A nucleic acid, a composition and a conjugate containing the nucleic acid, and a preparation method and uses thereof
By introducing stable modified nucleotides at specific locations of siRNA, the off-target effects and toxicity problems of siRNA in inhibiting the expression of APOC3 genes are solved, and efficient and safe treatment of dyslipidemia is achieved.
Patent Information
- Application Number
- CN202280046072.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-07-16
- Filing Date
- 2022-06-30
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2042-06-30
AI Technical Summary
Existing siRNAs have significant off-target effects and toxicity problems when inhibiting the expression of APOC3 gene, and are difficult to apply in drug development.
A siRNA was designed with the sense strand and antisense strand consisting of 19 nucleotides, containing stabilizing modified nucleotides at specific locations, such as 2'-O-methoxyethyl modification, which enhances thermal stability and reduces off-target effects while maintaining inhibitory activity on the APOC3 gene.
It significantly reduced off-target effects and toxic reactions, improved the stability of siRNA and the inhibitory activity of APOC3 gene expression, and showed good blood lipid reduction effect, safety and therapeutic effect.
Smart Images

Figure CN117580953B_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to a nucleic acid capable of inhibiting apolipoprotein C3 (APOC3) gene expression with reduced off-target effects, and a composition and conjugate containing the nucleic acid. The present disclosure also relates to methods for preparing and uses of these nucleic acids, compositions and conjugates. Background Art
[0002] Dyslipidemia, also known as hyperlipidemia, is a systemic disease in which fat metabolism or transport is abnormal, resulting in plasma lipids being higher than normal values, seriously threatening the health of patients worldwide. Apolipoprotein C3 (APOC3) plays an important role in lipid metabolism. In people carrying the APOC3 mutant gene, the expression level of APOC3 in the blood circulation decreases by 46%, and the plasma triglyceride level decreases by 39% compared with ordinary people. Therefore, using small interfering RNA (siRNA) to silence gene expression at the gene level and block APOC3 is undoubtedly an ideal means for treating dyslipidemia related to APOC3. In recent years, considerable progress has been made in the development of siRNA for inhibiting APOC3 gene expression into drugs.
[0003] In the research on the development of siRNA into drugs, the off-target effect is one of the important side effects related to toxicity. Currently, many siRNAs that show excellent pharmaceutical activities in preclinical pharmaceutical studies are difficult to be used in actual drug development due to the toxicity caused by their off-target effects. An ideal siRNA expected to be used for preparing drugs for actual application to patients should undoubtedly have low toxicity, including low toxicity caused by off-target effects. Therefore, how to obtain siRNAs with low off-target effects still needs to be further explored in this field. Summary of the Invention
[0004] In order to develop an siRNA capable of inhibiting the APOC3 gene with significantly reduced off-target effects, the inventors unexpectedly found that siRNAs having stabilized modified nucleotides at specific positions in the sequence showed significantly lower off-target effects than siRNAs without stabilized modified nucleotides at the corresponding positions. Further, some siRNAs having stabilized modified nucleotides at specific positions in the sequence showed significantly lower off-target effects while also showing APOC3 gene inhibitory activities that were not significantly reduced or comparable to those of siRNAs without stabilized modified nucleotides. Therefore, the inventors made the following inventions.
[0005] In one aspect, the present disclosure provides an siRNA. The siRNA comprises an antisense strand and a sense strand. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II. Both nucleotide sequence I and nucleotide sequence II consist of 19 nucleotides. Each nucleotide in nucleotide sequence I and nucleotide sequence II is a modified or unmodified nucleotide. Nucleotide sequence I and nucleotide sequence II are at least partially reverse complementary to form a double-stranded region. Nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, and the first nucleotide sequence is a nucleotide sequence with a length of 19 nucleotides in the mRNA expressed by the APOC3 gene. In the direction from the 5'-end to the 3'-end, at least one of the 3rd to 6th nucleotides of nucleotide sequence II is a stabilized modified nucleotide. The stabilized modified nucleotide refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose of the nucleotide is replaced by a stabilized modifying group. Compared with the siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilized modified nucleotide has increased thermal stability, and the steric hindrance of the stabilized modifying group is greater than that of 2'-O-methyl.
[0006] In another aspect, the present disclosure further provides a pharmaceutical composition, which contains the siRNA provided by the present disclosure and a pharmaceutically acceptable carrier.
[0007] In yet another aspect, the present disclosure further provides an siRNA conjugate. The siRNA conjugate contains the siRNA provided by the present disclosure and a conjugating group conjugated to the siRNA. The conjugating group comprises a linker and a pharmaceutically acceptable targeting group. Moreover, the siRNA, the linker, and the targeting group are sequentially covalently or non-covalently linked, and each targeting group is selected from ligands capable of binding to cell surface receptors.
[0008] In yet another aspect, the present disclosure further provides the use of the siRNA, pharmaceutical composition, and siRNA conjugate of the present disclosure in the preparation of a drug for treating and / or preventing diseases or symptoms related to the mRNA level of the APOC3 gene.
[0009] In yet another aspect, the present disclosure further provides a method for treating and / or preventing diseases or symptoms related to the mRNA level of the APOC3 gene. The method comprises administering the siRNA, pharmaceutical composition, and / or siRNA conjugate of the present disclosure to a subject in need thereof.
[0010] In yet another aspect, the present disclosure further provides a method for inhibiting the expression level of the APOC3 gene in cells. The method comprises contacting an effective dose of the siRNA, pharmaceutical composition, and / or siRNA conjugate of the present disclosure with the cells.
[0011] In addition, the present disclosure also provides a kit, which contains the siRNA, pharmaceutical composition and / or siRNA conjugate of the present disclosure.
[0012] Incorporated by reference
[0013] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent or patent application was specifically and individually incorporated herein by reference.
[0014] Beneficial effects
[0015] The siRNA, pharmaceutical composition and / or siRNA conjugate of the present disclosure have good stability, low off-target effects, good APOC3 gene expression inhibitory activity, and show good effects in reducing blood lipids. The specific description is as follows.
[0016] First, the siRNA, pharmaceutical composition, and / or siRNA conjugate of the present disclosure may have lower off-target effects and / or toxic reactions caused by off-target effects in vitro or in vivo. In particular, compared with a reference siRNA conjugate, mice administered the siRNA conjugate of the present disclosure showed significantly lower blood biochemical results and obvious toxicity advantages. For example, in mice administered the siRNA conjugate of the present disclosure at a dose of 100 mg / kg, the blood biochemical indices were significantly reduced, and there were no obvious abnormalities compared with the blank control group; and compared with the reference siRNA conjugate, mice administered the siRNA conjugate of the present disclosure did not show inflammatory cell infiltration and necrosis above moderate level, showing significantly lower toxic reactions in histopathology. For another example, even at a high dose of 300 mg / kg, there was no significant difference in serum ALT compared with the blank control group, and compared with 6 out of 6 mice administered the reference conjugate showing inflammatory cell infiltration in histopathological sections, only 3 mice administered the conjugate of the present disclosure showed inflammatory cell infiltration, and the number of mice with inflammatory cell infiltration was significantly reduced. For another example, the siRNA conjugate of the present disclosure has low off-target effects. In an in vitro sicheck system, the siRNA conjugate of the present disclosure showed excellent on-target inhibitory activity for the target sequence, with an IC50 value of 4.50 pM - 11.3 pM. At the same time, the inhibition rate for off-target sequences was less than 50% within the entire tested siRNA concentration range, showing low off-target effects. For another example, in mice administered the siRNA conjugate of the present disclosure at a high dose of 300 mg / kg weekly for three consecutive weeks, the serum ALT and AST concentrations were comparable to those of the blank control group; further, in pathological sections, mice administered the siRNA conjugate of the present disclosure also showed reactions similar to those of the blank control group in terms of hepatic steatosis and inflammation, without significant abnormalities, indicating that the siRNA conjugate of the present disclosure has very low hepatotoxicity.
[0017] Second, the siRNAs, pharmaceutical compositions, and / or siRNA conjugates of the present disclosure exhibit excellent APOC3 gene expression regulatory activity in in vitro and in vivo experiments. For example, the siRNA conjugates provided by the present disclosure exhibit high target sequence inhibitory activity in an in vitro sicheck system, with an IC50 between 6.89 - 8.55 pM. At the same time, they have a target sequence inhibitory activity similar to that of a reference siRNA conjugate that does not contain a stabilized modified nucleotide. Another example is that the siRNA conjugates provided by the present disclosure have high target sequence inhibitory activity in an in vitro sicheck system. At a low concentration of 0.01 nM, the inhibitory rate of the target sequence expression is at least 38.92 nM, reaching a maximum of 67.54%; at a concentration of 0.1 nM, the inhibitory rate of the target sequence expression can reach 84.73 - 89.35%. At the same time, compared with a reference siRNA conjugate that does not contain a stabilized modified nucleotide, it has a target sequence inhibitory activity level that is similar or not significantly reduced.
[0018] Third, the siRNAs, pharmaceutical compositions and / or siRNA conjugates of the present disclosure exhibit good effects of reducing blood lipid TG in vivo. For example, at different time points after administration, the siRNA conjugates of the present disclosure can significantly reduce the levels of TG and CHO in the sera of mice, and show similar or insignificantly reduced effects of reducing blood lipid levels as compared with the corresponding reference siRNA conjugates that do not include stabilized modified nucleotides. In particular, at a dose of 3 mg / kg, the siRNA conjugates of the present disclosure consistently show a very high effect of reducing blood lipid TG throughout the entire dosing period of up to 50 days, with a maximum inhibition rate of up to 90.2%. For another example, at different time points after administration, the siRNA conjugates of the present disclosure can significantly reduce the levels of TG and CHO in the sera of mice, and show similar effects of reducing blood lipid levels as compared with the corresponding reference siRNA conjugates that do not include stabilized modified nucleotides. In particular, at doses of 3 mg / kg and 1 mg / kg, the siRNA conjugates of the present disclosure consistently show a very high effect of reducing blood lipid TG throughout the entire dosing period of up to 50 days, with a maximum inhibition rate of up to 92.0%. For another example, at different time points after administration, siRNA conjugates of the present disclosure at different concentrations can all reduce the level of TG in the sera of mice. In particular, at a dosing dose of 9 mg / kg, after only one administration, the siRNA conjugates of the present disclosure can maintain an inhibition rate of the TG level greater than 50% for a long period of 64 days, and the maximum inhibition rate can reach 89.5%, showing excellent blood lipid inhibition ability. For another example, at different time points after administration, the siRNA conjugates of the present disclosure can significantly reduce the levels of TG and CHO in the sera of mice, and maintain a relatively high inhibition effect throughout 43 days during the experiment. In particular, the siRNA conjugates of the present disclosure at a dose of 3 mg / kg all show excellent effects of inhibiting blood lipids in mice, with the maximum inhibition rate of serum TG being higher than 88%; the maximum inhibition rate of serum CHO is 51.18% - 57.41%. For another example, at different time points after administration, the siRNA conjugates of the present disclosure can significantly reduce the levels of TG and CHO in the sera of mice, maintain a relatively high inhibition effect throughout 22 days during the experiment, and show similar effects of reducing blood lipid levels as compared with the corresponding reference siRNA conjugates that do not include stabilized modified nucleotides.
[0019] This shows that the siRNAs, pharmaceutical compositions and siRNA conjugates provided by the present disclosure can, while having significantly lower off-target effects and toxic reactions caused by off-target effects, especially hepatotoxic reactions, effectively inhibit the expression of the APOC3 gene in vitro and in vivo, and show good activity of reducing blood lipids. Therefore, they can effectively treat and / or prevent disease symptoms related to the mRNA level of APOC3 gene expression, especially dyslipidemia, with significantly higher safety, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1A and Figure 1B are scatter plots of the concentrations of ALT and AST in the sera of mice after administration of 300 mg / kg of the siRNA conjugate of the present disclosure or PBS each week for three consecutive weeks, respectively.
[0021] Figure 2 is a bar graph of the relative expression levels of the target sequence in the in vitro sicheck system after co-transfection of a plasmid containing the target sequence and the siRNA conjugate or the reference siRNA NC.
[0022] Figure 3A and Figure 3B are line graphs showing the changes in serum TG levels or serum CHO levels over time after administration of the siRNA conjugate of the present disclosure, the reference siRNA conjugate, or PBS, respectively.
[0023] Figure 4A and Figure 4B are line graphs showing the changes in serum TG levels or serum CHO levels over time after administration of the siRNA conjugate of the present disclosure, the reference siRNA conjugate, or PBS, respectively.
[0024] Figure 5A and Figure 5B are line graphs showing the changes in serum TG levels or serum CHO levels over time after administration of the siRNA conjugate of the present disclosure or PBS, respectively.
[0025] Figure 6 is a line graph showing the changes in serum TG levels over time after administration of different concentrations of the siRNA conjugate of the present disclosure or PBS.
[0026] Figure 7A and Figure 7B are line graphs showing the changes in serum TG levels or serum CHO levels over time after administration of the siRNA conjugate of the present disclosure or PBS, respectively.
[0027] Figure 8A and Figure 8B are line graphs showing the changes in serum TG levels or serum CHO levels over time after administration of the siRNA conjugate of the present disclosure, the reference siRNA conjugate, or PBS, respectively. DETAILED DESCRIPTION OF THE INVENTION
[0028] The following provides a detailed description of the specific embodiments of the present disclosure. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the present disclosure.
[0029] In the present disclosure, unless otherwise specified, APOC3 mRNA or "mRNA expressed by the APOC3 gene" refers to mRNA having the sequence shown in Genbank accession number NM_000040.3, and the APOC3 gene refers to the gene that transcribes the above APOC3 mRNA.
[0030] Definitions
[0031] In the foregoing and the following, unless otherwise specified, the capital letters C, G, U, and A represent the base composition of nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a nucleotide modified with a methoxy group; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a nucleotide modified with a fluoro group; the lowercase letter s indicates that there is a phosphorothioate linkage between the two nucleotides adjacent to the left and right of the letter s; P1 indicates that the nucleotide adjacent to the right of the P1 is a nucleotide modified with a 5'-phosphate nucleotide or a 5'-phosphate analog. In some embodiments, P1 is VP, Ps, or P representing specific modifications, wherein the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a nucleotide modified with vinyl phosphate (5'-(E)-vinylphosphonate, E-VP); the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a nucleotide modified with a phosphorothioate group; the capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5'-phosphate nucleotide.
[0032] In the foregoing and the following, the "fluoro-modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose of the nucleotide with a fluoro group, and the "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog formed by substituting the hydroxyl group at the 2'-position of the ribose of the nucleotide with a non-fluoro group. "Nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide, or thymidine deoxyribonucleotide. Such as an isonucleotide, a bridged nucleic acid (abbreviated as BNA), or an acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide formed by substituting the 2'-hydroxyl group of the ribose with a methoxy group.
[0033] In the context of the present text, the expressions "complementary" or "reverse complementary" may be used interchangeably and have the meaning well-known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary to each other, and the sequence of one strand can be deduced from the sequence of its complementary strand. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at corresponding positions do not pair in a complementary form.
[0034] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "essentially reverse complementary" means that there is no more than 1 base mismatch between the two nucleotide sequences; "fully reverse complementary" means that there are no base mismatches between the two nucleotide sequences.
[0035] In the above and below, especially when describing the preparation methods of the siRNA, pharmaceutical compositions or siRNA conjugates of the present disclosure, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes RNA phosphoramidites are also called Nucleoside phosphoramidites) used in solid-phase phosphoramidite synthesis according to the types and sequences of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid-phase phosphoramidite synthesis is a method well-known to those skilled in the art for RNA synthesis. The nucleoside monomers used in the present disclosure are all commercially available.
[0036] Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitutions or substitution patterns that are spatially impracticable, synthetically infeasible and / or inherently unstable.
[0037] As used herein, "alkyl" refers to straight-chain and branched-chain groups having a specified number of carbon atoms, typically from 1 to 20 carbon atoms, such as from 1 to 10 carbon atoms, e.g., from 1 to 8 or from 1 to 6 carbon atoms. For example, C1-C6 alkyl includes straight-chain and branched-chain alkyl groups having from 1 to 6 carbon atoms. When referring to an alkyl residue having a specific number of carbons, all branched-chain and straight-chain forms having that number of carbons are intended to be encompassed; thus, for example, "butyl" means including n-butyl, sec-butyl, isobutyl, and tert-butyl; "propyl" includes n-propyl and isopropyl. An alkylene is a subset of alkyl and refers to a residue that is the same as alkyl but has two attachment points.
[0038] As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond, which is obtained by removing one molecule of hydrogen from adjacent carbon atoms of the parent alkyl group. The group can be in the cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to: vinyl; propenyl, such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl; butenyl, e.g., but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, buta-1,3-dien-2-yl, and the like. In certain embodiments, the alkenyl group has from 2 to 20 carbon atoms, while in other embodiments, it has from 2 to 10, from 2 to 8, or from 2 to 6 carbon atoms. An alkenylene is a subset of alkenyl and refers to a residue that is the same as alkenyl but has two attachment points.
[0039] As used herein, "alkynyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond, which is obtained by removing two molecules of hydrogen from adjacent carbon atoms of the parent alkyl group. Typical alkynyl groups include, but are not limited to: ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, e.g., but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl, and the like. In certain embodiments, the alkynyl group has from 2 to 20 carbon atoms, while in other embodiments, it has from 2 to 10, from 2 to 8, or from 2 to 6 carbon atoms. An alkynylene is a subset of alkynyl and refers to a residue that is the same as alkynyl but has two attachment points.
[0040] As used herein, "alkoxy" refers to an alkyl group having a specified number of carbon atoms connected by an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy, and the like. An alkoxy group typically has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms connected by an oxygen bridge.
[0041] As used herein, "aryl" refers to a group formed by deriving from an aromatic monocyclic or polycyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only carbon and hydrogen and 6 to 18 carbon atoms, wherein at least one ring in the ring system is completely unsaturated, i.e., contains a cyclic, delocalized (4n + 2)π-electron system according to Hückel's theory. Aryl groups include, but are not limited to, groups such as phenyl, fluorenyl, and naphthyl. Arylene is a subset of aryl and refers to a residue that is the same as aryl but has two attachment points.
[0042] "Heteroaryl" refers to a group derived from a 3- to 18-membered aromatic ring radical, containing 2 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen, and sulfur. As used herein, heteroaryl can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, wherein at least one ring in the ring system is fully unsaturated, i.e., contains a cyclic delocalized (4n + 2)π-electron system according to Hückel's theory. Heteroaryl includes fused-ring or bridged-ring systems. In some embodiments, the heteroatoms in heteroaryl are oxidized heteroatoms. In some embodiments, heteroaryl contains one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in heteroaryl are quaternized nitrogen atoms. Heteroaryl is attached to the rest of the molecule through any ring atom. Examples of heteroaryl include, but are not limited to: azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3-benzodioxazolyl, benzofuranyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, chromenyl, chromenone, benzofuranyl, benzofuranone, benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopentano[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanone, furo[3,2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindolyl, dihydroindolyl, isoindolinyl, isoquinolinyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl (5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl and thiophenyl / thienyl.,
[0043] A variety of hydroxyl protecting groups can be used in the present disclosure. Generally, a protecting group renders a chemical functionality insensitive to specific reaction conditions and can be added to and removed from that functionality in a molecule without substantially damaging the remainder of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd ed, John Wiley & Sons, New York, 1991, which are hereby incorporated by reference in their entireties. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenyloxanthren-9-yl (Pixyl), and 9-(p-methoxyphenyl)oxanthren-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4′-dimethoxytrityl), and TMTr (4,4′,4″-trimethoxytrityl).
[0044] As used herein, the term "subject" refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and any species of poultry.
[0045] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic benefit. A "therapeutic benefit" means eradicating or ameliorating the underlying disorder being treated. In addition, a therapeutic benefit is obtained by eradicating or ameliorating one or more of the physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying disorder.
