Nod2 gene knockout CHO cell strain, preparation method and application thereof
By knocking out the Nod2 gene in CHO cells using the CRISPR/Cas9 system, the problem of trastuzumab aggregation in CHO cells was solved, achieving efficient expression and quality improvement of CHO cell lines, making them suitable for industrial production.
Patent Information
- Application Number
- CN202610429282.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-02
- Publication Date
- 2026-06-26
AI Technical Summary
When using existing CHO cells to produce trastuzumab, the formation of recombinant protein aggregates leads to a decrease in the yield of effective monomers and may induce immunogenicity, affecting drug safety and efficacy. How to maintain or increase the yield while reducing the level of target protein aggregation during CHO cell engineering is a challenge.
The Nod2 gene in CHO cells was knocked out using the CRISPR/Cas9 system. Gene editing was performed using gRNA targeting the Nod2 gene. Cell clones with loss of Nod2 function were screened and identified. A Nod2 gene knockout CHO cell line was constructed. The protein folding environment of organelles such as the endoplasmic reticulum was optimized to reduce protein aggregation levels and increase trastuzumab expression.
At the same cell density, the expression level of trastuzumab in the Nod2 gene knockout CHO cell line increased by 1.22 to 1.55 times, the aggregation level decreased, and the protein production capacity was improved, which improved the quality and safety of the drug and provided a new modification target for CHO cell host engineering, making it suitable for large-scale industrial production.
Smart Images
Figure CN122278776A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of trastuzumab technology, specifically relating to a Nod2 gene knockout CHO cell line, its preparation method, and its application. Background Technology
[0002] Trastuzumab is a key antibody drug for the clinical treatment of HER2-positive breast cancer and gastric cancer. Its global market demand continues to grow, and process improvements that enhance its production efficiency and reduce production costs have significant industrial value.
[0003] Chinese hamster ovary cells, abbreviated as CHO, are the primary host system for the commercial production of recombinant therapeutic antibodies. Current CHO cell engineering strategies primarily focus on directly regulating the cell cycle, apoptosis, or core metabolic pathways, resulting in low efficiency in recombinant protein synthesis due to basal cellular immune stress. Furthermore, the formation of protein aggregates during recombinant protein production not only reduces the effective monomer yield but may also induce immunogenicity, affecting drug safety and efficacy. Therefore, maintaining or increasing yield while reducing target protein aggregation levels in CHO cell engineering remains a long-standing but unresolved technical challenge in this field. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a Nod2 gene knockout CHO cell line, its preparation method, and its application.
[0005] To facilitate understanding of this invention, the materials used in this invention and their abbreviations are listed below: Chinese hamster ovary cells, abbreviated as CHO. Nucleotide-binding oligomerization domain protein 2, abbreviated as Nod2. Viable cell density, abbreviated as VCD. Radioimmunoprecipitation assay lysate, abbreviated as RIPA. Benzyl sulfonyl fluoride, abbreviated as PMSF. Enhanced chemiluminescence reagent, abbreviated as ECL. Clustered regularly spaced short palindromic repeat-associated endonuclease 9, abbreviated as CRISPR / Cas9. Transcription activator-like effector nucleases, abbreviated as TALENs. Zinc finger nucleases, abbreviated as ZFN.
[0006] The first objective of this invention is to provide a Nod2 gene knockout CHO cell line in which the Nod2 gene is lost.
[0007] The CHO cells were able to stably express trastuzumab before the Nod2 gene was knocked out.
[0008] The CHO cell line showed a 1.22-1.55-fold increase in trastuzumab expression at the same cell density.
[0009] Preferably, the loss of function of the Nod2 gene is achieved through gene knockout, gene silencing, or mutation.
[0010] Preferably, the loss of function of the Nod2 gene is achieved through a CRISPR / Cas9 system, TALENs, or ZFN gene knockout technology.
[0011] Preferably, when knocking out the Nod2 gene using the CRISPR / Cas9 system, the gRNA targeting the Nod2 gene used contains the sequences shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; The nucleotide sequence of SEQ ID NO.9 is 5′-CACCgataacaatatctcagatcg-3′; The nucleotide sequence of SEQ ID NO.10 is 5′-AAACcgatctgagatattgttatc-3′; The nucleotide sequence of SEQ ID NO.11 is 5′-CACCGgacggctgtgcctactcca-3′; The nucleotide sequence of SEQ ID NO.12 is 5′-AAACtggagtaggcacagccgtcC-3′.
