Application of Citrus leaf aqueous extract in the preparation of drugs for the prevention or treatment of alcoholic gastric ulcers
By preparing a drug composition of citrus leaf water extract, its anti-inflammatory and antioxidant effects are utilized to solve the problem of large side effects of existing drugs, and to achieve effective prevention and treatment of alcoholic gastric ulcers. It has high resource utilization and is environmentally friendly.
Patent Information
- Application Number
- CN202311729428.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-15
- Publication Date
- 2026-08-04
- Estimated Expiration
- 2043-12-15
AI Technical Summary
Existing medications for treating gastric ulcers have side effects and cannot effectively prevent alcoholic gastric ulcers. Orange leaf resources are not being fully utilized, leading to environmental pollution and resource waste.
A pharmaceutical composition is prepared by using citrus leaf water extract as the active ingredient, through concentration and freeze-drying, and then adding a pharmaceutically acceptable carrier for oral administration to prevent and treat gastric ulcers.
The water extract of citrus leaves reduces cell necrosis and inflammation through anti-inflammatory and antioxidant mechanisms, promotes gastric mucosal repair, significantly reduces the level of pro-inflammatory factors, increases mucus secretion, improves gastric acid secretion, and alleviates alcoholic gastric ulcer damage. It is simple and safe to use.
Smart Images

Figure CN117752721B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of citrus leaf water extract in the preparation of drugs and health products for the prevention of gastric ulcers. Background Technology
[0002] Gastric ulcers are chronic ulcers located between the pylorus and the cardia, and are a type of peptic ulcer. Ulcer formation is related to the digestive action of gastric acid and pepsin, hence the name peptic ulcer. Common influencing factors for gastric ulcers include Helicobacter pylori infection, smoking, alcohol consumption, use of nonsteroidal anti-inflammatory drugs (NSAIDs), and a high-salt diet. Currently, the main medications for treating this disease are antisecretory drugs, including histamine type 2 receptor antagonists such as cimetidine and its analogues, and irreversible proton pump inhibitors such as omeprazole, famotidine, and their analogues. Although these drugs are effective in the long term, they also have some side effects that hinder gastric healing and lead to ulcer recurrence. Therefore, developing safe and effective new drugs for the prevention and treatment of gastric ulcers has significant clinical value. The formation of gastric ulcers is closely related to unhealthy lifestyles, and excessive alcohol consumption is one of the common influencing factors. The hydrophobic hydrocarbon group and hydrophilic hydroxyl group in the chemical structure of ethanol can cause an imbalance in the gastric mucosal barrier and disrupt gastric acid secretion; it can also stimulate the infiltration and release of inflammatory factors and cells; alter cell permeability, making gastric mucosal cells more susceptible to oxidative damage; and it can change the gastric mucosal microcirculation, induce apoptosis, and lead to gastric mucosal erosion, edema, and hemorrhagic necrosis. Literature studies have found that ethanol-induced gastric mucosal damage in experimental animals results in functional and morphological changes similar to those in humans, such as abnormal gastric acid and mucus secretion and hemorrhagic necrosis.
[0003] Orange leaves are from the Rutaceae family plant Citrus reticulata. Citrus reticulata Blanco The dried leaves of citrus fruits and their cultivated varieties. Citrus leaves are abundant and more readily available and inexpensive than other parts of the plantation. With the continuous development of citrus cultivation, the total amount of citrus leaves left after harvesting is constantly increasing. Traditional methods of disposal involve on-site burning or discarding, causing serious environmental pollution and resource waste. Fully utilizing citrus leaf resources would bring certain economic and social benefits. Studies have shown that the dichloromethane extract of the leaves, a varietal waste of Murcott mandarins, can protect against gastric ulcers in mice through anti-anxiety, anti-inflammatory, antioxidant, and anti-apoptotic effects. However, the use of dichloromethane extraction has certain implications for subsequent drug applications in health products or therapeutic drugs. Therefore, based on the Rutaceae plant... Citrus reticulata 'Chachi' Whether the dried leaf extract of (Citrus aurantium) has a protective effect against alcoholic gastric ulcers requires further investigation. Summary of the Invention
[0004] To address the problems existing in the above-mentioned technologies, the application of citrus leaf water extract in the preparation of drugs and health products for the prevention of gastric ulcers is provided.
[0005] The objective of this invention is achieved through the following technical solution: This invention provides the application of citrus leaf aqueous extract in the preparation of drugs for the prevention of gastric ulcers.
[0006] This invention provides the application of citrus leaf aqueous extract in the preparation of drugs for treating gastric ulcers.
[0007] This invention provides the application of citrus leaf aqueous extract in the preparation of health products for the prevention of gastric ulcers.
[0008] This invention provides a method for preparing the aqueous extract of citrus leaves in the aforementioned application. The method is as follows: Weigh 100 g of citrus leaf powder, pass it through a No. 2 sieve, and place it in a decoction pot. Add 20 times the volume of distilled water, soak for 1 h, and extract twice, 1 h each time. Combine the two extracts and concentrate them in a rotary evaporator. Freeze the concentrated aqueous extract of citrus leaves at -80℃ for 24 h, and freeze-dry under reduced pressure in a freeze dryer for 72 h to obtain freeze-dried powder. Dissolve the freeze-dried powder in distilled water to obtain the corresponding concentration, thus obtaining the aqueous extract of citrus leaves.
[0009] The present invention provides a pharmaceutical composition comprising an aqueous extract of orange leaves or an aqueous extract of orange leaves with a pharmaceutically acceptable carrier or excipient.
[0010] The pharmaceutically acceptable carrier is an adhesive, wetting agent, surfactant, adsorbent carrier, or lubricant.
[0011] This invention provides the use of the pharmaceutical composition described herein in the preparation of a drug for preventing gastric ulcers.
[0012] This invention provides the use of the pharmaceutical composition described herein in the preparation of a drug for treating gastric ulcers.
[0013] The drug is administered orally.
[0014] The dosage of citrus leaf water extract is 0.1-50g / day.