[0046] As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a prophylactic benefit. To obtain a "prophylactic benefit", a double-stranded siRNA, pharmaceutical composition, or siRNA conjugate can be administered to a subject at risk of developing a particular disease or to a subject exhibiting one or more physiological symptoms of a reported disease, even if a diagnosis of the disease has not yet been made.
[0047] The siRNA of the present disclosure
[0048] In one aspect, the present disclosure provides an siRNA having high APOC3 gene inhibitory activity and low off-target effects.
[0049] The siRNA of the present disclosure contains nucleotide groups as basic structural units. As is well known to those skilled in the art, the nucleotide groups contain phosphate groups, ribose groups, and bases, which will not be elaborated herein again.
[0050] The siRNA of the present disclosure comprises a sense strand and an antisense strand. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II. Both nucleotide sequence I and nucleotide sequence II consist of 19 nucleotides. Each nucleotide in nucleotide sequence I and nucleotide sequence II is a modified or unmodified nucleotide. Nucleotide sequence I and nucleotide sequence II are at least partially reverse complementary to form a double-stranded region. Nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, and the first nucleotide sequence is a nucleotide sequence of 19 nucleotides in the mRNA expressed by the APOC3 gene; in the direction from the 5'-end to the 3'-end, at least one of the 3rd to 6th nucleotides of nucleotide sequence 2 is a stabilized modified nucleotide. The stabilized modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose of the nucleotide is replaced by a stabilized modifying group. Compared with an siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilized modified nucleotide has increased thermal stability, and the steric hindrance of the stabilized modifying group is greater than that of 2'-O-methyl.
[0051] In some embodiments, in the direction from the 5'-end to the 3'-end, the 3rd or 5th nucleotide in nucleotide sequence II is the stabilized modified nucleotide. In some embodiments, in the direction from the 5'-end to the 3'-end, no more than 2 nucleotides among the 3rd to 9th nucleotides in nucleotide sequence II are the stabilized modified nucleotides. By limiting the number of stabilized modified nucleotides at specific positions, the siRNA of the present disclosure can achieve an optimal balance between pharmaceutical activity and low off-target effects, and at the same time has excellent stability. In some embodiments, in the direction from the 5'-end to the 3'-end, the 3rd and / or 5th nucleotide in nucleotide sequence II is the stabilized modified nucleotide. In some embodiments, in the direction from the 5'-end to the 3'-end, the 3rd nucleotide in nucleotide sequence II is the stabilized modified nucleotide. In some embodiments, in the direction from the 5'-end to the 3'-end, the 5th nucleotide in nucleotide sequence II is the stabilized modified nucleotide.
[0052] In the siRNAs of the present disclosure, in the direction from the 5'-end to the 3'-end, nucleotides other than the 3rd to 9th nucleotides in the nucleotide sequence II are not stabilized modified nucleotides. If at least one of the 3rd to 6th nucleotides in the nucleotide sequence II is a stabilized modified nucleotide and there are stabilized modified nucleotides outside the 3rd to 9th nucleotides, it may significantly affect the regulatory ability of the siRNA on the expression level of the target sequence.
[0053] In some embodiments, "the increased thermal stability of the siRNA" means that the thermal dissociation temperature (Tm) of the siRNA increases. In some embodiments, "the increased thermal stability of the double-stranded siRNA" means that the Tm of the siRNA increases by at least 0.05 °C, in some embodiments by 0.1 - 6 °C, and in some embodiments by 0.5 - 4 °C. Without being limited by theoretical explanations, by including stabilized modified nucleotides at specific positions, the binding ability of the antisense strand in the siRNAs of the present disclosure to the mRNA expressed by the APOC3 gene is basically not affected, while the binding to off-target mRNAs is significantly reduced, thereby reducing or even eliminating off-target effects.
[0054] In some embodiments, each of the stabilized modifying groups independently has a structure represented by -X-R, wherein X is O, NR', S or SiR'2; R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, substituted C6-C8 aryl, and each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, substituted C6-C8 aryl. The substituted C2-C6 alkyl, substituted C6-C8 aryl or substituted C1-C6 alkyl refers to a group formed by substituting one or more hydrogen atoms in C2-C6 alkyl, C6-C8 aryl or C1-C6 alkyl with a substituting group, and the substituting group is selected from one or more of the following substituents: C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxo and thio. It should be noted that the present disclosure is not intended to cover all modifying groups conforming to the above structure, but only those stabilized modifying groups that can achieve increased thermal stability of the siRNA. In some embodiments, each of the stabilized modifying groups is independently selected from one of 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxoethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl and 2'-O-2,4-dinitrophenyl. In some embodiments, each of the stabilized modifying groups is 2'-O-methoxyethyl.
[0055] In some embodiments, the siRNA with stabilized nucleotides of the present disclosure can be the following first, second, and third siRNAs, and each siRNA will be described separately below.
[0056] The first siRNA
[0057] In some embodiments, the siRNA of the present disclosure is the first siRNA. Among them, the nucleotide sequence I has the same length as the nucleotide sequence shown in SEQ ID NO: 1 and has no more than 3 nucleotide differences, and the nucleotide sequence II has the same length as the nucleotide sequence shown in SEQ ID NO: 2 and has no more than 3 nucleotide differences:
[0058] 5′-CAAUAAAGCUGGACAAGAZ1-3′(SEQ ID NO: 1);
[0059] 5′-Z2UCUUGUCCAGCUUUAUUG-3′(SEQ ID NO: 2),
[0060] wherein, Z1 is A and Z2 is U;
[0061] Moreover, the nucleotide sequence I contains a nucleotide Z3 at a position corresponding to Z1, the nucleotide sequence II contains a nucleotide Z4 at a position corresponding to Z2, and the Z4 is the first nucleotide at the 5′ end of the antisense strand. The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO: 1. Among them, each U can optionally be replaced by T. In the above and below of the present disclosure, "position corresponding" means starting from the same end of the nucleotide sequence and being in the same position in the nucleotide sequence. For example, the first nucleotide at the 3′ end of the nucleotide sequence I is the nucleotide corresponding to the 1st nucleotide of SEQ ID NO: 1.
[0062] In some embodiments, the sense strand only contains the nucleotide sequence I, and the antisense strand only contains the nucleotide sequence II.
[0063] In some embodiments, there are no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1, and / or there are no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2.
[0064] In some embodiments, the nucleotide differences between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 include the difference at the Z4 position, and Z4 is selected from A, G or C. In some embodiments, the nucleotide difference is the difference at the Z4 position, and Z4 is selected from A, G or C. In some embodiments, Z3 is a nucleotide complementary to Z4. These nucleotide differences do not significantly reduce the target gene inhibition ability of the siRNA or increase the off-target effect of the siRNA, and these siRNAs containing nucleotide differences are also within the protection scope of the present disclosure.
[0065] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the essentially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.
[0066] In some embodiments, in the direction from the 5′ end to the 3′ end, the nucleotides at positions 2-19 of the nucleotide sequence II are completely reverse complementary to the nucleotides at positions 1-18 of the first nucleotide sequence. In some embodiments, the nucleotide sequence II is completely reverse complementary to the nucleotide sequence I, or there is a base mismatch between the second nucleotide in the nucleotide sequence II in the 5′-to-3′ direction and the second nucleotide in the nucleotide sequence I in the 3′-to-5′ direction. By including this base mismatch, the target gene expression inhibition activity of the siRNA of the present disclosure can be further enhanced while maintaining a low off-target effect.
[0067] In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4:
[0068] 5′-CAAUAAAGCUGGACAAGAZ3-3′(SEQ ID NO: 3);
[0069] 5′-Z4UCUUGUCCAGCUUUAUUG-3′(SEQ ID NO: 4),
[0070] wherein, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3; in some embodiments, Z3 is A and Z4 is U.
[0071] Furthermore, the sense strand and the antisense strand are of the same or different lengths, the sense strand is 19-23 nucleotides long, and the antisense strand is 19-26 nucleotides long. Thus, the length ratio of the sense strand and the antisense strand of the siRNA provided by the present disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22. In some embodiments, the length ratio of the siRNA sense strand to the antisense strand is 19 / 21, 21 / 23 or 23 / 25.
[0072] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV, each nucleotide of the nucleotide sequence III and nucleotide sequence IV is independently one of the non-fluorinated modified nucleotides and is not the stabilizing modification, the lengths of the nucleotide sequence III and nucleotide sequence IV are 1-4 nucleotides respectively, the nucleotide sequence IV and the nucleotide sequence III are equal in length, and the nucleotide sequence IV and the nucleotide sequence III are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is connected to the 5′ end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3′ end of the nucleotide sequence II. In addition, the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, and the second nucleotide sequence refers to a nucleotide sequence in the mRNA expressed by the APOC3 gene that is adjacent to the aforementioned first nucleotide sequence and has the same length as the nucleotide sequence IV.
[0073] In some embodiments, the lengths of both nucleotide sequences III and IV are 1 nucleotide, the base of nucleotide sequence III is C, and the base of nucleotide sequence IV is G; the base of the second nucleotide sequence is C; at this time, the length ratio of the sense strand to the antisense strand is 20 / 20; or, the lengths of both nucleotide sequences III and IV are 2 nucleotides, the base composition of nucleotide sequence III is CC, and the base composition of nucleotide sequence IV is GG; the composition of the second nucleotide sequence is CC; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21; or, the lengths of both nucleotide sequences III and IV are 3 nucleotides, the base composition of nucleotide sequence III is UCC, and the base composition of nucleotide IV is GGA; the composition of the second nucleotide sequence is UCC; at this time, the length ratio of the sense strand to the antisense strand is 22 / 22; or, the lengths of both nucleotide sequences III and IV are 4 nucleotides, the base composition of nucleotide sequence III is CUCC, and the base composition of nucleotide IV is GGAG; the base composition of the second nucleotide sequence is CUCC; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21.
[0074] In some embodiments, nucleotide sequence III and nucleotide sequence IV are completely reverse complementary. Therefore, given the base composition of nucleotide sequence III, the base composition of nucleotide sequence IV is determined.
[0075] The second siRNA
[0076] In some embodiments, the siRNA of the present disclosure is the second siRNA. Among them, the length of nucleotide sequence I is equal to the nucleotide sequence shown in SEQ ID NO: 45, and there are no more than 3 nucleotide differences, and the length of nucleotide sequence II is equal to the nucleotide sequence shown in SEQ ID NO: 46, and there are no more than 3 nucleotide differences:
[0077] 5′-UUAAAAGGGACAGUAUUCZ5-3′(SEQ ID NO: 45);
[0078] 5′-Z6GAAUACUGUCCCUUUUAA-3′(SEQ ID NO: 46),
[0079] wherein, Z5 is U, and Z6 is A;
[0080] Furthermore, nucleotide Z7 corresponding to Z5 is included in nucleotide sequence I, nucleotide Z8 corresponding to Z6 is included in nucleotide sequence II, and Z8 is the first nucleotide at the 5'-end of the antisense strand. The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO: 45. Among them, each U can optionally be replaced by T.
[0081] In some embodiments, the sense strand only contains nucleotide sequence I, and the antisense strand only contains nucleotide sequence II.
[0082] In some embodiments, there are no more than 1 nucleotide difference between nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 45, and / or there are no more than 1 nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 46.
[0083] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 46 includes the difference at the Z8 position, and Z8 is selected from U, G or C. In some embodiments, the nucleotide difference is the difference at the Z8 position, and Z8 is selected from U, G or C. In some embodiments, Z7 is the nucleotide complementary to Z8. These nucleotide differences do not significantly reduce the target gene inhibition ability of the siRNA or increase the off-target effect of the siRNA, and these siRNAs containing nucleotide differences are also within the protection scope of the present disclosure.
[0084] In some embodiments, nucleotide sequence I and nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the essentially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.
[0085] In some embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 2-19 of nucleotide sequence II are completely reverse complementary to the nucleotides at positions 1-18 of the first nucleotide sequence. In some embodiments, nucleotide sequence II is completely reverse complementary to nucleotide sequence I, or there is a base mismatch between the second nucleotide in nucleotide sequence II in the 5'-end to 3'-end direction and the second nucleotide in nucleotide sequence I in the 3'-end to 5'-end direction. By including this base mismatch, the target gene expression inhibition activity of the siRNA of the present disclosure can be further enhanced while maintaining a low off-target effect.
[0086] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 47, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 48:
[0087] 5′-UUAAAAGGGACAGUAUUCZ7-3′(SEQ ID NO: 47);
[0088] 5′-Z8GAAUACUGUCCCUUUUAA-3′(SEQ ID NO: 48),
[0089] wherein, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7; in some embodiments, Z7 is U and Z8 is A.
[0090] Moreover, the sense strand and the antisense strand may have the same or different lengths. The length of the sense strand is 19-23 nucleotides, and the length of the antisense strand is 19-26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided in the present disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23 or 23 / 25.
[0091] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of the non-fluorinated modified nucleotides and is not the stabilizing modification. The length of nucleotide sequence III and nucleotide sequence IV is each 1-4 nucleotides, the lengths of nucleotide sequence IV and nucleotide sequence III are equal, and nucleotide sequence IV and nucleotide sequence III are substantially reverse complementary or completely reverse complementary. Nucleotide sequence III is linked to the 5' end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3' end of nucleotide sequence II. Moreover, nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, where the second nucleotide sequence refers to the nucleotide sequence adjacent to the aforementioned first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as nucleotide sequence IV.
[0092] In some embodiments, the lengths of nucleotide sequences III and IV are both 1 nucleotide, the base of nucleotide sequence III is C, and the base of nucleotide sequence IV is G; the base of the second nucleotide sequence is C; at this time, the length ratio of the sense strand to the antisense strand is 20 / 20; or, the lengths of nucleotide sequences III and IV are both 2 nucleotides, the base composition of nucleotide sequence III is GC, and the base composition of nucleotide sequence IV is GC; the composition of the second nucleotide sequence is GC; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21; or, the lengths of nucleotide sequences III and IV are both 3 nucleotides, the base composition of nucleotide sequence III is UGC, and the base composition of nucleotide sequence IV is GCA; the composition of the second nucleotide sequence is GCA; at this time, the length ratio of the sense strand to the antisense strand is 22 / 22; or, the lengths of nucleotide sequences III and IV are both 4 nucleotides, the base composition of nucleotide sequence III is UUGC, and the base composition of nucleotide sequence IV is GCAA; the base composition of the second nucleotide sequence is GCAA; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21.
[0093] In some embodiments, nucleotide sequence III and nucleotide sequence IV are completely reverse complementary. Therefore, given the base composition of nucleotide sequence III, the base composition of nucleotide sequence IV is determined.
[0094] The third siRNA
[0095] In some embodiments, the siRNA disclosed herein is a second siRNA, wherein the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO: 105, and differs by no more than 3 nucleotides, and the nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO: 106, and differs by no more than 3 nucleotides:
[0096] 5′-GGACAGUAUUCUCAGUGCZ9-3′ (SEQ ID NO: 105);
[0097] 5′-Z 10 GCACUGAGAAUACUGUCC-3′ (SEQ ID NO: 106),
[0098] Among them, Z9 is U, Z 10 is A;
[0099] Furthermore, the nucleotide sequence I contains a nucleotide Z corresponding to position Z9. 11 The nucleotide sequence II contains a position corresponding to Z 10 The nucleotide Z 12 , the Z8 is the first nucleotide at the 5′ end of the antisense strand. The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO: 105, wherein each U can be arbitrarily replaced by T.
[0100] In some embodiments, the sense strand comprises only nucleotide sequence I, and the antisense strand comprises only nucleotide sequence II.
[0101] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 105, and / or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 106.
[0102] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 106 includes Z 12 The difference in position, and Z 12 is selected from G, C or U. In some embodiments, the nucleotide difference is Z 12 The difference in position, and Z 12 is selected from G, C or U. In some embodiments, Z 11 Yes and Z 12 Complementary nucleotides. These nucleotide differences do not significantly reduce the target gene inhibition ability of siRNA or increase the off-target effect of siRNA, and these siRNAs containing nucleotide differences are also within the scope of protection of the present disclosure.
[0103] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the essentially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.
[0104] In some embodiments, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 2-19 of the nucleotide sequence II are completely reverse complementary to the nucleotides at positions 1-18 of the first nucleotide sequence. In some embodiments, the nucleotide sequence II is completely reverse complementary to the nucleotide sequence I, or there is a base mismatch between the second nucleotide in the nucleotide sequence II in the 5'-end to 3'-end direction and the second nucleotide in the nucleotide sequence I in the 3'-end to 5'-end direction. By including this base mismatch, the target gene expression inhibitory activity of the siRNA of the present disclosure can be further enhanced while maintaining a low off-target effect.
[0105] In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 107, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 108:
[0106] 5'-GGACAGUAUUCUCAGUGCZ11-3'(SEQ ID NO: 107);
[0107] 5'-Z12GCACUGAGAAUACUGUCC-3'(SEQ ID NO: 108),
[0108] wherein Z 11 is selected from A, U, G or C, and Z 12 is a nucleotide complementary to Z 11 ; in some embodiments, Z 11 is U, and Z 12 is A.
[0109] Furthermore, the sense strand and the antisense strand may have the same or different lengths. The length of the sense strand is 19 - 23 nucleotides, and the length of the antisense strand is 19 - 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided in the present disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25.
[0110] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of the non - fluorinated modified nucleotides and is not the stabilizing modification. The lengths of nucleotide sequence III and nucleotide sequence IV are each 1 - 4 nucleotides, nucleotide sequence IV and nucleotide sequence III have the same length, and nucleotide sequence IV and nucleotide sequence III are substantially reverse - complementary or completely reverse - complementary. Nucleotide sequence III is linked to the 5′ end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3′ end of nucleotide sequence II. Moreover, nucleotide sequence IV is substantially reverse - complementary or completely reverse - complementary to the second nucleotide sequence, where the second nucleotide sequence refers to the nucleotide sequence adjacent to the aforementioned first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as nucleotide sequence IV.
[0111] In some embodiments, the lengths of both nucleotide sequences III and IV are 1 nucleotide, the base of nucleotide sequence III is C, and the base of nucleotide sequence IV is G; the base of the second nucleotide sequence is C; at this time, the length ratio of the sense strand to the antisense strand is 20 / 20; or, the lengths of both nucleotide sequences III and IV are 2 nucleotides, the base composition of nucleotide sequence III is AG, and the base composition of nucleotide sequence IV is CU; the composition of the second nucleotide sequence is AG; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21; or, the lengths of both nucleotide sequences III and IV are 3 nucleotides, the base composition of nucleotide sequence III is AAG, and the base composition of nucleotide IV is CUU; the composition of the second nucleotide sequence is AAG; at this time, the length ratio of the sense strand to the antisense strand is 22 / 22; or, the lengths of both nucleotide sequences III and IV are 4 nucleotides, the base composition of nucleotide sequence III is AAAG, and the base composition of nucleotide IV is CUUU; the base composition of the second nucleotide sequence is AAAG; at this time, the length ratio of the sense strand to the antisense strand is 21 / 21.
[0112] In some embodiments, nucleotide sequence III and nucleotide sequence IV are completely reverse complementary. Therefore, given the base of nucleotide sequence III, the base of nucleotide sequence IV is determined.
[0113] Hereinafter, the descriptions of nucleotide sequence V, nucleotide modifications in siRNA, and modified sequences apply to the siRNA of the present disclosure above, such as the first siRNA, the second siRNA, or the third siRNA. That is, if not specified otherwise, the following descriptions of siRNA should be regarded as descriptions of the siRNA of the present disclosure above, such as the first siRNA, the second siRNA, and the third siRNA one by one. For example, if not specifically indicating a specific siRNA, the meaning of "the siRNA further contains nucleotide sequence V" is "the siRNA of the present disclosure, such as the first siRNA, the second siRNA, or the third siRNA above, further contains nucleotide sequence V".
[0114] In some embodiments, the sense strand and the antisense strand have different lengths. The antisense strand further contains a nucleotide sequence V, and each nucleotide of the nucleotide sequence V is independently one of the non-fluorinated modified nucleotides and is not the stabilized modified nucleotide. The length of the nucleotide sequence V is 1 to 3 nucleotides, and it is connected to the 3′ end of the antisense strand to form a 3′ overhang of the antisense strand. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure can be 19 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length of the nucleotide sequence V is 2 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure can be 19 / 21, 21 / 23, or 23 / 25.
