of cells, and the growth curve diagrams of LN229, U251, and GBM#P3 cells based on OD450; Figure B is the further detection of proliferation ability based on the EdU experiment; Figures C and D show the changes in tumor invasion and migration ability after lentiviral transfection of cells; Figure E shows the change in cell colony formation ability after lentiviral transfection of cells; Figures F, G, and H are the results diagrams of in vivo experiments after lentiviral transfection of cells, and Figure I is the immunohistochemistry experiment diagram related to in vivo experiments.
[0034] Figure 3 It shows the diagram of the down-regulation of histone acetylation epigenetic modification in glioma caused by HMGCL knockdown in the embodiments of the present invention. Figure A shows the changes in downstream metabolites of HMGCL after knockdown; Figure B shows the changes in histone acetylation modification after knocking down HMGCL; Figures C, D, and E show the rescue of histone acetylation modification after taking measures such as using TSA and changing the concentrations of glucose and acetic acid in the culture medium.
[0035] Figure 4In the embodiments of the present invention, HMGCL can regulate the transcription of the cell cycle-related molecule FoxM1. Figure A shows the RNA-seq sequencing of cell samples after HMGCL knockdown; Figure B shows the GSEA enrichment analysis related to the sequencing; Figure C shows the intersection of down-regulated genes, genes related to the cell proliferation gene set, and genes related to the prognosis of glioma; Figure D shows the verification at the RNA level after HMGCL knockdown; Figure E shows the verification at the protein level after HMGCL knockdown; Figures F and G show the changes in the downstream transcription level of FoxM1.
[0036] Figure 5 In the embodiments of the present invention, HMGCL affects the expression of FoxM1 by inducing hyperacetylation around the promoter. Figure A shows the histone acetylation modification of the FoxM1 promoter in UCSC; Figures B and C show the ChIP verification based on the histone acetylation modification sites; Figures D and E show the rescue of the FoxM1 level after measures such as changing the concentrations of glucose and acetate in the culture medium.
[0037] Figure 6 In the embodiments of the present invention, HMGCL / FoxM1 can regulate the translocation and function of β-catenin. Figure A shows the nuclear-cytoplasmic translocation of β-catenin after HMGCL knockdown; Figure B shows the immunofluorescence staining against β-catenin; Figure C shows the detection of the β-catenin RNA level; Figure D shows the changes in the transcription level of the downstream molecules of β-catenin. Detailed implementation manners
[0038] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.
[0039] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. If the experimental methods in the following specific implementation manners do not specify specific conditions, they are generally carried out according to the conventional methods and conditions of molecular biology in the art, and such techniques and conditions are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., "Molecular Cloning: A Laboratory Manual", or according to the conditions recommended by the manufacturer.
[0040] The present invention will be further described with specific examples. The following examples are only for explaining the present invention and do not limit its content. If the specific experimental conditions are not specified in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the sales company. The materials, reagents, etc. used in the examples can be obtained through commercial channels without special instructions.
[0041] In a typical specific embodiment of the present invention, there is provided an application of a reagent for detecting the HMGCL encoding gene and its expression product in the preparation of a product for glioma diagnosis and / or prognosis.
[0042] The product can diagnose, detect, monitor or predict the progression of glioma (early or assistedly) by detecting the expression level of the HMGCL encoding gene and / or the expression product of the HMGCL encoding gene; experiments have proved that HMGCL is correlated with glioma grade, IDH mutation status, etc., and the expression level of HMGCL increases with the increase of glioma grade (malignancy degree), and high expression can predict poor prognosis; at the same time, the expression level of HMGCL in glioma cell lines and glioma stem cell lines is higher than that in normal astrocytes. Therefore, the HMGCL encoding gene and its expression product can be used as glioma diagnosis and / or prognosis biomarkers.
[0043] Among them, both the HMGCL encoding gene and its expression product are of human origin; the expression product of the HMGCL encoding gene is obviously the HMGCL protein, namely hydroxymethylglutaryl coenzyme A lyase.
[0044] Among them, the reagent for detecting the HMGCL encoding gene and its expression product includes substances for detecting the transcription of the HMGCL encoding gene based on RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing, and / or substances for detecting the situation of the HMGCL expression product (such as hydroxymethylglutaryl coenzyme A lyase) based on immunoassay methods.
