A gene qAC that regulates amylose content in rice and a method for improving amylose content using the qAC gene.

Abstract

This invention relates to a gene qAC that regulates amylose content in rice and a method for improving amylose content using the qAC gene. The qAC gene includes qAC6.1, qAC6.2, and qAC9.1 genes. The nucleotide sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.1, the nucleotide sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.3, and the nucleotide sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.5. The amino acid sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.2, the amino acid sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.4, and the amino acid sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.6. Through this invention, the rice qAC gene is highly expressed in seeds, specifically improving the amylose content of rice grains without significantly affecting other major agronomic traits of the rice plant. Knocking out the qAC gene in rice using genetic engineering technology can significantly reduce the amylose content of rice and improve the cooking and eating quality of rice. Therefore, the qAC gene has a promising application prospect in the breeding of high-quality rice.

Description

Technical Field

[0001] This invention relates to a gene qAC that regulates the amylose content of rice and a method for improving amylose content using the qAC gene, belonging to the field of plant genetic engineering technology. Background Technology

[0002] Rice is the staple food for more than half of the world's population, and my country is the world's largest producer and consumer of rice. In recent years, with the improvement of people's living standards and the opening of the rice market, rice has been widely traded as a commodity, and people have placed increasingly higher demands on rice quality. Previously, rice breeding in my country had focused primarily on high yield, with relatively slow progress in quality improvement, resulting in a limited number of high-quality rice varieties. Therefore, while ensuring yield, further improving rice quality is the most important goal of rice breeding in my country.

[0003] The ratio of amylose to total starch is called amylose content (AC), and the amylose content largely determines the quality of rice after cooking. Rice with too high an amylose content has relatively poor quality, expands too much, and is hard after cooking; while glutinous rice with an amylose content of less than 2% is too soft and lacks elasticity; soft rice with a low amylose content (8%-12%) has a texture between glutinous and sticky, and tastes good.

[0004] The Wx gene is a key enzyme gene for amylose synthesis, encoding granule-bound starch synthase I (GBSSI). Variations in the Wx gene sequence can alter GBSSI enzyme activity, thereby affecting the amylose content of rice and changing the softness of cooked rice. Besides the Wx gene, genes such as Du13 can directly regulate Wx. b Precursor mRNA splicing of alleles induces changes in amylose content (Cai et al., Plant Biotechnology Journal 2022). Furthermore, to create rice varieties with different amylose contents, the coding region or upstream regulatory region of the Wx gene was precisely edited using CRISPR / Cas9 gene editing technology, resulting in new rice germplasm with varying amylose contents (Zeng et al., Plant Biotechnology Journal 2020; Huang et al., Plant Biotechnology Journal 2020).

[0005] Currently, the creation of rice germplasm with different amylose contents mainly revolves around the Wx gene. Identifying and cloning new amylose content genes will enrich rice gene resources and lay the foundation for creating new high-quality rice germplasm. Previously, research focused on the regulation of rice quality by dominant expression genes in rice seeds, screening a batch of dominant expression genes and studying their effects on rice quality regulation. Among them, qAC6.1, qAC6.2, and qAC9.1 genes (qAC gene is a collective term in this invention) are highly expressed only during the rice grain filling period, indicating that qAC genes may play an important role in seed development. Summary of the Invention

[0006] The purpose of this invention is to address the problems existing in the process of improving the eating quality of rice, and to provide a gene qAC that regulates the amylose content of rice and a method for improving the amylose content using the gene qAC.

[0007] To achieve the above-mentioned objectives, the present invention adopts the following technical solution: a gene qAC for regulating the amylose content of rice, characterized in that the qAC gene includes qAC6.1, qAC6.2, and qAC9.1 genes, wherein the nucleotide sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.1, the nucleotide sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.3, and the nucleotide sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.5.

[0008] The amino acid sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.2, the amino acid sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.4, and the amino acid sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.6.

[0009] Application of qAC gene in regulating amylose content and improving the eating quality of rice.

[0010] The method of application is as follows: the rice amylose content gene qAC is edited to change the expression level of the qAC gene in the target rice variety, thereby obtaining rice plants with different rice amylose contents.

[0011] The recombinant vectors pC1300-qAC6.1-Cas9, pC1300-qAC6.2-Cas9, and pC1300-qAC9.1-Cas9 used in the gene editing process contain the qAC6.1, qAC6.2, and qAC9.1 genes, respectively; the vector system is CRISPR / Cas9, which contains the intermediate vector SK-gRNA and the final vector pC1300-Cas9.

