A rapid detection method for strawberry potato leafroll virus 1 and its application

Abstract

The invention discloses a rapid detection method for strawberry potato leafroll virus 1 and an application thereof. The detection method uses the P3-P5 fusion protein gene of strawberry potato leafroll virus 1 as a target sequence to design primers, and uses the primers to perform reverse transcription loop-mediated isothermal amplification to identify strawberry potato leafroll virus 1. The rapid detection method for strawberry potato leafroll virus 1 provided by the invention has short detection time, simple operation, strong specificity, high sensitivity, low instrument cost, and intuitive identification result. The invention adopts RT-LAMP amplification technology, can complete amplification detection within 40 minutes, is simple to operate, and after staining with fluorescent dye SYBR Green I, directly observes the identification result with naked eyes. In view of the intuitiveness of the detection method, it can be applied to a strawberry potato leafroll virus 1 detection kit, which is convenient and quick.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a rapid detection method for strawberry potato leafroll virus 1 and application thereof. Background Art

[0002] Strawberry polerovirus 1 (SPV1) belongs to the genus Potato leafroll virus of the family Southern Bean Mosaic Virus. Its genome is a positive single-stranded RNA consisting of 1 RNA with a length of 5986 nt, which is predicted to encode 6 proteins. In 2015, the virus SPV1 was found in strawberries in eastern Canada; in 2016, the virus SPV1 was reported in strawberries in the United States; in 2017, the virus SPV1 was reported in strawberries in Argentina; in 2022, the virus SPV1 was found in strawberries in Nepal. At present, there have been no reports of the virus SPV1 in China. It has been reported that the virus can cause strawberry decline, which will cause economic losses to strawberry production.

[0003] In 2000, Japanese scholar Notomi proposed the loop-mediated isothermal amplification (LAMP) technology, which has the advantages of strong specificity, simple operation and efficient amplification. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) based on LAMP technology is to add reverse transcriptase to the reaction system to achieve one-step amplification of RNA templates. This technology has been widely used in the detection of other viruses. At present, there are no reports on the detection of SPV1 using RT-LAMP technology. The detection method of virus SPV1 is mainly through high-throughput sequencing combined with RT-PCR method. This method is time-consuming and the instrument is expensive, and it is usually not possible to visually judge it with the naked eye. Therefore, it is very necessary to develop a detection method that is simple to operate, short in time, and can be visually judged with the naked eye. Summary of the invention

[0004] The main purpose of the present invention is to propose a rapid detection method for strawberry potato leafroll virus 1 and application thereof, aiming to provide an RT-LAMP detection method for strawberry potato leafroll virus 1 with strong specificity, high sensitivity, simple operation, low instrument cost and intuitive identification results.

[0005] To achieve the above object, the present invention proposes a method for rapid detection of strawberry potato leafroll virus 1. The detection method uses the P3-P5 fusion protein encoding gene of strawberry potato leafroll virus 1 as the target sequence to design primers, and uses the primers to perform reverse transcription loop-mediated isothermal amplification to identify strawberry potato leafroll virus 1.

[0006] Optionally, the primers include SPV1-F3 primer, SPV1-B3 primer, SPV1-FIP primer, SPV1-BIP primer and SPV1-LB primer, and their specific sequences are as follows:

[0007] SPV1-F3: GGTAGATCCGGCGCTATC;

[0008] SPV1-B3:ACAAGCCTGAGAAACAAAT;

[0009] SPV1-FIP:CGAGTACGATGACAACCCGCGGTCGGTGTCACA AATTCC;

[0010] SPV1-BIP: CAGATGCTCGTTTACGGTACGTACCGCTGAAGA AACAAACC;

[0011] SPV1-LB: CAACAGGGATCTGATCGGACTG.

[0012] Optionally, the detection method comprises the following steps:

[0013] S1. Extracting total RNA from biological samples to be tested;

[0014] S2, using the total RNA as a template, performing reverse transcription loop-mediated isothermal amplification using the primers described above to obtain an amplified product;

[0015] S3. Identify whether the biological sample to be tested contains strawberry potato leafroll virus 1 or is infected by strawberry potato leafroll virus 1 according to the amplification product.

[0016] Optionally, in step S3, the identification adopts the method described in 1) or 2) below:

[0017] 1) Add 0.3 μL of fluorescent dye SYBR Green I to the amplified product and observe the color change directly with naked eyes. The sample containing virus SPV1 will be dyed green, and the sample without virus SPV1 will appear orange;

[0018] 2) Conventional agarose gel electrophoresis and UV imaging observations show that samples containing virus SPV1 can form waterfall-shaped bands.