[0015] The present invention has the following beneficial effects: (1) Pathological analysis of a mouse alcoholic gastric ulcer model revealed that excessive alcohol consumption can lead to damage to the gastric mucosa of mice, resulting in redness, bleeding, edema, and ulceration. It also promotes the oxidative stress and inflammatory response process of the damaged gastric mucosa. Pre-administration of citrus leaf water extract can enhance the cell structure of gastric tissue, reduce cell necrosis and infiltration of inflammatory cells, increase the secretion of gastric mucus, inhibit the decrease of gastric acid pH, and alleviate gastric edema caused by ethanol damage. PEG2 can control gastric acid secretion and improve gastric mucus content. In this study, we also observed that after ethanol-induced damage in the model group mice, the body autonomously produces excessive PGE2 to counteract the low gastric acid pH and reduced mucus secretion in mice with gastric ulcers caused by ethanol. Compared with the model group, the PGE2 level in the medium and low dose groups of citrus leaf water extract was significantly increased.
[0016] (2) Pro-inflammatory cytokines secreted by macrophages, such as TNF-α and IL-6, can promote the infiltration of neutrophils into the gastric mucosa. The inflammatory process can induce oxidative stress, leading to an increase in lipid peroxidation MDA and a decrease in the levels of antioxidant enzymes SOD and GPx, thus exacerbating gastric mucosal damage in alcoholic gastric ulcers. In this study, the aqueous extract of citrus leaves significantly reduced the levels of pro-inflammatory factors IL-1β, IL-6, TNF-α, and lipid peroxidation products MDA in gastric tissue, while increasing the expression of Mn-SOD, CuZnSOD, and GPx genes. This result suggests that the aqueous extract of citrus leaves may exert a gastric protective effect through anti-inflammatory mechanisms and antioxidant pathways.
[0017] (3) The healing of gastric ulcers is controlled by cytokines and growth factors. The aqueous extract of tangerine leaves can increase the expression of VEGF and EGFR genes in the gastric tissue of mice with alcoholic gastric ulcers. This result suggests that the aqueous extract of tangerine leaves may exert its ulcer repair effect by promoting the synthesis of mucosal growth factor and vascular endothelial growth factor.
[0018] (4) Using water as the extraction solvent, the operation steps are simple and safe, and the obtained orange leaf extract is safe and reliable for preparing drugs and health products for the prevention and treatment of gastric ulcers. The water extract of orange leaves has a significant protective effect against gastric mucosal damage caused by ethanol by improving antioxidant status, inhibiting inflammation, promoting the expression of epidermal growth factor, and increasing the production of gastric protective factor PGE2. It provides a new strategy for the prevention of gastric ulcer disease. Attached Figure Description
[0019] Figure 1 Animal experiment schedule.
[0020] Figure 2The MTT assay was used to determine the proliferative effect of citrus leaf aqueous extract on GES-1 cells. Results are expressed as mean ± standard error (n=5). Compared with the control group, **P<0.01, ***P<0.001.
[0021] Figure 3 Effects of citrus leaf aqueous extract on 10% ethanol-induced GES-1 cell damage (Results are expressed as mean ± standard error (n=5). Compared with the control group, ###P<0.001; compared with the model group, ***P<0.001).
[0022] Figure 4 Effects of Citrus reticulata leaf aqueous extract on basic indicators in mice with alcoholic gastric ulcers. A: Changes in mouse body weight during gavage administration; B: Effects of Citrus reticulata leaf aqueous extract on gastric organ coefficients in mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, ###P<0.001; compared with the model group, *P<0.05, ***P<0.001.
[0023] Figure 5 Effects of citrus leaf aqueous extract pretreatment on the gross morphology (A) and ulcer area (B) of gastric mucosa in mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, ###P<0.001; compared with the model group, ***P<0.001.
[0024] Figure 6 Effect of Citrus aurantium leaf aqueous extract on gastric juice pH in mice with alcoholic gastric ulcers. Results are presented as mean ± standard error (n=6). Compared with the control group, #P<0.05; compared with the model group, *P<0.05, **P<0.01.
[0025] Figure 7 HE staining histopathological evaluation. Results are expressed as mean ± standard error (n=3). A: Histopathological observation of gastric mucosa in mice with alcoholic gastric ulcers; B: HE histopathological score. Compared with the control group, ###P<0.001; compared with the model group, ***P<0.001.
[0026] Figure 8 PAS staining histopathological assessment.
[0027] Figure 9 Effects of Citrus aurantium leaf aqueous extract on serum MDA (A) and gastric tissue Total-SOD (B) in mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, ###P<0.001; compared with the model group, *P<0.05, **P<0.01, ***P<0.001.
[0028] Figure 10 Effects of Citrus aurantium leaf aqueous extract on serum IL-1β, IL-6, TNF-α and PGE2 levels in mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, #P<0.05, ##P<0.01, ###P<0.001; compared with the model group, *P<0.01, ***P<0.001.
[0029] Figure 11 Effects of Citrus reticulata leaf aqueous extract on the mRNA transcription levels of CuZn-SOD, Mn-SOD, and GPx in gastric tissue of mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, #P<0.05, ##P<0.01; compared with the model group, *P<0.05, **P<0.01.
[0030] Figure 12 Effects of Citrus aurantium leaf aqueous extract on the transcriptional levels of VEGF and EGFR mRNA in gastric tissue of mice with alcoholic gastric ulcers. Results are expressed as mean ± standard error (n=6). Compared with the control group, ##P<0.01, ###P<0.001; compared with the model group, *P<0.05, **P<0.01.
[0031] Figure 13 Venn diagram of compound-disease intersection targets.
[0032] Figure 14 "Compound-Key Target-Disease" Network.
[0033] Figure 15 Compound-disease target protein interaction (PPI) network.
[0034] Figure 16 KEGG signaling pathway enrichment results.
[0035] Figure 17 GO function enrichment results.
[0036] Figure 18 Construction of key components-core targets-pathway network.