[0115] Each nucleotide in the nucleotide sequence V can be any nucleotide. For ease of synthesis and cost savings, the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides (dTdT), two consecutive uridine ribonucleotides (UU); or, to improve the affinity between the siRNA antisense strand and the target mRNA, the nucleotide sequence V is completely reverse complementary to the third nucleotide sequence, and the third nucleotide sequence refers to the nucleotide sequence adjacent to the first nucleotide sequence or the second nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as the nucleotide sequence V. Therefore, in some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA of the present disclosure is 19 / 21 or 21 / 23. At this time, the siRNA of the present disclosure has better mRNA silencing activity.
[0116] In some embodiments, for the first type of siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 1, and the base composition of the third nucleotide sequence is CC; the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 6:
[0117] 5′-CAAUAAAGCUGGACAAGAZ3-3′ (SEQ ID NO: 5);
[0118] 5′-Z4UCUUGUCCAGCUUUAUUGGG-3′ (SEQ ID NO: 6),
[0119] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 8:
[0120] 5′-CCCAAUAAAGCUGGACAAGAZ3-3′ (SEQ ID NO: 7);
[0121] 5′-Z4UCUUGUCCAGCUUUAUUGGGAG-3′ (SEQ ID NO: 8),
[0122] wherein, Z4 is the first nucleotide at the 5′ end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is the nucleotide complementary to Z3.
[0123] In some embodiments, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 9, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 10:
[0124] 5′-CAAUAAAGCUGGACAAGAA-3′ (SEQ ID NO: 9);
[0125] 5′-UUCUUGUCCAGCUUUAUUGGG-3′ (SEQ ID NO: 10),
[0126] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 11, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 12:
[0127] 5′-CCCAAUAAAGCUGGACAAGAA-3′ (SEQ ID NO: 11);
[0128] 5′-UUCUUGUCCAGCUUUAUUGGGAG-3′ (SEQ ID NO: 12).
[0129] In some embodiments, for the second siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 45, and the base composition of the third nucleotide sequence is GC. The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 50:
[0130] 5′-UUAAAAGGGACAGUAUUCZ7-3′ (SEQ ID NO: 49);
[0131] 5′-Z8GAAUACUGUCCCUUUUAAGC-3′ (SEQ ID NO: 50),
[0132] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 51, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 52:
[0133] 5′-GCUUAAAAGGGACAGUAUUCZ7-3′ (SEQ ID NO: 51);
[0134] 5′-Z8GAAUACUGUCCCUUUUAAGCAA-3′ (SEQ ID NO: 52),
[0135] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 149:
[0136] 5′-UUAAAAGGGACAGUAUUCZ7-3′ (SEQ ID NO: 49);
[0137] 5′-Z8GAAUACUGUCCCUUUUAAUU-3′ (SEQ ID NO: 149),
[0138] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 51, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 150:
[0139] 5′-GCUUAAAAGGGACAGUAUUCZ7-3′ (SEQ ID NO: 51);
[0140] 5′-Z8GAAUACUGUCCCUUUUAAGCUU-3′ (SEQ ID NO: 150),
[0141] Wherein, Z8 is the first nucleotide at the 5′ end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is the nucleotide complementary to Z7.
[0142] In some embodiments, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 53, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 54:
[0143] 5′-UUAAAAGGGACAGUAUUCU-3′(SEQ ID NO: 53);
[0144] 5′-AGAAUACUGUCCCUUUUAAGC-3′(SEQ ID NO: 54),
[0145] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 55, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 56:
[0146] 5′-GCUUAAAAGGGACAGUAUUCU-3′(SEQ ID NO: 55);
[0147] 5′-AGAAUACUGUCCCUUUUAAGCAA-3′(SEQ ID NO: 56).
[0148] In some embodiments, for the third siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 105, and the base composition of the third nucleotide sequence is AG. The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 110:
[0149] 5′-GGACAGUAUUCUCAGUGCZ 11 -3′(SEQ ID NO: 109);
[0150] 5′-Z 12 GCACUGAGAAUACUGUCCCU-3′(SEQ ID NO: 110),
[0151] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 111, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 112:
[0152] 5′-AGGGACAGUAUUCUCAGUGCZ 11 -3′(SEQ ID NO: 111);
[0153] 5′-Z 12 GCACUGAGAAUACUGUCCCUUU-3′(SEQ ID NO: 112),
[0154] wherein the Z 12 is the first nucleotide at the 5′ end of the antisense strand, Z11 selected from A, U, G, or C, and Z 12 is a nucleotide complementary to Z 11 complementary nucleotides.
[0155] In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 113, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 114:
[0156] 5′-GGACAGUAUUCUCAGUGCU-3′ (SEQ ID NO: 113);
[0157] 5′-AGCACUGAGAAUACUGUCCCU-3′ (SEQ ID NO: 114),
[0158] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 115, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 116:
[0159] 5′-AGGGACAGUAUUCUCAGUGCU-3′ (SEQ ID NO: 115);
[0160] 5′-AGCACUGAGAAUACUGUCCCUUU-3′ (SEQ ID NO: 116).
[0161] As described above, the nucleotides in the siRNA of the present disclosure are each independently a modified or unmodified nucleotide. In some embodiments, some or all of the nucleotides in the siRNA of the present disclosure are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or abolish the function of the siRNA of the present disclosure to inhibit APOC3 gene expression.
[0162] In the context of the present disclosure, the term "modified nucleotide" refers to a nucleotide or nucleotide analogue formed by substituting the 2'-hydroxyl group of the ribose of a nucleotide with another group, or a nucleotide in which the base on the nucleotide is a modified base. The modified nucleotide does not significantly weaken or abolish the function of the siRNA to inhibit gene expression. For example, the modified nucleotides disclosed in J.K. Watts, G.F. Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): 842-55 can be selected.
[0163] In some embodiments, in the direction from the 5′ end to the 3′ end, if the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence II are not the stabilized modified nucleotides, they are 2′-fluoro modified nucleotides. In some embodiments, all nucleotides in the nucleotide sequence II are modified nucleotides; in the direction from the 5′ end to the 3′ end, if the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence II are not the stabilized modified nucleotides, they are 2′-fluoro modified nucleotides, and the other nucleotides in the nucleotide sequence II are each independently one of the non-fluoro modified nucleotides. In some embodiments, in the direction from the 5′ end to the 3′ end, the 7th - 9th nucleotides of the nucleotide sequence I are 2′-fluoro modified nucleotides. In some embodiments, all nucleotides in the nucleotide sequence I are modified nucleotides; in the direction from the 5′ end to the 3′ end, the 7th - 9th nucleotides of the nucleotide sequence I are 2′-fluoro modified nucleotides, and the other nucleotides in the nucleotide sequence I are each independently one of the non-fluoro modified nucleotides. The siRNA of the present disclosure can achieve a good balance between gene expression regulation activity and in vivo stability by having the above modifications.
[0164] In the context of the present disclosure, "fluoro modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2′ position of the ribose group of a nucleotide with fluorine, and it has the structure shown in the following formula (7). "Non-fluoro modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2′ position of the ribose group of a nucleotide with a non-fluorine group, or a nucleotide analogue. In some embodiments, each non-fluoro modified nucleotide is independently selected from one of the nucleotides formed by substituting the hydroxyl group at the 2′ position of the ribose group of a nucleotide with a non-fluorine group or a nucleotide analogue.
[0165] These nucleotides formed by substituting the hydroxyl group at the 2′ position of the ribose group with a non-fluorine group are well-known to those skilled in the art, and these nucleotides can be selected from one of 2′-alkoxy modified nucleotides, 2′-alkyl modified nucleotides, 2′-substituted alkyl modified nucleotides, 2′-amino modified nucleotides, 2′-substituted amino modified nucleotides, and 2′-deoxynucleotides.
[0166] In some embodiments, the 2′-alkoxy modified nucleotide is a methoxy modified nucleotide (2′-OMe), as shown in formula (8). In some embodiments, the 2′-amino modified nucleotide (2′-NH2) is as shown in formula (9). In some embodiments, the 2′-deoxynucleotide (DNA) is as shown in formula (10):
[0167]
[0168] A nucleotide analogue refers to a group that can replace nucleotides in nucleic acids but has a structure different from adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide, or thymidine deoxyribonucleotide. In some embodiments, the nucleotide analogue can be a non-natural nucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide.
[0169] BNA refers to a constrained or inaccessible nucleotide. BNA can contain a bridged structure with a "fixed" C3'-endo sugar puckering of a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, this bridge is incorporated at the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, BNA can be LNA, ENA, cET BNA, etc., where LNA is shown in formula (12), ENA is shown in formula (13), and cET BNA is shown in formula (14):
[0170]
[0171] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of nucleotides. In some embodiments, the acyclic nucleotide can be unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), where UNA is shown in formula (15) and GNA is shown in formula (16):
[0172]
[0173] In the above formulas (15) and (16), R is selected from H, OH, or an alkoxy group (O-alkyl).
[0174] Non-natural nucleotides are compounds formed by changing the position of the base on the ribose ring in nucleotides. In some embodiments, the non-natural nucleotide can be a compound formed by moving the base from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (17) or (18).
[0175]
[0176] In the compounds of the above formulas (17)-(18), Base represents a nucleic acid base, such as A, U, G, C, or T; R is selected from H, OH, F, or a non-fluorinated group as described above.
[0177] In some embodiments, the nucleotide analogue is selected from one of non-natural nucleotides, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluorinated modified nucleotide is a methoxy-modified nucleotide. Herein and hereinafter, the methoxy-modified nucleotide refers to a nucleotide formed by substituting the 2'-hydroxy group of the ribose with a methoxy group.
[0178] As used above and below, "fluorine-modified nucleotide", "2'-fluorine-modified nucleotide", "nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by fluorine", and "nucleotide having a 2'-fluororibosyl group" have the same meaning, all referring to a compound having the structure shown in Formula (7) formed by replacing the 2'-hydroxyl group of a nucleotide with fluorine; "methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by methoxy", and "nucleotide having a 2'-methoxyribosyl group" have the same meaning, all referring to a compound having the structure shown in Formula (8) formed by replacing the 2'-hydroxyl group of the ribose group of a nucleotide with methoxy.
[0179] In some embodiments, the siRNA containing a stabilized modified nucleotide of the present disclosure is an siRNA having the following modifications: in the sense strand, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 7, 8, 9 or positions 5, 7, 8, 9 of the nucleotide sequence I are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or positions 2, 6, 8, 9, 14, 16 of the nucleotide sequence II are fluorine-modified nucleotides, the nucleotide at position 3 or position 5 in the antisense strand is a stabilized modified nucleotide, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides.
[0180] The siRNA having the above modifications not only has a low cost, but also makes ribonucleases in the blood less likely to cleave nucleic acids, thereby increasing the stability of the nucleic acids and enabling the nucleic acids to have stronger resistance to nuclease hydrolysis. At the same time, the above modifications reduce the off-target effect of the siRNA and do not significantly reduce the inhibitory performance of the siRNA.
[0181] In some embodiments, the siRNA provided by the present disclosure is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1 and siAPOC3c2-M2
[0182] In some embodiments, at least a part of the phosphate groups in the phospho-sugar backbone of at least one single strand among the sense strand and the antisense strand of the siRNA provided by the present disclosure is a phosphate group with a modifying group. In some embodiments, the phosphate group with a modifying group is a phosphorothioate group formed by substituting at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom; in some embodiments, the phosphate group with a modifying group is a phosphorothioate group having a structure as shown in formula (1):
[0183]
[0184] This modification can stabilize the double-stranded structure of the siRNA and maintain high specificity and high affinity for base pairing.
[0185] In some embodiments, in the siRNA provided by the present disclosure, the phosphorothioate group linkage exists in at least one location selected from the group consisting of: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination of the above. In some embodiments, the phosphorothioate group linkage exists at all of the above positions except the 5′ end of the sense strand. In some embodiments, the phosphorothioate group linkage exists at all of the above positions except the 3′ end of the sense strand. In some embodiments, the phosphorothioate group linkage exists in at least one of the following positions:
[0186] between the 1st and 2nd nucleotides at the 5′ end of the sense strand;
[0187] between the 2nd and 3rd nucleotides at the 5′ end of the sense strand;
[0188] between the 1st and 2nd nucleotides at the 3′ end of the sense strand;
[0189] between the 2nd and 3rd nucleotides at the 3′ end of the sense strand;
[0190] between the 1st and 2nd nucleotides at the 5′ end of the antisense strand;
[0191] between the 2nd and 3rd nucleotides at the 5′ end of the antisense strand;
[0192] between the 1st and 2nd nucleotides at the 3′ end of the antisense strand; and
[0193] between the 2nd and 3rd nucleotides at the 3′ end of the antisense strand.
[0194] In some embodiments, the siRNA provided by the present disclosure is one of siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S, and siAPOC3c2-M2S listed in Tables 1a-1c.
[0195] In some embodiments, the 5′-terminal nucleotide of the antisense strand of the siRNA is a 5′-phosphate nucleotide or a nucleotide modified with a 5′-phosphate analog.
[0196] The commonly used 5′-phosphate nucleotide or nucleotide modified with a 5′-phosphate analog is well known to those skilled in the art. For example, the 5′-phosphate nucleotide may have the following structure:
[0197]
[0198] Again, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48 disclose the following 4 nucleotides modified with 5′-phosphate analogs:
[0199]
[0200] Among them, R is selected from H, OH, methoxy, and fluorine; Base represents a nucleic acid base and is selected from A, U, C, G, or T.
[0201] In some embodiments, the 5′-phosphate nucleotide is a nucleotide containing a 5′-phosphate modification as shown in formula (2), and the nucleotide modified with a 5′-phosphate analog is a nucleotide containing a vinyl phosphate (5′-(E)-vinylphosphonate, E-VP) modification, as shown in formula (3), or a nucleotide modified with a phosphorothioate, as shown in formula (5).
[0202] In some embodiments, the siRNA of the present disclosure is one of siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b2-M2SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1SP1, and siAPOC3c2-M2SP1 listed in Table 1a - Table 1c below.
[0203] The inventors of the present disclosure unexpectedly found that the siRNA provided by the present disclosure not only has significantly enhanced plasma and lysosomal stability and significantly low off-target effects, but also retains high gene inhibitory activity.
[0204] The siRNA provided by the present disclosure can be obtained by conventional siRNA preparation methods in the art (such as solid-phase synthesis and liquid-phase synthesis methods). Among them, solid-phase synthesis already has commercial customization services. Modified nucleotide groups can be introduced into the siRNA of the present disclosure by using nucleoside monomers with corresponding modifications. The methods for preparing nucleoside monomers with corresponding modifications and the methods for introducing modified nucleotide groups into siRNA are also well-known to those skilled in the art.
[0205] Pharmaceutical composition
[0206] The present disclosure provides a pharmaceutical composition, which contains the above-mentioned siRNA as an active ingredient and a pharmaceutically acceptable carrier.
[0207] The pharmaceutically acceptable carrier may be a carrier commonly used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and one or more of their derivatives.
[0208] In some embodiments, in the pharmaceutical composition, there is no particular requirement for the contents of siRNA and the pharmaceutically acceptable carrier. In some embodiments, the weight ratio of siRNA to the pharmaceutically acceptable carrier may be 1:(1 - 500). In some embodiments, the above weight ratio is 1:(1 - 50).
[0209] In some embodiments, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds commonly used in the art. For example, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protecting agent, and an osmotic pressure regulator.
[0210] The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5 - 8.5 and / or a phosphate buffer with a pH value of 5.5 - 8.5, such as a phosphate buffer with a pH value of 5.5 - 8.5.
[0211] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.
[0212] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200-700 milliosmoles per kilogram (mOsm / kg). Those skilled in the art can easily determine the content of the osmotic pressure regulator according to the required osmotic pressure. In some embodiments, the dosage of the preparation made from the pharmaceutical composition may be adjusted due to different administration methods during administration.
[0213] In some embodiments, the pharmaceutical composition may be a liquid preparation, such as an injection; or it may be a freeze-dried powder injection, which is mixed with a liquid excipient during administration to prepare a liquid preparation. The liquid preparation may be used for subcutaneous, intramuscular, or intravenous injection administration, and may also be delivered by spraying to the lungs, or by spraying through the lungs to other organ tissues (such as the liver), or by oropharyngeal inhalation, or nasal administration, etc. In some embodiments, the pharmaceutical composition is used for spraying administration.
[0214] In some embodiments, the pharmaceutical composition may be in the form of a liposomal preparation. In some embodiments, the pharmaceutically acceptable carrier used in the liposomal preparation includes an amine-containing transfection compound (hereinafter also referred to as an organic amine), a co-lipid, and / or a polyethylene glycolylated lipid. Among them, the organic amine, co-lipid, and polyethylene glycolylated lipid may be selected from one or more of the amine-containing transfection compounds or pharmaceutically acceptable salts or derivatives, co-lipids, and polyethylene glycolylated lipids described in Chinese Patent Application CN103380113A (incorporated herein by reference in its entirety).
[0215] In some embodiments, the organic amine may be the compound shown in formula (201) described in Chinese Patent Application CN103380113A or a pharmaceutically acceptable salt thereof:
[0216]
[0217] Wherein:
[0218] X 101 and X 102 are each independently O, S, N-A or C-A, where A is hydrogen or C1-C 20 hydrocarbon chain;
[0219] Y 101 and Z 101Each independently is C=O, C=S, S=O, CH-OH or SO2;
[0220] R 101 , R 102 , R 103 , R 104 , R 105 , R 106 and R 107 each independently is hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight-chain aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or straight-chain heteroaliphatic group, a substituted or unsubstituted, branched or straight-chain acyl group, a substituted or unsubstituted, branched or straight-chain aryl group, a substituted or unsubstituted, branched or straight-chain heteroaryl group;
[0221] x is an integer from 1 to 10;
[0222] n is an integer from 1 to 3, m is an integer from 0 to 20, p is 0 or 1; wherein, if m = p = 0, then R 102 is hydrogen;
[0223] And, if at least one of n or m is 2, then R 103 and the nitrogen in formula (201) form a structure as shown in formula (202) or formula (203):
[0224]
[0225] wherein, g, e and f each independently are integers from 1 to 6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom in formula (201).
[0226] In some embodiments, R 103 is a polyamine. In other embodiments, R 103 is a ketal. In some embodiments, in formula (201), each of R 101 and R 102 independently is any substituted or unsubstituted, branched or straight-chain alkyl or alkenyl group having 3 to about 20 carbon atoms, such as 8 to about 18 carbon atoms, and 0 to 4 double bonds, such as 0 to 2 double bonds.
[0227] In some embodiments, if each of n and m independently has a value of 1 or 3, then R 103 can be any one of the following formulas (204) - (213):
[0228]
[0229] Among them, in Formulas (204)-(213), g, e, and f are each independently an integer from 1 to 6, each "HCC" represents a hydrocarbon chain, and each * indicates a possible connection point to the nitrogen atom in Formula (201), where each H at any * position can be replaced to achieve connection to the nitrogen atom in Formula (201). 103 A possible connection point to the nitrogen atom in Formula (201), where each H at any * position can be replaced to achieve connection to the nitrogen atom in Formula (201).
[0230] Among them, the compound shown in Formula (201) can be prepared according to the description in Chinese Patent Application CN103380113A.
[0231] In some embodiments, the organic amine is the organic amine shown in Formula (214) and / or the organic amine shown in Formula (215):
[0232]
[0233] The co-lipid is cholesterol, an analogue of cholesterol, and / or a derivative of cholesterol;
[0234] The polyethylene glycolylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)]-2000.
[0235] In some embodiments, in the pharmaceutical composition, the molar ratio among the organic amine, the co-lipid, and the polyethylene glycolylated lipid is (19.7-80):(19.7-80):(0.3-50), for example, it can be (50-70):(20-40):(3-20).
