Use of targeting enpp1 in the treatment of systemic lupus erythematosus
By targeting ENPP1 to regulate mtDNA-induced CD4+ T cell differentiation, the ENPP1 inhibitor ENPP1-IN-1 was used to treat systemic lupus erythematosus (SLE), which solved the problems of adverse reactions and poor efficacy of existing treatments and achieved effective remission of SLE.
Patent Information
- Application Number
- CN202410099487.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-24
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2044-01-24
Smart Images

Figure CN118105494B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biological technology and medical testing technology, and in particular to the application of a targeted ENPP1 in the treatment of systemic lupus erythematosus. Background Technology
[0002] Systemic lupus erythematosus (SLE) is a typical autoimmune disease with a clinical incidence rate that is increasing year by year. It mainly affects young women, and in the later stages, it often co-occurs with other autoimmune diseases, increasing the difficulty of treatment and creating a burden on society and families. The occurrence of SLE involves environmental and genetic factors, but abnormal immune function in patients is the key to the development of the disease.
[0003] SLE is an autoantibody-mediated autoimmune disease. Approximately 70% of patients have anti-dsDNA IgG antibodies, which are the main pathogenic basis for the onset and relapse of the disease. The production of these autoantibodies is inseparable from CD4. + T cells.
[0004] CD4 + T cells play a crucial role in autoimmune diseases such as SLE, participating not only in B cell immune responses but also differentiating into pro-inflammatory Th1 and Th17 cells, mediating tissue inflammation and causing tissue damage. DNA reacts with ds-DNA IgG antibodies to form DNA-anti-ds-DNA antibody immune complexes, which deposit in organs such as the kidneys, causing further damage and leading to lupus nephritis, the leading cause of death in SLE patients.
[0005] Studies have shown that DNA, as the initiator of SLE, primarily originates from apoptotic cells. Furthermore, the induction of SLE by one's own DNA depends on CD4+. + T cells, when CD4 is depleted + Following T cell initiation, the production of anti-ds-DNA IgG antibodies was fundamentally eliminated, and the progression of SLE disease was slowed. Autologous DNA includes nuclear DNA (nDNA) and mitochondrial DNA (mtDNA). Previous studies have found that mtDNA is significantly elevated in SLE patient T cells, indicating that mtDNA has a stronger immunogenicity. Autologous DNA promotes the differentiation and function of effector T cells. Classic DNA sensing pathways include cGAS-STING, NLRP3-inflammatory body, and TLR9. However, some studies have found that DNA promotes Th2 cell differentiation independently of these sensors. In our study, we also found that pathways such as cGAS-STING, NLRP3-inflammatory body, TLR9, and the KU complex are related to CD4+ in SLE. +The lack of correlation between T cell differentiation and function suggests the possible existence of a novel DNA sensing pathway within T cells, involved in CD4+. + The differentiation and function of T cells affect the occurrence and development of SLE disease.
[0006] ENPP1, also known as PC-1, is a type II transmembrane glycoprotein with nucleotide pyrophosphatase and diester activities. ENPP1 is expressed in many tissues and is crucial for purine signal transduction, playing an important role in the regulation of cardiovascular, neurological, immune, musculoskeletal, hormonal, and hematopoietic functions in mammals. Our latest research found that ENPP1 specifically binds to mitochondrial DNA (mtDNA) and regulates CD4+. + T cell differentiation and function.
[0007] Currently, the main treatment for SLE patients involves immunosuppressants; however, the use of high-dose hormones and immunosuppressants can lead to significant adverse reactions. Furthermore, the use of novel targeted therapies has largely failed to achieve the expected results or has resulted in severe non-specific toxicities. The pathogenesis of SLE remains unclear, and there has been no breakthrough in targeted therapy for SLE in clinical practice for nearly 50 years. Therefore, it is urgent to explore the pathogenesis of SLE in order to identify therapeutic targets.