[0012] The method for preparing the recombinant vector pC1300-qAC6.1-Cas9 is as follows: The intermediate vector SK-gRNA is digested with the restriction endonuclease Aar I, and then ligated with the complementary primers of the denatured and annealed target gene using T4 ligase to obtain the intermediate vector SK-gRNA-qAC6.1; the SK-gRNA-qAC6.1 intermediate vector, which has been correctly identified by sequencing, is double-digested with Kpn I and Bgl II to recover the target fragment of 300 bp, and then ligated with the final vector pC1300-Cas9, which has been double-digested with Kpn I and BamHI.

[0013] The specific target site sequence for editing the qAC6.1 gene using the CRISPR / Cas9 system is 5'-CGCTGCTTTCAGCCCGGCAA-3', and the primer sequences are as follows:

[0014] sequence name sequence Serial Number qAC6.1-cas9-F GGCACGCTGCTTTCAGCCCGGCAA SEQ ID NO.7 qAC6.1-cas9-R AAACTTGCCGGGCTGAAAGCAGCG SEQ ID NO.8 .

[0015] The method for preparing the recombinant vector pC1300-qAC6.2-Cas9 is as follows: The intermediate vector SK-gRNA is digested with the restriction endonuclease Aar I, and then ligated with complementary primers of the denatured and annealed target gene using T4 ligase to obtain the intermediate vector SK-gRNA-qAC6.2; the correctly sequenced SK-gRNA-qAC6.2 intermediate vector is double-digested with Kpn I and Bgl II, and the target fragment of 300 bp is recovered and ligated with the final vector pC1300-Cas9, which has been double-digested with Kpn I and BamHI.

[0016] The specific target site sequence for editing the qAC6.2 gene using the CRISPR / Cas9 system is 5'-TGGTGGGGCGGGAGGAGCAG-3', and the primer sequences are as follows:

[0017] qAC6.2-cas9-F GGCATGGTGGGGCGGGAGGAGCAG SEQ ID NO.9 qAC6.2-cas9-R AAACCTGCTCCTCCCGCCCCACCA SEQ ID NO.10 .

[0018] The method for preparing the recombinant vector pC1300-qAC9.1-Cas9 is as follows: The intermediate vector SK-gRNA is digested with the restriction endonuclease Aar I, and then ligated with complementary primers of the denatured and annealed target gene using T4 ligase to obtain the intermediate vector SK-gRNA-qAC9.1; the correctly sequenced SK-gRNA-qAC9.1 intermediate vector is double-digested with Kpn I and Bgl II, and the target fragment of 300 bp is recovered and ligated with the final vector pC1300-Cas9, which has been double-digested with Kpn I and BamHI.

[0019] The specific target site sequence for editing the qAC9.1 gene using the CRISPR / Cas9 system is 5'-GGTCTCGTGCTCCTCGTGGG-3'; the primer sequences are as follows:

[0020] qAC9.1-cas9-F GGCAGGTCTCGTGCTCCTCGTGGG SEQ ID NO.11 qAC9.1-cas9-R AAACCCCACGAGGAGCACGAGACC SEQ ID NO.12 .

[0021] The present invention provides an advanced and scientific method. In its first aspect, the present invention provides a rice qAC gene, wherein the qAC6.1 gene is located on chromosome 6 of rice, with gene number Os06g0141400 (RAP-DB naming convention) or LOC_Os06g04930 (MSU naming convention). The full-length nucleotide sequence of the coding region of the qAC6.1 gene is 426 bp, as shown in SEQ ID NO.1. The full-length amino acid sequence encoded by the qAC6.1 gene contains 141 amino acids, as shown in SEQ ID NO.2.

[0022] The qAC6.2 gene is located on chromosome 6 of rice, with gene number Os06g0528300 (RAP-DB naming convention) or LOC_Os06g33690 (MSU naming convention). The full-length nucleotide sequence of the coding region of the qAC6.2 gene is 621 bp, as shown in SEQ ID NO.3. The full-length amino acid sequence encoded by the qAC6.2 gene contains 206 amino acids, as shown in SEQ ID NO.4.

[0023] The qAC9.1 gene is located on chromosome 9 of rice, with gene number Os09g0427800 (RAP-DB naming convention) or LOC_Os09g25890 (MSU naming convention). The full-length nucleotide sequence of the coding region of the qAC9.1 gene is 2661 bp, as shown in SEQ ID NO.5. The full-length amino acid sequence encoded by the qAC9.1 gene contains 886 amino acids, as shown in SEQ ID NO.6.

[0024] Secondly, this invention provides an application of the rice qAC gene in altering amylose content.