[0037] Sequence description: SEQ ID No. 1: GAGCCCTTCCACAATGCCAAAGTT SEQ ID No.2: TGTGATGGGTGTGAACCACGAGAA SEQ ID No.3: ACATTGGCTCACTTCCAGAAACAC SEQ ID No.4: GGTTGGAACCGGCATCTTTATC SEQ ID No.5: GCCATCTGGGCCAAAGATACC SEQ ID No.6: GTCTTCGCATGAATAGGCCAAT SEQ ID No.7:GGGTTCCACGTCCATCAGTA SEQ ID No.8: CAGGTCTCCAACATGCCTC SEQ ID No.9: AACTCAGGTCGCTCTTCAGC SEQ ID No.10: CTCCAGCAACTCTCCTTTGG SEQ ID No.11: CTCCAGCAACTCTCCTTTGG SEQ ID No.12:ATTCTTGCCATTCTCCTGGT Detailed Implementation
[0038] The present invention will be described in detail below with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention. Unless otherwise specified, the experimental methods described in the following embodiments are conventional methods; unless otherwise specified, the reagent kit materials can be obtained commercially.
[0039] Example 1: In vitro and in vivo study on the activity of orange leaves against ethanol-induced gastric ulcers in mice.
[0040] 1. Experimental materials
[0041] 1.1 Experimental Apparatus
[0042] 1.2 Experimental Reagents
[0043] 1.3 Experimental Medicinal Materials Rutaceae plants Citrus reticulata 'Chachi' The dried leaves of (Chachigan) are produced in Xinhui District, Jiangmen City, Guangdong Province, and are provided by Jiangmen Xinhui District Xinbaotang Chenpi Co., Ltd.
[0044] 1.4 Laboratory Animals 5-week-old ICR mice (male, weighing 25-30 g), at the SPF level, were purchased from Spf (Suzhou) Biotechnology Co., Ltd., with the animal license number SCXK (Su) 2022-0006. Each mouse had free access to water and food, and the experiment was conducted after one week of adaptive feeding.
[0045] 2. Experimental methods
[0046] 2.1 Preparation of drugs Weigh 100 g of orange leaf powder (passed through No. 2 sieve) and put it into a decocting pot. Add 20 times the volume of distilled water, soak for 1 h, extract twice, each time for 1 h. Combine the two extraction solutions, concentrate them in a rotary evaporator. Freeze the concentrated orange leaf aqueous extract at -80 °C for 24 h, and then place it in a freeze dryer for vacuum freeze drying for 72 h to obtain freeze-dried powder. Dissolve the freeze-dried powder with distilled water to prepare the corresponding concentration, and thus obtain the orange leaf aqueous extract.
[0047] 2.2 Cell experiment design
[0048] 2.2.1 Effect of orange leaf aqueous extract on the proliferation of GES-I cells Take cells in the logarithmic growth phase, adjust the cell density to 5×10 4 cells / mL, inoculate 100 μL per well into a 96-well plate, and culture in a constant temperature incubator at 37 °C and 5% CO2 for 12 h. Then, aspirate the culture medium. Add incomplete culture medium to the blank group and the control group, and add 100 μL of culture medium containing different concentrations of orange leaf aqueous extract (0.1, 0.2, 0.5, 1, 2 mg / mL) to the drug administration group. Culture in a constant temperature incubator at 37 °C and 5% CO2 for 24 h, then aspirate the culture medium, add 100 μL of 10% MTT, and culture in the dark in a constant temperature incubator at 37 °C and 5% CO2 for 4 h. Discard the upper layer of the culture medium, quickly add 150 μL of DMSO to each well, and shake at a low speed (650 rmp) on a shaker for 10 min to fully dissolve the crystals. Detect the OD value with an enzyme-labeled instrument, with the detection wavelength at 570 nm and the reference wavelength at 650 nm. Calculate the proliferation rate according to the formula:
[0049] 2.2.2 Effect of orange leaf aqueous extract on the survival rate of ethanol-induced GES-I cells Take cells in the logarithmic growth phase, adjust the cell density to 1×10 5100 μL of the culture medium was seeded per well in a 96-well plate at a concentration of 1 / mL. After 12 h of incubation, the culture medium was discarded. 100 μL of serum-free culture medium was added to the control and model groups, while serum-free culture medium containing different concentrations of the drug was added to the drug-treated groups (0.5, 1, and 2 mg / mL). After 24 h of incubation, the supernatant was discarded. 100 μL of serum-free culture medium was added to the control group, while 100 μL of culture medium containing 10% ethanol was added to the model and drug-treated groups. After 3 h of incubation, 10% MTT was added and the plates were incubated for 4 h. The supernatant was discarded, and 150 μL of DMSO was added to dissolve the contents. The plates were then shaken for 10 min (37℃, 650 rpm) and detected using a microplate reader (detection wavelength 570 nm, reference wavelength 650 nm).
[0050] 2.3 Animal Experiment Design
[0051] 2.3.1 Grouping of experimental animals and establishment of the model Sixty ICR mice were randomly divided into six groups of ten mice each: (1) control group; (2) model group; (3) positive control group (omeprazole 20 mg / kg); (4) low-dose group (JY-LD, 1 g / kg, within the clinical dose range); (5) medium-dose group (JY-MD, 2 g / kg, within the clinical dose range); and (6) high-dose group (JY-HD, 4 g / kg). Figure 1 The experimental design of the method involved gavage administration, with pre-administration for 15 days, once daily. Mice in the control and model groups were given distilled water. One hour after the last administration, all animals except the control group mice were treated with 10 mL / kg of anhydrous ethanol. All animals were fasted for 24 hours before modeling, but were allowed free access to water.
[0052] 2.3.2. Obtaining experimental animal samples After treatment with anhydrous ethanol for 1 h, blood was collected from the eyeballs and the mice were euthanized. The abdominal cavity of the mice was immediately opened, and the stomach tissue was removed, cut along the greater curvature, immersed in 2 mL of physiological saline, and the stomach contents were rinsed. The tissue was then blotted dry with filter paper, weighed, and laid flat on a plate for photographic processing. The stomach tissue was then divided into two parts: one part was immersed in 4% paraformaldehyde for histological observation, and the other part was stored at -80℃ for later analysis. Blood samples were allowed to stand at room temperature for at least 30 min, centrifuged at 3000 rpm at 4℃ for 10 min, and the supernatant was collected to obtain serum samples, which were stored at -80℃.