[0008] Therefore, attention should be paid to the effect of mtDNA on CD4. + The effects of T cell differentiation and function, especially ENPP1, will help in the development of targeted therapeutic strategies for SLE. Summary of the Invention
[0009] The main technical problem solved by this invention is to provide an application of targeting ENPP1 in the treatment of systemic lupus erythematosus, and to explore the regulation of CD4 by mtDNA. + This study investigates the mechanisms of abnormal T-cell differentiation, explores the clinical translational value of ENPP1 in systemic lupus erythematosus (SLE) based on the ENPP1 target, and proposes a new targeted therapy for SLE.
[0010] To solve the above-mentioned technical problems, one technical solution adopted by the present invention is: to provide an application of targeting ENPP1 in the treatment of systemic lupus erythematosus, wherein the systemic lupus erythematosus has CD4 + Abnormal T cell differentiation and induction of CD4 + mtDNA from abnormal T cell differentiation contains a novel recognizable molecule, ENPP1, which regulates mtDNA-induced CD4+. + T cell differentiation, with ENPP1 as a target for the treatment of systemic lupus erythematosus.
[0011] Optionally, the primer sequence for ENPP1 is: CAAAGGTCGCTGTTTCGAGAG, TGCACGTCTCCTGGTAATCTAAA.
[0012] Optionally, the mtDNA contains the recognition molecule ENPP1, comprising:
[0013] The mtDNA was used to transfect the CD4 of healthy individuals. + T cells were subjected to RNA sequencing and cross-analysis with the molecular signature database MSigDB, which revealed that ENPP1, ENOX1 and ZNF705E were upregulated.
[0014] The mtDNA was used to transfect the CD4 of healthy individuals. + T cells were analyzed, and the mRNA levels of ENPP1, ENOX1, and ZNF705E were measured. The results showed that ENPP1 plays a role in mtDNA-induced CD4+ activation. + Increased selectivity in T cells;
[0015] CD4 extracted from patients with systemic lupus erythematosus + T cells, detecting CD4 + The expression of ENPP1 mRNA and protein in T cells showed that the levels of ENPP1 mRNA and protein were elevated.
[0016] Optionally, CD4 can be regulated in mtDNA via ENPP1. + T cell differentiation includes:
[0017] The test is to determine whether ENPP1 specifically binds to the mtDNA.
[0018] The ENPP1 induces CD4 in the mtDNA + The impact on T cell differentiation;
[0019] A humanized SLE mouse model was established and treated with the ENPP1 inhibitor ENPP1-IN-1.
[0020] Optionally, detecting whether the ENPP1 specifically binds to the mtDNA includes:
[0021] CD4 in healthy individuals and patients with systemic lupus erythematosus + In T cells, ENPP1 effectively and specifically binds to the mtDNA, and CD4+ in patients with systemic lupus erythematosus... + The binding of ENPP1 to mtDNA in T cells is higher than in healthy individuals;
[0022] CD4 in healthy individuals +When mtDNA or nDNA is transfected into T cells, ENPP1 always binds effectively to the mtDNA.
[0023] mtDNA was labeled with Alexa Fluor 488, and the specific binding between ENPP1 and mtDNA was further verified by immunoprecipitation assay.
[0024] Optionally, the ENPP1 induces CD4 in the mtDNA. + The effects on T cell differentiation include: the mtDNA-induced CD4+ expression reduction after knocking down ENPP1 expression with ENPP1 siRNA. + The differentiation of T cells into effector T cells decreases, while the differentiation of regulatory T cells increases.
[0025] Optionally, the establishment of the humanized SLE mouse model includes: reconstructing the immune system of NSG mice using peripheral blood mononuclear cells from systemic lupus erythematosus patients, and injecting 10... 7 PBMCs from patients with systemic lupus erythematosus were introduced into NSG mice.
[0026] The beneficial effects of this invention are: This invention provides an application of targeting ENPP1 in the treatment of systemic lupus erythematosus, by exploring the effect of mtDNA on CD4... + The mechanism of T cell differentiation focuses on ENPP1, a novel molecule that recognizes mtDNA, and how ENPP1 can regulate mtDNA-induced CD4+. + The study aims to explore new treatment strategies for systemic lupus erythematosus (SLE) by differentiating T cells and targeting ENPP1 as a therapeutic target. Attached Figure Description
[0027] Figure 1 It is mtDNA transfection of CD4 in healthy individuals + After T cells were induced, RNA-seq analysis was performed, showing a schematic diagram of significant upregulation of ENPP1, ENOX1, and ZNF705E.