[0025] The method of application is as follows: the rice gene qAC is edited to change the expression level of the qAC gene in the target rice variety, thereby obtaining rice plants with different amylose contents.

[0026] The recombinant vectors pC1300-qAC6.1-Cas9, pC1300-qAC6.2-Cas9, and pC1300-qAC9.1-Cas9 used in the gene editing process contain the qAC6.1, qAC6.2, and qAC9.1 genes, respectively. The vector system is CRISPR / Cas9, which includes the intermediate vector SK-gRNA and the final vector pC1300-Cas9.

[0027] The method for preparing the recombinant vector pC1300-qAC-Cas9 is as follows: The intermediate vector SK-gRNA is digested with the restriction endonuclease Aar I, and then ligated with the complementary primers of the denatured and annealed target gene using T4 ligase to obtain the intermediate vector SK-gRNA-qAC; the correctly sequenced SK-gRNA-qAC intermediate vector is double-digested with Kpn I and Bgl II to recover the target fragment of 300 bp, and ligated with the final vector pC1300-Cas9, which has been double-digested with Kpn I and BamHI.

[0028] Preferably, the specific target sequence for editing the qAC6.1 gene using the CRISPR / Cas9 system is 5'-CGCTGCTTTCAGCCCGGCAA-3', the specific target sequence for editing the qAC6.2 gene using the CRISPR / Cas9 system is 5'-TGGTGGGGCGGGAGGAGCAG-3', and the specific target sequence for editing the qAC9.1 gene using the CRISPR / Cas9 system is 5'-GGTCTCGTGCTCCTCGTGGG-3'. The primer sequences are as follows:

[0029] sequence name sequence Serial Number qAC6.1-cas9-F GGCACGCTGCTTTCAGCCCGGCAA SEQ ID NO.7 qAC6.1-cas9-R AAACTTGCCGGGCTGAAAGCAGCG SEQ ID NO.8 qAC6.2-cas9-F GGCATGGTGGGGCGGGAGGAGCAG SEQ ID NO.9 qAC6.2-cas9-R AAACCTGCTCCTCCCGCCCCACCA SEQ ID NO.10 qAC9.1-cas9-F GGCAGGTCTCGTGCTCCTCGTGGG SEQ ID NO.11 qAC9.1-cas9-R AAACCCCACGAGGAGCACGAGACC SEQ ID NO.12

[0030] The present invention has the following effects:

[0031] This invention discloses a rice qAC gene and a method for improving amylose content using it. The rice qAC gene is highly expressed in seeds and can specifically improve the amylose content of rice grains without significantly affecting other major agronomic traits of the rice plant. Knocking out the qAC gene in rice using genetic engineering technology can significantly reduce the amylose content of rice and improve its cooking and eating quality. Therefore, the qAC gene has great application potential in high-quality rice breeding. Attached Figure Description

[0032] Figure 1 This refers to the spatiotemporal expression characteristics of the qAC6.1 gene in rice retrieved from a public database in Example 1.

[0033] Figure 2 This refers to the spatiotemporal expression characteristics of the qAC6.2 gene in rice retrieved from a public database in Example 1.

[0034] Figure 3 This refers to the spatiotemporal expression characteristics of the qAC9.1 gene in rice retrieved from a public database in Example 1.

[0035] Figure 4 This is the transcriptome sequencing experiment in Example 1 that verifies the expression pattern of the qAC6.1 gene in rice.

[0036] Figure 5 This is the transcriptome sequencing experiment in Example 1 that verifies the expression pattern of the qAC6.2 gene in rice.

[0037] Figure 6 This is the transcriptome sequencing experiment in Example 1 that verifies the expression pattern of the qAC9.1 gene in rice.

[0038] Figure 7 This is a schematic diagram of the qAC gene editing target sites and mutation types in Example 2.

[0039] Figure 8 This is an agronomic trait analysis of the qAC gene knockout line in Example 3.

[0040] Figure 9 This is a physicochemical quality analysis of the qAC gene knockout line in Example 3. Detailed Implementation

[0041] The following embodiments are provided to illustrate the present invention, but do not limit the scope of the invention.

[0042] Unless otherwise specified, the experimental methods in the following examples were performed according to conventional procedures, and the materials and reagents used were all commercially available conventional biochemical reagents.