[0019] Optionally, the reaction system used in the reverse transcription loop-mediated isothermal amplification is 2.5 μL 10×Isothermal Amplification Buffer, 8 mmol / L Mg 2+, 1mmol / L dNTPs, 1μmol / L SPV1-FIP and SPV1-BIP, 0.1μmol / L SPV1-F3 and SPV1-B3, 0.1μmol / L SPV1-LB, 0.4mmol / L Betaine, 1μL WarmStart Bst2.0DNA Polymerase, 0.2μL WarmStart RTx Reverse Transcriptase, 1μL template RNA, add ddH2O to make up to 25μL.

[0020] Optionally, the reaction procedures used for the reverse transcription loop-mediated isothermal amplification are 60° C., 30 min; 80° C., 10 min.

[0021] The present invention also proposes the use of the above-mentioned rapid detection method of strawberry potato leafroll virus 1 in preparing a kit for detecting strawberry potato leafroll virus 1.

[0022] The beneficial effects of the present invention are:

[0023] (1) The rapid detection method for strawberry potato leafroll virus 1 provided by the present invention has short detection time, simple operation, strong specificity, high sensitivity, low instrument cost, and intuitive identification results.

[0024] (2) The present invention proposes a rapid detection method for the virus SPV1, which uses RT-LAMP amplification technology and can complete amplification detection within 40 minutes. The operation is simple, and after staining with the fluorescent dye SYBR Green I, the identification result can be directly observed by naked eyes. In view of the intuitiveness of the detection method, it can be applied to the strawberry potato leafroll virus 1 detection kit, which is convenient and fast.

[0025] (3) The present invention optimizes the reaction conditions of conventional RT-LAMP and performs an amplification reaction under the optimized conditions of the present invention, thereby being able to quickly obtain reaction results and saving raw material costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1This is a detection diagram of amplification products at various reaction temperatures of SPV1 RT-LAMP amplification in Example 2 of the present invention (M: DNA Marker TL-2000, NTC is a negative control without adding RNA template);

[0028] Figure 2 This is a detection diagram of SPV1 RT-LAMP amplification at different reaction times in Example 2 of the present invention;

[0029] Figure 3 This is an amplification diagram of the primers SPV1-FIP / BIP at different concentrations in SPV1 RT-LAMP in Example 2 of the present invention;

[0030] Figure 4 This is an amplification diagram of the primer SPV1-F3 / B3 at different concentrations in SPV1 RT-LAMP in Example 2 of the present invention;

[0031] Figure 5 It is the amplification diagram of the primer SPV1-LB at different concentrations in SPV1 RT-LAMP in Example 2 of the present invention;

[0032] Figure 6 Mg in SPV1 RT-LAMP in Example 2 of the present invention 2+ Amplification plots at different final concentrations;

[0033] Figure 7 This is an amplification diagram of SPV1 RT-LAMP at different final concentrations of dNTPs in Example 2 of the present invention;

[0034] Figure 8 This is the amplification diagram of Betaine at different final concentrations in SPV1 RT-LAMP in Example 2 of the present invention;

[0035] Fig. 9 This is a specific detection diagram of the SPV1 RT-LAMP optimization system in Example 3 of the present invention (M: DNAMarkerTL-2000; 1: virus-free RNA sample; 2-6: RNA samples containing viruses SVBV, SMoV, SMYEV, SCrV4 and SPV1);

[0036] Fig.10 This is a sensitivity detection diagram of the RT-PCR and RT-LAMP detection methods for SPV1 in Example 4 of the present invention.

[0037] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0038] To make the purpose, technical scheme and advantages of the embodiment of the present invention clearer, the technical scheme in the embodiment of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiment, it is carried out according to the normal conditions or the conditions recommended by the manufacturer. If the reagents or instruments used do not specify the manufacturer, they are all conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes, taking "A and / or B" as an example, including scheme A, or scheme B, or schemes that A and B meet at the same time. In addition, the technical schemes between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in the field to achieve. When the combination of technical solutions is contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist, and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work belong to the scope of protection of the present invention.

[0039] The technical scheme of the present invention is further described in detail below in conjunction with specific examples and accompanying drawings. It should be understood that the following examples are only used to explain the present invention and are not intended to limit the present invention. The techniques and methods in the following examples are conventional techniques and methods unless otherwise specified. The reagents and instruments are conventional products that can be obtained commercially unless otherwise specified.