[0236] In some embodiments, the pharmaceutical composition particles formed by the siRNA of the present disclosure and the above amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, usually about 40 nm to about 135 nm, more usually, the average diameter of the liposome particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm. For example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.
[0237] In some embodiments, in the pharmaceutical composition formed by the siRNA of the present disclosure and the above-mentioned amine-containing transfection reagent, the weight ratio (weight / weight ratio) of siRNA to all lipids (such as organic amines, co-lipids, and / or polyethylene glycolated lipids) ranges from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12, or from about 1:6 to about 1:10. For example, the weight ratio of the siRNA of the present disclosure to all lipids is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.
[0238] In some embodiments, the components of the pharmaceutical composition may exist independently when sold and may exist in the form of a liquid preparation when in use. In some embodiments, the pharmaceutical composition formed by the siRNA provided by the present disclosure and the above-mentioned pharmaceutically acceptable carrier can be prepared by various known methods, only by replacing the existing siRNA with the siRNA provided by the present disclosure; in some embodiments, it can be prepared according to the following method:
[0239] Suspend the organic amine, co-lipid, and polyethylene glycolated lipid in alcohol according to the above molar ratio and mix well to obtain a lipid solution; the amount of alcohol used makes the total mass concentration of the obtained lipid solution 2 - 25 mg / mL, for example, it can be 8 - 18 mg / mL. The alcohol is selected from pharmaceutically acceptable alcohols, such as alcohols that are liquid near room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, polyethylene glycol 200, polyethylene glycol 300, and polyethylene glycol 400, and it can be ethanol, for example.
[0240] Dissolve the siRNA provided by the present disclosure in a buffer salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05 - 0.5 M, for example, it can be 0.1 - 0.2 M, adjust the pH of the buffer salt solution to 4.0 - 5.5, for example, it can be 5.0 - 5.2, and the amount of the buffer salt solution used makes the concentration of siRNA not exceed 0.6 mg / mL, for example, it can be 0.2 - 0.4 mg / mL. The buffer salt is selected from one or more of soluble acetates and soluble citrates, and it can be sodium acetate and / or potassium acetate, for example.
[0241] Mix the lipid solution and the aqueous siRNA solution, and incubate the obtained product at 40 - 60 °C for at least 2 minutes, for example, it can be 5 - 30 minutes, to obtain an incubated liposomal preparation. The volume ratio of the lipid solution to the aqueous siRNA solution is 1:(2 - 5), and it can be 1:4, for example.
[0242] The incubated liposomal preparation is concentrated or diluted, impurities are removed, and sterilization is carried out to obtain the pharmaceutical composition provided by the present disclosure. Its physicochemical parameters are as follows: the pH value is 6.5 - 8, the encapsulation efficiency is not less than 80%, the particle size is 40 - 200 nm, the polydispersity index is not higher than 0.30, and the osmotic pressure is 250 - 400 mOsm / kg; for example, the physicochemical parameters can be that the pH value is 7.2 - 7.6, the encapsulation efficiency is not less than 90%, the particle size is 60 - 100 nm, the polydispersity index is not higher than 0.20, and the osmotic pressure is 300 - 400 mOsm / kg.
[0243] Among them, concentration or dilution can be carried out before, after, or simultaneously with the removal of impurities. Various existing methods can be used to remove impurities. For example, a tangential flow system or a hollow fiber column can be used for ultrafiltration under the condition of 100 kDa, and the ultrafiltration exchange solution is phosphate buffer (PBS) with a pH of 7.4. Various existing methods can be used for sterilization. For example, filtration sterilization can be carried out on a 0.22 μm filter.
[0244] siRNA conjugate
[0245] The present disclosure provides an siRNA conjugate, which contains the siRNA provided by the present disclosure and a conjugation group conjugated to the siRNA. In some embodiments, the conjugation group includes a linker and a pharmaceutically acceptable targeting group and / or delivery assisting group, and the siRNA, the linker, and the targeting group or the delivery assisting group are covalently or non-covalently connected in sequence. Each targeting group is selected from ligands capable of binding to cell surface receptors, and each delivery assisting group is selected from groups capable of increasing the biocompatibility of the siRNA conjugate in the target organ or tissue to be delivered.
[0246] In the context of the present disclosure, unless otherwise specified, "conjugation" means that two or more chemical moieties each having a specific function are connected to each other in a covalent bonding manner; correspondingly, "conjugation" refers to a compound formed by covalent bonding between these individual chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently connecting one or more chemical moieties having specific functions to the siRNA. The siRNA conjugate should be understood as the general term for multiple siRNA conjugates or the siRNA conjugate represented by a certain chemical formula according to the context. In the context of the present disclosure, "conjugation molecule" should be understood as a specific compound that can be conjugated to the siRNA through a reaction to finally form the siRNA conjugate of the present disclosure.
[0247] Generally, the conjugating group comprises at least one pharmaceutically acceptable targeting group and an optional linker, and the siRNA, the linker, and the targeting group are connected in sequence. In some embodiments, the number of the targeting groups is 1-6. In some embodiments, the number of the targeting groups is 2-4. The siRNA molecule can be conjugated to the conjugating group non-covalently or covalently, for example, it can be covalently conjugated to the conjugating group. The conjugation site of the siRNA and the conjugating group can be at the 3′-end or 5′-end of the sense strand of the siRNA, or at the 5′-end of the antisense strand, or also in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA and the conjugating group is at the 3′-terminal of the sense strand of the siRNA.
[0248] In some embodiments, the conjugating group can be connected to the phosphate group, 2′-hydroxyl group, or base of the nucleotide. In some embodiments, the conjugating group can also be connected to the 3′-hydroxyl group, and in this case, the nucleotides are connected by 2′-5′ phosphodiester bonds. When the conjugating group is connected to the end of the siRNA strand, the conjugating group is usually connected to the phosphate group of the nucleotide; when the conjugating group is connected to the internal sequence of the siRNA, the conjugating group is usually connected to the ribose ring or the base. For various connection methods, reference can be made to the literature: Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.
[0249] The targeting group can be connected to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. The types of these linkers and targeting groups and the connection manner with the siRNA can refer to the disclosure content of WO2015006740A2, and its entire content is incorporated herein by reference.
[0250] In some embodiments, the targeting group can be a ligand commonly used in the field of siRNA administration, such as various ligands described in WO2009082607A2, and its entire disclosure content is incorporated herein by reference.
[0251] In some embodiments, at least one or each of the targeting groups is selected from ligands capable of binding to a cell surface receptor that expresses the APOC3 gene.
[0252] In some embodiments, at least one or each of the targeting groups is selected from ligands capable of binding to a mammalian hepatocyte surface receptor (ASGPR). In some embodiments, each of the targeting groups is independently a ligand that is affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes. In some embodiments, each of the targeting groups is independently an asialoglycoprotein or a sugar. In some embodiments, each of the targeting groups is independently an asialoglycoprotein, such as asialoorosomucoid (ASOR) or asialofetuin (ASF). In some embodiments, each of the targeting groups is independently selected from D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside ethyl ester, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose. In some embodiments, at least one or each of the targeting groups is galactose or N-acetylgalactosamine.
[0253] In some embodiments, the linker in the siRNA conjugate of the present disclosure has the structure shown in formula (301):
[0254]
[0255] Among them, k is an integer from 1 to 3;
[0256] L A has a structure containing an amide bond as shown in formula (302), L B has a structure containing N-acylpyrrolidine as shown in formula (303), contains a carbonyl group and an oxygen atom, L C is a linking group based on hydroxymethylaminomethane, bis(hydroxymethyl)aminomethane or tris(hydroxymethyl)aminomethane;
[0257]
[0258] Among them, n 302 、q 302 and p 302 are each independently an integer from 2 to 6. Optionally, n 302 、q 302 and p 302 are each independently 2 or 3; n 303 is an integer from 4 to 16. Optionally, n 303 is an integer from 8 to 12, represents the site where the groups are covalently linked.
[0259] In the linker, each L A is respectively linked to one of the targeting groups through an ether bond, and through the oxygen atom of the hydroxyl group in the L C part to form an ether bond with the L C part; L B is linked to the nitrogen atom of the amino group in the L C part through the carbonyl group in formula (303) to form an amide bond, and is linked to the siRNA through the oxygen atom in formula (303) to form a phosphate bond or a phosphorothioate bond through an oxygen atom.
[0260] In some embodiments, the siRNA conjugate provided by the present disclosure has a structure as shown in formula (305):
[0261]
[0262] Among them, Nu represents the siRNA provided by the present disclosure.
[0263] In some embodiments, the linker in the siRNA conjugate of the present disclosure has a structure as shown in formula (306):
[0264]
[0265] Among them, n 306 is an integer from 0 to 3, and each p 306an integer independently from 1 to 6, represents the site of covalent attachment of the group; the linking group forms an ether bond connection with the targeting group through the oxygen atom marked with *; at least one of the oxygen atoms marked with # of the linking group forms a phosphoester bond or a phosphorothioate bond with the siRNA and is connected, and the remaining oxygen atoms marked with # are connected to hydrogen atoms to form hydroxyl groups, or are connected to C1-C3 alkyl groups to form C1-C3 alkoxy groups;
[0266] In some embodiments, the siRNA conjugate of the present disclosure has the structure shown in formula (307):
[0267]
[0268] wherein Nu represents the siRNA provided by the present disclosure.
[0269] In some embodiments, the siRNA conjugate of the present disclosure has the structure shown in formula (308):
[0270]
[0271] wherein,
[0272] n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4;
[0273] each of m1, m2 or m3 is independently an integer selected from 2 to 10;
[0274] R 10 、R 11 、R 12 、R 13 、R 14 or R 15 are each independently H, or are selected from the group consisting of: C1-C 10 alkyl, C1-C 10 haloalkyl, and C1-C 10 alkoxy;
[0275] R3 has the structure shown in formula A59:
[0276]
[0277] wherein, E1 is OH, SH or BH2, and Nu represents the siRNA provided by the present disclosure;
[0278] R2 is a straight-chain alkylene group with 1 to 20 carbon atoms, and one or more of the carbon atoms are optionally replaced by any one or more selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10Vinylene, C2-C 10 Ethynylene, C6-C 10 Arylene, C3-C 18 Heterocyclylene and C5-C 10 Heteroarylene; and wherein R2 may optionally have one or more substituents selected from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 Heteroaryl, C1-C 10 Haloalkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Haloalkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Haloalkyl, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl)(C1-C 10 Alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)(C1-C 10 Alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON(C1-C 10 Alkyl)(C1-C 10 Alkyl), -CONH(C1-C 10 Alkyl), -CONH2, -NHC(O)(C1-C 10 Alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10 Alkyl), -SO2(phenyl), -SO2(C1-C 10(haloalkyl), -SO2NH2, -SO2NH(C1-C 10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 haloalkyl);
[0279] Each L1 is independently a straight-chain alkylene group having 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more of the groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenylene, C2-C 10 alkynylene, C6-C 10 arylene, C3-C 18 heterocycloalkylene and C5-C 10 heteroarylene; and wherein L1 may optionally have substituents of any one or more of the groups consisting of: C1-C 10 alkyl, C6-C 10 aryl, C5-C 10 heteroaryl, C1-C 10 haloalkyl, -OC1-C 10 alkyl, -OC1-C 10 alkylphenyl, -C1-C 10 alkyl-OH, -OC1-C 10 haloalkyl, -SC1-C 10 alkyl, -SC1-C 10 alkylphenyl, -C1-C 10 alkyl-SH, -SC1-C 10 haloalkyl, halogen substituents, -OH, -SH, -NH2, -C1-C 10 alkyl-NH2, -N(C1-C 10 alkyl)(C1-C 10 alkyl), -NH(C1-C 10 alkyl), -N(C1-C 10 alkyl)(C1-C 10 alkylphenyl), -NH(C1-C 10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 alkyl), -CON(C1-C 10 alkyl)(C1-C 10 alkyl), -CONH(C1-C 10 alkyl), -CONH2, -NHC(O)(C1-C 10(alkyl), -NHC(O)(phenyl), -N(C1-C 10 (alkyl)C(O)(C1-C 10 (alkyl), -N(C1-C 10 (alkyl)C(O)(phenyl), -C(O)C1-C 10 (alkyl), -C(O)C1-C 10 (alkyl)phenyl, -C(O)C1-C 10 (haloalkyl), -OC(O)C1-C 10 (alkyl), -SO2(C1-C 10 (alkyl), -SO2(phenyl), -SO2(C1-C 10 (haloalkyl), -SO2NH2, -SO2NH(C1-C 10 (alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 (alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 (haloalkyl);
[0280] Denotes the site of covalent attachment of the group;
[0281] M1 represents a targeting group, which is defined and can be selected from the same range as described above. In some embodiments, each M1 is independently selected from one of the ligands having an affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells.
[0282] Those skilled in the art will understand that although for convenience L1 is defined as a linear alkyl, it may not be a linear group or have a different name, such as an amine or alkenyl resulting from the above substitutions and / or permutations. For the purposes of the present disclosure, the length of L1 is the number of atoms in the chain connecting the two attachment points. For this purpose, a ring (such as a heterocycloalkyl or heteroaryl) obtained by replacing the carbon atoms of the straight-chain alkylene group is counted as one atom.
[0283] When M1 is a ligand with affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, in some embodiments, n1 can be an integer of 1-3, and n3 can be an integer of 0-4, ensuring that the number of M1 ligands in the conjugate is at least 2; in some embodiments, n1+n3≥2, so that the number of M1 ligands can be at least 3, making it easier for the M1 ligand to bind to the asialoglycoprotein receptor on the surface of the liver, thereby promoting the conjugate to enter the cell through endocytosis. Experiments show that when the number of M1 ligands is greater than 3, the ease with which the M1 ligand binds to the asialoglycoprotein receptor on the surface of the liver is not significantly increased. Therefore, considering the ease of synthesis, structure / process cost, and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.
[0284] In some embodiments, when m1, m2 and m3 are independently selected from integers of 2-10, the spatial positions between multiple M1 ligands can be made suitable for the binding of M1 ligands to the asialoglycoprotein receptor on the liver surface. In order to make the conjugate provided by the present disclosure simpler, easier to synthesize and / or reduce costs, in some embodiments, m1, m2 and m3 are each independently an integer of 2-5. In some embodiments, m1=m2=m3.
[0285] Those skilled in the art will appreciate that when R 10 , R 11 , R 12 , R 13 , R 14 and R 15 Each independently selected from H, C1-C 10 Alkyl, C1-C 10 Haloalkyl, and C1-C 10 When one of the alkoxy groups is used, the properties of the conjugate disclosed herein will not be changed, and the purpose of the present disclosure can be achieved. 10 , R 11 , R 12 , R 13 , R 14 and R 15 Each is independently selected from H, methyl and ethyl. 10 , R 11 , R 12 , R 13 , R 14 and R 15 Both are H.
[0286] According to the siRNA conjugate provided by the present disclosure, R3 is a group having the structure shown in formula A59, wherein E1 is OH, SH or BH2. Considering the easy availability of the preparation raw materials, in some embodiments, E1 is OH or SH.
[0287] In some embodiments, R2 is selected to achieve the connection between N on the nitrogen-containing backbone and A59. In the context of the present disclosure, the "nitrogen-containing backbone" refers to the chain structure in which the carbon atoms connected to N in R 10 , R 11 , R 12 , R 13 , R 14 and R 15 are connected to N with each other. Therefore, R2 can be any linking group that can connect the A59 group to N on the nitrogen-containing backbone in an appropriate manner. In some embodiments, in the case of preparing the siRNA conjugate of the present disclosure by a solid-phase synthesis process, the R2 group needs to contain both a linking site for connecting to N on the nitrogen-containing backbone and a linking site for connecting to P in R3. In some embodiments, the site in R2 for connecting to N on the nitrogen-containing backbone forms an amide bond with N, and the site for connecting to P on R3 forms a phosphoester bond with P. In some embodiments, R2 is B5, B6, B5' or B6':
[0288]
[0289] wherein, represents the site of covalent bond connection of the group.
[0290] The value range of q2 can be an integer from 1 to 10. In some embodiments, q2 is an integer from 1 to 5.
[0291] The function of L1 is to connect the M1 ligand to N on the nitrogen-containing backbone, providing a targeting function for the siRNA conjugate of the present disclosure. In some embodiments, L1 is selected from one or more linking combinations of the groups of formula A1 - A26. In some embodiments, L1 is selected from one or more linking combinations of A1, A4, A5, A6, A8, A10, A11 and A13; in some embodiments, L1 is selected from a linking combination of at least 2 of A1, A4, A8, A10 and A11; in some embodiments, L1 is selected from a linking combination of at least 2 of A1, A8 and A10.
[0292]
[0293]
[0294] In some embodiments, the length of L1 can be 3 to 25 atoms, 3 to 20 atoms, 4 to 15 atoms, or 5 to 12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 atoms.
[0295] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10, and in some embodiments, j2 is an integer from 3 to 5. R’ is an alkyl group of C1-C4, and in some embodiments, R’ is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31, and in some embodiments, Ra is A27 or A28. Rb is an alkyl group of C1-C5, and in some embodiments, Rb is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, in formulae A1 - A26, j1, j2, R’, Ra, and Rb are each selected to enable the N on the nitrogen-containing backbone to be connected to the M1 ligand, and to make the spatial positions between the M1 ligands more suitable for the M1 ligand to bind to the asialoglycoprotein receptor on the liver surface.
[0296]
[0297] In some embodiments, the siRNA conjugate of the present disclosure has a structure shown in formulae (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421), or (422):
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305] In some embodiments, P in formula A59 can be linked to any possible position in the siRNA sequence. For example, P in formula A59 can be linked to any nucleotide on the sense strand or the antisense strand of the siRNA; in some embodiments, P in formula A59 is linked to any nucleotide on the sense strand of the siRNA. In some embodiments, P in formula A59 is linked to the end of the sense strand or the antisense strand of the siRNA; in some embodiments, P in formula A59 is linked to the end of the sense strand of the siRNA. The end refers to the first 4 nucleotides counted from one end of the sense strand or the antisense strand. In some embodiments, P in formula A59 is linked to the terminus of the sense strand or the antisense strand of the siRNA; in some embodiments, P in formula A59 is linked to the 3′ terminus of the sense strand of the siRNA. In the case of linking to the above positions of the sense strand of the siRNA, after the conjugate provided by the present disclosure enters the cell and unwinds, the separate siRNA antisense strand can be released to inhibit target gene expression through the RNAi mechanism.
[0306] P in formula A59 can be linked to any possible position on the nucleotide in the siRNA. For example, the 5′ position of the nucleotide, the 2′ position of the nucleotide, the 3′ position of the nucleotide, or the base of the nucleotide. In some embodiments, P in formula A59 can be linked to the 2′ position, 3′ position, or 5′ position of the nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, P in formula A59 is linked to the oxygen atom formed after dehydrogenation of the 3′ hydroxyl group of the nucleotide at the 3′ terminus of the sense strand of the siRNA, or P is linked to the nucleotide by substituting the hydrogen in the 2′-hydroxyl group of a nucleotide in the sense strand of the siRNA, or P is linked to the nucleotide by substituting the hydrogen in the 5′ hydroxyl group of the nucleotide at the 5′ terminus of the sense strand of the siRNA.
[0307] In some embodiments, the siRNA included in the siRNA conjugate of the present disclosure can be any one of the siRNAs listed in Table 1a, 1b, or 1c, for example. The siRNA conjugate containing these siRNAs exhibits low off-target effects and high mRNA inhibitory activity on APOC3 gene expression.