[0053] 2.3.3 Determination of the gastric edema index The mice were weighed, and the extracted whole stomach tissue was weighed. The gastric edema index was calculated using the formula:
[0054] 2.3.4 Measurement of gastric juice pH The gastric contents were mixed with physiological saline and centrifuged at 10,000 rpm at 4°C for 10 min. 0.5 mL of the supernatant was taken and diluted 40 times with physiological saline. The pH value of the gastric juice was measured using a pH meter.
[0055] 2.3.5 Analysis of Morphological Changes in Gastric Mucosa of Mice with Gastric Ulcers The macroscopic morphology of the gastric mucosa was observed, including the integrity of the gastric tissue, surface smoothness, color, bleeding, erosion, and other abnormalities. After taking photographs of the gastric tissue, ImageJ software was used to measure the area of each gastric mucosal injury. The results were expressed as a percentage of the gastric ulcer area in the total tissue area according to a formula:
[0056] 2.3.6 Histopathological Analysis of Gastric Injury Gastric tissue was fixed in 4% paraformaldehyde for more than 24 hours, then soaked in paraffin, and stained with HE and PAS respectively. The damage and mucus secretion of gastric mucosa were observed under a microscope. HE staining scoring method reference [6]: (1) bleeding (blue arrow): 0-4 points; (2) mucosal edema (green arrow): 0-4 points; (3) epithelial cell loss (black arrow): 0-3 points; (4) inflammatory cell infiltration (yellow arrow): 0-3 points.
[0057] 2.3.7 Indicator Testing
[0058] 2.3.7.1 ELISA method was used to determine the serum levels of IL-1β, IL-6, TNF-α, and PGE2 in mice. Follow the instructions in the ELISA kit.
[0059] (1) Set up blank wells (blank control wells without sample and enzyme-labeled reagent), standard wells, and sample wells for testing on the enzyme-labeled plate. Accurately add 50 μL of standard to the enzyme-labeled plate. Add 40 μL of sample diluent to the sample wells, and then add 10 μL of the serum sample to be tested (the final sample dilution is 5 times). Add the sample to the wells of the enzyme-labeled plate, trying not to touch the well walls, and gently shake to mix. Then seal the plate with sealing film and incubate at 37°C for 30 min.
[0060] (2) Carefully peel off the sealing film, discard the liquid, shake dry, fill each well with concentrated washing solution diluted 30 times, let stand for 30 seconds and then discard, repeat this 5 times, and pat dry.
[0061] (3) Add 50 μL of enzyme-labeled reagent to each well, except for the blank wells. Then seal the plate with sealing film and incubate at 37°C for 30 min.
[0062] (4) Same as (2).
[0063] (5) Add 50 μL of color developer A to each well first, then add 50 μL of color developer B, gently shake to mix, and develop color at 37°C in the dark for 10 min.
[0064] (6) Add 50 μL of stop solution to each well to stop the reaction (the blue color will immediately turn yellow). Zero the instrument with the blank well and measure the OD value of each well sequentially at a wavelength of 450 nm within 15 min.
[0065] 2.3.7.2 Detection of BCA protein concentration Follow the instructions on the protein concentration assay (BCA) kit. (1) Mix solution A and solution B in the BCA kit at a ratio of 50:1 to obtain the working solution of BCA.
[0066] (2) Add 0, 1, 2, 4, 8, 12, 16 and 20 μL of protein standard solution to the 96-well plate in sequence as standard curve wells. Add 1 μL of total protein solution to be tested to the sample wells and make up the volume of each well to 20 μL with physiological saline.
[0067] (3) Add 200 μL of LBCA working solution to each well, mix well, and incubate the 96-well plate at 37°C for 30 min. Then remove the plate. Use a microplate reader to measure the OD value of each well at 562 nm, and finally calculate the protein concentration of the sample using the standard curve method.
[0068] 2.3.7.3 Detection of MDA in gastric tissue Follow the instructions on the MDA test kit.
[0069] (1) Weigh 15 mg of mouse gastric tissue into a 2 mL thick-bottomed EP tube, add physiological saline at 9 times the tissue weight, and grind at 4℃ (grinding for a total of 4 times, each run time 60 s, interruption time 10 s, preset frequency 60 Hz) to obtain gastric tissue homogenate. After homogenization, centrifuge at 12000 rpm for 10 min and collect the supernatant for subsequent determination.
[0070] (2) Add 0.1 mL of physiological saline to a 0.5 mL EP tube as a blank control, add 0.1 mL of different concentration standards to prepare a standard curve, add 0.1 mL of homogenate supernatant for determination; then add 0.2 mL of MDA detection working solution.
[0071] (3) After mixing, heat at 100°C or in a boiling water bath for 15 min.
[0072] (4) Cool to room temperature in a water bath and centrifuge at 3000 rpm for 10 min at room temperature. Take 200 μL of supernatant and add it to a 96-well plate. Then measure the OD value at 532 nm using an ELISA reader.
[0073] 2.3.7.4 Detection of T-SOD in serum Follow the instructions on the T-SOD detection kit.
[0074] (1) Prepare the reagent one application solution, reagent four application solution and colorimetric reagent in sequence according to the instructions, and set aside for use.
[0075] (2) Dilute the serum sample 2.5 times with physiological saline.
[0076] (3) Add 400 μL of reagent one application solution, 20 μL of diluted serum sample, reagent two, reagent three, and reagent four application solutions to a 1.5 mL EP tube in sequence to make a sample tube; add 400 μL of reagent one application solution, 20 μL of distilled water, reagent two, reagent three, and reagent four application solutions to make a blank tube.
[0077] (4) Mix thoroughly with a vortex mixer and place in a 37°C constant temperature air bath for 40 min.
[0078] (5) Add 800 μL of colorimetric reagent to each tube, and add 200 μL to a 96-well plate. Then measure the absorbance at 550 nm using an ELISA reader.