[0028] Figure 2 It is mtDNA transfection of CD4 in healthy individuals + A comparison of the selective increase in ENPP1 detected by qPCR after T cell therapy;
[0029] Figure 3 It is a qPCR test for CD4 in SLE patients + A comparison of elevated ENPP1 mRNA levels in T cells;
[0030] Figure 4 It is a flow cytometry assay for CD4 in SLE patients. +A comparison chart showing elevated ENPP1 protein levels in T cells;
[0031] Figure 5 In healthy individuals and SLE patients, CD4 + In T cells, ENPP1 effectively and specifically binds to mtDNA. Meanwhile, in SLE patients, the binding of ENPP1 to mtDNA is significantly higher than that in healthy individuals (see comparison chart).
[0032] Figure 6 CD4 from healthy individuals + A comparison diagram showing how ENPP1 effectively binds to mtDNA after transfection with mtDNA or nDNA in T cells.
[0033] Figure 7 This is a schematic diagram illustrating the binding of ENPP1 and mtDNA through immunoprecipitation assays using mtDNA labeled with Alexa Fluor 488.
[0034] Figure 8 The effect of mtDNA-induced CD4 after knocking down ENPP1 expression with ENPP1 siRNA. + A comparison chart showing decreased T cell differentiation and increased regulatory T cell differentiation;
[0035] Figure 9 This is a comparison chart showing the increase in serum IgG concentration during the identification of a humanized mouse model of SLE;
[0036] Figure 10 This is a comparison chart showing increased IgG deposition in the kidneys during the identification of a humanized SLE mouse model;
[0037] Figure 11 This is a comparison chart showing increased renal immune cell infiltration during the identification of a humanized mouse model of SLE.
[0038] Figure 12 This is a comparison chart showing the increase in urinary protein concentration during the identification of a humanized mouse model of SLE;
[0039] Figure 13 This is a comparison chart showing the decrease in serum IgG concentration after treatment with ENPP1 inhibitors;
[0040] Figure 14 This is a comparison chart showing the reduction in renal immune cell infiltration after treatment with ENPP1 inhibitors;
[0041] Figure 15 This is a comparison chart showing the reduction in renal IgG deposition after treatment with ENPP1 inhibitors;
[0042] Figure 16This is a comparison chart showing the reduction in urinary protein concentration in mice after treatment with ENPP1 inhibitors. Detailed Implementation
[0043] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings, so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby providing a clearer and more explicit definition of the scope of protection of the present invention.
[0044] This embodiment includes:
[0045] An application of ENPP1 targeting in the treatment of systemic lupus erythematosus (SLE), a disease characterized by CD4+. + Abnormal T cell differentiation and induction of CD4 + T cell abnormal differentiation involves mtDNA, which possesses a novel recognizable molecule, ENPP1. ENPP1 regulates mtDNA-induced CD4+. + T cell differentiation, with ENPP1 as a target for the treatment of systemic lupus erythematosus.
[0046] In SLE patients, high levels of mtDNA are present in the cytoplasm, and mtDNA induces CD4+. + Abnormal T cell differentiation mediates tissue inflammatory responses; simultaneously, mtDNA possesses strong immunogenicity, inducing the body to produce anti-dsDNA antibodies, which in turn form antigen-antibody complexes that deposit in tissues and organs, causing damage. This is a significant initiating factor in the pathogenesis of SLE. Previous studies have found that mtDNA induces CD4+ in SLE. + Abnormal T cell differentiation does not depend on classical DNA sensing pathways, suggesting the existence of novel pathways. In this application, a novel mtDNA recognition molecule, ENPP1, was discovered, which can specifically bind to mtDNA and exert its function; the role of the novel DNA recognition molecule ENPP1 in CD4+ in SLE was investigated. + The study explored the role of T cell differentiation and the clinical translational value of targeting and inhibiting ENPP1, finding that inhibiting ENPP1 has a good therapeutic effect and could become a new therapeutic target for SLE.