[0308] Table 1a The first siRNA sequence of the present disclosure
[0309]
[0310] Table 1b The second siRNA sequence of the present disclosure
[0311]
[0312]
[0313] Table 1c The third siRNA sequence of the present disclosure
[0314]
[0315]
[0316] Wherein, the capital letters C, G, U, and A represent the base composition of nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a nucleotide modified with methoxy; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a nucleotide modified with fluoro; the capital letters underlined S indicate that the nucleotide adjacent to the left of the letter S is a stabilized modified nucleotide; the lowercase letter s indicates that there is a phosphorothioate linkage between the two nucleotides on the left and right of the letter s; P1 indicates that the nucleotide adjacent to the right of the P1 is a nucleotide modified with 5′-phosphate nucleotide or 5′-phosphate analog. In some embodiments, S represents a specific stabilized modification such as moe , wherein, the underlined letter combination moe indicates that the nucleotide adjacent to the left of the letter combination moe is a nucleotide modified with 2′-O-methoxyethyl. In some embodiments, P1 represents a specific modification of VP, Ps, or P, wherein, the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a nucleotide modified with vinylphosphonate (5′-(E)-vinylphosphonate, E-VP); the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a nucleotide modified with phosphorothioate; the capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5′-phosphate nucleotide. Additionally, each U in the sequences listed in Table 1a - 1c above can be arbitrarily replaced by T without significantly affecting the activity or off-target effect of the siRNA.
[0317] Preparation of the siRNA conjugate of the present disclosure
[0318] The above siRNA conjugates can be synthesized by methods that have been described in detail in the prior art. For example, WO2015006740A2 describes in detail the preparation methods of various siRNA conjugates. The siRNA conjugates of the present disclosure can also be obtained by means well-known to those skilled in the art. As described in W02014025805A1, the preparation method of the structure shown in formula (305) is described, and Rajeev et al. described the preparation method of the structure shown in formula (307) in ChemBioChem 2015, 16, 903 - 908. Chinese Patent Application CN110959011A also discloses in detail the method for preparing the siRNA conjugate shown in formula (308). The above-mentioned literature content is incorporated herein by reference in its entirety.
[0319] The siRNA conjugates of the present disclosure can also be used in combination with other pharmaceutically acceptable excipients, which can be one or more of various preparations or compounds commonly used in the art. For details, reference can be made to the description of the pharmaceutical compositions of the present disclosure above.
[0320] Applications of the siRNA, pharmaceutical composition and siRNA conjugate of the present disclosure
[0321] In some embodiments, the present disclosure provides the use of the siRNA, and / or pharmaceutical composition and / or siRNA conjugate of the present disclosure in the preparation of a medicament for treating and / or preventing a disease or condition related to the mRNA level of APOC3 gene expression. In some embodiments, the disease or condition related to the mRNA level of APOC3 gene expression is dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis.
[0322] In some embodiments, the present disclosure provides a method for treating and / or preventing a disease or condition related to the mRNA level of APOC3 gene expression, the method comprising administering to a subject in need the siRNA, and / or pharmaceutical composition, and / or siRNA conjugate of the present disclosure. In some embodiments, the disease or condition related to the mRNA level of APOC3 gene expression is dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis.
[0323] In some embodiments, the present disclosure further provides a method for inhibiting the expression level of APOC3 gene in cells, the method comprising contacting the cells with an effective dose of the siRNA, and / or pharmaceutical composition and / or siRNA of the present disclosure.
[0324] By administering the siRNA, pharmaceutical composition, and / or siRNA conjugate provided by the present disclosure to a subject in need thereof, it is possible to achieve the purpose of preventing and / or treating a pathological condition or disease caused by the expression of a specific gene in cells through a mechanism of regulating gene expression. Therefore, the siRNA, pharmaceutical composition, and / or siRNA conjugate provided by the present disclosure can be used for preventing and / or treating the pathological condition or disease, or for preparing a medicament for preventing and / or treating the pathological condition or disease described herein.
[0325] As used herein, the term "administer" refers to placing the siRNA, pharmaceutical composition, and / or siRNA conjugate into a subject's body by a method or route that enables at least partial localization of the siRNA, pharmaceutical composition, and / or siRNA conjugate to a desired site to produce a desired effect. Routes of administration suitable for the methods of the present disclosure include topical administration and systemic administration. Generally, topical administration results in delivery of more siRNA, pharmaceutical composition, and / or siRNA conjugate to a specific site compared to the entire body of the subject; while systemic administration results in delivery of the siRNA, pharmaceutical composition, and / or siRNA conjugate to substantially the entire body of the subject. Considering that the present disclosure aims to provide a means for preventing and / or treating a pathological condition or disease caused by the expression of a specific gene in hepatocytes, in some embodiments, it is a mode of administration capable of delivering the drug to the liver.
[0326] Administration to a subject can be carried out by any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The frequency of administration can be once or multiple times per day, per week, every two weeks, every three weeks, per month, or per year.
[0327] The dosage of the siRNA, pharmaceutical composition, and / or siRNA conjugate described in the present disclosure can be a conventional dosage in the art, and the dosage can be determined according to various parameters, especially the age, weight, and sex of the subject. Toxicity and efficacy can be determined by standard pharmaceutical procedures in cell culture or experimental animals, such as determining LD50 (the dose that kills 50% of the population) and ED50 (in a quantal response, the dose that can cause 50% of the maximum response intensity, and in a qualitative response, the dose that causes 50% of the experimental subjects to show a positive response). The range of human dosage can be derived based on data obtained from cell culture analysis and animal studies.
[0328] When administering the siRNA, pharmaceutical composition, and / or siRNA conjugate described in the present disclosure, for example, for male or female C57BL / 6J or C3H / HeNCrlVr mice at 6 - 12 weeks of age and weighing 18 - 25 g, based on the amount of siRNA in the siRNA, pharmaceutical composition, and / or siRNA conjugate: for an siRNA conjugate formed by an siRNA and a pharmaceutically acceptable conjugate molecule, the dosage of siRNA can be 0.001 - 100 mg / kg body weight, in some embodiments 0.01 - 50 mg / kg body weight, in further embodiments 0.05 - 20 mg / kg body weight, in still further embodiments 0.1 - 15 mg / kg body weight, and in yet further embodiments 0.1 - 10 mg / kg body weight. When administering the siRNA, pharmaceutical composition, and / or siRNA conjugate described in the present disclosure, the above dosages are preferably used.
[0329] In addition, by introducing the siRNA, pharmaceutical composition, and / or siRNA conjugate of the present disclosure into cells with abnormal expression of a specific gene, it is also possible to achieve the purpose of inhibiting the expression of the specific gene in the cells through the mechanism of gene expression regulation. In some embodiments, the cells are hepatocytes. In some embodiments, the hepatocytes can be cells selected from hepatoma cell lines such as Hep3B, HepG2, Huh7, etc. or isolated primary hepatocytes, and in some embodiments are primary hepatocytes.
[0330] When using the method provided in the present disclosure to inhibit the expression of a specific gene in cells, the dosage of siRNA in the provided siRNA, pharmaceutical composition, and / or siRNA conjugate is easily determined by those skilled in the art according to the desired effect. For example, in some embodiments, the dosage of siRNA in the provided siRNA conjugate is an amount sufficient to reduce the expression of the target gene and result in an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM or up to about 5 nM at the surface of the target cells. The amount required to achieve this local concentration will vary with various factors, including the delivery method, delivery site, the number of cell layers between the delivery site and the target cells or tissues, whether the delivery is local or systemic, etc. The concentration at the delivery site can be significantly higher than the concentration at the surface of the target cells or tissues.
[0331] Kit
[0332] The present disclosure provides a kit, which contains the siRNA, pharmaceutical composition, and / or siRNA conjugate provided in the present disclosure.
[0333] In some embodiments, the kits described herein may provide siRNA, a pharmaceutical composition, and / or a conjugate in one container. In some embodiments, the kits described herein may include a container providing a pharmaceutically acceptable excipient. In some embodiments, other components, such as stabilizers or preservatives, etc., may also be included in the kits. In some embodiments, the kits described herein may include at least one other therapeutic agent in a container different from the container providing the siRNA, pharmaceutical composition, and / or conjugate described herein. In some embodiments, the kits may include instructions for mixing the siRNA, pharmaceutical composition, and / or conjugate with a pharmaceutically acceptable carrier and / or excipient or other components (if any).
[0334] In the kits of the present disclosure, the siRNA and the pharmaceutically acceptable carrier and / or excipient, and the pharmaceutical composition and / or conjugate, and / or the pharmaceutically acceptable excipient may be provided in any form, such as in liquid form, dry form, or lyophilized form. In some embodiments, the siRNA and the pharmaceutically acceptable carrier and / or excipient, and the pharmaceutical composition and / or conjugate and optionally the pharmaceutically acceptable excipient are substantially pure and / or sterile. In some embodiments, sterile water may be provided in the kits of the present disclosure.
[0335] The present disclosure will be further illustrated by examples below, but the present disclosure is not limited thereby.
[0336] Examples
[0337] Unless otherwise specified, the reagents and media used in the following examples are commercially available products, and the operations such as nucleic acid electrophoresis and real-time PCR are carried out according to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).
[0338] Preparation Examples 1-7 Synthesis of the siRNA Conjugates Provided by the Present Disclosure
[0339] According to the preparation method described in Preparation Example 1 of CN110959011A, conjugates 1-7 in Table 2 below were prepared. The only difference is that the sense strand and antisense strand of the siRNA contained in each siRNA conjugate are shown in Table 2 respectively; for the nucleic acid sequences of the siRNA numbered conjugate 1-conjugate 7 in Table 2 below, the sense strand and antisense strand of the siRNA were synthesized respectively. After diluting each siRNA conjugate to a concentration of 0.2 mg / mL (calculated based on siRNA) using ultrapure water (Milli-Q ultrapure water instrument, resistivity 18.2 MΩ·cm (25 °C)), molecular weight detection was performed using a liquid chromatography-mass spectrometry instrument (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model: LCT Premier). The measured value was consistent with the theoretical value, indicating that the synthesized conjugates 1-7 are the target-designed double-stranded nucleic acid sequences. Each siRNA conjugate has the structure shown in formula (403), and the siRNA contained in this siRNA conjugate has the siRNA sequences corresponding to conjugates 1-7 in Table 2 respectively. For example, for conjugate 5, the theoretical value of the molecular weight (mw) of the sense strand: 7581.42; the measured value 7581.22, the theoretical value of the antisense strand: 6948.55; the measured value: 6948.72. The measured value is consistent with the theoretical value, indicating that this conjugate has the structure shown in formula (403) and this conjugate has the siRNA sequence corresponding to conjugate 5 in Table 2.
[0340] Table 2 siRNA sequences in siRNA conjugates
[0341]
[0342]
[0343] Among them, the capital letters C, G, U, A, T represent the base composition of nucleotides; the lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a nucleotide modified with methoxy; the lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a nucleotide modified with fluoro; the underlined letter combination moe represents that the nucleotide adjacent to the left of the letter combination moe is a nucleotide modified with ribose 2′-O-methoxyethyl; the lowercase letter s represents that there is a phosphorothioate linkage between the two nucleotides on the left and right of the letter s; P represents that the nucleotide to the right of the letter P is a 5′-phosphate nucleotide.
[0344] Comparison of the synthesis of reference siRNA conjugates in Preparation Examples 1-3
[0345] According to the preparation method described in Preparation Example 1 of CN110959011A, the reference siRNA conjugates numbered 1-3 in Table 2 below were prepared. The difference is only that the sense strand and antisense strand of the siRNA contained in each reference siRNA conjugate are shown in Table 2 respectively; according to the nucleic acid sequences of the siRNAs numbered 1-3 in Table 2 below, the sense strand and antisense strand of the siRNA were synthesized respectively. After diluting each reference siRNA conjugate to a concentration of 0.2 mg / mL (calculated based on siRNA) using ultrapure water (Milli-Q ultrapure water instrument, resistivity 18.2 MΩ·cm (25 °C)), the molecular weight was detected using a liquid chromatography-mass spectrometry (LC-MS, purchased from Waters, model: LCT Premier). The measured value was consistent with the theoretical value, indicating that the synthesized reference conjugates 1-3 respectively have the double-stranded nucleic acid sequences designed as targets. Each reference siRNA conjugate has the structure shown in formula (403), and the siRNAs contained therein respectively have the siRNA sequences corresponding to reference conjugates 1-3 in Table 2, and these siRNA sequences do not contain stabilized modified nucleotides.
[0346] Synthesis of reference siRNA NC in Comparative Preparation Example 4
[0347] According to the method described in Preparation Example 1 of W02019105418(A1), the following reference siRNA NC was synthesized by solid-phase synthesis. The difference is only that DEPC water was used to dissolve the sense strand shown in SEQ ID NO: 161 and the antisense strand shown in SEQ ID NO: 162 that are equimolar and complementary to each other, and then annealed to obtain reference siRNA NC:
[0348] 5’-UmsUmsCmUmCmCmGfAfAfCmGmUmGmUmCmAmCmGmUm-3’
[0349] (SEQ ID NO: 161);
[0350] 5’-AmsCfsGmUmGmAfCmAmCmGmUmUmCmGfGmAfGmAmAmsCmsUm-3’
[0351] (SEQ ID NO: 162).
[0352] Synthesis of siRNA provided by the present disclosure in Preparation Examples 8-14
[0353] According to the method described in Preparation Example 1 of W02019105418(A1), the siRNA sequences listed in Table 2 were synthesized by solid-phase synthesis method, except that equimolar sense and antisense strands complementary to each other in Table 2 were dissolved in DEPC water, and then annealed to obtain siRNA1-siRNA7 provided by the present disclosure, and their sequences are shown in Table 2.
[0354] Comparative Preparation Examples 4-10
[0355] According to the same method as in Preparation Examples 8-14, reference siRNA-reference siRNA7 were prepared.
[0356] Experimental Example 1 Toxicity Effect of siRNA Conjugates in Mice
[0357] Conjugate 1, Conjugate 2 and Reference Conjugate 1 were separately dissolved in PBS to a solution of 10 mg / ml (calculated based on the siRNA conjugate). ICR mice (half male and half female, weighing 18-22 g, 5-6 weeks old, purchased from Beijing Sparf Bioscience Co., Ltd.) were randomly grouped, with 6 mice in each group (half male and half female), and numbered separately. By subcutaneous injection into the nape of the neck, each mouse was respectively given the above siRNA conjugate solution, and the administration volume was 10 mL / kg, as the test group; in addition, each mouse in another group of mice was respectively given PBS, and the administration volume was 10 mL / kg, as the blank control group.
[0358] Calculated with the administration time point as the first day, on the 8th day, orbital blood collection was performed on each mouse in the test group and the blank control group, and the blood collection volume was 0.6 mL. After incubation at 37 °C for 60 min after blood collection, centrifugation was performed at 4 °C at 3000 rpm for 15 min to obtain serum. Further, a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy) was used to detect the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum. The results are shown in Table 1.
[0359] Furthermore, after blood collection on the 8th day, the mice were sacrificed and dissected, and preserved in 10% neutral buffered formalin fixative and pathological sections were made. The severity of hepatic steatosis and inflammation in the pathological sections was evaluated and graded.
[0360] Experimental group Reference conjugate 1 Conjugate 1 Conjugate 2 Dose 100 mg / kg 100 mg / kg 100 mg / kg ALT 420% 116% 118% AST 126% - 32%
[0361] In Table 1, the numbers before and including the "%" represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in the mouse serum and the concentration in the serum of the blank control group, relative to the concentration in the serum of the blank control group. For example, 420% in Table 1 represents that the concentration of alanine aminotransferase in the mouse administered with reference conjugate 1 at 100 mg / Kg is 420% higher than that in the blank control group.
[0362] From the results in Table 1, it can be seen that compared with the blank control, the mice administered with reference conjugate 1 without stabilized modified nucleotides showed obvious changes in blood biochemical indexes. The concentration of ALT increased by 420%, and the concentration of AST increased by 126%. In the mice administered with siRNA conjugate 1 or 2 of the present disclosure, the concentration of ALT only increased by 116% and 118% respectively, and the concentration of AST only increased by 32%, showing significantly reduced blood biochemical indexes.
[0363] The results of pathological sections showed that compared with the blank control, among the 6 mice administered with reference conjugate 1 without stabilized modified nucleotides, 1 mouse showed moderate hepatocyte inflammatory reaction, specifically manifested as diffuse infiltration of a small amount of inflammatory cells in the hepatic lobule, diffuse hyperplasia of fibroblasts in the hepatic sinus, 3 mice showed mild hepatocyte inflammatory reaction, with focal infiltration of inflammatory cells visible in the local hepatic lobule, 1 mouse showed local hepatic lobule inflammatory necrosis, and individual hepatocytes showed punctate necrosis. Among the mice administered with conjugate 1 of the present disclosure, only 2 mice showed mild hepatocyte inflammatory reaction, manifested as infiltration of a small amount of inflammatory cells, and there was no inflammatory reaction or necrosis above moderate degree. Among the mice administered with conjugate 2 of the present disclosure, only 1 mouse showed mild hepatocyte inflammatory reaction, and there was no inflammatory reaction or necrosis above moderate degree. Compared with reference conjugate 1, conjugates 1 and 2 showed significantly lower toxic reactions.
[0364] The above results indicate that compared with the reference conjugate, the siRNA conjugate of the present disclosure can effectively reduce the liver toxicity reaction caused by off-target effects. Therefore, it shows significantly higher safety in the preparation of drugs for the treatment and / or prevention of diseases or symptoms related to dyslipidemia, and has excellent development prospects.
[0365] Experimental Example 2 Toxicity Effect of siRNA Conjugate in Mice
[0366] Dissolve conjugate 6, conjugate 7 and reference conjugate 3 in PBS to prepare solutions of 10 mg / ml and 30 mg / ml (calculated based on the siRNA conjugate). Randomly divide ICR mice (half male and half female, weighing 18 - 22 g, 5 - 6 weeks old, purchased from SPF Biotechnology Co., Ltd.) into groups and number them separately. For each conjugate at each concentration, the animals are divided into two groups: a 2 - week group and a 4 - week group, with 6 mice in each group (half male and half female). By subcutaneous injection in the nape of the neck, administer the above - mentioned siRNA conjugate solutions to each mouse, with the administration volume being 10 mL / kg, as the test group; in addition, administer PBS to each mouse in the two groups, with the administration volume being 10 mL / kg, as the 2 - week group or 4 - week group of the blank control group respectively.
[0367] Calculated with the administration time point as the first day, 15 days later, sacrifice 6 mice in the 2 - week group of conjugate at a concentration of 300 mg / kg and conduct necropsy, and preserve them in 10% neutral buffered formalin fixative and make pathological sections respectively. On the 29th day, collect orbital blood from 6 mice in the 4 - week groups of the test group and the blank control group respectively, with the blood collection volume being 0.6 mL for each. After incubation at 37°C for 60 min, centrifuge at 3000 rpm for 15 min at 4°C to obtain serum. Further use a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy) to detect the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum, and compare with the blank control group. The results are shown in Table 2. Evaluate and grade the severity of inflammatory cell infiltration and hepatocyte necrosis in the pathological sections and make relative comparisons.
[0368] Table 2 Blood biochemical results in mice administered with siRNA conjugates
[0369]
[0370] In Table 2, F represents female mice, and the number before % represents the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in the serum of mice and the concentration in the serum of the blank control group, as a percentage of the concentration in the serum of the blank control group. For example, F: 212% in Table 2 represents that the concentration of alanine aminotransferase in female mice administered with reference conjugate 3 at 300 mg / Kg is 212% higher than that in the blank control group.
[0371] As can be seen from the results in Table 2, compared with the blank control, the mice administered with reference conjugate 3 without stabilized modified nucleotides showed obvious changes in blood biochemical indexes. At a high dose of 300 mg / Kg, the concentrations of ALT and AST in female mice increased by 212% and 36% respectively. At the same dose, the concentrations of ALT and AST in female mice administered with conjugate 7 of the present disclosure increased by 130% and 32% respectively. Compared with reference conjugate 3, the concentration of ALT decreased significantly; no increase in the concentrations of ALT and AST was found in the mice administered with conjugate 6 of the present disclosure, and the degree of change in blood biochemical indexes decreased significantly compared with reference conjugate 3.