[0079] 2.3.7.5 RNA Extraction and qPCR Analysis (1) RNA extraction from gastric tissue: Weigh 10 mg of mouse gastric tissue into a 2 mL thick-bottomed EP tube, add 500 μL of Trizol reagent, and grind at 4℃ (grinding for a total of 4 times, each run time 60 s, interruption time 10 s, preset frequency 60 Hz) to obtain gastric tissue homogenate. In a clean bench, add 100 μL of chloroform solution, vortex for 15 s to form an emulsion, stand on ice for 5 min, and centrifuge at 12000 rpm and 4℃ for 15 min. Take the supernatant, add an equal volume of isopropanol, invert and mix well, stand on ice for 10 min, and centrifuge at 12000 rpm and 4℃ for 10 min. Discard the supernatant, add 1 mL of 75% ethanol to wash, invert 6-8 times, stand at room temperature for 5 min, and centrifuge at 12000 rpm and 4℃ for 5 min. Discard the ethanol, wait for the ethanol to evaporate completely, and add an appropriate amount of DEPC water to dissolve.
[0080] (2) RNA concentration determination and reverse transcription: The concentration and purity of RNA samples were determined using a Nano-100 micro spectrophotometer. Each sample was measured three times. Subsequent analysis was only performed when the RNA concentration was not less than 30 ng / μL and the purity was between 1.7 and 2.2 (260 / 280). The HiScript II QRT SuperMix for qPCR kit was operated according to the instructions: 12 μL of RNA sample (concentration of 1 μg / 12 μL, diluted with a certain volume of DEPC water according to the RNA sample concentration) was added to 4 μL of 4×gDNA wiper Mix solution, pipetted and mixed evenly, and incubated at 42℃ for 2 min. Then, 4 μL of 5×HiScript II qPCR SuperMix II solution was added to prepare a 20 μL reverse transcription reaction system. The reverse transcription conditions were 50℃ for 15 min; 85℃ for 5 s. The synthesized cDNA sample was added to 160 μL of DEPC water, mixed well, and stored at -80℃ for later use.
[0081] (3) qPCR reaction: 2.5 nmol of primer was dissolved in 250 μL of DEPC water. qPCR was performed using the ChamQ™ SYBR qPCR Master Mix (Low ROX Premixed) kit. The reaction system was 20 μL: 10 μL of 2×ChamQ SYBR qPCR Master Mix (Low ROX Premixed), 9.2 μL of cDNA sample solution, 0.4 μL of the first primer, and 0.4 μL of the second primer. The reaction program was: pre-denaturation stage, 95°C, 30 s; 40 cycles, 95°C, 10 s → 60°C, 30 s; melting curve stage, 95°C, 15 s → 60°C, 60 s → 95°C, 15 s. The target gene expression levels of each group were corrected according to the GAPDH mRNA expression levels. ΔΔ CT scans were used for data analysis. △ CT = Target gene CT - Internal reference gene CT, and △△ CT = Experimental Group △ CT-control group △ CT, expression value 2^ (-△△ (CT). Primer sequences are shown in Table 1.
[0082] Table 1 qPCR primer sequences
[0083] 2.3.8 Data Statistical Analysis Data were statistically analyzed and plotted using Graphpad Prism 8.0.1 software. Experimental results are expressed as mean ± standard error (SEM). ANOVA analysis was used for comparisons between groups, and P < 0.05 was considered statistically significant.
[0084] 3. Experimental Results and Discussion
[0085] 3.1 Protective effect of citrus leaf aqueous extract against ethanol-induced GES-I cell damage
[0086] 3.1.1 Effects of Citrus leaf aqueous extract on GES-I cell proliferation like Figure 2The image shows the effect of different concentrations of citrus leaf aqueous extract on the proliferation of GES-1 cells. The results showed that, compared with the control group, citrus leaf aqueous extract (0.5 mg / mL, 1 mg / mL, and 2 mg / mL) significantly promoted cell proliferation (P < 0.01 or P < 0.001, compared with the control group), while the 0.1 mg / mL and 0.2 mg / mL groups showed no significant difference compared with the control group. Citrus leaf aqueous extract (0.5 mg / mL, 1 mg / mL, and 2 mg / mL) can be used for subsequent cell experiments.
[0087] 3.1.2 Effect of Citrus leaf aqueous extract on ethanol-induced GES-I cell survival rate Ethanol can cause cell dehydration, degeneration, and necrosis, and ethanol-induced gastric mucosal injury is a commonly used modeling method. The MTT assay was used to detect the effect of ethanol-induced GES-1 cell survival rate of citrus leaf aqueous extract. As shown in Figure 3, compared with the control group, the survival rate of the model group was significantly reduced (P < 0.001). Compared with the model group, citrus leaf aqueous extract (0.5 mg / mL, 1 mg / mL, 2 mg / mL) dose-dependently increased cell survival rate (P < 0.001).
[0088] 3.2 Protective effect of citrus leaf aqueous extract against ethanol-induced gastric ulcers in mice
[0089] 3.2.1 Effects of Citrus leaf aqueous extract on basic indicators in mice with alcoholic gastric ulcers Mouse weight changes as follows Figure 4 As shown in Figure 4-A, the overall body weight of mice in each group showed an increasing trend with the increase in feeding days. The decrease in body weight on days 14-15 was caused by fasting. The effect of citrus leaf aqueous extract on the gastric organ coefficient of mice with gastric ulcers is shown in Figure 4-B. Compared with the control group, ethanol treatment significantly increased the gastric organ coefficient of mice (P < 0.001). Pretreatment with citrus leaf aqueous extract and omeprazole group significantly reversed this phenomenon (P < 0.01 or P < 0.001). The results indicate that citrus leaf aqueous extract can alleviate ethanol-induced gastric ulcer edema in mice.