[0045] The product includes but is not limited to primers, probes, (gene or protein) chips, nucleic acid membrane strips, detection kits, detection devices or equipment for detecting the expression level of HMGCL in a test sample.
[0046] The test sample is a human sample, including but not limited to glioma cells and glioma tissues of a subject.
[0047] In another specific embodiment of the present invention, there is provided a system for glioma diagnosis and / or prognosis evaluation, and the system at least includes:
[0048] An acquisition module, which is configured to: acquire the expression level of a biomarker of a subject;
[0049] An evaluation module, which is configured to: evaluate the disease condition of a subject according to the expression level of the biomarker obtained by the acquisition module;
[0050] Wherein, the biomarker is the HMGCL-encoding gene and / or the expression product of the HMGCL-encoding gene (such as hydroxymethylglutaryl-CoA lyase).
[0051] The evaluation of the disease condition of the subject includes the diagnosis of glioma in the subject, the malignancy degree of glioma, and the survival period of glioma patients.
[0052] It should be noted that the system for diagnosing or assisting in the diagnosis of glioma according to the present invention can be a virtual device, as long as it can implement the functions of the analysis module and the evaluation module. The analysis module can include various detection reagent materials and / or detection instrument devices, etc.; the evaluation module can be any computing instrument, module or virtual device that can analyze and process the detection results of the analysis module to obtain the glioma disease risk assessment status. For example, various possible detection results and corresponding disease risk situations can be pre-formulated into corresponding data charts, and the detection results of the detection module can be compared with this data chart to obtain the glioma incidence risk assessment result.
[0053] In another specific embodiment of the present invention, a computer-readable storage medium is provided, on which a program is stored, and when the program is executed by a processor, the functions of the system are implemented.
[0054] In another specific embodiment of the present invention, an electronic device is provided, including a memory, a processor, and a program stored on the memory and executable on the processor, and when the processor executes the program, the functions of the system are implemented.
[0055] In another specific embodiment of the present invention, the application of HMGCL as a target in the prevention and treatment of glioma and / or screening of glioma-related drugs is provided.
[0056] In another specific embodiment of the present invention, the method for screening glioma-related drugs includes:
[0057] 1) Treat a system expressing and / or containing HMGCL with a candidate substance; set a parallel control without treating with the candidate substance;
[0058] 2) After completing step 1), detect the expression level of HMGCL in the system; compared with the parallel control, if the expression level of HMGCL in the system treated with the candidate substance is significantly reduced, the candidate substance can be used as a candidate glioma drug.
[0059] In yet another specific embodiment of the present invention, the system may be a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.
[0060] In yet another specific embodiment of the present invention, there is provided the use of a substance that inhibits the expression of the HMGCL-encoding gene and its expression product and / or reduces its activity in the preparation of a product;
[0061] The function of the product is any one or more of the following:
[0062] (a1) Inhibiting the proliferation of glioma cells;
[0063] (a2) Inhibiting the invasion and migration of glioma cells;
[0064] (a3) Promoting cell cycle arrest of glioma cells;
[0065] (a4) Inhibiting the colony formation of glioma cells;
[0066] (a5) Inhibiting the expression of histone acetylation modification in glioma cells;
[0067] (a6) Inhibiting the expression and transcriptional regulatory function of the cell cycle-related molecule FoxM1 in glioma cells;
[0068] (a7) Preventing and / or treating glioma.
[0069] In yet another specific embodiment of the present invention, the substance that inhibits the expression level of HMGCL may be an interfering molecule that uses HMGCL as a target sequence and can inhibit the expression of HMGCL, and specifically may include shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, antisense nucleic acid, or a construct (such as a lentivirus) that can express or form the shRNA, small interfering RNA, dsRNA, microRNA, antisense nucleic acid; and an antibody against hydroxymethylglutaryl coenzyme A lyase, and may also include compound inhibitors.
[0070] In yet another specific embodiment of the present invention, the above product may be a drug or an experimental reagent, and the experimental reagent can be used for basic research.
[0071] When the above product is a drug, the drug may further comprise one or more pharmaceutically or food - acceptable excipients. The excipients used may be in solid or liquid form. Solid - form preparations include powders, tablets, dispersible granules, capsules, pills and suppositories. Powders and tablets may contain from about 0.1% to about 99.9% of the active ingredient. Suitable solid excipients may be magnesium carbonate, magnesium stearate, talc, sugar or lactose. Tablets, powders, pills and capsules are solid dosage forms suitable for oral administration. Liquid - form preparations include solutions, suspensions and emulsions, examples of which are parenteral aqueous solutions or water - propylene glycol solutions, or oral solutions with added sweeteners and contrast agents. In addition, it can also be made into small - volume aqueous injections for injection, freeze - dried powder injections for injection, large - volume infusions or small - volume infusions.