[0372] The results of pathological sections showed that, compared with the blank control, the mice administered with reference conjugate 3 without stabilized modified nucleotides showed obvious liver inflammatory reactions, and inflammatory cell infiltration occurred in all 6 mice. Only 3 mice showed inflammatory cell infiltration among the mice administered with conjugate 6. Only 3 mice showed inflammatory cell infiltration among the mice administered with conjugate 7. Compared with the reference conjugate, the number of mice with inflammatory cell infiltration in the tissue pathology of the conjugate of the present disclosure also decreased significantly.
[0373] The above results indicate that, compared with the reference conjugate, the siRNA conjugate of the present disclosure can effectively reduce the liver toxicity reaction caused by off-target effects, and thus shows significantly higher safety in the preparation of drugs for the treatment and / or prevention of diseases or symptoms related to dyslipidemia, and has excellent development prospects.
[0374] Experimental Example 3 Toxicity Effect of siRNA Conjugate in Mice
[0375] According to the method of Experimental Example 2, the toxicity effect of the siRNA conjugate in mice was verified. The difference was only that conjugate 3 and reference conjugate 2 were used for the test. Each conjugate was dissolved in PBS to a solution of 10 mg / ml (calculated as the siRNA conjugate). There were 3 male mice in each of the 2-week group and the 4-week group (labeled as group D15 and group D29 in Table 19 respectively). That is, the toxicity effects of conjugate 13 and reference conjugate 2 in mice at a dose of 100 mg / kg were tested.
[0376] Table 3 Blood Biochemical Results in Mice Administered with siRNA Conjugate
[0377]
[0378] In Table 3, the number before % represents the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in the serum of mice and the concentration in the serum of the blank control group, and the percentage of the concentration in the serum of the blank control group.
[0379] As can be seen from the results in Table 3, compared with the blank control, the mice administered with reference conjugate 2 that does not contain stabilized modified nucleotides showed obvious changes in blood biochemical indexes. On the 15th day after administration, the concentrations of ALT and AST in the serum increased by 71% and 54% respectively, and on the 29th day after administration, the concentrations of ALT and AST in the serum increased by 118% and 94% respectively. However, no increase in the concentrations of ALT and AST in the serum was observed in the mice administered with conjugate 3 at the same dose. The conjugate 3 of the present disclosure showed significantly lower blood biochemical indexes.
[0380] The results of pathological sections showed that, compared with the blank control, among the mice administered with reference conjugate 2 that does not contain stabilized modified nucleotides, 1 mouse showed severe hepatocyte degeneration in the histopathological results, specifically manifested as extensive visible hepatocyte swelling, loose and pale cytoplasm, and some hepatocytes accompanied by vacuolar degeneration, with tiny round vacuoles visible in the cytoplasm. 2 mice showed moderate hepatocyte degeneration, specifically manifested as massive to extensive cytoplasmic loosening of hepatocytes, and some hepatocytes accompanied by vacuolar degeneration, with tiny round vacuoles visible in the cytoplasm. Among the mice administered with the siRNA conjugate 3 of the present disclosure, 3 mice showed mild hepatocyte degeneration, and the number of hepatocytes with cytoplasmic loosening was less. Compared with the reference conjugate, the degree of hepatocyte degeneration was significantly reduced in histopathology, showing significantly lower toxic reactions.
[0381] The above results indicate that, compared with the reference conjugate, the siRNA conjugate of the present disclosure can effectively reduce the hepatotoxic reaction caused by off-target effects. Therefore, it shows significantly higher safety in the preparation of drugs for the treatment and / or prevention of diseases or symptoms related to dyslipidemia, and has excellent development prospects.
[0382] Experimental Example 4 Toxicity Effect of siRNA Conjugate in Mice
[0383] Conjugate 3 and conjugate 5 were respectively dissolved in PBS to a solution of 30 mg / ml (calculated based on the siRNA conjugate). ICR mice (half male and half female, weighing 18 - 22 g, 5 - 6 weeks old, purchased from Beijing SPF Biotechnology Co., Ltd.) were randomly grouped, with 10 mice in each group (half male and half female), and numbered respectively. By subcutaneous injection in the nape of the neck, each mouse was administered the above siRNA conjugate solution, and the administration volume was 10 mL / kg for each, as the test group; in addition, each mouse in a group of mice was administered PBS, and the administration volume was 10 mL / kg for each, as the blank control group.
[0384] Calculated with the first administration time point as day 1, each mouse was re-administered on days 8 and 15 respectively. The concentration and administration volume of the siRNA conjugate solution (or PBS) used were the same as those of the first administration. On day 16, orbital blood collection was performed on each mouse in the test group and the blank control group, with a blood collection volume of 0.6 mL. After blood collection, it was incubated at 37 °C for 60 min, and then centrifuged at 3000 rpm for 15 min at 4 °C to obtain serum. Further, a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy) was used to detect the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum. The results are shown in Figure 1A 、 Figure 1B 。
[0385] Figure 1A 、 Figure 1B are scatter plots of the concentrations of ALT and AST in the serum of mice after administering 300 mg / kg of the siRNA conjugate or PBS of the present disclosure weekly for three consecutive weeks. As shown by Figure 1A and Figure 1B , compared with the blank control group, after administering the siRNA conjugate of the present disclosure, the concentrations of serum ALT and AST were comparable to those of the blank control group, indicating that the siRNA conjugate of the present disclosure has very low hepatotoxicity.
[0386] Furthermore, after blood collection, the mice were sacrificed and dissected, and preserved in 10% neutral buffered formalin fixative and pathological sections were made. And relative comparisons were made. The pathological sections showed that the mice administered with conjugate 3 or conjugate 5 of the present disclosure showed reactions similar to those of the blank control group in terms of hepatic steatosis and inflammation, without significant abnormalities. This also indicates that the siRNA conjugate of the present disclosure has very low hepatotoxicity.
[0387] The above results indicate that the siRNA conjugate of the present disclosure can effectively reduce the hepatotoxicity reaction caused by off-target effects, and thus shows significantly higher safety in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms, and has excellent development prospects.
[0388] Experimental Example 4 Inhibitory Activity of siRNA Conjugate in vitro sicheck System
[0389] In this experimental example, an in vitro sicheck system was used to detect the inhibitory activity of conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 6, conjugate 7, reference conjugate 1, reference conjugate 2, reference conjugate 3, or reference siRNANC on the target sequence in the in vitro sicheck system.
[0390] [1] Construction of Detection Plasmid
[0391] A detection plasmid was constructed using the psiCHECKTM-2 (PromegaTM) plasmid, and the plasmid contains a target sequence 1, that is, the siRNA target sequence. For the siRNA conjugate to be tested, the target sequence 1 is shown as follows:
[0392] TGCTCAGTTCATCCCTAGAGGCAGCTGCTCCAGGAACAGAGGTGCCATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGGGTTACATGAAGCACGCCACCAAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAGTTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGCGAGCTCCTTGGGTCCTGCAATCTCCAGGGCTGCCCCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTGGCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCTGCTATG(SEQ ID NO: 163)
[0393] This target sequence 1 is a nucleotide sequence in the mRNA expressed by the human APOC3 gene targeted by the detected siRNA. Therefore, the inhibitory effect of each siRNA conjugate on the target sequence 1 can reflect the inhibitory ability of the siRNA in the detected siRNA conjugate on APOC3 gene expression. The target sequence 1 and its complementary sequence were cloned into the Xho I / Not I sites of the psiCHECKTM-2 plasmid.
[0394] [2] Transfection
[0395] HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% (v / v) penicillin-streptomycin (Gibco, Invitrogen) in an incubator at 37°C with 5% CO2 / 95% air.
[0396] HEK293A cells were seeded at 8×10 3 cells / well in a 96-well plate. After 16 h when the cell growth density reached 70 - 80%, the H-DMEM complete medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well for further culturing for 1.5 h.
[0397] The above detection plasmid was diluted with DEPC-treated water to a detection plasmid working solution of 200 ng / μL; each of the following siRNA conjugates or the reference siRNA NC was separately formulated into siRNA conjugate working solutions or reference siRNA NC working solutions at 3 different concentrations (calculated as siRNA) of 10 nM, 3 nM, and 1 nM using DEPC-treated water. The siRNA conjugates used were conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 6, conjugate 7, reference conjugate 1, reference conjugate 2, and reference conjugate 3 obtained from the above preparation.
[0398] For each siRNA conjugate or reference siRNA NC, 1A1 - 1A3 solutions were separately prepared. Each 1A1 - 1A3 solution sequentially contained 1 μL of the siRNA conjugate working solution or reference siRNA NC working solution at the above 3 concentrations, 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid), and 10 μL of Opti-MEM medium.
[0399] 1B solutions were prepared. Each 1B solution contained 0.2 μL of Lipofectamine TM 2000 and 10 μL of Opti-MEM medium.
[0400] 1C solutions were prepared. Each 1C solution contained 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid) and 10 μL of Opti-MEM medium.
[0401] One 1B solution was separately mixed with one 1A1 - 1A3 solution of each siRNA conjugate or reference siRNA NC obtained, and incubated at room temperature for 20 min to obtain transfection complexes 1X1 - 1X3 of each siRNA conjugate or reference siRNA NC.
[0402] Mix one part of Solution 1B with one part of Solution 1C and incubate at room temperature for 20 min to obtain the blank transfection complex 1X4.
[0403] In the culture wells, add the transfection complexes 1X1 - 1X3 of each siRNA conjugate or reference siRNA NC respectively, mix evenly, and the addition amount is 20 μL / well to obtain the transfection complexes with the final concentrations of each siRNA conjugate or reference siRNA NC being approximately 0.1 nM, 0.03 nM, and 0.01 nM (calculated based on siRNA) respectively. The transfection complexes 1X1 - 1X3 of each siRNA conjugate or reference siRNA NC are transfected into 3 culture wells respectively to obtain the co - transfection mixtures containing the siRNA conjugate or reference siRNA NC, denoted as the test groups.
[0404] For each siRNA conjugate or reference siRNA NC, in another 3 culture wells, add the transfection complex 1X4 respectively, and the addition amount is 20 μL / well to obtain the transfection mixtures without siRNA, denoted as the blank control groups.
[0405] After transfecting the co - transfection mixtures containing siRNA and the co - transfection mixtures without siRNA in the culture wells for 4 hours, add 100 μL of H - DMEM complete medium containing 20% FBS to each well. Place the 96 - well plate in a CO₂ incubator and continue culturing for 24 hours.
[0406] [3] Detection
[0407] Aspirate the medium in the culture wells, and add 150 μL of the mixed solution of Dual - Luciferase reagent and H - DMEM (volume ratio 1:1) to each well, mix thoroughly, incubate at room temperature for 10 min, then transfer 120 μL of the mixed solution to a 96 - well microplate, and use a Synergy II multi - functional microplate reader (BioTek) to read the chemiluminescence value (Fir) of Firefly in each culture well on the 96 - well microplate; then add 60 μL of Dual - Stop& reagent to each well on the 96 - well microplate, mix thoroughly, incubate at room temperature for 10 min, and then read the chemiluminescence value (Ren) of Renilla in each culture well on the 96 - well microplate according to the layout for reading Fir using the microplate reader.
[0408] Calculate the luminescence ratio Ratio = Ren / Fir for each well on a 96-well microplate. The luminescence ratio Ratio(test) or Ratio(control) for each test group or control group is the average of the Ratios of three culture wells; taking the luminescence ratio of the control group as the benchmark, normalize the luminescence ratios of each test group to obtain the ratio R of Ratio(test) / Ratio(control), which represents the relative expression level of the Renilla reporter gene, i.e., the residual activity. The inhibition rate of each siRNA conjugate or reference siRNA NC against target sequence 1 = (1 - R) × 100%.
[0409] The inhibitory effect of each siRNA conjugate or reference siRNA NC on target sequence 1 is shown in Figure 2 . Figure 2 It is a bar chart of the relative expression level of target sequence 1 in the in vitro sicheck system after co-transfecting the plasmid containing target sequence 1 and the siRNA conjugate or reference siRNA NC to be tested. Further, the expression inhibition rates of each siRNA conjugate or reference siRNA NC on target sequence 1 are summarized in Table 3.
[0410] Table 4 Expression inhibition rates of target sequence 1 in the in vitro sicheck system
[0411]
[0412] According to Figure 2 and the results in Table 4, it can be seen that the siRNA conjugates provided by the present disclosure have high inhibitory activity against target sequences in the in vitro sicheck system. At a low concentration of 0.01 nM, the expression inhibition rate of target sequence 1 is at least 38.92 nM, up to 67.54%; at a concentration of 0.1 nM, the expression inhibition rate of target sequence 1 is at least 84.73%, up to 89.35%. At the same time, it has a target sequence inhibition activity level close to that of reference conjugate 1, reference conjugate 2, or reference conjugate 3 that do not contain stabilized modified nucleotides.
[0413] Experimental Example 6 Inhibitory activity of siRNA conjugates in the in vitro sicheck system
[0414] In this experimental example, an in vitro sicheck system was used to detect the inhibitory activity of conjugate 6, conjugate 7, or reference conjugate 3 against target sequences in the in vitro sicheck system.
[0415] According to the method described by Kumico Ui-Tei et.al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, a detection plasmid was constructed. The detection plasmid and the conjugate to be tested were co-transfected into HEK293A cells, and the inhibitory activity of the target sequence of siRNA was reflected by the expression level of the dual luciferase reporter gene. The specific steps are as follows:
[0416] [1] Construction of the detection plasmid
[0417] The psiCHECK TM -2 (Promega TM ) plasmid was used to construct the detection plasmid, which contains a target sequence 2, that is, the target sequence of the siRNA conjugate. For the siRNA conjugate to be tested, the target sequence 2 is shown as follows:
[0418] TTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACC
[0419] (SEQ ID NO: 164)
[0420] This target sequence 2 is the complete complementary sequence of the antisense strand in the detected siRNA conjugate. Therefore, the inhibitory effect of each siRNA conjugate on target sequence 1 can reflect the inhibitory ability of the target gene expression of the detected siRNA conjugate. The target sequence 2 and its complementary sequence were cloned into the Xho I / Not I sites of the psiCHECKTM-2 plasmid.
[0421] [2] Transfection
[0422] HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% (v / v) penicillin-streptomycin (Gibco, Invitrogen) at 37°C in an incubator containing 5% CO2 / 95% air.
[0423] HEK293A cells were seeded at 8×10 3 cells / well in a 96-well plate. After 16 hours, when the cell growth density reached 70 - 80%, the H-DMEM complete medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well and cultured for an additional 1.5 hours.
[0424] The above detection plasmid was diluted with DEPC-treated water to a detection plasmid working solution of 200 ng / μL; each siRNA conjugate in Table 4 was separately formulated with DEPC-treated water into 11 different concentration siRNA conjugate working solutions of 1.00 μM, 0.330 μM, 0.110 μM, 0.0370 μM, 0.0123 μM, 0.00412 μM, 0.00137 μM, 0.000457 μM, 0.000152 μM, 0.0000508 μM, and 0.0000169 μM (counted by the amount of siRNA in the siRNA conjugate). The siRNA conjugates used were conjugate 6, conjugate 7, and reference conjugate 3 obtained from the above preparation.
[0425] For each siRNA conjugate, 2A1 - 2A11 solutions were separately prepared. Each 2A1 - 2A11 solution sequentially contained 1 μL of the above 11-concentration siRNA working solution, 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid), and 10 μL of Opti-MEM medium.
[0426] 2B solutions were prepared. Each 2B solution contained 0.2 μL of LipofectamineTM 2000 and 10 μL of Opti-MEM medium.
[0427] 2C solutions were prepared. Each 2C solution contained 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid) and 10 μL of Opti-MEM medium.
[0428] One 2B solution was separately mixed with one 2A1 - 2A11 solution of each siRNA conjugate and incubated at room temperature for 20 min to obtain the transfection complexes 2X1 - 2X11 of each siRNA conjugate.
[0429] One 2B solution was mixed with one 2C solution and incubated at room temperature for 20 min to obtain the blank transfection complex 2X12
[0430] In the culture wells, transfection complexes 2X1 - 2X11 of each siRNA conjugate were added separately and mixed evenly, with an addition amount of 20 μL / well, to obtain transfection complexes with final concentrations of each siRNA conjugate approximately 0.01 μM, 0.0033 μM, 0.0011 μM, 0.00037 μM, 0.000123 μM, 0.0000412 μM, 0.0000137 μM, 0.00000457 μM, 0.00000152 μM, 0.000000508 μM, and 0.000000169 μM (calculated based on the amount of siRNA in the siRNA conjugate). The transfection complexes 2X1 - 2X11 of each siRNA conjugate were transfected into 3 culture wells respectively to obtain co - transfection mixtures containing the siRNA conjugate, denoted as the test groups.
[0431] For each siRNA conjugate, in another 3 culture wells, transfection complex 2X12 was added separately, with an addition amount of 20 μL / well, to obtain a transfection mixture without the siRNA conjugate, denoted as the blank control group.
[0432] After transfecting the co - transfection mixtures containing the siRNA conjugate and the co - transfection mixtures without the siRNA conjugate in the culture wells for 4 hours, 100 μL of H - DMEM complete medium containing 20% FBS was supplemented to each well. The 96 - well plate was placed in a CO2 incubator and cultured for another 24 hours.
[0433] [3] Detection
[0434] The medium in the culture wells was aspirated, and 150 μL of a mixed solution of Dual - Luciferase reagent and H - DMEM (volume ratio 1:1) was added to each well, mixed thoroughly, and after incubating at room temperature for 10 min, 120 μL of the mixed solution was transferred to a 96 - well microplate, and the chemiluminescence value (Fir) of Firefly in each culture well on the 96 - well microplate was read using a Synergy II multi - functional microplate reader (BioTek); then 60 μL of Dual - Stop& reagent was added to each well of the 96 - well microplate, mixed thoroughly, and after incubating at room temperature for 10 min, according to the layout of reading Fir, the chemiluminescence value (Ren) of Renilla in each culture well on the 96 - well microplate was read using the microplate reader.
[0435] Calculate the luminescence ratio Ratio = Ren / Fir for each well on the 96-well microplate. The luminescence ratio Ratio(test) or Ratio(control) for each test group or control group is the average of the Ratio values of three culture wells; using the luminescence ratio of the control group as a reference, normalize the luminescence ratios of each test group to obtain the ratio R of Ratio(test) / Ratio(control), which represents the relative expression level of the Renilla reporter gene, i.e., the residual activity. The inhibition rate of siRNA on the target sequence = (1 - R) × 100%.
[0436] Based on the relative residual activity of Renilla in HEK293A cells after transfection with different concentrations of the siRNA to be tested, use the non-linear regression analysis function of Graphpad 5.0 software to fit the log(inhibitor) vs. response-Variableslope (four parameters) dose-response curve.
[0437] According to the function corresponding to the fitted dose-response curve, calculate the IC50 value of the siRNA to be tested targeting the target sequence. The function is as follows,
[0438]
[0439] Wherein:
[0440] Y is the ratio R, i.e., the relative residual activity of Renilla,
[0441] X is the logarithm of the siRNA transfection concentration,
[0442] Bot is the Y value at the bottom of the steady state period,
[0443] Top is the Y value at the top of the steady state period,
[0444] X′ is the X value corresponding to when Y is half between the bottom and the top, and HillSlope is the slope of the curve at X′.
[0445] From this dose-response curve and the corresponding function, determine the X 50 value corresponding to when Y = 50%, and calculate to obtain the IC 50 value = 10^X 50 (nM), and the IC 50 values are summarized in Table 5.
[0446] Conjugate number <![CDATA[IC 50 > Conjugate 6 8.55 pM Conjugate 7 6.89 pM Reference conjugate 3 6.68 pM
[0447] From the results in Table 5, it can be seen that the siRNA conjugate of the present disclosure has high target sequence inhibition activity in the in vitro sicheck system, and the IC 50between 6.89 and 8.55 pM. Meanwhile, reference conjugate 3, which is identical to the other sequences but does not contain stabilized modified nucleotides, has a close target sequence inhibitory activity.