[0090] 3.2.2 Effects of Citrus leaf aqueous extract on gastric mucosal morphology and ulcer area in mice with alcoholic gastric ulcers As shown in Figure 5-A, the gastric mucosa of the control group mice was intact, light red in color, and showed no bleeding, edema, or ulceration. The gastric mucosa of the model group mice was severely damaged, with a rough and uneven surface, reduced folds, and large ulcers and erosions, showing obvious hemorrhagic lesions. Compared with the model group, the degree of gastric mucosal damage in each treatment group was reduced, hemorrhagic damage was significantly reduced, and only a few bleeding points were occasionally observed. In this experiment, the bleeding areas in the gastric tissue of mice with gastric ulcers were irregular in shape and the bleeding points were small and dense, making it impossible to measure the length of the bleeding area and bleeding points using calipers. Therefore, ImageJ software was used to analyze and statistically analyze the area of gastric ulcers in mice. As shown in Figure 5-B, compared with the control group, the area of gastric ulcers in mice significantly increased after anhydrous ethanol treatment (P < 0.001). Pretreatment with citrus leaf aqueous extract (1 g / kg, 2 g / kg, 4 g / kg) significantly reduced the area of gastric ulcers in mice in a dose-dependent manner, alleviating the degree of gastric damage (P < 0.001).
[0091] 3.2.3 Effect of Citrus leaf aqueous extract on gastric juice pH in mice with alcoholic gastric ulcers Although the mice had been fasted for 24 hours before treatment, their stomach contents were still relatively large, and their gastric juice was scarce and difficult to collect. Therefore, this experiment used a method of rinsing the stomach tissue in a fixed volume of physiological saline to collect gastric juice. As shown in Figure 6, compared with the control group, the pH of the gastric juice in the model group was significantly decreased (P < 0.05), indicating that excessive ethanol intake leads to increased gastric acid secretion. The omeprazole group and the medium-dose orange leaf group (2 g / kg) significantly increased the pH of the gastric juice (P < 0.01 or P < 0.001) and inhibited the increase in gastric acid secretion. The low-dose orange leaf group (1 g / kg) and the high-dose orange leaf group (4 g / kg) also inhibited the decrease in the pH of the gastric juice in mice with gastric ulcers, but there was no statistically significant difference. The results indicate that a certain dose of orange leaf aqueous extract can protect the gastric mucosa by inhibiting gastric acid secretion and reduce gastric mucosal damage caused by alcohol.
[0092] 3.2.4 Histopathological observation Histopathological examination using HE staining further confirmed the morphology of the gastric mucosa. As shown in Figure 7, no damage was observed in the gastric mucosa of the control group mice, while the gastric mucosa of the model group mice showed significant edema, epithelial cell loss accompanied by severe interstitial hemorrhage, and obvious inflammatory cell infiltration in the submucosa, with a significantly higher pathological score (P<0.001). In all drug-treated groups, the gastric gland structure was generally intact, with fewer epithelial cell shedding, a small amount of hemorrhage, and mild edema, but no obvious inflammatory cell infiltration was observed, and the pathological score was significantly lower (P<0.001).
[0093] PAS staining is a typical pathological diagnostic method widely used in diabetes and gastric ulcer diseases. In gastric ulcer diseases, it is often used to detect mucus secretion and assess changes in acidic and basic glycoproteins. As shown in Figure 8, compared with the control group, the mucus layer in the model group was significantly damaged and the amount of mucus was reduced, while the drug treatment group showed some relief from this phenomenon and increased mucus secretion.
[0094] 3.2.5 Effects of Citrus leaf aqueous extract on MDA levels in gastric tissue and serum T-SOD activity in mice with alcoholic gastric ulcers Ethanol stimulation leads to an imbalance in the oxidation and antioxidant levels of the gastric mucosa, resulting in oxidative stress. The reactive oxygen species (ROS) generated by this stress can directly or indirectly damage cell function, causing disruption of the gastric mucosal barrier, impaired gastric mucosal repair, and ultimately, gastric ulcer formation. MDA, as a lipid peroxide, reflects the level of oxygen free radicals in the body; a decrease in MDA content can indicate a reduction in gastric mucosal damage.
[0095] As shown in Figure 9, compared with the control group, the MDA content in the gastric tissue homogenate of the model group was significantly increased (P<0.001), and the T-SOD activity was significantly decreased (P<0.001). The omeprazole group and all other treatment groups significantly reduced MDA levels (P<0.05, P<0.01, or P<0.001), while the omeprazole group slightly increased T-SOD activity, and JY-HD significantly increased TSOD activity (P<0.05). These results indicate that ethanol has a damaging effect on the gastric mucosa of mice, increasing the level of oxidative stress in the gastric tissue. Drug administration can reduce oxidative damage to the gastric mucosa.
[0096] 3.2.6 Effects of Citrus leaf aqueous extract on serum IL-1β, IL-6, TNF-α and PGE2 levels in mice with alcoholic gastric ulcers Inflammation is a crucial component of the pathological process of gastric ulcers. Inflammation and oxidative stress are interdependent; inflammation can induce oxidative stress, and oxidative stress can also trigger inflammation through the activation of multiple pathways. Under pathological inflammatory conditions, activated phagocytes (such as neutrophils and macrophages) produce large amounts of reactive oxygen species (ROS), such as superoxide, hydrogen peroxide, and hydroxyl radicals, further exacerbating oxidative stress. ROS can trigger inflammation and damage by producing pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α. As shown in Figures 10-A to 10-C, compared with the control group, the serum levels of IL-6, IL-1β, and TNF-α in the model group mice were significantly increased (P < 0.05 or P < 0.001). Pretreatment with the drug significantly reduced serum levels of IL-6, IL-1β, and TNF-α (P < 0.05 or P < 0.01), indicating that the aqueous extract of Citrus reticulata leaves has a significant anti-inflammatory effect and provides good protection for the gastric mucosa of mice with gastric ulcers. Endogenous prostaglandins (PGs) play a crucial role in regulating the integrity and various functions of the digestive tract mucosa, with type E prostaglandins being the most effective among these functions. PGE2 is a key defense factor in the gastric mucosa with cytoprotective effects, playing a vital role in regulating gastric acid and mucus secretion. Its production promotes the healing of ethanol-induced gastric mucosal lesions. PGE2 production not only dilates blood vessels and increases mucosal blood flow but also increases mucus and bicarbonate secretion, forming a barrier that protects gastric mucosal epithelial cells from damage, thereby preserving the integrity of the gastric mucosa. As shown in Figure 10-D, compared with the control group, serum PGE2 levels in the model group and each drug-treated group were significantly increased (P < 0.05 or P < 0.01 or P < 0.001); compared with the model group, PGE2 levels were significantly increased in the omeprazole group and the medium and high dose groups of orange leaves. The elevated PGE2 level in the model group indicates that during the development of gastric ulcers, gastric defense factors self-stress and produce excessive PGE2 to counteract the low gastric pH and reduced mucus secretion in mice with ethanol-induced gastric ulcers. After drug pretreatment, the PGE2 protein secretion level further increased.
