A high specific activity alkaline xylanase mutant
By genetically modifying alkaline xylanase and designing specific amino acid substitution sites, its specific activity was improved, solving the problems of low specific activity and high cost of existing alkaline xylanases in industrial applications, and enabling wider industrial applications.
Patent Information
- Application Number
- CN202311342665.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-12
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2042-07-12
AI Technical Summary
Existing alkaline xylanases have problems such as low enzyme activity, instability, and high cost in industrial applications, making it difficult to meet production needs.
By genetically engineering alkaline xylanase, mutants with specific amino acid substitutions were designed and constructed, including mutants at sites such as I37V, A59S, D63E, D104Y, T107M/K, N167G, and D192E, to improve its specific activity.
The specific activity of the mutants was significantly increased, generally by 8.5%-32.8%, especially the D192E single-point mutant, which had the highest specific activity of 1625.11 U/mg, reducing production costs and promoting its application in the industrial field.
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a high specific activity basic xylanase mutant and its applications. Background Technology
[0002] Xylan is a widely distributed pentose sugar in nature. Xylanases are enzymes that degrade xylan into xylobiose, oligosaccharides (including those higher than xylobiose), and small amounts of xylose. They play a crucial role in the xylan degradation process. Because xylan has a complex composition, its hydrolysis requires the synergistic action of multiple enzymes. Therefore, in a broad sense, xylanase refers to a group of enzymes that can hydrolyze xylan into oligosaccharides or monosaccharides, including endoβ-1,4-D-xylanase, β-D-xylosidase, α-L-arabinosidase, α-D-glucuronidase, acetylxylanase, and phenolic esterase. In a narrow sense, xylanase refers specifically to endoβ-1,4-D-xylanase. Xylanases have a wide range of sources and can be produced by various types of microorganisms. Based on their tolerance to acidic and alkaline environments, xylanases can be classified as alkaline, neutral, and acidic.
[0003] Alkaline xylanase plays a vital role in the paper, feed, and food industries. Particularly in papermaking, it significantly reduces pollution emissions and improves product quality, particularly in pulping, bleaching, and waste paper deinking. Pretreatment of alkaline straw pulp with xylanase AU-PE89 before bleaching increased the yield of Grade A pulp by 1.43%, fine pulp yield by 1.48%, and improved sheet strength, while reducing fiber damage during the washing and bleaching stages. Studies have shown that adding xylanase from *Arthrobacter sp.* MTCC5214 during pulp bleaching reduced the kappa value of sulfate pulp by 20%, equivalent to a 29% reduction in chlorine usage during bleaching. Furthermore, compared to untreated pulp, enzyme treatment increased pulp brightness by 9.6%.
[0004] To expand the application scope of alkaline xylanase in production, many scholars have recently utilized cloning and genetic engineering techniques to express, purify, and culture alkaline xylanase genes isolated from nature, achieving significant progress. For example, Bai et al. conducted structural comparison and mutation analysis on xylanase Xyn11A-LC from Bacillus subtilis SN5, finding that the content of charged residues in alkaline xylanase increases under higher pH conditions. Furthermore, compared to neutral and acidic xylanases, alkaline xylanase has fewer serine, threonine, and tyrosine residues. Mutation analysis revealed that the participation of at least six amino acids (Glu16, Trp18, Asn44, Leu46, Arg48, Ser187) enhances the enzyme's activity under alkaline conditions. Long et al. used a dual-plasmid co-expression method to transform the xylanase gene from *Aspergillus niger* into *Pichia pastoris*, increasing its expression capacity by 33%. By optimizing culture conditions, the expression capacity was increased by 2.4 times compared to shake-flask culture, providing a new method for increasing xylanase yield in production. Liu Jun et al. established a random mutant library of the xylanase gene using error-prone PCR and double-enzyme digestion vector reconstruction. They screened four mutants whose relative enzyme activity was approximately 15% higher than the original strain enzyme within the pH range of 8.0–9.5. These four mutant sites were then combined for mutation. Each combined mutant enzyme showed higher affinity and catalytic efficiency for the substrate than the wild-type original strain enzyme, and its pH stability was also significantly higher.