[0448] Inhibitory Activity of siRNA Conjugates in vitro sicheck System in Experimental Example 7
[0449] According to the method of Experimental Example 6, the off-target sequence inhibitory activities of conjugate 3 and conjugate 6 in the in vitro sicheck system were tested. The only difference was that conjugate 3 or conjugate 6 was used instead of the tested siRNA conjugate for detection; for conjugate 6, the target sequence used was target sequence 2, or target sequence 3-5 shown below were used to replace target sequence 2 respectively; for conjugate 3, the target sequence used was target sequence 2, or target sequence 6-8 shown below were used to replace target sequence 2 respectively:
[0450] Target sequence 3:
[0451] TAGGCCCCTTTCAAGTATTCT (SEQ ID NO: 165)
[0452] Target sequence 4:
[0453] AGAATACTGTCCCTTTTAAGC (SEQ ID NO: 166)
[0454] Target sequence 5:
[0455] CTCCGCAGTGAAATTTTAAGC (SEQ ID NO: 167)
[0456] Target sequence 6:
[0457] CTTTCACTGCGGATCAGTGCT (SEQ ID NO: 168)
[0458] Target sequence 7:
[0459] AGCACTGAGAATACTGTCCCT (SEQ ID NO: 169)
[0460] Target sequence 8:
[0461] CTACAGTCTCCGCCTGTCCCT (SEQ ID NO: 170)
[0462] Among them, the target sequence 2 contains the complete complementary sequence of the siRNA antisense strand in conjugate 3 and conjugate 6. Therefore, the inhibitory effect of conjugate 3 or 6 on target sequence 2 can reflect the ApoC3 mRNA inhibitory activity of conjugate 3 or 6; the target sequence 3 contains a sequence partially complementary to the siRNA antisense strand in conjugate 6, the target sequence 4 contains the complete complementary sequence of the siRNA sense strand in conjugate 6, and the target sequence 5 contains a sequence partially complementary to the siRNA sense strand in conjugate 6. Therefore, the inhibitory effect of conjugate 6 on target sequences 3, 4, or 5 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the more likely conjugate 6 is to cause off-target. Similarly, the target sequence 6 contains a sequence partially complementary to the siRNA antisense strand in conjugate 3, the target sequence 7 contains the complete complementary sequence of the siRNA sense strand in conjugate 3, and the target sequence 8 contains a sequence partially complementary to the siRNA sense strand in conjugate 3. Therefore, the inhibitory effect of conjugate 3 on target sequences 6, 7, or 8 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the more likely conjugate 3 is to cause off-target.
[0463] As a result, in the in vitro sicheck system, the inhibitory IC50 of conjugate 6 on target sequence 2 was 11.3 pM, and the inhibition rate on target sequences 3, 4, or 5 was less than 50% within the entire tested siRNA concentration range, that is, no off-target occurred; the inhibitory IC50 of conjugate 3 on target sequence 2 was 4.50 pM, and the inhibition rate on target sequences 6, 7, or 8 was less than 50% within the entire tested siRNA concentration range, that is, no off-target occurred.
[0464] It can be seen that in the in vitro sicheck system, the siRNA conjugates of the present disclosure show excellent on-target inhibitory activity for the target sequence, with an IC50 value of 4.50 pM - 11.3 pM; at the same time, the siRNA conjugates of the present disclosure have a low off-target effect.
[0465] Experimental Example 8 Inhibitory Activity of siRNA Conjugates in the In Vitro sicheck System According to the method of Experimental Example 6, the inhibitory activity of conjugate 5 in the in vitro sicheck system was tested. The only difference was that conjugate 5 was used instead of the tested siRNA conjugate for detection. As a result, conjugate 5 showed high inhibitory activity for the target sequence in the in vitro sicheck system, with an IC 50 of 49.8 pM.
[0466] Experimental Example 9 Effect of siRNA Conjugates on Reducing Blood Lipids in Mice (in vivo)
[0467] Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content > 2 mmol / L were randomly divided into groups of 6 mice each, with an equal number of males and females. Conjugate 6, reference conjugate 3, and PBS blank control were administered to each group of mice respectively. The drug dose for all animals was calculated based on body weight, and a single dose was administered by subcutaneous injection. The dosing dose of each siRNA conjugate (calculated based on the amount of siRNA) was 3 mg / kg of mouse body weight, and the dosing volume was 5 ml / kg. Each siRNA conjugate was provided as an aqueous PBS solution, and the concentration of the conjugate to be prepared was calculated based on the dosing dose and dosing volume. Each mouse in another group was given 1×PBS with a dosing volume of 5 ml / kg as the blank control group.
[0468] Taking the dosing time point as the first day, blood was collected from the orbital venous plexus of mice on the 1st, 9th, and 15th days, 100 μL each time. After blood collection, it was placed at room temperature for 30 min and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The content of total cholesterol (CHO) and triglyceride (TG) in the serum was further detected using a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy).
[0469] Standardized blood lipid level = (blood lipid content of the test group after dosing / blood lipid content of the test group before dosing) × 100%.
[0470] Inhibition rate of blood lipid level = (1 - blood lipid content of the test group after dosing / blood lipid content of the test group before dosing) × 100%.
[0471] Among them, blood lipid refers to total cholesterol (CHO) or triglyceride (TG).
[0472] Figure 3A and Figure 3B are line graphs showing the changes in serum TG level or serum CHO level over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS of the present disclosure. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 6A and 6B below:
[0473] Table 6A Serum TG inhibition rate of siRNA conjugate in transgenic mice
[0474]
[0475] Table 6B Serum CHO inhibition rate of siRNA conjugate in transgenic mice
[0476]
[0477] Figure 3A 、Figure 3B As well as the results in Tables 6A and 6B show that at different time points after administration, conjugate 6 can significantly reduce the TG and CHO levels in the serum of mice, and shows a reduction effect on blood lipid levels that does not exceed 11% compared with the corresponding reference conjugate 3 that does not include the stabilized modified nucleotide.
[0478] Experimental Example 10 Effect of siRNA conjugate on reducing blood lipids in mice (in vivo)
[0479] The method of Experimental Example 9 was used to examine the effect of conjugate 7 of the present disclosure on reducing blood lipids in mice. The difference is only that conjugate 7, reference conjugate 3, and PBS blank control were respectively administered to each group of mice. All animals were dosed according to body weight, and a single dose was administered by subcutaneous injection. The dosing dose of each siRNA conjugate (calculated based on the amount of siRNA) was 3 mg / kg and 1 mg / kg of mouse body weight, and the dosing volume was 5 ml / kg. Taking the dosing time point as the first day, blood was taken from the orbital venous plexus of mice on the 1st, 9th, 15th, 22nd, 29th, 36th, and 50th days respectively.
[0480] Figure 4A and Figure 4B are respectively line graphs showing the changes in serum TG level or serum CHO level over time after administration of the siRNA conjugate of the present disclosure, reference siRNA conjugate, or PBS. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in the following Tables 7A and 7B:
[0481] Table 7A Serum TG inhibition rate of siRNA conjugate in transgenic mice
[0482]
[0483] Table 7B Serum CHO inhibition rate of siRNA conjugate in transgenic mice
[0484]
[0485] Figure 4A , Figure 4B As well as the results in Tables 7A and 7B show that at different time points after administration, conjugate 7 can significantly reduce the TG and CHO levels in the serum of mice, and shows a comparable or even better reduction effect on blood lipid levels compared with the corresponding reference conjugate 3 that does not include the stabilized modified nucleotide. In particular, at a dose of 3 mg / kg, conjugate 7 always shows a high blood lipid TG reduction effect throughout the entire dosing period of up to 50 days, and the highest inhibition rate can reach 90.2%.
[0486] Experimental Example 11 Effect of siRNA conjugate on reducing blood lipids in mice (in vivo)
[0487] According to the method of Experimental Example 9, the effect of the siRNA conjugate on reducing blood lipids in mice was detected, except that the siRNA conjugate used was Conjugate 3 or Conjugate 4. The results are shown in FIGS. 9A and 9B.
[0488] FIGS. 9A and 9B are line graphs showing the changes in serum TG level or serum CHO level over time after administration of the siRNA conjugate of the present disclosure or PBS. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 8A and 8B below:
[0489] Table 8A Serum TG inhibition rate of siRNA conjugate in transgenic mice
[0490]
[0491] Table 8B Serum CHO inhibition rate of siRNA conjugate in transgenic mice
[0492]
[0493] Figure 5A 、 Figure 5B And the results in Tables 8A and 8B show that at different time points after administration, Conjugate 3 and Conjugate 4 can significantly reduce the TG and CHO levels in the serum of mice. In particular, at the doses of 3 mg / kg and 1 mg / kg, Conjugate 4 consistently showed a high effect on reducing blood lipid TG throughout the entire administration period of up to 50 days, with a maximum inhibition rate of up to 92.0%.
[0494] Experimental Example 12 Effect of siRNA conjugate on reducing blood lipids in mice (in vivo)
[0495] According to the method of Experimental Example 9, the effect of the siRNA conjugate on reducing blood lipids in mice was detected, except that the siRNA conjugate used was Conjugate 3, and the administration dose of each siRNA conjugate (calculated based on the amount of siRNA) was 9 mg / kg, 3 mg / kg, 1 mg / kg, 0.5 mg / kg, 0.25 mg / kg, 0.1 mg / kg, or 0.05 mg / kg of mouse body weight, and the administration volume was 5 ml / kg. Each siRNA conjugate was provided as an aqueous PBS solution, and the concentration of the conjugate to be prepared was calculated based on the administration dose and administration volume. Taking the administration time point as the first day, blood was collected from the orbital venous plexus of mice on the 1st, 8th, 15th, 22nd, 29th, 36th, 43rd, 50th, 57th, and 64th days to detect the TG level in the serum. The results are as Figure 6 shown.
[0496] Figure 6 To show the line graph of the change in serum TG levels over time after administration of conjugate 3 or PBS at different concentrations. Further, the serum TG inhibition rates at each time point are summarized in Table 9 below:
[0497] Table 9 Serum TG inhibition rates of siRNA conjugates in transgenic mice
[0498]
[0499] Figure 6 And the results in Table 9 show that at different time points after administration, conjugate 3 at different concentrations can reduce the TG level in the serum of mice. In particular, at a dosing dose of 9 mg / kg, after only one administration, the siRNA conjugate of the present disclosure can maintain a TG level inhibition rate greater than 50% for a long time of 64 days, and the highest inhibition rate can reach 89.5%, showing excellent blood lipid inhibition ability.
[0500] Experimental Example 13 Effect of siRNA conjugate on reducing blood lipid in mice (in vivo)
[0501] Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content > 2 mmol / L were randomly divided into groups, with 8 mice in each group, half male and half female. Conjugate 3, conjugate 5, and PBS blank control were administered to each group of mice respectively. The drug dosage for all animals was calculated based on body weight, and a single administration was performed by subcutaneous injection. The dosing doses (calculated based on the amount of siRNA) of each siRNA conjugate were 3 mg / kg and 1 mg / kg of mouse body weight, and the dosing volume was 5 ml / kg. Each siRNA conjugate was provided as an aqueous solution of PBS, and the concentration of the conjugate to be prepared was calculated based on the dosing dose and dosing volume. Each mouse in another group was given 1×PBS with a dosing volume of 5 ml / kg as the blank control group.
[0502] Taking the dosing time point as the first day, blood was collected from the orbital venous plexus of mice on the 1st, 8th, 15th, 22nd, 29th, 36th, and 43rd days, 100 μL each time. After blood collection, it was placed at room temperature for 30 min and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. Further, the contents of total cholesterol (CHO) and triglyceride (TG) in the serum were detected using a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy).
[0503] Standardized blood lipid level = (blood lipid content in the test group after administration / blood lipid content in the test group before administration) × 100%.
[0504] Inhibitory rate of blood lipid level = (1 - blood lipid content in the test group after administration / blood lipid content in the test group before administration) × 100%.
[0505] Among them, blood lipid refers to total cholesterol (CHO) or triglyceride (TG).
[0506] Figure 7A and Figure 7B are respectively line graphs showing the changes in serum TG level or serum CHO level over time after administration of the siRNA conjugate or PBS of the present disclosure. Further, after administration of the siRNA conjugate of the present disclosure, the inhibitory rates of mouse serum TG and serum CHO at each time point are summarized in Table 10A and Table 10B below:
[0507] Table 10A Serum TG inhibitory rate of siRNA conjugate in transgenic mice
[0508]
[0509] Table 10B Serum CHO inhibitory rate of siRNA conjugate in transgenic mice
[0510]
[0511] Analysis Figure 7A 、 Figure 7B From the results of Table 10A, Table 10B, and the analysis, it can be seen that at different time points after administration, Conjugate 3 and Conjugate 5 can significantly reduce the TG and CHO levels in the serum of mice. And a high inhibitory effect is maintained throughout the 43-day experimental period. In particular, both Conjugate 3 and Conjugate 5 at a dose of 3 mg / kg showed excellent inhibitory effects on mouse blood lipids. The maximum inhibitory rate of serum TG was higher than 88%; the maximum inhibitory rates of serum CHO were 51.18% and 57.41% respectively. The above results indicate that the siRNA conjugate of the present disclosure can effectively reduce blood lipid levels for a long time and shows excellent development prospects in the preparation of drugs for the treatment and / or prevention of diseases or symptoms related to dyslipidemia.
[0512] Experimental Example 14 Effect of siRNA conjugate on reducing blood lipids in mice (in vivo)
[0513] Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content > 2 mmol / L were randomly divided into groups of 6 mice each, with an equal number of males and females. Conjugate 1, Conjugate 2, reference conjugate 1, and PBS blank control were administered to each group of mice respectively. The drug dose for all animals was calculated based on body weight, and a single dose was administered by subcutaneous injection. The dosing doses of each siRNA conjugate (calculated based on the amount of siRNA) were 3 mg / kg and 1 mg / kg of mouse body weight, and the dosing volume was 5 ml / kg. Each siRNA conjugate was provided as an aqueous PBS solution, and the concentration of the conjugate to be prepared was calculated based on the dosing dose and dosing volume. Each mouse in another group was given 1×PBS with a dosing volume of 5 ml / kg as the blank control group.
[0514] Taking the dosing time point as day 1, blood was collected from the orbital venous plexus of mice on days 1, 8, 15, and 22, 100 μL each time. After blood collection, it was placed at room temperature for 30 min and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The contents of total cholesterol (CHO) and triglyceride (TG) in the serum were further detected using a PM1P000 / 3 fully automatic serum biochemical analyzer (SABA, Italy).
[0515] Normalized blood lipid level = (blood lipid content in the test group after dosing / blood lipid content in the test group before dosing) × 100%.
[0516] Inhibition rate of blood lipid level = (1 - blood lipid content in the test group after dosing / blood lipid content in the test group before dosing) × 100%.
[0517] Among them, blood lipid refers to total cholesterol (CHO) or triglyceride (TG).
[0518] Figure 8A and Figure 8B are line graphs showing the changes in serum TG level or serum CHO level over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS of the present disclosure. Further, after administration of the siRNA conjugate of the present disclosure, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 11A and 11B below:
[0519] Table 11A Serum TG inhibition rate of siRNA conjugate in transgenic mice
[0520]
[0521]
[0522] Table 11B Serum CHO inhibition rate of siRNA conjugate in transgenic mice
[0523]
[0524] Figure 8A 、 Figure 8B The results in Table 11A and Table 11B indicate that at different time points after administration, conjugate 1 and conjugate 2 can significantly reduce the TG and CHO levels in the serum of mice. Moreover, a high inhibitory effect is maintained throughout the 22-day experimental period, and a lipid level reduction effect similar to that of the corresponding reference conjugate 1 without the stabilized modified nucleotide is shown.
[0525] In particular, both conjugate 1 and conjugate 2 at a dose of 3 mg / kg showed excellent lipid inhibition effects in mice, with the maximum inhibition rates of serum TG both higher than 92%; the maximum inhibition rates of serum CHO were 57.5% and 54.9% respectively. The above results indicate that the siRNA conjugates of the present disclosure can effectively reduce lipid levels for a long time and show excellent development prospects in the preparation of drugs for the treatment and / or prevention of diseases or symptoms related to dyslipidemia.
[0526] Experimental Example 15 Determination of the duplex thermal dissociation temperature Tm
[0527] Each of siRNA1 - siRNA7 and reference siRNA1 - reference siRNA7 prepared above was formulated into a 0.02 mg / mL solution with 1X PBS buffer as the test solution. The test solution was added to a 10 mm path length quartz cuvette on an Agilent cary300UV spectrophotometer equipped with a thermal program, and the temperature - absorbance curve was monitored at a wavelength of 260 nm, where the heating rate was 0.5 °C / min, starting from 20.0 °C and heating up to 95 °C. The duplex thermal dissociation temperature Tm was calculated from the first derivative of the temperature - absorbance curve according to the spectrophotometer instructions. The Tm values are shown in Table 12 below:
[0528] Table 12 Duplex thermal dissociation temperature Tm
[0529]
[0530]
[0531] Among them, reference siRNA1 - reference siRNA7 have the same base sequences as siRNA1 - siRNA7 in sequence, but are siRNAs with no modification at the positions where siRNA1 - siRNA7 have stabilized modified nucleotides:
[0532] ATm value (test siRNA) = Tm (siRNA) - Tm (reference siRNA).
[0533] As can be seen from the results in Table 12, compared with the case where the nucleotides at the same position are unmodified, the double-stranded oligonucleotides and their conjugates containing stabilized modified nucleotides of the present disclosure have a higher double-stranded thermal dissociation temperature, and the double-stranded thermal dissociation temperature increases by at least 1.33 °C. Among them, the one with the largest increase is siRNA1, which increases by 2.91 °C compared to the reference siRNA.
[0534] Some embodiments of the present disclosure have been described in detail above. However, the present disclosure is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.
[0535] In addition, it should be noted that, among the various specific technical features described in the above some embodiments, they can be combined in any appropriate manner without contradiction. To avoid unnecessary repetition, the present disclosure will not separately describe various possible combination methods.
[0536] Furthermore, any combination can be made between various different embodiments of the present disclosure, as long as it does not violate the idea of the present disclosure, and it should also be regarded as the content disclosed by the present disclosure.
Claims
1. A siRNA, the siRNA comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, both the nucleotide sequence I and the nucleotide sequence II consisting of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II being a modified nucleotide, the nucleotide sequence I and the nucleotide sequence II being completely reverse complementary to form a double-stranded region, the nucleotide sequence II being at least partially reverse complementary to a first nucleotide sequence, the first nucleotide sequence being a nucleotide sequence of 19 nucleotides in the mRNA expressed by the apolipoprotein C3 gene, in the direction from the 5'-end to the 3'-end, at least one of the 3rd to 6th nucleotides of the nucleotide sequence II being a stabilized modified nucleotide, the 3rd or 5th nucleotide of the nucleotide sequence II being the stabilized modified nucleotide, the stabilized modified nucleotide referring to a nucleotide in which the 2'-hydroxyl group of the ribose of the nucleotide is replaced by a stabilized modifying group, the thermal stability of the siRNA comprising the stabilized modified nucleotide being increased compared to a siRNA in which the corresponding position nucleotide is an unmodified nucleotide, and the steric hindrance of the stabilized modifying group being greater than 2'-O-methyl, each stabilized modifying group being 2'-O-methoxyethyl, the sense strand and the antisense strand have the same or different lengths, the length of the sense strand being 19 - 23 nucleotides, and the length of the antisense strand being 19 - 26 nucleotides; and the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4: 5'- CAAUAAAGCUGGACAAGAZ3 -3'(SEQ ID NO:3); 5'- Z4UCUUGUCCAGCUUUAUUG -3'(SEQ ID NO:4), Among them, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3; Z4 is the first nucleotide at the 5'-end of the antisense strand; alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:47, and the nucleotide sequence II is the nucleotide sequence shown in SEQID NO:48: 5'- UUAAAAGGGACAGUAUUCZ7 -3'(SEQ ID NO:47); 5'- Z8GAAUACUGUCCCUUUUAA -3'(SEQ ID NO:48), wherein, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7; Z8 is the first nucleotide at the 5'-end of the antisense strand; alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:107, and the nucleotide sequence II is the nucleotide sequence shown in SEQID NO:108: 5'- GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:107); 5'-Z 12 GCACUGAGAAUACUGUCC - 3'(SEQ ID NO:108), Among them, Z 11 is selected from A, U, G or C, and Z 12 is a nucleotide complementary to Z 11 ; the said Z 12 is the first nucleotide at the 5'-end of the antisense strand In the direction from the 5'-end to the 3'-end, if the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence II are not the stabilized modified nucleotides, they are 2'-fluoro modified nucleotides, and the other nucleotides in the nucleotide sequence II are each independently one of the non-fluoro modified nucleotides; in the direction from the 5'-end to the 3'-end, the 7th - 9th nucleotides of the nucleotide sequence I are 2'-fluoro modified nucleotides, and the other nucleotides in the nucleotide sequence I are each independently one of the non-fluoro modified nucleotides, and each non-fluoro modified nucleotide is a methoxy modified nucleotide, and the methoxy modified nucleotide refers to a nucleotide formed by substituting the 2'-hydroxyl group of the ribose with a methoxy group.