[0097] 3.2.7 Effects of Citrus leaf aqueous extract on the mRNA transcription level of oxidative stress factors in gastric tissue of mice with alcoholic gastric ulcers Oxidative stress is a significant factor in gastric mucosal damage, and SOD, MDA, and GPx can comprehensively reflect the level of oxidative stress. SOD and GPx belong to the antioxidant enzyme system, effectively inhibiting damage caused by oxidative stress, reducing the accumulation of free radicals in the body, and thus reducing oxidation. SOD and GPx can reflect the scavenging capacity of ROS, protecting cells from peroxide damage and reflecting the antioxidant level of the gastric mucosa. Higher animal cells contain only two types of SOD: CuZn-SOD and MnSOD, the sum of which is total SOD (T-SOD). As shown in Figure 11, compared with the control group, the expression of CuZn-SOD, Mn-SOD, and GPx genes in the gastric tissue of the model group mice was significantly decreased (P < 0.05 or P < 0.01). Compared with the model group, the expression of each gene was significantly increased in the omeprazole group and the JY-HD group (P < 0.05 or P < 0.01). JY-LD significantly increased the expression of Mn-SOD gene (P < 0.05), and increased the expression of CuZn-SOD and GPx genes, but there was no statistical difference. JY-MD significantly increased the expression of CuZn-SOD and Mn-SOD genes (P < 0.05), and increased the expression of GPx gene, but there was no statistical difference.
[0098] 3.2.8 Effects of Citrus leaf aqueous extract on epidermal growth factor mRNA transcription levels in gastric tissue of mice with alcoholic gastric ulcers The healing process of gastric ulcers is complex, involving many steps, including granulation tissue formation, ulcer tissue contraction, angiogenesis, and reepithelialization. All these processes are controlled by various cytokines and growth factors, such as VEGF, EGF, EGFR, and bFGF. VEGF can regulate the proliferation and migration of vascular endothelial cells, promote the formation of microvascular and capillary networks, and accelerate the repair of alcohol-induced acute gastric injury. EGFR is an important gastric mucosal defense factor that plays a crucial role in gastric mucosal repair. EGF is an important bioactive peptide that can inhibit gastric acid and pepsin secretion, improve gastric mucosal blood flow, protect the gastric mucosa from damage, and accelerate ulcer healing. The bioactivity of EGF requires binding to its receptor EGFR to exert its effect. After binding, it can form a dimer, promoting mucosal repair and reducing gastric acid secretion, which is of great significance for the healing of gastric ulcers. As shown in Figure 12, compared with the model group, the high dose of citrus leaf water extract (4 g / kg) significantly increased the expression of VEGF and EGFR genes in the gastric tissue of mice with alcoholic gastric ulcers (P < 0.01 or P < 0.001), while the medium dose of citrus leaf extract (2 g / kg) only increased the expression of VEGF gene (P < 0.05), and there was no significant difference between the omeprazole group and the model group.
[0099] Example 2: Exploring the Mechanism of Action of Orange Leaves on Gastric Ulcers Based on Network Pharmacology
[0100] 1. Experimental materials
[0101] 2. Experimental Methods
[0102] 2.1 Screening of drug targets Information on 17 compounds in orange leaves was obtained by HPLC-Q-TOF-MS / MS analysis. Thirteen of these compounds were identified through literature review and comparison with standards. The SDF(2D) structures or canonical smiles values of the compounds were collected from the PubMed database. Homo sapiens and Probability > 0 were used as screening criteria for targets. The target information of the compounds was predicted using their SDF(2D) structures or canonical smiles values in the SwissTarget Prediction database.
[0103] 2.2 Disease Target Prediction Search for gastric ulcer-related targets in the OMIM and GeneCard databases using "gastric ulcer" as the keyword.
[0104] 2.3 Construction of Compound-Disease Protein Interaction (PPI) Network Compound-disease intersection targets were analyzed in the String database to construct a PPI network. A PPI protein interaction network diagram of relevant targets was obtained using "Homosapiens" and a parameter score > 0.4 as screening criteria. The TSV format data obtained from String was imported into Cytoscape 3.9.1 software for further data visualization. The "Network Analyze" function was used to perform topological analysis on the PPI network, using degree, betweenness centrality, and closeness as parameters to screen core targets.
[0105] 2.4 KEGG Pathway Enrichment and GO Functional Analysis KEGG pathway enrichment and GO function analysis were performed on the intersection targets of citrus leaf compounds and diseases using the Metascape database. The screening criteria were "Homo sapiens," with a minimum overlap of 3 targets, a p-value cutoff of 0.01, and a minimum enrichment of 1.5. The enriched pathways were visualized using the MicroBioinformatics online analysis platform.
[0106] 2.5 Construction of the "Component-Target-Pathway" Network Potential active ingredients, overlapping targets, and highly correlated signaling pathways are imported into Cytoscape V 3.9.1 software to construct an "ingredient-target-pathway" structure, making all data visual and easy to analyze.
[0107] 3. Experimental Results and Discussion
[0108] 3.1 Screening of chemical component targets Information on compounds in orange leaves is shown in Table 2. Following the screening method for drug targets in section 2.1, information on 13 compound targets was obtained, totaling 415 targets. After removing duplicates, 157 targets were identified.
[0109] Table 2. Compound information in orange leaves
[0110] 3.2 Compound-Disease Intersection Targets and Venn Diagram Construction The OMIM database yielded 82 disease targets, while the GeneCard database, after filtering by a "Relevance score" of "≥4.23" (the median of the two calculations), resulted in 1386 targets. Combining the results from both databases and removing duplicates, a total of 1441 disease targets were obtained. The chemical component targets from orange leaves and the disease targets were imported into the Venny online tool to create a Venn diagram, as shown below. Figure 13 Ultimately, 66 common targets were identified, which are the targets of orange leaves in treating gastric ulcers.