[0047] First, we need to investigate how mtDNA induces CD4. + ENPP1 was discovered during T cell differentiation. We transfected CD4 cells from healthy individuals with mtDNA from apoptotic cells. +T cells (all mtDNA samples below are derived from apoptotic cells), with the untransfected mtDNA group serving as a control, were stimulated with anti-CD3 / CD28 beads. Samples were collected 3 days later for RNA sequencing, followed by cross-analysis with the molecular signature database MSigDB. The results showed that after mtDNA transfection, ENOX1, ENPP1, ZNF705E, and the unknown gene AC097218.3 were detected on CD4 cells. + The expression was significantly upregulated in T cells. Next, mtDNA was used to transfect CD4 cells from healthy individuals. + T cells were analyzed, and the mRNA levels of ENOX1, ENPP1, and ZNF705E were measured. The results showed that ENPP1 plays a role in mtDNA-induced CD4+ activation. + Selective elevation in T cells; to further verify, CD4 was extracted from SLE patients. + T cells were analyzed to detect ENPP1 mRNA and protein expression. The results showed significantly elevated levels of both ENPP1 mRNA and protein. This suggests that ENPP1 plays a role in mtDNA regulation of CD4+. + They play an important role in T cell differentiation.
[0048] Next, we investigated whether ENPP1 specifically binds to mtDNA. ENPP1 was immunoprecipitated from healthy individuals and SLE patients, and the binding of ENPP1 to mtDNA and nDNA was analyzed. Binding to mtDNA was detected by D-LOOP and ATPase6, while binding to nDNA was detected by POLG. The results showed that ENPP1 specifically binds to mtDNA regardless of whether it originates from healthy individuals or SLE patients. + In T cells, ENPP1 can effectively and specifically bind to mtDNA, and the binding to mtDNA is significantly higher in SLE patients than in healthy individuals. To further verify this, in healthy individuals' CD4+ cells... + T cells were transfected with mtDNA or nDNA and stimulated with anti-CD3 / CD28 beads. Samples were taken 3 days later, and the results were consistent with previous findings: ENPP1 effectively and specifically bound to mtDNA, while binding to nDNA remained consistently low. Finally, we labeled the mtDNA of apoptotic cells with Alexa Fluor488 and transfected it into CD44 cells from healthy individuals. + In T cells, an antibody against Alexa Fluor488 is then used to extract CD4 cells. + Immunoprecipitation of mtDNA in T cells was performed, and mtDNA (ND1) was observed by gel electrophoresis. The interaction between mtDNA and ENPP1 protein was also detected using immunoprecipitation experiments. The results showed that ENPP1 significantly bound to mtDNA, indicating that ENPP1 plays a role in mtDNA-induced CD4+ activating protein exchange. +T cells function by binding to mtDNA during differentiation, and this binding is specific.
[0049] Then, the effects of ENPP1 on mtDNA-induced CD4 were investigated. + The effect on T cell differentiation. Simultaneous transfection of healthy individuals' CD4 cells with mtDNA and ENPP1 siRNA. + T cells were stimulated with anti-CD3 / CD28 beads, and samples were collected and analyzed 4 days later. Results showed decreased expression of T-bet, RORγt, and Bcl6, and increased expression of Foxp3, indicating that CD4+ expression was negative. + T cell differentiation into pro-inflammatory effector T cells decreases while differentiation into regulatory T cells increases. This suggests that ENPP1 participates in and influences SLE disease progression, driving further translational evaluation using humanized disease models.
[0050] Finally, based on the above experimental foundation, a humanized SLE mouse model was established to observe the transformational value of ENPP1. The immune system of NSG mice was reconstructed using peripheral blood mononuclear cells from SLE patients, and 10 ENPP1 was injected via the tail vein. 7 Patient-derived PBMCs were introduced into NSG mice. Four weeks later, samples were collected to measure serum anti-dsDNA IgG levels, renal IgG deposition, renal immune cell infiltration, and urinary protein concentration to confirm that SLE patient immune cells can effectively induce humanized SLE in NSG mice. In the humanized SLE mouse model, treatment with the ENPP1 inhibitor ENPP1-IN-1 was performed. Four weeks later, serum anti-dsDNA IgG levels, renal IgG deposition, immune cell infiltration, and urinary protein concentration were measured. Results showed that treatment with the ENPP1 inhibitor reduced serum anti-dsDNA IgG levels, renal IgG deposition, immune cell infiltration, and urinary protein concentration, effectively alleviating disease severity in the humanized SLE mouse model.