[0072] In another specific embodiment of the present invention, a method for preventing and / or treating glioma is provided, the method comprising: administering to a subject a therapeutically effective dose of the above - mentioned drug.
[0073] The subject refers to an animal that has been the subject of treatment, observation or experiment, and can be a human and non - human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, chimpanzees, etc., and most preferably refers to humans. The "therapeutically effective amount" refers to the amount of the active compound or agent, including the compounds of the present invention, that can cause a biological or medical response in a tissue system, animal or human that is sought by a researcher, veterinarian, doctor or other medical personnel, which includes alleviating or partially alleviating the symptoms of the disease, syndrome, disorder or condition being treated. It must be recognized that the optimal dosage and dosing interval of the active ingredient described in the present invention are determined by its nature and external conditions such as the form, route and site of administration and the particular mammal being treated, and this optimal dosage can be determined by conventional techniques. It must also be recognized that the optimal course of treatment, i.e., the daily dose of the compound over a specified period of time, can be determined by methods well - known in the art.
[0074] The present invention will be further explained and illustrated by the following examples, but this does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
[0075] Examples
[0076] I. Materials and Methods
[0077] 1. Ethical statement and clinical glioma tumor specimens
[0078] The protocol in this study was approved by the Ethics Committee of Qilu Hospital of Shandong University (DWLL-2021-096). This study was conducted in full compliance with relevant regulations and guidelines. Human glioma tissue samples were obtained from surgeries performed on patients at Qilu Hospital. Non-tumor brain tissue samples were from patients who required surgery due to brain trauma events. Written informed consent was provided by all enrolled patients. Clinical information and expression data of glioma samples from public databases were retrieved from the TCGA, CGGA, and Rembrandt databases.
[0079] 2. Cell culture and reagents
[0080] Human glioblastoma cells were purchased from the Cell Bank of the Chinese Academy of Sciences. All glioma cell lines were cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific; Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and incubated in a cell culture incubator at 37 °C with 5% carbon dioxide. Patient-derived GBM stem cells (GSCs) P3 were previously isolated from GBM surgical specimens and characterized. GSCs were cultured in Neurobasal medium (Gibco / Thermo Fisher Scientific) containing 2% B-27 NeuroMix (Thermo Fisher Scientific), 20 ng / mL epidermal growth factor (EGF; PeproTech; East Windsor, NJ, USA), and 10 ng / mL basic fibroblast growth factor (bFGF; PeproTech). Normal human astrocytes (NHA) and NHA transfected with human papillomavirus 16 E6 / E7 and human TERT (immortalized NHA-ET) were obtained from Lonza (Walkersville, MD, USA) and cultured in astrocyte medium (ScienCell) supplemented with the Astrocyte Growth Medium BulletKit (ScienCell; Carlsbad, CA, USA).
[0081] 3. Construction of lentivirus for stable knockdown of HMGCL
[0082] Both transient transfection and stable transfection were carried out using Lipofectamine 2000 reagent (ThermoFisher Scientific) according to the manufacturer's instructions. For siRNA experiments, cells were transfected with 100 pmol of siRNA (GenePharma; Shanghai, China) for 48 hours. After transfection of HEK293T cells with the lentiviral packaging plasmids psPAX2 and pCMV-VSV-G and the lentiviral expression construct for 48 hours, the stably expressed lentiviral supernatant was harvested. Target cells were cultured with the supernatant for 24 hours, and puromycin selection was started 48 hours later. The siRNA sequences targeting HMGCL were as follows: siHMGCL-1: 5'-CCAGCUUUGUGUCUCCUAAGU-3'; siHMGCL-2: 5'-ACCAAGAAGUUCUACUCAAUG-3'; siNC: 5'-UUCUCCGAACGUGUCACGUTT-3'. The expression constructs of shNC and shHMGCL were purchased from Obio Technology (Shanghai, China).