[0111] 3.3 Construction of Compound-Target-Disease Network As shown in Figure 14, in the "compound-target-disease" network of tangerine leaves for treating gastric ulcers, there are 7 potential active ingredients for treating gastric ulcers, namely hesperidin, nonotrimonin, tangeretin, 5-Demethylnobiletin, diosmin, neodiosmin, and catasticin, all of which are flavonoid compounds.
[0112] 3.4 Compound-Disease Target Network Analysis and Protein-Protein Interaction (PPI) Network Construction 66 target points were analyzed in the String database to construct a PPI network. Using "Homosapiens" and a parameter score > 0.4 as filtering criteria, and hiding unconnected nodes, the PPI network analysis yielded 66 nodes, 458 edges, and an average node degree of 13.9. The results were imported into Cytoscape 3.9.1 software to plot the network. In the PPI network, larger target points are more important, and thicker, darker lines between nodes indicate tighter connections. Figure 15As shown in Table 3, the core targets with a sensitivity score >20 include epidermal growth factors such as EGFR, inflammatory factors such as TNF and IL2, and genes related to mucosal basement membrane reconstruction such as MMP2 and MMP9. The top three targets are AKT1, TNF, and EGFR. AKT, also known as protein kinase B, is an important member of the PI3K-AKT signaling pathway, widely involved in regulating cell apoptosis, proliferation, migration, differentiation, and metabolism. Studies have shown that AKT activation can recruit and activate immune cells such as neutrophils, eosinophils, and monocytes, which then migrate to the site of inflammation, accelerating the inflammatory response. Abnormal expression of PI3K and AKT genes and proteins promotes apoptosis and drives the progression of gastric ulcers. EGFR is a member of the epidermal growth factor receptor (HER) family and plays a role in promoting cell differentiation, proliferation, migration, increasing gastric mucosal blood flow, and inhibiting gastric acid secretion during gastric mucosal injury repair.
[0113] Table 3 Summary of Orange Leaf Compounds as Core Disease Targets
[0114] 3.5 GO functional analysis and KEGG enrichment analysis of compound disease intersection targets The overlapping targets of orange leaves and diseases were imported into the Metascape database, and KEGG signaling pathway and GO function enrichment annotation analysis was performed. The results are as follows: Figure 16As shown in Figure 17, KEGG enrichment analysis yielded 139 pathways. The top 20 pathways were: cancer pathway, PI3K / Akt signaling pathway, EGFR tyrosine kinase inhibitor resistance, proteoglycans in cancer, chemical carcinogenesis (reactive oxygen species), prostate cancer, breast cancer, human cytomegalovirus infection, hepatocellular carcinoma, melanoma, non-small cell lung cancer, human papillomavirus infection, Kaposi's sarcoma-associated herpesvirus infection, focal adhesion, small cell lung cancer, chemical carcinogenesis (receptor activation), gastric cancer, lipids and atherosclerosis, VEGF signaling pathway, and hepatitis C. Literature review indicated that the PI3K / Akt signaling pathway and VEGF signaling pathway were associated with gastric ulcer disease. GO functional enrichment analysis revealed 1259 biological processes (BP), 45 cellular components (CC), and 98 molecular functions (MF). BP mainly involves protein phosphorylation, positive regulation of phosphorylation, extranuclear estrogen signaling, responses to peptides, and responses to amyloid β; CC mainly involves transferase complexes, transfer of phosphorus-containing groups, receptor complexes, membrane lateral surfaces, extracellular matrix, and membrane rafts; MF mainly involves protein kinase activity, protein tyrosine kinase activity, serine hydrolase activity, protein homodimerization activity, and heme binding.
[0115] 3.6 Construction of the "Key Component-Core Target-Pathway" Network A "component-target-pathway" network diagram of the effects of citrus leaves on gastric ulcers was constructed using Cytoscope V3.9.1 software, as shown in Figure 18. Hesperidin, nobiletin, 5-Demethylnobiletin, diosmin, neodiosmin, and catasticin are associated with gastric ulcers caused by citrus leaves, involving 14 core targets and 20 pathways. The core targets with the highest intensity values are AKT1, TNF, EGFR, HRAS, and SRC, and the main pathways involved include cancer pathways, EGFR tyrosine kinase inhibitor resistance, prostate cancer, breast cancer, the PI3K / Akt signaling pathway, and the VEGF signaling pathway.
Claims
1. The application of citrus leaf aqueous extract in the preparation of drugs for the prevention of alcoholic gastric ulcers, characterized in that, The preparation method of citrus leaf water extract is as follows: Weigh 100 g of citrus leaf powder, pass it through a No. 2 sieve, put it into a decoction pot, add 20 times the volume of distilled water, soak for 1 h, extract twice, 1 h each time, combine the two extracts, concentrate in a rotary evaporator, freeze the concentrated citrus leaf water extract at -80℃ for 24 h, and freeze-dry under reduced pressure in a freeze dryer for 72 h to obtain freeze-dried powder; dissolve the freeze-dried powder in distilled water to obtain the corresponding concentration, thus obtaining citrus leaf water extract; the citrus leaf water extract uses dried leaves of citrus tangerine as raw material and water as extraction solvent.
2. The application of citrus leaf aqueous extract in the preparation of drugs for treating alcoholic gastric ulcers, characterized in that, The preparation method of citrus leaf water extract is as follows: Weigh 100 g of citrus leaf powder, pass it through a No. 2 sieve, put it into a decoction pot, add 20 times the volume of distilled water, soak for 1 h, extract twice, 1 h each time, combine the two extracts, concentrate in a rotary evaporator, freeze the concentrated citrus leaf water extract at -80℃ for 24 h, and freeze-dry under reduced pressure in a freeze dryer for 72 h to obtain freeze-dried powder; dissolve the freeze-dried powder in distilled water to obtain the corresponding concentration, thus obtaining citrus leaf water extract; the citrus leaf water extract uses dried leaves of citrus tangerine as raw material and water as extraction solvent.