[0012] A second objective of this invention is to provide a method for preparing a Nod2 gene knockout CHO cell line, comprising the following steps: introducing a gene editing tool targeting the Nod2 gene into CHO host cells expressing trastuzumab to induce a loss-of-function mutation in the gene; and screening and identifying cell clones with loss of Nod2 gene function.
[0013] Preferably, the gene editing tool is a CRISPR / Cas9 system, including a vector expressing Cas9 protein and gRNA targeting the Nod2 gene; preferably, the target sequence of the gRNA is located in the first and second exons of the Nod2 gene.
[0014] Preferably, the screening and identification includes: screening successfully transfected cell pools using puromycin, obtaining monoclonal cell lines through limiting dilution, and screening homozygous knockout clones with frameshift mutations or large fragment deletions at the target site through PCR amplification and sequencing analysis.
[0015] The application of a Nod2 gene knockout CHO cell line in the production of trastuzumab, the method of which includes the following steps: culturing the trastuzumab-producing CHO cell line in serum-free suspension medium. After culturing, collecting the culture supernatant by centrifugation, purifying it, and obtaining trastuzumab.
[0016] Preferably, the culture is a suspension culture, with culture conditions of 36℃~38℃, CO2 concentration of 4%~6%, rotation speed of 100rpm~140rpm, and culture time of 6d~8d.
[0017] Preferably, the culture medium for suspension culture is ExCellOptiVitro®CHO serum-free basal medium CE01.
[0018] Compared with the prior art, the present invention has the following beneficial effects: 1. The Nod2 gene knockout CHO cell line of the present invention loses its Nod2 gene function. The CHO cells stably express trastuzumab before Nod2 gene knockout. At the same cell density, the trastuzumab expression level in the CHO cell line is increased by 1.22 to 1.55 times. This invention is the first to discover a functional correlation between the Ddit4 gene and trastuzumab expression in CHO cell lines; the Ddit4 gene-deficient CHO cell line shows a significant increase in trastuzumab expression and a decrease in aggregation level.
[0019] This invention is the first to discover and demonstrate that knocking out the Nod2 gene in CHO cells expressing trastuzumab can effectively reduce the aggregation level of the target protein and simultaneously increase the expression level of approximately 250 kDa trastuzumab monomer. Figure 8 As shown, compared with the parental cells, the signal intensity of the low molecular weight aggregate band <150kDa in the culture supernatant of the knockout cell line was significantly weakened, while the signal of the band at about 250kDa was enhanced, indicating that the effective protein production capacity per unit cell was improved.
[0020] This invention successfully knocked out the Nod2 gene, which improved the solubility and antibody ratio of trastuzumab. This provides a novel modification target for CHO cell host engineering that focuses on improving product quality, and its technical approach has outstanding inventiveness.
[0021] 2. The method for preparing the Nod2 gene knockout CHO cell line of the present invention includes the following steps: introducing a gene editing tool targeting the Nod2 gene into CHO host cells expressing trastuzumab, causing a loss-of-function mutation in the gene. Screening and identification to obtain cell clones with loss of Nod2 gene function. The method for preparing the Nod2 gene knockout CHO cell line of the present invention modifies CHO cells at the gene level, thus the high-yield trait can be stably inherited, making it suitable for large-scale industrial production. While increasing yield, no significant inhibition of normal cell growth was observed in the cell line, demonstrating a unique advantage in increasing product output. Attached Figure Description
[0022] Figure 1This is an agarose gel electrophoresis image of the backbone vector PX459 in Example 1 of the present invention and PX459 linearized after being digested with BbsI.
[0023] Figure 2 This diagram shows the construction and validation of the Nod2 gene knockout vector in Example 1 of the present invention. In the diagram, A represents the sequencing validation alignment of the gRNA designed for the Nod2 gene exon E1. B represents the sequencing validation alignment of the gRNA designed for the Nod2 gene exon E2. C represents the sequencing validation alignment of the gRNA designed for the Nod2 gene exon E4. D represents the sequencing validation alignment of the gRNA designed for the Nod2 gene exon E5. E represents the agarose gel electrophoresis of the Nod2 gene knockout vector.
[0024] Figure 3 The image shows agarose gel electrophoresis images of cell lines K13N-1, K13N-2, K13N-3, K13N-4, K13N-5, K13N-6, K13N-7, K13N-8 and K13N-9 in Example 2 of the present invention.
[0025] Figure 4 The image shows the sequencing results of cell lines K13N-1, K13N-5, and K13N-7 in Example 2 of this invention. In the image, A represents K13N-1, B represents K13N-5, and C represents K13N-7.