[0040] Main reagents: Plant total RNA extraction kit and agarose gel DNA recovery kit were purchased from Guangzhou Meiji Biotechnology Co., Ltd.; cDNA synthesis kit, DNA Marker, and DH5α Escherichia coli competent cells were purchased from Tolo Biotechnology Co., Ltd.; 2×Es Taq MasterMix for PCR amplification was purchased from Kangwei Century Biotechnology Co., Ltd.; 10×Isothermal Amplification Buffer, Bst 2.0WarmStart DNA Polymerase, WarmStart RTxReverse Transcriptase, and MgSO4 were purchased from New England BioLabs (NEB, Beijing); Betaine was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; dNTPs and SYBR Green I dye were purchased from Beijing Solebow Technology Co., Ltd.; TA cloning vector pMD19 and DNA ligation kit were purchased from Bao Bioengineering (Dalian) Co., Ltd.

[0041] Example 1 Obtaining primers for detecting virus SPV1

[0042] The virus SPV1 detected by high-throughput sequencing in the laboratory in the early stage was analyzed for homology with the SPV1 sequence published in GenBank (accession numbers are MZ351172.1, OR295467.1, NC_025435.1, KM233705.1 and MZ328110.1) by DNAMAN. The conserved region was used as a template, and the P3-P5 fusion protein encoding gene of strawberry potato leafroll virus 1 was used as the target sequence to design 5 specific primers for RT-LAMP detection. The primers were synthesized by Wuhan Aoke Biotechnology Co., Ltd. The primer sequences are shown in Table 1.

[0043] Table 1 Primer set for virus SPV1 detection

[0044]

[0045]

[0046] Example 2 Optimization of detection method

[0047] The present invention optimizes various conditions of the RT-LAMP detection method, and the samples used are taken from the Nanhu Strawberry Planting Base in Wuhan. 0.1 g of fresh strawberry leaves are taken, and the total RNA of the sample is extracted using a plant total RNA extraction kit. After reverse transcription, the specific detection primers SPV1F (TCTGGTCGTGAGGCAAATCTTC) and SPV1R (GAGTGACTGCCAAATCTCCTTCC) are used for PCR amplification detection, and the sample containing SPV1 is determined, and the extracted RNA is stored at -80°C for later use.

[0048] The specific method for optimizing the RT-LAMP reaction conditions is as follows:

[0049] (1) Initial reaction system

[0050] The basic detection system is 2.5μL 10×Isothermal Amplification Buffer, 8mM MgSO4, 1.4mmol / L dNTPs, 1.6μmol / L SPV1-FIP and SPV1-BIP, 0.2μmol / L SPV1-F3 and SPV1-B3, 0.4μmol / L SPV1-LB, 0.4mol / L betaine, 1μL Bst 2.0WarmStart DNAPolymerase (8U / μL), 0.2μLWarmStart RTx Reverse Transcriptase (15U / μL), 1μL template RNA, add ddH2O to make up to 25μL, and finally add 20μL sterile mineral oil to the reaction mixture to cover it to prevent aerosol contamination during the reaction and the opening detection process. In addition, 0.3μL SYBR Green I dye is added to the inner wall of the tube cap before the reaction for staining observation after the reaction. The reaction procedure was incubation at 63°C for 60 min and then treatment at 80°C for 10 min.

[0051] (2) Selection of optimal temperature

[0052] Using RNA containing SPV1 as template, the reaction temperature was optimized according to the above reaction system. Six reaction temperatures were set at 60, 61, 62, 63, 64, and 65°C. The reactions were incubated at different temperatures for 60 minutes and then treated at 80°C for 10 minutes. At the same reaction temperature, a negative control was set with ddH2O instead of template RNA.

[0053] After the reaction, the fluorescent dye SYBR Green I was mixed into the reaction solution by centrifugation to observe the color change; at the same time, 0.5 μL of the reaction solution was taken for agarose gel electrophoresis. The results showed that obvious waterfall-shaped bands were formed at 60℃~65℃, and the corresponding reaction products turned green after SYBR Green I staining, with no obvious difference (see Figure 1 ), and 60°C was determined as the constant temperature for amplification.

[0054] (3) Selection of optimal reaction time

[0055] Select 60℃ as the reaction temperature, set 10, 20, 30, 40, 50, 60min for a total of 6 different reaction times, and the other conditions are the same as step (2). The test results show that the product has a waterfall-like band when the reaction time is between 20-60min. When the reaction time is 30min, the electrophoresis band of the product is clear and bright and is obviously green after SYBR Green I staining (see Figure 2 ), and the optimal reaction time was determined to be 30 min.