[0083] 4. Real-time quantitative PCR
[0084] RNA was extracted from glioma cells using Trizol reagent (Invitrogen, Life Technologies). And reverse transcription was performed. The primers for HMGCL were forward primer: 5’-GCTCTTGGCTGCCCTTATGA-3’; reverse primer: 5’-TTACAGGTAGCCTGAGCCAC-3’.
[0085] 5. Western blot
[0086] The harvested cells were lysed by heat denaturation in RIPA cell lysis buffer. Protein lysates (20 μg) were analyzed, and the proteins were transferred to a polyvinylidene difluoride membrane (PVDF). The primary antibodies HMGCL (Proteintech), H3K27ac (CST), FoxM1 (CST), and β-catenin (CST) were incubated. Specific proteins were detected by enhanced chemiluminescence (ECL, Millipore, Bredford, USA).
[0087] 6. Analysis of cell proliferation ability
[0088] Glioma cells were seeded in 96-well cell culture plates at a density of 3000 cells / well. After transfection for 24, 48, 72, and 96 h, cell proliferation was analyzed using the Cell Counting Kit-8 (CCK-8). 10 μL of CCK-8 reagent was added to each well and then incubated in a cell culture incubator for 1 h. Then, the optical density was measured at 450 nm using Ensight (PerkinElmer), and the cell proliferation curve was analyzed and plotted.
[0089] 7. Colony formation assay
[0090] Cells were seeded into 6-well plates at a density of 1000 cells / well. DMEM containing 10% fetal bovine serum was changed every three days. After 15 days, the cells were fixed with methanol, stained with crystal violet for 15 minutes, and photographed. Each experiment was repeated 3 times.
[0091] 8. Spheroid formation assay
[0092] Cells were seeded into 12-well plates at a density of 1000 cells / well and cultured using Neurobasal stem cell medium. After 10 days, the number of spheroids was detected by microscopy and photographed and counted. Each experiment was repeated 3 times.
[0093] 9. Cell invasion ability detection assay
[0094] Glioma spheroids were incubated in a spheroid formation matrix for 72 h. Spheroids with a diameter of >2 mm were implanted into 96-well plates, and invasion gel (Trevigen; Gaithersburg, MD, USA) was added. Glioma spheroids were photographed under a microscope every 24 h. The ellipsoid at 0 h was used as a reference point for measuring the invasion area of invasive cells.
[0095] The GBM-brain organoid co-culture invasion in vitro system was that GFP-transfected GBM cells were cultured into glioma spheroids and then co-cultured with mature brain organoids for 72 h. The invasion images of GBM cells were captured under a confocal microscope (Leica TCS SP8; Wetzlar, Germany).
[0096] 10. Flow cytometry
[0097] For cell cycle analysis, cells were harvested, fixed with 75% ethanol for 48 hours at 4°C, and incubated with propidium iodide (PI; BD Biosciences; Franklin Lakes, NJ, USA) for 15 minutes. To detect apoptosis of cells, the cells were rinsed with PBS, resuspended, and incubated with Annexin V-FITC and PI (BD Biosciences) for 15 minutes. All cells were analyzed on a C6 flow cytometer (BD Biosciences), and the data were analyzed using FlowJo software (V10, BD Biosciences).
[0098] 11. Chromatin Immunoprecipitation (ChIP) Assay
[0099] The ChIP assay was performed using the EZ-ChIP Immunoprecipitation Kit (Millipore; Billerica, MA, USA). The following antibodies were used: anti-H3K27ac (ab4729, 1:100, Abcam) and normal rabbit IgG (#2729, 1:100, Cell Signaling Technology). The primer sequences for the H3K27ac binding sites in the FoxM1 promoter were as follows:
[0100] FOXM1(H3K27ac)-88F TAAGCAGTGAGAAGGCCACG FOXM1(H3K27ac)-88R TGGAGATTTGGGTCACACGG FOXM1(H3K27ac)-183F GGAGCAGGGGAGTGTGTATG FOXM1(H3K27ac)-183R CGTGGCCTTCTCACTGCTTA
[0101] Briefly, GBM cells or NHAs were crosslinked with 1% formaldehyde solution for 10 minutes and quenched with 0.125 M glycine. The cells were spun down, washed, resuspended, lysed, and sonicated. The fragmented chromatin extracts were pre-cleared with agarose beads in the ChIP kit and incubated overnight with the antibody or normal rabbit IgG as a control. After washing, elution, and reverse crosslinking, the DNA was analyzed by qPCR.