[0026] Figure 5 The image shows the qPCR results of cell lines K13N-1, K13N-5, and K13N-7 in Example 2 of this invention.
[0027] Figure 6 This is a graph showing the protein expression levels of cell lines K13N-1, K13N-5, and K13N-7 in Example 2 of the present invention. In the graph, A represents the results of Western blot analysis, and B represents the quantitative results of the Western blot analysis.
[0028] Figure 7 This image shows the cell viability and cell density of cell lines K13N-1, K13N-5, and K13N-7 in Example 3 of this invention. In the image, A represents cell viability, and B represents cell density.
[0029] Figure 8 This is a whole-membrane Western blotting result of trastuzumab expression and aggregation levels in cell lines K13N-1, K13N-5, and K13N-7 in Example 3 of the present invention. In the figure, A represents the immunoblotting result, and B represents the relative expression level of trastuzumab. Detailed Implementation
[0030] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the following detailed description, in conjunction with preferred embodiments and accompanying drawings, provides a clear and complete account of the technical solutions of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0031] It should be noted that all technical terms used in this invention are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.
[0032] The main materials used in this invention are PX459 backbone carrier, Lipofectamine™ 2000 transfection reagent, PMSF, and RIPA lysis buffer.
[0033] The PX459 backbone vector was purchased from Addgene, catalog number 62988, product name pSpCas9(BB)-2A-Puro (PX459) V2.0. Lipofectamine™ 2000 transfection reagent was purchased from Hefei Baisha Biotechnology Co., Ltd., catalog number BL623B. PMSF was purchased from Beyotime Biotechnology Co., Ltd., product code ST507-10ml. RIPA lysis buffer was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China), product code P0013B, formulation: 50mM, pH 7.4 Tris-HCl, 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS.
[0034] The parental cells used in this invention are a CHO-S-derived cell line that was previously constructed in the laboratory and can stably express trastuzumab, named B-7-13.
[0035] Construction method of B-7-13: An expression vector containing the heavy and light chain genes of trastuzumab and the blast fungicide resistance gene for selection was transformed into CHO-S host cells. After introduction via liposome transfection, the cells were subjected to pressure selection in DMEM / F12 complete medium with a concentration of 15 μg / mL blast fungicide to obtain a cell pool with a stable integrated expression cassette. Subsequently, the cell pool was subjected to monoclonal selection using a limiting dilution method to obtain B-7-13. B-7-13 can stably express trastuzumab in chemically defined suspension medium under normal CHO cell culture conditions. The chemically defined medium refers to a medium in which the chemical structure and concentration of all components are known, and which does not contain animal-derived components or plant hydrolysates. B-7-13 will be used as the host cell or parental cell for subsequent editing of the Ddit4 gene.
[0036] Example 1 A method for constructing a Nod2 gene knockout vector includes the following steps: The gene editing vector constructed in this invention uses CRISPR / Cas9 technology to construct a recombinant plasmid targeting gRNA knockout. The specific steps are as follows: 1. Target primer design Using the genome sequence of Chinese hamsters as the target, the Nod2 genome sequence was searched in the NCBI database. Taking advantage of the multiple exons in the Nod2 gene, sgRNAs were designed for different exon sequences. Based on the common exon sequences of the transcriptome, pairs of sgRNAs were designed for each of the first, second, fourth, and fifth exon sequences in the CDS region: Nod2-E1-gRNA-F and Nod2-E1-gRNA-R, Nod2-E2-gRNA-F and Nod2-E2-gRNA-R, Nod2-E4-gRNA-F and Nod2-E4-gRNA-R, and Nod2-E5-gRNA-F and Nod2-E5-gRNA-R. The selected sgRNA sequences were verified through transfection efficiency and knockout effect: Nod2-E4-gRNA-F, Nod2-E4-gRNA-R, Nod2-E5-gRNA-F, and Nod2-E5-gRNA-R.
[0037] The nucleotide sequence of exon 1 is shown in SEQ ID NO.1. The nucleotide sequence of exon 2 is shown in SEQ ID NO.2. The nucleotide sequence of exon 4 is shown in SEQ ID NO.3. The nucleotide sequence of exon 5 is shown in SEQ ID NO.4. The nucleotide sequence of Nod2-E1-gRNA-F is shown in SEQ ID NO.5. The nucleotide sequence of Nod2-E1-gRNA-R is shown in SEQ ID NO.6. The nucleotide sequence of Nod2-E2-gRNA-F is shown in SEQ ID NO.7. The nucleotide sequence of Nod2-E2-gRNA-R is shown in SEQ ID NO.8. The nucleotide sequence of Nod2-E4-gRNA-F is shown in SEQ ID NO.9. The nucleotide sequence of Nod2-E4-gRNA-R is shown in SEQ ID NO.10. The nucleotide sequence of Nod2-E5-gRNA-F is shown in SEQ ID NO.11. The nucleotide sequence of Nod2-E5-gRNA-R is shown in SEQ ID NO.12.