[0056] (4) Selection of optimal primer concentration

[0057] The reaction concentration of primer SPV1-FIP / BIP was set to 1.0, 1.2, 1.4, 1.6, 1.8 μmol / L, and then the reaction was carried out at 60°C for 30 min and then at 80°C for 10 min. The test results showed that the reaction products at different concentrations could produce waterfall-shaped bands, and they all showed obvious green after SYBR Green I staining, with no significant difference (see Figure 3 ), so the reaction concentration of SPV1-FIP / BIP was selected as 1.0 μmol / L.

[0058] The primer SPV1-F3 / B3 was set at 5 reaction concentrations of 0.1, 0.15, 0.2, 0.25, and 0.3 μmol / L. After the reaction, the detection results showed that the reaction products at different concentrations could produce waterfall-shaped bands, which were obviously green after SYBR Green I staining, with no significant difference (see Figure 4 ), so the reaction concentration of SPV1-F3 / B3 was selected as 0.1 μmol / L.

[0059] Six reaction concentrations of 0, 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L were set for the loop primer SPV1-LB. After the reaction, the test results showed that the reaction products at concentrations of 0.1-0.5 μmol / L could be stained with SYBR Green I in obvious green, and the electrophoresis results showed waterfall-shaped bands (see Figure 5 ), so the reaction concentration of primer SPV1-LB was selected as 0.1 μmol / L.

[0060] (5)Mg 2+ Concentration selection

[0061] Mg 2+ The final concentration of the reaction was set at 2, 4, 6, 8, and 10 mmol / L. After the reaction, the test results showed that at a final concentration of 6-10 mmol / L, the reaction product had a waterfall-shaped band, and it was green after SYBR Green I staining, and when the final concentration was 8 mmol / L, the band was the brightest (see Figure 6 ), therefore, Mg 2+ The final reaction concentration was 8 mmol / L.

[0062] (6) Selection of dNTPs concentration

[0063] The final concentration of dNTPs in the reaction system was set to 0, 0.5, 1.0, 1.4, 2.0 mmol / L. After the reaction, the reaction product was detected and it was shown that when the final concentration of dNTPs was 1.0-2.0 mmol / L, waterfall-shaped bands were visible in electrophoresis, and they appeared green after staining (see Figure 7 ), therefore, the final concentration of dNTPs in the reaction was determined to be 1.0 mmol / L.

[0064] (7) Determination of Betaine Concentration

[0065] The final concentration of Betaine in the reaction system was set to 0.4, 0.8, 1.0, 1.2, and 1.4 mol / L. After the reaction, the test results showed that when the final concentration was 0.4 mol / L, the band of the reaction product was the brightest and was stained green by SYBR GreenI (see Figure 8 ), so the final concentration of Betaine added to the reaction system was determined to be 0.4 mol / L.

[0066] After the above screening tests, the final optimized reaction system was 2.5 μL 10×IsothermalAmplification Buffer, 8 mmol / L Mg 2+ , 1mmol / L dNTPs, 1μmol / L SPV1-FIP and SPV1-BIP, 0.1μmol / L SPV1-F3 and SPV1-B3, 0.1μmol / L SPV1-LB, 0.4mmol / L Betaine, 1μL WarmStart Bst2.0DNA Polymerase, 0.2μL WarmStart RTx Reverse Transcriptase, 1μL template RNA, add ddH2O to make up to 25μL, and react at 60℃ for 30min.

[0067] Example 3 RT-LAMP method specific detection

[0068] RNA samples containing viruses SVBV, SMoV, SMYEV, SCrV4 and SPV1 and RNA from healthy strawberry leaves without these viruses were selected as templates, and the specificity of RT-LAMP was determined according to the optimal system determined in Example 2. After the test results were determined by electrophoresis and staining, the positive amplification products were identified by TA cloning sequencing. The test results showed that only the samples carrying the virus SPV1 showed waterfall-shaped bands, and the product color turned green (see Fig. 9). Since the expected amplification size of primers SPV1-F3 and SPV1-B3 is 250 bp, a band of about 250 bp in size was cut from the gel and sequenced by TA cloning. The result was aligned to virus SPV1 by BLASTn. This shows that the detection system has good specificity.