[0102] 12. In Vivo Experiments in Mice
[0103] Intracranial gliomas were established by stereotactically implanting GBM#P3 fluorescent cells (1×106) transfected with the HMGCL stable knockdown virus into the brains of mice. Bioluminescence imaging was used to detect the growth of intracranial tumors on days 4 and 20. Kaplan-Meier survival curves were used to describe survival time and body weight.
[0104] 13. Statistical Analysis
[0105] GraphPad Prism 7 software was used, and ANOVA or t-test was applied. All experiments were repeated three times, and the mean ± standard error was taken. The Kaplan-Meier survival curve was analyzed using the log-rank test. The chi-square test and Fisher's exact analysis were applied to determine the relationship between HMGCL expression and clinicopathology. P < 0.05 was considered statistically significant.
[0106] II. Experimental Results
[0107] 1. HMGCL gene is abnormally highly expressed in GBM and is related to tumor grade and prognosis
[0108] The results of TCGA bioinformatics analysis showed that HMGCL was correlated with glioma grade, IDH mutation status, etc. ( Figure 1 A), and HMGCL was highly expressed in the IDH wild-type group and the 1p / 19q non-codel group ( Figure 1 B, 1C); the Kaplan-Meier survival curve and Log-rank test suggested that in the three databases, the expression level of HMGCL was indicative of the overall survival period after glioma surgery, and high expression could predict poor prognosis ( Figure 1 D). Immunohistochemical staining in the clinical cases we collected (n = 20) showed that the expression level of HMGCL increased with the increase of glioma grade ( Figure 1 E); meanwhile, the expression level of HMGCL in glioma cell lines and glioma stem cell lines was higher than that in normal astrocytes ( Figure 1 F). Combining the above information indicates that HMGCL has important clinical indicative significance in glioma tissues, and it can be used as a new biological marker to provide a basis for the prognosis evaluation of glioma patients.
[0109] 2. Specific interference with HMGCL significantly inhibits the malignant proliferation of glioma
[0110] To evaluate the function of HMGCL in GBM, we constructed lentiviruses to specifically knockdown the expression of HMGCL protein in GBM cells LN229, U251MG, and GBM#P3. The subsequent CCK-8 and EdU experimental results showed that the proliferation of the three GBM cell lines in the HMGCL knockdown group decreased after 4 days ( Figure 2 A, 2B). The 3D sphere invasion experiment and brain-like invasion experiment we conducted suggested that knockdown of HMGCL would lead to a decrease in the invasion activity of tumor cells ( Figure 2 C, 2D). Meanwhile, knockdown of HMGCL would also cause G1 / S phase arrest and lead to a decrease in colony formation ( Figure 2 E). The in vivo experiment we conducted subsequently suggested that knockdown of HMGCL could inhibit tumor growth ( Figure 2F, 2G), and can extend the survival time of nude mice bearing tumors ( Figure 2 H). Immunohistochemical staining indicated that the level of Ki-67 decreased after inhibiting HMGCL ( Figure 2 I).
[0111] 3. HMGCL knockdown leads to downregulation of histone acetylation epigenetic modification in glioma
[0112] Since HMGCL is a key metabolic enzyme, its downstream metabolites include acetyl-CoA, acetoacetate, and β-hydroxybutyrate further metabolized from acetoacetate. To detect which metabolite plays a role, we detected several metabolites and found that only acetyl-CoA decreased significantly after HMGCL knockdown ( Figure 2 A). Since acetyl-CoA is a key raw material for histone acetylation, we detected the level of histone acetylation and found that the level of histone acetylation modification decreased after HMGCL knockdown ( Figure 2 B). To further prove it, after using TSA and changing the concentrations of glucose and acetate in the medium, etc., the decreased level of histone acetylation was rescued ( Figure 2 C, 2D, 2E).
[0113] 4. mRNA-seq sequencing indicates that HMGCL can regulate the transcription of the cell cycle-related molecule FoxM1
[0114] Histone acetylation modification can play a pro-cancer role by activating the transcription of multiple downstream classical oncogenes. Based on this, we first performed RNA-seq sequencing on the cell samples after HMGCL knockdown (completed by LC Sciences, Figure 4 A). The enrichment analysis results showed that the cell cycle-related pathways were significantly altered in HMGCL-KD cells ( Figure 4 B). By taking the intersection of the downregulated genes, genes related to the cell proliferation gene set, and genes related to glioma prognosis, two possible downstream molecules, FoxM1 and CASP2, were finally determined ( Figure 4 C). Subsequent verification experiments showed that the levels of FoxM1 decreased at both the RNA level and the protein level after HMGCL knockdown ( Figure 4 D, 4E). Fluorescence quantitative PCR indicated that the downstream expression level of FoxM1 decreased after HMGCL knockdown, suggesting that the transcriptional regulatory function of FoxM1 was inhibited ( Figure 4 F, 4G). At the same time, the expression levels of p21 and p27 increased, which was related to the G1 / S phase arrest.