[0038] The nucleotide sequence of SEQ ID NO.1 is shown below: ATGTGCTCACAGGAAGACTTCCAGGCACAGAGGAGCCAGCTGGTGGCACTGTTGGTCTCGGGGTCCTTGGAGGGCTTTGAGAGCATCTTGGACTGGCTGCTATCCTGGGATGTGCTGTCCTGGGAGGACTATGAGGGCCTTAGCCTCCCTGGCCAACCTCTCTCCCATTCTGCCAGGCGCCTACTGGACACAGTCTGGAACAAGGGTGATTGGGGCTGTCAGAAGCTCCT TGAAGCTGTCCAGGAGGCCCAGGCCAACAGTCATACTCTGGAACTGCATGGCTGCTGGGACACTCACTCCATTCAACCAACCAGAGACCTGCAGAGTCACCGGCCAGCCATTGTCCGGGGACTCTACAACCATGTAGAAGCCATGCTGGAGCTGGCAAGAGCAAGGATTCCTGAGCCAGTATGAATGTGATGAGATCAGGCTGCCAATCTTCACATCATCCCAGAGG.
[0039] The nucleotide sequence of SEQ ID NO.2 is shown below: GCAAGAAGGCTGCTTGACCTTGCCACAGTGAAGGCAAATGGACTGGCTGCCTTCCTTCTACAGCACATCAAAGAACTGCCTTCACCATCCCTGCCTTATGAAG.
[0040] The nucleotide sequence of SEQ ID NO.3 is shown below: TTTGCGAGATAACAATATCTCAGATCGAGGTGTCTGCACACTGATTGAGTATGCTCTCACTGTGAGCAGCTGCAGAAGCTAGC.
[0041] The nucleotide sequence of SEQ ID NO.4 is shown below: TCTCTTCAACAACAAGCTCACAGACGGCTGTGCCTACTCCATGGCCAAGCTCCTTGCACACAGGCAGAACTTCTTGTCACTGAG.
[0042] The nucleotide sequence of SEQ ID NO.5 is shown below: 5′-CACCGcattctgccaggcgcctac-3′.
[0043] The nucleotide sequence of SEQ ID NO.6 is shown below: 5′-AAACgtaggcgcctggcagaatgC-3′.
[0044] The nucleotide sequence of SEQ ID NO.7 is shown below: 5′-CACCgttctttgatgtgctgtaga-3′.
[0045] The nucleotide sequence of SEQ ID NO.8 is shown below: 5′-AAACtctacagcacatcaaagaac-3′.
[0046] The nucleotide sequence of SEQ ID NO.9 is shown below: 5′-CACCgataacaatatctcagatcg-3′.
[0047] The nucleotide sequence of SEQ ID NO.10 is as follows: 5′-AAACcgatctgagatattgttatc-3′.
[0048] The nucleotide sequence of SEQ ID NO.11 is as follows: 5′-CACCGgacggctgtgcctactcca-3′.
[0049] The nucleotide sequence of SEQ ID NO.12 is shown below: 5′-AAACtggagtaggcacagccgtcC-3′.
[0050] 2. Construction of the Nod2 gene knockout vector 2.1 Linearization Vector Construction: The PX459 vector was used as the backbone vector for expressing the Cas9 enzyme. The PX459 vector contains two restriction endonuclease sites (BbsI). The PX459 vector was linearized using BbsI. The linearization digestion system is shown in Table 1. The products were added to PCR tubes according to the following system, thoroughly mixed, and incubated at 37°C for at least 4 hours. The digestion products were then subjected to agarose gel electrophoresis. The results are shown below. Figure 1 As shown, the agarose gel containing the linearized carrier was purified and recovered using a gel recovery kit for later use.
[0051] Table 1 Enzyme digestion system 2.2 Primer phosphorylation: The four pairs of synthesized gRNA primers were phosphorylated. The primer sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12. The phosphorylation reaction system is shown in Table 2. The primers were added to the PCR tubes according to the following system, mixed thoroughly, and then transferred to the PCR instrument to perform the reaction according to the procedure in Table 3.