[0069] Example 4 RT-LAMP method sensitivity detection

[0070] The RNA containing SPV1 was diluted 10-fold in a stepwise manner to obtain RNA stock solution, 10 -1 , 10 -2 , 10 -3 , 10 -4 and 10 -5 The RNA templates with different dilution multiples were used for RT-LAMP and RT-PCR amplification to compare the sensitivity of the two methods. The RT-LAMP amplification system adopts the optimized system in Example 2. RT-PCR includes two steps, wherein the reverse transcription step is: the reverse transcription system is 4μL 5×All-in-one RT buffer, 1μL All-in-one Enzyme Mix, 1μL total RNA, after adding ddH2O to 20μL, react at 25℃ for 5min, 60℃ for 15min, and finally 85℃ for 5s. The synthesized cDNA is stored at -20℃ for standby use. The PCR system is 5μL 2×Es Taq MasterMix, 0.4μmol / L primers SPV1F and SPV1R, 1μL template cDNA, ddH2O is added to 10μL, and finally 20μL mineral oil is added to the reaction mixture to prevent the system from being evaporated during the amplification reaction. The reaction procedure was pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 40 s, 32 cycles; and extension at 72°C for 5 min.

[0071] The results showed that SPV1 virus could be detected in both the original solution and after 10-fold dilution in RT-PCR test (see Fig.10 A), and the RT-LAMP test results showed that when the original solution, 10-fold diluted RNA and 100-fold diluted RNA were used as templates, the electrophoresis detection showed obvious waterfall bands, and the corresponding SYBR Green I also showed obvious green (see Fig.10 B). Therefore, RT-LAMP detection of SPV1 in strawberry leaf samples was 10 times more sensitive than RT-PCR detection.

[0072] In summary, the reverse transcription loop-mediated isothermal amplification detection method based on LAMP technology provided by the present invention is suitable for the detection of strawberry potato leafroll virus 1, and is more sensitive, has a shorter reaction time, and has a stronger specificity than the conventional RT-PCR method, and the identification results can be directly observed with the naked eye.

[0073] The above are only preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the patent protection scope of the present invention.

Claims

1. A rapid detection method for strawberry potato leafroll virus 1, characterized in that: The detection method uses the P3-P5 fusion protein encoding gene of strawberry potato leafroll virus 1 as the target sequence to design primers, and uses the primers to perform reverse transcription loop-mediated isothermal amplification to identify strawberry potato leafroll virus 1; The primers include SPV1-F3 primer, SPV1-B3 primer, SPV1-FIP primer, SPV1-BIP primer and SPV1-LB primer, and their specific sequences are as follows: SPV1-F3: GGTAGATCCGGCGCTATC; SPV1-B3:ACAAGCCTGAGAAACAAAT; SPV1-FIP:CGAGTACGATGACAACCCGCGGTCGGTGTCACAAATTCC; SPV1-BIP: CAGATGCTCGTTTACGGTACGTACCGCTGAAGAAACAAACC; SPV1-LB: CAACAGGGATCTGATCGGACTG; The reaction system used in the reverse transcription loop-mediated isothermal amplification is 2.5 μL 10×IsothermalAmplification Buffer, 8 mmol / L MgSO4, 1 mmol / L dNTPs, 1 μmol / L SPV1-FIP and SPV1-BIP, 0.1 μmol / L SPV1-F3 and SPV1-B3, 0.1 μmol / L SPV1-LB, 0.4 mmol / L Betaine, 1 μLWarmStart Bst 2.0 DNA Polymerase, 0.2 μL WarmStart RTx Reverse Transcriptase, 1 μL template RNA, and ddH2O is added to make up to 25 μL; The reaction program of the reverse transcription loop-mediated isothermal amplification is 60° C. for 30 min and 80° C. for 10 min.

2. The rapid detection method for strawberry potato leaf roll virus 1 according to claim 1, characterized in that: The detection method comprises the following steps: S1. Extracting total RNA from biological samples to be tested; S2, using the total RNA as a template, performing reverse transcription loop-mediated isothermal amplification using the primers as described in claim 1 to obtain an amplified product; S3. Identify whether the biological sample to be tested contains strawberry potato leafroll virus 1 or is infected by strawberry potato leafroll virus 1 according to the amplification product.

3. The rapid detection method for strawberry potato leaf roll virus 1 according to claim 2, characterized in that: In step S3, the identification is performed by the following method 1) or 2): 1) Add 0.3 μL of fluorescent dye SYBR Green I to the amplified product and observe the color change directly with naked eyes. The sample containing virus SPV1 will be dyed green, and the sample without virus SPV1 will appear orange; 2) Conventional agarose gel electrophoresis and UV imaging observations show that samples containing virus SPV1 can form waterfall-like bands.

4. A kit for detecting strawberry potato leafroll virus 1, characterized in that: The kit comprises the primers according to any one of claims 1 to 3.

Images