[0043] Example 1: Spatiotemporal expression pattern analysis of qAC gene in rice;

[0044] This research team focused on the regulation of rice quality by dominant expression genes in rice seeds, and screened a batch of dominant expression genes for studying their regulatory effects on rice quality. Among them, the qAC gene was highly expressed during the rice grain filling stage (see attached image). Figure 1-3 This indicates that the gene may play an important role in seed development. The protein encoded by the qAC6.1 (LOC_Os06g04930) gene contains 141 amino acids (SEQ ID NO.2), while the corresponding gene contains 426 nucleotides (SEQ ID NO.1); the protein encoded by the qAC6.2 (LOC_Os06g33690) gene contains 206 amino acids (SEQ ID NO.4), while the corresponding gene contains 621 nucleotides (SEQ ID NO.3); and the protein encoded by the qAC9.1 (LOC_Os09g25890) gene contains 886 amino acids (SEQ ID NO.6), while the corresponding gene contains 2661 nucleotides (SEQ ID NO.5). The nucleotide and amino acid sequences of the above genes are all derived from the reference genome of the rice variety Nipponbare (rice.plantbiology.msu.edu).

[0045] To verify the seed-specific expression characteristics of the qAC gene, using the Japonica rice variety Zhonghua 11 as material, transcriptome sequencing was employed to analyze the expression abundance of the qAC gene in rice plant leaves, glumes, young inflorescences, and seeds at different post-flowering stages. Samples were ground and cells were disrupted in liquid nitrogen for total RNA extraction. mRNA was purified using an mRNA purification kit, and the expression level of the qAC gene in different tissues was then detected following standard reference transcriptome sequencing procedures. The results are attached. Figure 4-6 As shown, the qAC gene is highly expressed during the grain-filling stage of rice, indicating that it is a dominant gene in seed development and may play an important role in seed development.

[0046] Example 2: Construction and genetic transformation of qAC gene knockout vector in rice;

[0047] Based on existing CRISPR / Cas9-related experimental methods, this study selected sequences containing NGG as PAM sites on the exons of the qAC gene as knockout target sites. Specifically, the specific target site sequence for the qAC6.1 gene is 5'-CGCTGCTTTCAGCCCGGCAA-3', for the qAC6.2 gene it is 5'-TGGTGGGGCGGGAGGAGCAG-3', and for the qAC9.1 gene it is 5'-GGTCTCGTGCTCCTCGTGGG-3'. Primers for gene editing vector construction were then designed using the online tool targetDesign. The CRISPR / Cas9 gene editing vector construction primer sequences are as follows:

[0048] sequence name sequence Serial Number qAC6.1-cas9-F GGCACGCTGCTTTCAGCCCGGCAA SEQ ID NO.7 qAC6.1-cas9-R AAACTTGCCGGGCTGAAAGCAGCG SEQ ID NO.8 qAC6.2-cas9-F GGCATGGTGGGGCGGGAGGAGCAG SEQ ID NO.9 qAC6.2-cas9-R AAACCTGCTCCTCCCGCCCCACCA SEQ ID NO.10 qAC9.1-cas9-F GGCAGGTCTCGTGCTCCTCGTGGG SEQ ID NO.11 qAC9.1-cas9-R AAACCCCACGAGGAGCACGAGACC SEQ ID NO.12

[0049] The CRISPR / Cas9 vector system used in this study was provided by Researcher Wang Kejian of the China National Rice Research Institute. The system contains the intermediate vector SK-gRNA and the final expression vector pC1300-Cas9, whose DNA backbones are derived from the pBlueScript(SK+) vector and the pCAMBLA1300 vector, respectively.

[0050] The specific process is as follows: The intermediate vector SK-gRNA was digested with the restriction endonuclease Aar I, and then ligated with complementary primers of the denatured and annealed target gene using T4 ligase to obtain the intermediate vector SK-gRNA-qAC. The correctly sequenced SK-gRNA-qAC intermediate vector was double-digested with Kpn I and Bgl II, and then ligated with the final vector pC1300-Cas9, which had been double-digested with Kpn I and BamHI, to obtain the recombinant vector pC1300-Cas9-qAC. The pC1300-Cas9-qAC recombinant vector was transformed into Agrobacterium strain EHA105 using a heat shock method. Positive Agrobacterium strains containing the pC1300-Cas9-qAC vector were obtained through kanamycin selection.

[0051] Using the above-mentioned positive pC1300-Cas9-qAC Agrobacterium strain, callus cells of the rice parent Zhonghua 11 were transformed using the Agrobacterium-mediated transformation method. The rice callus was screened for hygromycin resistance to obtain resistant callus. The resistant callus was transferred to differentiation medium, and positive transgenic seedlings were obtained after differentiation culture. Finally, after detection and identification, the seedlings were transplanted to the field to obtain T0 generation rice plants.