[0052] Table 2 Primer phosphorylation system Table 3 Annealing Temperature System The final collected reaction solution is phosphorylated double-stranded gRNA, and the product can be stored at -20°C.
[0053] 2.3 Ligation of linearized vector: The four pairs of phosphorylated double-stranded gRNA fragments obtained in 2.2 were ligated with the linearized Cas9 expression vector obtained in 2.1. The reaction system is shown in Table 4. The following components were added to centrifuge tubes in sequence, mixed thoroughly, and transferred to a PCR instrument for overnight incubation at 16°C. The incubation product was transformed into Escherichia coli DH5α cells the next day. LB solid and liquid culture media were prepared in advance, and ampicillin was added at a ratio of 1:1000. Escherichia coli DH5α cells were plated on LA solid culture plates and then placed in a 37°C incubator for 13 hours.
[0054] Table 4 Connection System After 14 hours, the culture was expanded. Using the autoclaved pipette tip, a single colony was carefully selected from the LA solid culture plate and then transferred to a 15 mL centrifuge tube containing 5 mL of LA liquid medium. The tubes were clearly labeled. The centrifuge tubes were placed in a shaker and incubated at 37°C and 220 rpm for 14 hours.
[0055] After 14 hours, the bacterial culture became turbid. The bacterial culture was collected and preserved. The preservation steps were as follows: First, prepare 60% glycerol. Mix the collected bacterial culture with an equal volume of 60% glycerol to form a glycerol culture. Take 1.8 mL of the glycerol culture and transfer it to an autoclaved 2 mL centrifuge tube. Use a portion of the glycerol culture for sequencing, and transfer the remaining portion to other autoclaved 2 mL centrifuge tubes. Store the tubes at -20°C. After sequencing, the correct plasmid is the expression vector containing sgRNA and Cas9. The glycerol bacteria corresponding to the correctly constructed vector were removed from the -20℃ freezer, and 1 mL of glycerol bacterial culture was transferred to a 15 mL centrifuge tube containing 5 mL of LA liquid medium. The culture was incubated at 37℃ with shaking at 220 rpm for 14 h. After the bacterial culture became turbid, the plasmid was extracted according to the plasmid extraction kit instructions, resulting in four successfully constructed Nod2 gene knockout vectors, named pX459-Nod2-E1, pX459-Nod2-E2, pX459-Nod2-E4, and pX459-Nod2-E5, respectively. Figure 2 As shown.
[0056] Example 2 A method for preparing stable CHO cells with Nod2 gene knockout includes the following steps: 1. Construction of Nod2 gene knockout monoclonal cell lines 1.1 Selection of puromycin concentration: pX459-Nod2-E1, pX459-Nod2-E2, pX459-Nod2-E4 and pX459-Nod2-E5 vectors have puromycin resistance and can be used for screening positive clone cell lines in the later stage.
[0057] It is necessary to determine the minimum lethal dose of puromycin for normal cells. Different mammalian cells have different sensitivities and tolerance levels to puromycin. B-7-13 cells stably expressing trastuzumab were then administered at a concentration of 2 × 10⁻⁶. 5 Cells were seeded at a density of 10 cells / mL into 24-well plates. After 24 hours, when the cell confluence reached 80%, puromycin was added at concentrations of 0 μg / mL, 6 μg / mL, 8 μg / mL, 10 μg / mL, 12 μg / mL, 14 μg / mL, and 16 μg / mL. The cells were cultured for 7 days, and the optimal concentration that could induce normal cell death was observed. The optimal concentration was found to be 10 μg / mL.
[0058] After determining the optimal concentration, B-7-13 cells were again incubated at 6 × 10⁻⁶. 5 Cells were seeded at a density of 10 cells / mL into 6-well plates. After 24 hours, when cell confluence reached 80%, pX459-Nod2-E4 and pX459-Nod2-E5 cells were co-transfected at a 1:1 ratio, following the instructions for Lipofectamine 2000 from Biosharp. After 48 hours, the medium was replaced with DMEM / F12 complete medium at a concentration of 10 μg / mL puromycin, with the medium changed every other day. After 5 days, untransfected normal cells died, and the medium was replaced with DMEM / F12 complete medium at a concentration of 5 μg / mL puromycin, with the medium changed every other day. After 14 days of selection, cell pools were obtained, expanded in 6-well plates, and cryopreserved for later use.
[0059] 1.2 Screening and Establishment of Monoclonal Cell Lines To obtain gene knockout cell lines with uniform genetic background, the cell pools that had undergone preliminary screening with puromycin were subjected to monoclonal screening.