[0115] 5. HMGCL affects the expression of FoxM1 by inducing hyperacetylation around the promoter.
[0116] Through the UCSC database, we determined that the promoter region of FoxM1 is regulated by histone H3K27ac modification ( Figure 5 A). We designed primers at sites upstream and downstream of the FoxM1 transcription start site for ChIP experiments to verify. The experiments showed that the H3K27ac modification level in the FoxM1 promoter region decreased ( Figure 5 B, 5C). Rescue experiments further demonstrated that the FoxM1 level could be rescued by the H3K27ac rescue condition ( Figure 5 D, 5E).
[0117] 6. HMGCL / FoxM1 can regulate β-catenin translocation and function.
[0118] Since FoxM1 can interfere with β-catenin function, we further verified the β-catenin function. After HMGCL knockdown, β-catenin decreased at the protein level ( Figure 6 A), and at the same time, its distribution in the nucleus decreased ( Figure 6 B). We detected the RNA level and found that the FoxM1 level decreased, while the β-catenin level did not change significantly ( Figure 6 C). Therefore, we speculated that HMGCL affects β-catenin by influencing the FoxM1 level. At the same time, the transcription level of β-catenin downstream molecules also decreased ( Figure 6 D).
[0119] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions recorded in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. Use of a reagent for detecting an HMGCL-encoding gene and its expression product in the preparation of a product for diagnosing and / or prognosticating glioblastoma.
2. The application according to claim 1, characterized in that, Both the HMGCL-encoding gene and its expression product are of human origin; the expression product of the HMGCL-encoding gene is the HMGCL protein, i.e., hydroxymethylglutaryl-CoA lyase; The prognosis includes the evaluation of the survival period of the subject.
3. The application according to claim 1, characterized in that, The reagent for detecting the HMGCL-encoding gene and its expression product includes substances for detecting the transcription of the HMGCL-encoding gene based on RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip, and gene sequencing, and / or substances for detecting the situation of the HMGCL expression product based on immunoassay methods; The product includes a chip, a nucleic acid membrane strip, a detection kit, or a detection device for detecting the expression level of the HMGCL in a test sample; The test sample is a human sample, including glioblastoma cells and glioblastoma tissues of the subject.
4. The application according to claim 3, wherein The chip is a gene or protein chip.
5. A system for diagnosing and / or prognosticating glioblastoma, characterized in that, The system at least includes: An acquisition module configured to: acquire the expression level of a biomarker of the subject; An evaluation module configured to: evaluate the disease condition of the subject according to the expression level of the biomarker obtained by the acquisition module; Wherein, the biomarker is the HMGCL-encoding gene and / or the expression product of the HMGCL-encoding gene.
6. The system according to claim 5, wherein, The evaluation of the disease condition of the subject includes the diagnosis of glioblastoma of the subject, the malignancy degree of glioblastoma, and the evaluation of the survival period of glioblastoma patients.
7. A computer-readable storage medium having a program stored thereon, characterized in that, When the program is executed by a processor, it realizes the functions of the system according to claim 5 or 6.
8. An electronic device, comprising a memory, a processor, and a program stored on the memory and executable on the processor, characterized in that, When the processor executes the program, it realizes the functions of the system according to claim 5 or 6.
9. Use of a substance for inhibiting the expression and / or reducing the activity of an HMGCL-encoding gene and its expression product in the preparation of a drug for treating glioblastoma; The substance for inhibiting the expression and / or reducing the activity of the HMGCL-encoding gene and its expression product is siRNA, and its sequences are as follows: siHMGCL-1: 5'- CCAGCUUUGUGUCUCCUAAGU-3'; siHMGCL-2: 5'- ACCAAGAAGUUCUACUCAAUG-3'; siNC: 5'-UUCUCCGAACGUGUCACGUTT-3'.