[0005] Currently used xylanases suffer from problems such as low specific enzyme activity, instability, and high cost, failing to meet production needs and requiring property optimization through molecular modification. This invention provides an alkaline xylanase with high specific enzyme activity, making it more suitable for practical applications in the industrial field. Summary of the Invention
[0006] The purpose of this invention is to provide a basic xylanase mutant. The specific activity of the mutant is significantly increased compared to the wild type, which is beneficial for its widespread application in industrial fields.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] The present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, at at least one position of an amino acid substitution selected from the group consisting of: 37, 59, 63, 104, 107, 167, 192.
[0009] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0010] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0011] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: I37V, A59S, D63E, D104Y, T107M / K, N167G, D192E.
[0012] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.
[0013] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.
[0014] The present invention also relates to a host cell comprising the above-described recombinant expression vector.
[0015] When the above plasmids were transferred into host cells, the specific activity of the recombinant xylanase mutant was significantly improved.
[0016] In some embodiments of the present invention, the host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).
[0017] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).
[0018] The present invention also provides the application of the above-mentioned xylanase mutant in the field of papermaking.
[0019] This invention provides mutants based on wild-type xylanase H1, containing at least one mutation site among I37V, A59S, D63E, D104Y, T107M / K, N167G, and D192E. Compared with wild-type xylanase H1, the specific activity of the xylanase mutants provided by this invention is generally increased by 8.5%-32.8%; among them, the xylanase mutant containing the single-point mutation D192E has the highest specific activity, reaching 1625.11 U / mg, achieving unexpected technical results.
[0020] In summary, the specific activity of the xylanase mutant provided by this invention is significantly improved, which helps to reduce the production cost of xylanase and promote its widespread application in the industrial field. Detailed Implementation
[0021] This invention discloses a basic xylanase mutant, its preparation method and application, the DNA molecule encoding the basic xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0022] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:
[0023] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.
[0024] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.
[0025] Culture medium formulation:
[0026] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0027] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
[0028] Yeast selection medium (MD medium): 2% peptone, 2% agarose;
[0029] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin;
[0030] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol;
[0031] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0032] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;
[0033] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;
[0034] Lower culture medium plates: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar.
[0035] The present invention will be further illustrated below with reference to the embodiments:
[0036] Example 1 Construction of recombinant plasmid
[0037] The source of Paecilomyces ( Paecilomyces. sp The xylanase gene (GeneBank ACS26244.1) of *Pichia pastoris* was optimized based on codon bias, with the addition of 6 bases GAATTC (EcoRI cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named H1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.
[0038] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with restriction endonucleases EcoRI and Not I. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).
[0039] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-H1.
[0040] Example 2 Screening of high specific activity xylanase mutants
[0041] To further enhance the enzymatic activity of xylanase H1, the applicant conducted protein structure analysis. This protein belongs to the GH11 family of xylanases and has a β-jelly roll structure. The applicant used directed evolutionary evolution technology to screen for a large number of mutations in this enzyme.
[0042] 1.1 Design of PCR primers H1-F1 and H1-R1:
[0043] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (The underlined part is the EcoRI restriction enzyme recognition site);
[0044] H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (The underlined part is the NotI restriction enzyme recognition site).
[0045] Using the H1 gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The resulting product was transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.
[0046] 30 μl of lysis buffer was transferred to two new 96-well plates. 30 μl of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was determined using the DNS method. 150 μl of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity and protein content of different mutants were calculated. Ultimately, the applicant screened single-point mutants I37V, A59S, D63E, D104Y, T107M, T107K, N167G, and D192E from over 20,000 transformants, demonstrating significantly increased xylanase specific activity.
[0047] Based on the above-mentioned wild-type xylanase H1, this invention provides mutants containing single mutation sites of I37V, A59S, D63E, D104Y, T107M / K, N167G, and D192E, respectively.