[0060] The specific steps are as follows: (1) Cell preparation: The cell pool was digested with trypsin and resuspended in complete culture medium for cell counting.
[0061] (2) Limiting dilution: The cell suspension is serially diluted to the theoretical concentration of 0.5 to 1 cell per 100 μL of culture medium to obtain the cell suspension.
[0062] (3) Seeding and culture: Seed the cell suspension into 96-well cell culture plates, adding 100 μL to each well. In this way, each well contains less than 1 cell on average, to ensure that the vast majority of positive wells are derived from the proliferation of a single cell.
[0063] (4) Single-clone identification and labeling: The 96-well plates were incubated in an incubator at 37°C and 5% CO2. After 5 to 7 days, the wells containing only one independent cell colony were observed and labeled under a microscope.
[0064] (5) Monoclonal expansion culture: When the cell colonies in the labeled wells grow to 30%~50% of the bottom area of the well, they are digested with trypsin and transferred sequentially to 24-well plates, 12-well plates and 6-well plates for gradual expansion culture to obtain monoclonal cell lines.
[0065] (6) Cell Preservation and Nomenclature: The monoclonal cell lines were cryopreserved. Potentially knocked-out Nod2 gene monoclonal cell lines were screened from the Chinese population and numbered and named as follows: K13N-1, K13N-2, K13N-3, K13N-4, K13N-5, K13N-6, K13N-7, K13N-8, and K13N-9. These monoclonal lines will be used for subsequent genotyping.
[0066] 2. Validation of Nod2 gene knockout monoclonal cell lines 2.1 Genome-level sequencing verification: Expanded monoclonal cells K13N-1, K13N-2, K13N-3, K13N-4, K13N-5, K13N-6, K13N-7, K13N-8, and K13N-9 were collected. Genomic DNA was extracted using a genomic DNA extraction kit. PCR primers, Nod2-EF and Nod2-ER, were designed at the knockout site, 300 bp upstream of the fourth exon sequence and downstream of the fifth exon sequence of the Nod2 genome. Their sequences are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively. PCR amplification was performed, and the reaction system is shown in Table 5.
[0067] SEQ ID NO.13 Forward primer: CTGCCATCTGCTTGCTAGGT.
[0068] SEQ ID NO.14 Reverse primer: AGCTTGCCTGATGAGTTCTGA.
[0069] Table 5 Amplification System 10 µL of the amplified product was analyzed by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown in the figure. Based on the agarose gel electrophoresis results, cell lines that may have been knocked out were selected and subjected to PCR again. 2 µL of the amplification product was taken for agarose gel electrophoresis, and the remaining 18 µL of product was sequenced. The sequencing results are shown in the figure. Figure 4 As shown in the figure. The results showed that K13N-1, K13N-5, and K13N-7 caused large-fragment knockouts. Three successfully knocked-out cell lines were obtained, namely K13N-1, K13N-5, and K13N-7, and subsequent experiments were conducted on these three knocked-out cell lines.
[0070] 2.2 mRNA and protein level validation 2.2.1 qPCR verification of mRNA levels in knockout cell lines RNA was extracted from B-7-13 and knockout cell lines, and reverse transcription was performed to obtain cDNA. The specific reaction was carried out in two steps, as shown in Table 6 for the first step and Table 7 for the second step. Table 6. First-step reaction system Table 7. Second step reaction system The reaction was terminated at 50℃ for 15 minutes and then at 85℃ for 5 seconds.
[0071] qPCR primers for the Nod2 gene, Nod2-F and Nod2-R, were designed, with sequences shown in SEQ ID NO.15 and SEQ ID NO.16, respectively. qPCR detection was performed on B-7-13 and K13N-1, K13N-5, and K13N-7 cell lines. The primers were diluted 10-fold and the cDNA was diluted 2-fold. The reaction system is shown in Table 8. The Nod2 expression levels in cell lines K13N-1, K13N-5, and K13N-7 are shown in Table 8. Figure 5 As shown in the figure. The results showed that the mRNA expression level of the Nod2 gene in the knockout cell line was significantly lower than that in B-7-13.
[0072] SEQ ID NO.15 Forward primer: CTTGCAGTTCCTGGGGTTCT.
[0073] SEQ ID NO.16 Reverse primer: AGGCTGAGCCATTTGATGCT.