2. The siRNA according to claim 1, wherein, In the direction from the 5'-end to the 3'-end, no more than 2 nucleotides among the 3rd - 9th nucleotides in the nucleotide sequence II are the stabilized modified nucleotides.
3. The siRNA according to claim 1 or 2, wherein The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases, and Tm is the double-stranded thermal dissociation temperature of the siRNA.
4. The siRNA according to claim 3, wherein, The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by at least 0.05 °C.
5. The siRNA according to claim 3, wherein, The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by 0.1 - 6 °C.
6. The siRNA according to claim 3, wherein The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by 0.5 - 4 °C.
7. The siRNA according to claim 1, wherein, The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:1, 5'- CAAUAAAGCUGGACAAGAZ1 -3'(SEQ ID NO:1), where Z1 is A; Alternatively, the first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:45, 5'- UUAAAAGGGACAGUAUUCZ5 -3'(SEQ ID NO:45), where Z5 is U; Alternatively, the first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:105, 5'- GGACAGUAUUCUCAGUGCZ9 -3'(SEQ ID NO:105), where Z9 is U.
8. The siRNA according to claim 1, wherein The sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of the non-fluorinated modified nucleotides and is not the stabilizing modification. The length of nucleotide sequence III is 1, 2, 3, or 4 nucleotides. Nucleotide sequence IV has the same length as nucleotide sequence III, and nucleotide sequence IV and nucleotide sequence III are substantially reverse complementary or completely reverse complementary. Nucleotide sequence III is linked to the 5'-end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3'-end of nucleotide sequence II, and nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, where the second nucleotide sequence refers to the nucleotide sequence adjacent to the first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as nucleotide sequence IV.
9. The siRNA according to claim 8, wherein, Nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:
3. Moreover, the lengths of nucleotide sequences III and IV are both 1 nucleotide. The base of nucleotide sequence III is C, and the base of nucleotide sequence IV is G; or the lengths of nucleotide sequences III and IV are both 2 nucleotides. The base composition of nucleotide sequence III is CC, and the base composition of nucleotide sequence IV is GG; or the lengths of nucleotide sequences III and IV are both 3 nucleotides. The base composition of nucleotide sequence III is UCC, and the base composition of nucleotide sequence IV is GGA; or the lengths of nucleotide sequences III and IV are both 4 nucleotides. The base composition of nucleotide sequence III is CUCC, and the base composition of nucleotide sequence IV is GGAG.
10. The siRNA according to claim 9, wherein, The length of the second nucleotide sequence is 1, 2, 3, or 4 nucleotides, and the base compositions are C, CC, UCC, or CUCC, respectively.
11. The siRNA according to claim 8, wherein, Nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:
47. Moreover, the lengths of nucleotide sequences III and IV are both 1 nucleotide. The base of nucleotide sequence III is C, and the base of nucleotide sequence IV is G; or the lengths of nucleotide sequences III and IV are both 2 nucleotides. The base composition of nucleotide sequence III is GC, and the base composition of nucleotide sequence IV is GC; or the lengths of nucleotide sequences III and IV are both 3 nucleotides. The base composition of nucleotide sequence III is UGC, and the base composition of nucleotide sequence IV is GCA; or the lengths of nucleotide sequences III and IV are both 4 nucleotides. The base composition of nucleotide sequence III is UUGC, and the base composition of nucleotide sequence IV is GCAA.
12. The siRNA according to claim 11, wherein, The length of the second nucleotide sequence is 1, 2, 3, or 4 nucleotides, and the base compositions are C, GC, GCA, or GCAA, respectively.
13. The siRNA according to claim 8, wherein, The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 107, and the lengths of the nucleotide sequences III and IV are both 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; or, the lengths of the nucleotide sequences III and IV are both 2 nucleotides, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, the base composition of the nucleotide sequence III is AAG, and the base composition of the nucleotide sequence IV is CUU; or, the lengths of the nucleotide sequences III and IV are both 4 nucleotides, the base composition of the nucleotide sequence III is AAAG, and the base composition of the nucleotide sequence IV is CUUU.
14. The siRNA according to claim 13, wherein, The length of the second nucleotide sequence is 1, 2, 3, or 4 nucleotides, and the base compositions are G, AG, AAG, or AAAG, respectively.
15. The siRNA according to claim 1 or 8, wherein, The siRNA further contains an oligonucleotide sequence V, each nucleotide of the oligonucleotide sequence V is independently one of the non-fluorinated modified nucleotides and is not the stabilized modified nucleotide, the length of the nucleotide sequence V is 1 to 3 nucleotides, and it is connected to the 3'-end of the antisense strand to form a 3'-overhang of the antisense strand.
16. The siRNA according to claim 15, wherein, The length of the nucleotide sequence V is 2 nucleotides, and in the direction from the 5'-end to the 3'-end, the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides, two consecutive uridine ribonucleotides, or is completely reverse complementary to the third nucleotide sequence, and the third nucleotide sequence refers to the nucleotide sequence adjacent to the first nucleotide sequence or the second nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as the nucleotide sequence V.
17. The siRNA according to claim 16, wherein, The first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 1, and the base composition of the third nucleotide sequence is CC; or, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 45, and the base composition of the third nucleotide sequence is GC; or, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 105, and the base composition of the third nucleotide sequence is AG.
18. The siRNA according to claim 1, wherein, The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 6: 5'- CAAUAAAGCUGGACAAGAZ3 -3'(SEQ ID NO: 5); 5'- Z4UCUUGUCCAGCUUUAUUGGG -3'(SEQ ID NO: 6), wherein, Z4 is the first nucleotide at the 5'-end of the antisense strand, Z3 is selected from A, U, G, or C, and Z4 is the nucleotide complementary to Z3; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:7, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:8: 5'- CCCAAUAAAGCUGGACAAGAZ3 -3'(SEQ ID NO:7); 5'- Z4UCUUGUCCAGCUUUAUUGGGAG -3'(SEQ ID NO:8), wherein Z4 is the first nucleotide at the 5'-end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is the nucleotide complementary to Z3; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:49, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:50: 5'- UUAAAAGGGACAGUAUUCZ7 -3'(SEQ ID NO:49); 5'- Z8GAAUACUGUCCCUUUUAAGC -3'(SEQ ID NO:50), wherein Z8 is the first nucleotide at the 5'-end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is the nucleotide complementary to Z7; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:51, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:52: 5'- GCUUAAAAGGGACAGUAUUCZ7 -3'(SEQ ID NO:51); 5'- Z8GAAUACUGUCCCUUUUAAGCAA -3'(SEQ ID NO:52), wherein Z8 is the first nucleotide at the 5'-end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is the nucleotide complementary to Z7; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:49, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:149: 5'- UUAAAAGGGACAGUAUUCZ7 -3'(SEQ ID NO:49); 5'- Z8GAAUACUGUCCCUUUUAAUU -3'(SEQ ID NO:149), wherein Z8 is the first nucleotide at the 5'-end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is the nucleotide complementary to Z7; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:150: 5'- GCUUAAAAGGGACAGUAUUCZ7 -3'(SEQ ID NO:51); 5'- Z8GAAUACUGUCCCUUUUAAGCUU -3'(SEQ ID NO:150), Wherein, Z8 is the first nucleotide at the 5'-end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 110: 5'- GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:109); 5'- Z 12 GCACUGAGAAUACUGUCCCU -3'(SEQ ID NO:110), Wherein, said Z 12 is the first nucleotide at the 5'-end of the antisense strand, and Z 11 is selected from A, U, G or C, and Z 12 is a nucleotide complementary to Z 11 ; Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 111, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 112: 5'- AGGGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:111); 5'-Z 12 GCACUGAGAAUACUGUCCCUUU - 3'(SEQ ID NO:112), Among them, the Z 12 is the first nucleotide at the 5'-end of the antisense strand, and Z 11 is selected from A, U, G or C, and Z 12 is a nucleotide complementary to Z 11 19. The siRNA according to claim 1, wherein The siRNA is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1 and siAPOC3c2-M2, siAPOC3a1-M1 is Sense strand: CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 13) Antisense strand: UmUfC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm (SEQ ID NO: 14) siAPOC3a1-M2 is Sense strand: CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 15) Antisense strand: UmUfCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm (SEQ ID NO: 16) siAPOC3a2-M1 is Sense strand: CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 17) Antisense strand: UmUfC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm (SEQ ID NO: 18) siAPOC3a2-M2 is Sense strand: CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 19) Antisense strand: UmUfCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm (SEQ ID NO: 20) siAPOC3b1-M1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 57) Antisense strand: AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCm (SEQ ID NO: 58) siAPOC3b1-M2 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 59) Antisense strand: AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCm (SEQ ID NO: 60) siAPOC3b2-M1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 61) Antisense strand: AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmAmAm (SEQ ID NO: 62) siAPOC3b2-M2 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 63) Antisense strand: AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmAmAm (SEQ ID NO: 64) siAPOC3b3-M1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 57) Antisense strand: AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmUmUm (SEQ ID NO: 89) siAPOC3b3-M2 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 59) Antisense strand: AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmUmUm (SEQ ID NO: 90) siAPOC3b4-M1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 61) Antisense strand: AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmUmUm (SEQ ID NO: 91) siAPOC3b4-M2 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 63) Antisense strand: AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmUmUm (SEQ ID NO: 92) siAPOC3c1-M1 is Sense strand: GmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 117) Antisense strand: AmGfC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUm (SEQ ID NO: 118) siAPOC3c1-M2 is Sense strand: GmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 119) Antisense strand: AmGfCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUm (SEQ ID NO: 120) siAPOC3c2-M1 is Sense strand: AmGmGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 121) Antisense strand: AmGfC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmUmUm (SEQ ID NO: 122) siAPOC3c2-M2 is Sense strand: AmGmGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 123) Antisense strand: AmGfCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmUmUm (SEQ ID NO: 124).
20. The siRNA according to claim 1, wherein, At least one phosphate group in the phospho-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate group with a modifying group, and the phosphate group with a modifying group is present in at least one of the positions consisting of the following groups: Between the first nucleotide and the second nucleotide at the 5'-end of the sense strand; Between the second nucleotide and the third nucleotide at the 5'-end of the sense strand; Between the first nucleotide and the second nucleotide at the 3'-end of the sense strand; Between the second nucleotide and the third nucleotide at the 3'-end of the sense strand; Between the first nucleotide and the second nucleotide at the 5'-end of the antisense strand; Between the second nucleotide and the third nucleotide at the 5'-end of the antisense strand; Between the first nucleotide and the second nucleotide at the 3'-end of the antisense strand; and Between the second nucleotide and the third nucleotide at the 3'-end of the antisense strand.
21. The siRNA according to claim 20, wherein, The siRNA is one of siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S and siAPOC3c2-M2S, siAPOC3a1-M1S is Sense strand: CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 21) Antisense strand: UmsUfsC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm (SEQ ID NO: 22) siAPOC3a1-M2S is Sense strand: CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 23) Antisense strand: UmsUfsCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm (SEQ ID NO: 24) siAPOC3a2-M1S is Sense strand: CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 25) Antisense strand: UmsUfsC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 26) siAPOC3a2-M2S is Sense strand: CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 27) Antisense strand: UmsUfsCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 28) siAPOC3b1-M1S is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 65) Antisense strand: AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmsGmsCm (SEQ ID NO: 66) siAPOC3b1-M2S is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 67) Antisense strand: AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmsGmsCm (SEQ ID NO: 68) siAPOC3b2-M1S is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 69) Antisense strand: AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsAmsAm (SEQ ID NO: 70) siAPOC3b2-M2S is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 71) Antisense strand: AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsAmsAm (SEQ ID NO: 72) siAPOC3b3-M1S is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 65) Antisense strand: AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmsUmsUm (SEQ ID NO: 93) siAPOC3b3-M2S is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 67) Antisense strand: AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmsUmsUm (SEQ ID NO: 94) siAPOC3b4-M1S is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 69) Antisense strand: AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsUmsUm (SEQ ID NO: 95) siAPOC3b4-M2S is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 71) Antisense strand: AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsUmsUm (SEQ ID NO: 96) siAPOC3c1-M1S is Sense strand: GmsGmsAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 125) Antisense strand: AmsGfsC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmsCmsUm (SEQ ID NO: 126) siAPOC3c1-M2S is Sense strand: GmsGmsAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 127) Antisense strand: AmsGfsCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmsCmsUm (SEQ ID NO: 128) siAPOC3c2-M1S is Sense strand: AmsGmsGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 129) Antisense strand: AmsGfsC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmsUmsUm (SEQ ID NO: 130) siAPOC3c2-M2S is Sense strand: AmsGmsGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 131) Antisense strand: AmsGfsCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmsUmsUm (SEQ ID NO: 132).
22. The siRNA according to claim 1, wherein The 5'-terminal nucleotide of the antisense strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog.
23. The siRNA according to claim 22, wherein, The siRNA is one of siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b2-M2SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1SP1 and siAPOC3c2-M2SP1. siAPOC3a1-M1P1 is Sense strand: CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 29) Antisense strand: P1UmUfC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm (SEQ ID NO: 30) siAPOC3a1-M2P1 is Sense strand: CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 31) Antisense strand: P1UmUfCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm (SEQ ID NO: 32) siAPOC3a2-M1P1 is Sense strand: CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 33) Antisense strand: P1UmUfC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm (SEQ ID NO: 34) siAPOC3a2-M2P1 is Sense strand: CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 35) Antisense strand: P1UmUfCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm (SEQ ID NO: 36) siAPOC3a1-M1SP1 is Sense strand: CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 37) Antisense strand: P1UmsUfsC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm (SEQ ID NO: 38) siAPOC3a1-M2SP1 is Sense strand: CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 39) Antisense strand: P1UmsUfsCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm (SEQ ID NO: 40) siAPOC3a2-M1SP1 is Sense strand: CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 41) Antisense strand: P1UmsUfsC S UmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 42) siAPOC3a2-M2SP1 is Sense strand: CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm (SEQ ID NO: 43) Antisense strand: P1UmsUfsCmUmU S GfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm (SEQ ID NO: 44) siAPOC3b1-M1P1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 73) Antisense strand: P1AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCm (SEQ ID NO: 74) siAPOC3b1-M2P1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 75) Antisense strand: P1AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCm (SEQ ID NO: 76) siAPOC3b2-M1P1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 77) Antisense strand: P1AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmAmAm (SEQ ID NO: 78) siAPOC3b2-M2P1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 79) Antisense strand: P1AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmAmAm (SEQ ID NO: 80) siAPOC3b1-M1SP1 is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 81) Antisense strand: P1AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmsGmsCm (SEQ ID NO: 82) siAPOC3b1-M2SP1 is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 83) Antisense strand: P1AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmsGmsCm (SEQ ID NO: 84) siAPOC3b2-M1SP1 is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 85) Antisense strand: P1AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsAmsAm (SEQ ID NO: 86) siAPOC3b2-M2SP1 is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 87) Antisense strand: P1AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsAmsAm (SEQ ID NO: 88) siAPOC3b3-M1P1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 73) Antisense strand: P1AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmUmUm (SEQ ID NO: 97) siAPOC3b3-M2P1 is Sense strand: UmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 75) Antisense strand: P1AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmUmUm (SEQ ID NO: 98) siAPOC3b4-M1P1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 77) Antisense strand: P1AmGfA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmUmUm (SEQ ID NO: 99) siAPOC3b4-M2P1 is Sense strand: GmCmUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 79) Antisense strand: P1AmGfAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmUmUm (SEQ ID NO: 100) siAPOC3b3-M1SP1 is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 81) Antisense strand: P1AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmsUmsUm (SEQ ID NO: 101) siAPOC3b3-M2SP1 is Sense strand: UmsUmsAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 83) Antisense strand: P1AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmsUmsUm (SEQ ID NO: 102) siAPOC3b4-M1SP1 is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 85) Antisense strand: P1AmsGfsA S AmUmAfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsUmsUm (SEQ ID NO: 103) siAPOC3b4-M2SP1 is Sense strand: GmsCmsUmUmAmAmAmAmGfGfGfAmCmAmGmUmAmUmUmCmUm (SEQ ID NO: 87) Antisense strand: P1AmsGfsAmAmU S AfCmUmGmUmCmCmCmUfUmUfUmAmAmGmCmsUmsUm (SEQ ID NO: 104) siAPOC3c1-M1P1 is Sense strand: GmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 133) Antisense strand: P1AmGfC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUm (SEQ ID NO: 134) siAPOC3c1-M2P1 is Sense strand: GmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 135) Antisense strand: P1AmGfCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUm (SEQ ID NO: 136) siAPOC3c2-M1P1 is Sense strand: AmGmGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 137) Antisense strand: P1AmGfC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmUmUm (SEQ ID NO: 138) siAPOC3c2-M2P1 is Sense strand: AmGmGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 139) Antisense strand: P1AmGfCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmUmUm (SEQ ID NO: 140) siAPOC3c1-M1SP1 is Sense strand: GmsGmsAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 141) Antisense strand: P1AmsGfsC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmsCmsUm (SEQ ID NO: 142) siAPOC3c1-M2SP1 is Sense strand: GmsGmsAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 143) Antisense strand: P1AmsGfsCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmsCmsUm (SEQ ID NO: 144) siAPOC3c2-M1SP1 is Sense strand: AmsGmsGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 145) Antisense strand: P1AmsGfsC S AmCmUfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmsUmsUm (SEQ ID NO: 146) siAPOC3c2-M2SP1 is Sense strand: AmsGmsGmGmAmCmAmGmUfAfUfUmCmUmCmAmGmUmGmCmUm (SEQ ID NO: 147) Antisense strand: P1AmsGfsCmAmC S UfGmAmGmAmAmUmAmCfUmGfUmCmCmCmUmsUmsUm (SEQ ID NO: 148).
24. A pharmaceutical composition comprising the siRNA according to any one of claims 1-23 and a pharmaceutically acceptable carrier.
25. An siRNA conjugate comprising the siRNA according to any one of claims 1-23 and a conjugating group conjugated to the siRNA, the conjugating group comprising a linker and a pharmaceutically acceptable targeting group, and wherein the siRNA, the linker and the targeting group are covalently or non-covalently linked in sequence, and each targeting group is selected from ligands capable of binding to cell surface receptors.
26. Use of the siRNA according to any one of claims 1-23, and / or the pharmaceutical composition according to claim 24 and / or the siRNA conjugate according to claim 25 in the preparation of a medicament for the treatment and / or prevention of a disease or condition associated with the mRNA level of APOC3 gene expression; wherein the disease or condition associated with the mRNA level of APOC3 gene expression is dyslipidemia.
27. A kit comprising the siRNA according to any one of claims 1-23, and / or the pharmaceutical composition according to claim 24 and / or the siRNA conjugate according to claim 25.
Citation Information
Patent Citations
Amine-containing transfection reagents and methods for making and using same
CN103380113A
Conjugates and preparation and use thereof
CN110959011A
Targeting lipids
WO2009082607A2
Oligonucleotide-ligand conjugates and process for their preparation
WO2015006740A2
Nucleic acid, composition and conjugate containing same, preparation method, and use
CN110997917A