[0051] In summary, targeted inhibition of ENPP1 has good application value in the treatment of SLE.
[0052] The following experiments illustrate the invention in detail, but do not limit the scope of the invention.
[0053] Experiment 1. In mtDNA-induced CD4 + In T cells, new DNA recognition molecules are searched for.
[0054] 1.1 Experimental materials and reagents
[0055] (1) Cells: PBMCs were all obtained from recruited volunteers.
[0056] (2) Reagent: EasySep™ Human CD4 + T cell isolation kit (Stemcell); CD3 / CD28 beads (Thermo Fisher Scientific); Mitochondrial isolation kit (abcam); Deoxyribonucleic acid kit (QIAGEN); HiScript III RT SuperMix for qPCR (Vazyme); SYBR Green qPCR MasterMix (Bimake); ENPP1 antibody (Santa Cruz);
[0057] Primer sequence for ENPP1: CAAAGGTCGCTGTTTCGAGAG, TGCACGTCTCCTGGTAATCTAAA;
[0058] Primer sequence for ENOX1: GAGATAGCGATAGACACGACCC, CACAGATTGAGTCAGACACGAG;
[0059] Primer sequences for ZNF705E: CCAGACAGGGAAAGTGCCCTTAA, GATTCCGGGAGAAGATTGCACTCAC.
[0060] 1.2 Experimental Procedure
[0061] 1.2.1 Preparation of apoptotic mtDNA
[0062] 1) Cell samples were collected from PBMCs after 6 days of stimulation with CD3 / CD28 beads;
[0063] 2) Isolate mitochondria from cells;
[0064] 3) Extract mtDNA.
[0065] 1.2.2CD4 + T cell sorting
[0066] 1) Resuspend the PBMCs, mix thoroughly, and count;
[0067] 2) Add the appropriate volume of CD4 according to the number of cells. + T cell sorting buffer and antibody are fed into sorting tubes (5*10). 6 Add 25 μl CD4 to each cell + T-cell sorting antibodies), let stand for 5 minutes;
[0068] 3) Added with CD4 +T cell sorting antibody of the same volume of CD4 + T-cell sorting magnetic beads;
[0069] 4) Carefully transfer the sorting tube to the magnetic rack and let it stand for 5 minutes;
[0070] 5) Use a pipette to transfer the T-cell-containing buffer into a new sorting tube;
[0071] 6) Carefully transfer the sorting tube to the magnetic rack and let it stand for 5 minutes;
[0072] 7) Transfer the T cell buffer to a centrifuge tube using a pipette, centrifuge at 1700 rpm for 7 minutes, and the final precipitate is the desired CD4. + T cells.
[0073] 1.2.3CD4 + T cell transfection
[0074] 1) Add 2 ml of culture medium to the 12-well plate and place it in an incubator to equilibrate for at least 30 minutes;
[0075] 2) Resuspend cells for counting, take 5-10*10 cells. 6 1 cell, 200g, centrifuged at room temperature for 10 minutes, and the supernatant was discarded;
[0076] 3) Resuspend the cells in 100 μl of electroporation reagent;
[0077] 4) Add 1-5 μg mtDNA to each tube;
[0078] 5) Transfer the sample to the electroporation cup (cover the sample, and ensure there are no air bubbles at the bottom);
[0079] 6) Place the electro-rotating cup into the electro-rotator and select the program;
[0080] 7) Add the preheated culture medium and gently transfer the sample into the 12-well plate;
[0081] 8) After about 6 hours, collect the transfected cells, count them, change the culture medium to a new plate, and add anti-CD3 / 28beads to stimulate the cells.