[0048] Example 3 Expression of xylanase in Pichia pastoris
[0049] 3.1 Construction of expression vector
[0050] Based on the codon preference of Pichia pastoris, the gene sequences of xylanase H1 and its mutants were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.
[0051] Following the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μl, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.
[0052] 3.2 Construction of Pichia pastoris engineered strains
[0053] 3.2.1 Preparation of competent yeast cells
[0054] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min, and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).
[0055] 3.2.2 Conversion and Screening
[0056] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.
[0057] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing xylanase H1 and xylanase mutant, respectively.
[0058] 1. Method for determining xylanase activity
[0059] (1) Definition of xylanase enzyme activity unit
[0060] Under conditions of 50℃ and pH 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, denoted by U.
[0061] (2) Method for determining xylanase activity
[0062] Take 10.0 ml of xylan solution and equilibrate at 50°C for 20 min.
[0063] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.
[0064] Blank sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, add 5 ml of DNS reagent, and vibrate electromagnetically for 3 s. Then add 2.0 ml of xylan solution, equilibrate at 50℃ for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to a final volume of 25 ml, and vibrate electromagnetically for 3-5 s. Using the standard blank sample as a blank control, measure the absorbance A at 540 nm. B .
[0065] Sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, then add 2.0 ml of xylan solution (equilibrated at 50℃), vibrate electromagnetically for 3 s, and precisely incubate at 50℃ for 30 min. Add 5.0 ml of DNS reagent, vibrate electromagnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with water, vibrating electromagnetically for 3 s. Using a standard blank sample as a blank control, measure the absorbance A at 540 nm. E .
[0066] X D =[(A E - A B )×K+ C0]×N×1000 / (M×t).
[0067] In the formula:
[0068] X D —Xylanase activity in the sample dilution, U / ml;
[0069] A E —Absorbance of the enzyme reaction solution;
[0070] A B —Absorbance of the enzyme blank sample;
[0071] K—the slope of the standard curve;
[0072] C0—The intercept of the standard curve;
[0073] M—The molar mass of xylose, M(C5XYN110O5) = 150.2 g / mol;
[0074] t—Enzymatic hydrolysis reaction time, min;
[0075] N—Enzyme solution dilution factor;
[0076] 1000 — conversion factor, 1 mmol = 1000 μmol.
[0077] (3) Measurement results
[0078] Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase H1 and its mutant was 420-750 U / mL.
[0079] 2. Protein content determination method
[0080] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.
[0081] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method.
[0082] The protein content was determined using the method described above. The results showed that the protein content of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase H1 and its mutants was 0.34-0.5 mg / mL.
[0083] 3. Specific vitality calculation
[0084] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.
[0085] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).
[0086] The specific results are shown in Table 1.
[0087] Table 1 Comparison of specific activities of alkaline xylanase mutants
[0088] Xylanase and its single-point mutants Specific activity (U / mg) Wild type H1 1223.00 I37V 1328.92 A59S 1615.01 D63E 1395.12 D104Y 1397.25 T107M 1319.89 T107K 1379.92 N167G 1462.18 D192E 1625.11
[0089] As can be seen from the results in Table 1, compared with wild-type xylanase H1, the specific activity of the alkaline xylanase mutants provided by the present invention is generally increased by 8.5%-32.8%; among them, the alkaline xylanase mutant containing the D192E single-point mutation has the highest specific activity, reaching 1625.11 U / mg, achieving unexpected technical results.
[0090] In summary, the alkaline xylanase mutant provided by this invention has a significantly improved specific activity, which helps to reduce the production cost of the enzyme and promote its widespread application in the industrial field, especially in the papermaking industry.
Claims
1. A xylanase mutant, characterized in that, The mutant is a xylanase with the amino acid sequence SEQ ID NO:1 in which the 167th amino acid is changed from Asn to Gly.
2. A DNA molecule encoding the xylanase mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3.
5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).
6. The application of the xylanase mutant of claim 1 in the papermaking field.
Citation Information
Patent Citations
Xylanase variants and polynucleotides encoding same
CN109415710A
Xylanase variants and polynucleotides encoding same
US20180010110A1