[0074] Table 8 qPCR reaction system 2.2.2 Western blot validation of protein expression levels in knockout cell lines Total protein was extracted from B-7-13, K13N-1, K13N-5, and K13N-7 cell lines and analyzed by Western blotting. The specific steps are as follows: Cells were lysed using a protein lysis buffer prepared with PMSF and RIPA at a volume ratio of 1:100. Cells were collected and centrifuged. The supernatant was collected, and protein concentration was determined using the BCA method. 40 μg of protein sample was added to each well. Electrophoresis was initiated after loading, initially at 80 V for 30 min, followed by 220 V. After sample dispersion, wet transfer was performed for approximately 35 min. The membrane was blocked with rapid blocking buffer for 15 min. The membrane was washed with TBST for 10 min and incubated with primary antibody overnight at 4°C. After recovering the primary antibody, the membrane was washed three times with TBST for 10 min each time, incubated with secondary antibody at room temperature for 2 h, and then washed three times with TBST for 10 min each time. High-sensitivity ECL chromogenic buffer was used for development. The protein expression levels of K13N-1, K13N-5, and K13N-7 are shown below. Figure 6 As shown in the figure. The results showed that the protein expression level of Nod2 in the K13N-1, K13N-5, and K13N-7 cell lines was significantly lower than that in the B-7-13 cell line, indicating that the Nod2 gene knockout was successful.
[0075] In this embodiment, the gene editing vector with dual gRNA knockout target provided by the present invention was used to co-transfect B-7-13 cells to achieve efficient knockout of the Nod2 gene in CHO cells, thereby constructing an endogenous Nod2 gene-deficient CHO cell line.
[0076] Example 3 The application of Nod2 gene knockout CHO cells in trastuzumab production includes the following steps: 1. Methods for expressing trastuzumab in CHO cells (1) Cell lines: Three monoclonal cell lines K13N-1, K13N-5, and K13N-7, which were confirmed as homozygous knockout of Nod2 by genotype identification and verification of mRNA and protein levels in Example 2, were selected as the experimental group. Unedited parental cells B-7-13 were used as the control group.
[0077] (2) Culture and Inoculation: After thawing and adapting all cell lines from cryopreservation, suspension culture was performed using ExCell OptiVitro® CHO serum-free basal medium CE01 with chemically defined suspension medium. Cells in the logarithmic growth phase and in good condition were centrifuged to remove the original medium, resuspended in fresh suspension medium, and their density adjusted. Each cell line was cultured at the same initial viable cell density of 0.5 × 10⁻⁶ cells / year. 6 Cells / mL were inoculated into multiple parallel shake flasks.
[0078] (3) Culture and monitoring: The shake flasks were placed in a constant temperature shaking incubator at 37°C, 5% CO2, and 120 rpm for 7 days. Samples were taken daily, and the viable cell density and cell viability of each group were measured using an automated cell counter, and growth curves were plotted.
[0079] (4) Product yield detection: At the end of the 7th day of culture, the culture supernatant of all shake flasks was collected and cell debris was removed by centrifugation. The yield of trastuzumab was semi-quantitatively analyzed by Western blotting. The specific steps were as follows: equal volumes of supernatant samples were subjected to SDS-PAGE electrophoresis, and after membrane transfer, incubation and color development were performed using a specific primary antibody against human IgG Fc fragment and the corresponding secondary antibody. The signal was acquired by a chemiluminescence imaging system, and the gray values of the bands in each experimental group and the control group were compared using image analysis software to calculate the relative expression level.
[0080] 2. Expression results of trastuzumab The cell viability and cell density of cell lines K13N-1, K13N-5, and K13N-7 are as follows: Figure 7 As shown in the figure. The results showed that during the 7-day culture period, the cell viability of the three Nod2 knockout cell lines K13N-1, K13N-5, and K13N-7 was not significantly different from that of the parental control group B-7-13, and all remained at a high level of >90%. The cell growth density was comparable to that of the parental control.
[0081] The expression levels of trastuzumab in cell lines K13N-1, K13N-5, and K13N-7 are as follows: Figure 8 As shown in the figure. Quantitative analysis of the gray values of the bands in Western blotting revealed that, at the end of culture day 7, the signal intensity of trastuzumab in the supernatant of the three knockout cell lines was stronger than that in the control group. In the low molecular weight region <150kDa, parental B-7-13 cells showed multiple heterogeneous bands, while the corresponding band signals in the three knockout cell lines were generally weakened or disappeared, indicating a reduction in antibody degradation fragments or misaggregated products.