[0052] Example 3: Phenotypic analysis of qAC gene knockout lines;

[0053] 1. Detection of genetically modified plants;

[0054] Thirty transgenic seedlings of the qAC6.1, qAC6.2, and qAC9.1 genes were obtained using Agrobacterium-mediated genetic transformation. First, PCR detection using universal primers for hygromycin resistance genes yielded positive seedlings containing hygromycin resistance. Then, a pair of PCR sequencing primers (SEQ ID NO. 13 to 18) were designed upstream and downstream of the knockout target site sequence to detect sequence variations near the target site. After PCR amplification and sequencing analysis based on the target site sequence, the mutation types of the qAC6.1, qAC6.2, and qAC9.1 genes were obtained (see appendix). Figure 7 The sequencing primer sequences are as follows:

[0055] sequence name sequence Serial Number qAC6.1-cx-F TGGCAAACTGCAAGGGATCA SEQ ID NO.13 qAC6.1-cx-R CTTCTCCTGCTGCCTAGCTT SEQ ID NO.14 qAC6.2-cx-F TTGCTACTAGGCTCATGGCG SEQ ID NO.15 qAC6.2-cx-R ATCACGAAGCAGATTGCCGA SEQ ID NO.16 qAC9.1-cx-F TAACTTGAAGGGCTATTG SEQ ID NO.17 qAC9.1-cx-R GATCCGCCGGGGGGATTG SEQ ID NO.18

[0056] 2. Agronomic traits and physicochemical quality analysis of qAC gene knockout lines;

[0057] To clarify the role and other biological functions of the qAC gene in seed development, key seed traits and field agronomic traits of qAC gene knockout lines were investigated. In T0 and T1 generations, compared with the wild-type parent Zhonghua 11, the plant height, main spike length, and seed setting rate of the qAC gene knockout lines remained unchanged, and grain shape traits such as grain length, grain width, and grain weight also showed no significant changes (see attached). Figure 8 This indicates that the qAC gene has no effect on yield traits in rice. Further analysis of the qAC gene's impact on rice quality traits showed that, compared to the wild-type parent Zhonghua 11, the qAC gene knockout lines exhibited no change in protein content, but a significant decrease in amylose content. (See attached image) Figure 9 This indicates that the qAC gene specifically regulates the amylose content in rice, which is consistent with its seed-specific expression characteristics.

[0058] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention. Those skilled in the art can make possible changes and modifications to the present invention based on the above-disclosed technical content without departing from the scope of the technical solution of the present invention, or modify it into equivalent embodiments with equivalent changes. Any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. Application of knocking out rice qAC genes in reducing rice amylose content, wherein the qAC genes include qAC6.1, qAC6.2, and qAC9.1 genes, wherein the nucleotide sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.1, the nucleotide sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.3, and the nucleotide sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, The amino acid sequence encoded by the qAC6.1 gene is shown in SEQ ID NO.2, the amino acid sequence encoded by the qAC6.2 gene is shown in SEQ ID NO.4, and the amino acid sequence encoded by the qAC9.1 gene is shown in SEQ ID NO.

6.

3. The application according to claim 1, characterized in that, Gene knockout was performed using CRISPR / Cas9. The specific target sequence for knocking out the qAC6.1 gene using the CRISPR / Cas9 system is 5'-CGCTGCTTTCAGCCCGGCAA-3'; the specific target sequence for knocking out the qAC6.2 gene is 5'-TGGTGGGGCGGGAGGAGCAG-3'; and the specific target sequence for knocking out the qAC9.1 gene is 5'-GGTCTCGTGCTCCTCGTGGG-3'.

4. A method for preparing rice with reduced amylose content, characterized in that, The qAC gene in rice was knocked out. The qAC gene includes qAC6.1, qAC6.2, and qAC9.1 genes. The nucleotide sequence of the coding region of the qAC6.1 gene is shown in SEQ ID NO.1, the nucleotide sequence of the coding region of the qAC6.2 gene is shown in SEQ ID NO.3, and the nucleotide sequence of the coding region of the qAC9.1 gene is shown in SEQ ID NO.

5.

5. The preparation method according to claim 4, characterized in that, Gene knockout was performed using CRISPR / Cas9. The specific target sequence for knocking out the qAC6.1 gene using the CRISPR / Cas9 system is 5'-CGCTGCTTTCAGCCCGGCAA-3'; the specific target sequence for knocking out the qAC6.2 gene is 5'-TGGTGGGGCGGGAGGAGCAG-3'; and the specific target sequence for knocking out the qAC9.1 gene is 5'-GGTCTCGTGCTCCTCGTGGG-3'.

Images