[0082] 1.2.4 Detection of related gene expression by real-time quantitative PCR
[0083] 1) Total RNA was extracted using the Trizol method;
[0084] 2) Synthesize cDNA using HiScript III RT SuperMix for qPCR;
[0085] 3) Quantitative analysis was performed using SYBR Green qPCR MasterMix.
[0086] 1.2.5 Flow cytometry detection of cellular protein expression
[0087] 1) Collect cells, centrifuge at 1700 rpm for 5 min, and discard the supernatant;
[0088] 2) Wash once with 2% PBS, centrifuge at 1700 rpm for 5 min, and discard the supernatant;
[0089] 3) Add 200 μl of 4% paraformaldehyde to each sample and fix at room temperature for 15 min;
[0090] 4) Add 2% PBS to neutralize, centrifuge at 1700 rpm for 7 min, and discard the supernatant;
[0091] 5) Add 200 μl of membrane rupture solution to each sample and incubate on ice for 30 min;
[0092] 7) Add 2% PBS to neutralize, centrifuge at 1700 rpm for 7 min, and discard the supernatant;
[0093] 8) Wash once with 2% PBS, centrifuge at 1700 rpm for 7 min, and discard the supernatant;
[0094] 9) Add 1 μl of flow cytometry antibody and 100 μl of 2% PBS to each sample, and stain at 4°C for 40 min;
[0095] 10) Add 2% PBS to neutralize, centrifuge at 1700 rpm for 7 min, and discard the supernatant;
[0096] 11) Add 200 μl of 2% PBS, transfer to a flow cytometer, and perform instrumental analysis.
[0097] 1.3 Experimental Results
[0098] Based on the above experimental results, and through RNA-seq analysis, a novel DNA recognition molecule, ENPP1, was discovered, which can be activated by mtDNA-induced CD4+. + Selective elevation of ENPP1 in T cells, and also elevated in SLE patients, indicates that ENPP1 plays a role in mtDNA-induced CD4+ activation. + T cells play an important role, and the results are shown in... Figures 1 to 4 .
[0099] Figures 1 to 4 ENPP1 regulates CD4 in mtDNA + Changes in T cells. Figure 1 This shows mtDNA transfection of CD4 in healthy individuals. + After T cells were induced, RNA-seq was performed, and ENPP1, ENOX1 and ZNF705E were significantly upregulated. Figure 2 This shows mtDNA transfection of CD4 in healthy individuals.+ After T cell administration, qPCR analysis showed a selective increase in ENPP1. Figure 3 and Figure 4 The results showed qPCR and flow cytometry detection of CD4 in SLE patients. + The mRNA and protein levels of ENPP1 are elevated in T cells.
[0100] Experiment 2. Detection of the interaction mechanism between ENPP1 and mtDNA
[0101] 2.1 Experimental materials and reagents
[0102] (1) Cells: Same as Experiment 1.
[0103] (2) Reagents: Alexa Flour488 (Invitrogen); Alexa Fluor488 Polyclonal Antibody (Invitrogen); Protein A / G magnetic beads (selleck); CUT&RUNAssay Kit for qPCR (Vazyme); the rest are the same as in Experiment 1.
[0104] 2.2 Experimental Procedure
[0105] 2.2.1 Western Blot Experiment
[0106] 1) Electrophoresis: Prepare a polyacrylamide separating gel with a molecular weight appropriate to the target protein. Load the sample protein according to its concentration and start electrophoresis until the loading buffer indicator reaches the bottom of the separating gel, then stop electrophoresis.
[0107] 2) Transfer: The transfer is carried out in the following order: black side of clamp / filter paper / separating gel / PVDF membrane / filter paper / white side of transfer clamp. The wet transfer method is used with a current of 200mA. The transfer time is determined according to the molecular weight.
[0108] 3) Sealing: Place the PVDF membrane after transfer in 5% milk and seal at room temperature for 2 hours;
[0109] 4) Incubation of primary antibody: Add to the primary antibody prepared with antibody dilution solution and incubate overnight at 4°C;
[0110] 5) The next day, wash the membrane with 0.1% PBST every 10 minutes for a total of 3 times; incubate the secondary antibody at room temperature for 1 hour, and wash the membrane with 0.1% PBST every 10 minutes for a total of 3 times.