[0082] Based on the yield of the parental cell line B-7-13, calculations showed that: the yield of cell line K13N-1 was 1.22 times that of the parental cell line; the yield of cell line K13N-5 was 1.52 times that of the parental cell line; and the yield of cell line K13N-7 was 1.49 times that of the parental cell line.
[0083] As demonstrated in the above examples, knocking out the Nod2 gene in CHO cells expressing trastuzumab can effectively increase the production of the target protein while maintaining normal cell activity. Notably, this increased production was not accompanied by a significant increase in cell density, suggesting that Nod2 knockout may not promote cell proliferation, but rather reduce the basal load of the cell's inherent immune signals, thereby decreasing energy and resource consumption and directing more cellular metabolic capacity towards recombinant protein synthesis. This beneficial effect indicates that Nod2 knockout may optimize the protein folding environment of organelles such as the endoplasmic reticulum by reducing the basal immune stress level of cells, thus reducing misfolding and aggregation of the target protein and allowing more synthetic resources to be used to produce correctly folded antibodies. This discovery not only confirms that cell engineering targeting Nod2 is an effective strategy for simultaneously improving the yield and quality of trastuzumab, but also opens up a new avenue for improving the physicochemical properties of recombinant protein drugs by regulating the cell's inherent immune pathways, possessing significant novelty and industrial application value.
[0084] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of this invention have been described, those skilled in the art, once they understand the inventive concept of this invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of this invention.
[0085] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention is also intended to include such modifications and variations.
Claims
1. A Nod2 gene knockout CHO cell line, characterized in that, The CHO cells lost the function of the Nod2 gene; The CHO cells were able to stably express trastuzumab before the Nod2 gene was knocked out. The CHO cell line showed a 1.22-1.55-fold increase in trastuzumab expression at the same cell density.
2. The Nod2 gene knockout CHO cell line according to claim 1, characterized in that, The loss of function of the Nod2 gene is achieved through gene knockout, gene silencing, or mutation.
3. The Nod2 gene knockout CHO cell line according to claim 2, characterized in that, The loss of function of the Nod2 gene is achieved through the CRISPR / Cas9 system, TALENs, or ZFN gene knockout technology.
4. The Nod2 gene knockout CHO cell line according to claim 3, characterized in that, When knocking out the Nod2 gene using the CRISPR / Cas9 system, the gRNA targeting the Nod2 gene used contains the sequences shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; The nucleotide sequence of SEQ ID NO.9 is 5′-CACCgataacaatatctcagatcg-3′; The nucleotide sequence of SEQ ID NO.10 is 5′-AAACcgatctgagatattgttatc-3′; The nucleotide sequence of SEQ ID NO.11 is 5′-CACCGgacggctgtgcctactcca-3′; The nucleotide sequence of SEQ ID NO.12 is 5′-AAACtggagtaggcacagccgtcC-3′.
5. The method for preparing a Nod2 gene knockout CHO cell line according to claim 1, characterized in that, The process includes the following steps: introducing a gene-editing tool targeting the Nod2 gene into CHO host cells expressing trastuzumab to induce a loss-of-function mutation in the gene; and screening and identifying cell clones that have lost the function of the Nod2 gene.
6. The method for preparing a Nod2 gene knockout CHO cell line according to claim 5, characterized in that, The gene editing tool is a CRISPR / Cas9 system, including a vector expressing the Cas9 protein and a gRNA targeting the Nod2 gene; preferably, the target sequence of the gRNA is located in the first and second exons of the Nod2 gene.
7. The method for preparing a Nod2 gene knockout CHO cell line according to claim 6, characterized in that, The screening and identification process includes: screening successfully transfected cell pools using puromycin, obtaining monoclonal cell lines through limiting dilution, and screening homozygous knockout clones with frameshift mutations or large deletions at the target site through PCR amplification and sequencing analysis.
8. The application of the Nod2 gene knockout CHO cell line according to claim 1 in the production of trastuzumab, characterized in that, The method of application includes the following steps: culturing the CHO cell line producing trastuzumab in serum-free suspension medium; after culturing, collecting the culture supernatant by centrifugation, purifying it, and obtaining trastuzumab.
9. The application of the Nod2 gene knockout CHO cell line according to claim 8 in the production of trastuzumab, characterized in that, The culture was a suspension culture, with culture conditions of 36℃~38℃, CO2 concentration of 4%~6%, rotation speed of 100rpm~140rpm, and culture time of 6d~8d.
10. The application of the Nod2 gene knockout CHO cell line according to claim 9 in the production of trastuzumab, characterized in that, The culture medium for suspension culture is ExCellOptiVitro®CHO serum-free basal medium CE01.