[0111] 6) Add ECL luminescent liquid and expose on the machine.
[0112] 2.2.2 CUT & RUN Experiment
[0113] Follow the instructions on the kit.
[0114] 2.2.3 mtDNA Immunoprecipitation Reaction
[0115] 1) Label mtDNA using the ULYSIS NucleicAcid Labeling Kit;
[0116] 2) Lyse cells with IP lysis buffer at 4°C for 30 min;
[0117] 3) Centrifuge at 14000g for 15 minutes and collect the supernatant;
[0118] 4) The supernatant was incubated with Alexa Fluor 488 Polyclonal Antibody at 4°C for 8 hours;
[0119] 5) Protein A / G magnetic beads and the antigen-antibody mixture were co-incubated at 4°C for 3 hours;
[0120] 6) After cleaning, the magnetic beads are divided into two parts: one part is used for Western blotting, and the other part is used to extract DNA for conventional PCR and gel electrophoresis.
[0121] 2.2 Experimental Results
[0122] The experimental results showed that mtDNA transfection of CD4 + Following T cell activation, ENPP1 can specifically bind to mtDNA; simultaneously, in SLE patients' CD4+... + The same phenomenon was observed in T cells, and the binding amount of ENPP1 to mtDNA was significantly higher than in healthy individuals, as shown in the results below. Figures 5 to 7 .
[0123] Figures 5 to 7 Detect the interaction between ENPP1 and mtDNA; Figure 5 The results showed CD4 levels in healthy individuals and SLE patients. + In T cells, ENPP1 effectively and specifically binds to mtDNA, and the binding of ENPP1 to mtDNA is significantly higher in SLE patients than in healthy individuals. Figure 6 Displayed CD4 from healthy individuals + After transfection with mtDNA or nDNA in T cells, ENPP1 can always effectively bind to mtDNA. Figure 7 The results showed that ENPP1 and mtDNA were bound by immunoprecipitation assays after mtDNA was labeled with Alexa Fluor 488.
[0124] Experiment 3. ENPP1 effect on mtDNA-induced CD4 + The impact on T cell differentiation.
[0125] 3.1 Experimental Materials and Reagents
[0126] (1) Cells: Same as Experiment 1.
[0127] (2) Reagents: ENPP1 siRNA (Raybot Biotech); the rest are the same as the above experiments.
[0128] 3.2 Experimental Procedure
[0129] The flow cytometry method was used for the same detection as in Experiment 1.
[0130] 3.3 Experimental Results
[0131] Based on our experimental results, we found that mtNDA-induced CD4 + Transfecting T cells with ENPP1 siRNA and knocking down ENPP1 expression resulted in CD4... + T cell differentiation decreases effector T cell differentiation and increases regulatory T cell differentiation. Results are shown in […]. Figure 8 .
[0132] Figure 8 This demonstrates the effect of ENPP1 on mtDNA-induced CD4. + The effect of ENPP1 knockdown on ENPP1 expression with ENPP1 siRNA on mtDNA-induced CD4. + T cell differentiation is reduced, while regulatory T cell differentiation is increased.
[0133] Experiment 4. Based on a humanized mouse model of SLE, explore the clinical translational value of ENPP1.
[0134] 4.1 Experimental materials and reagents
[0135] (1) Cells: Same as the above experiments.
[0136] (2) Animals: 6-8 week old SPF-grade wild-type NSG mice (Biocytok) weighing 18-22g were selected, and the 3R principle of experimental animal handling was followed. The experimental protocol was approved by the Experimental Animal Ethics Committee of Soochow University.
[0137] (3) Reagents: dsDNA IgG ELISA Kit (Abnova); mouse urine protein detection kit (GeneRayBiotech); mouse serum IgG antibody detection kit (Chondrex); Alexa Fluor488 anti-human IgG (Abcam); the rest are the same as the above experiments.
[0138] 4.2 Experimental Procedure
[0139] 4.2.1 Establishment of humanized disease models
[0140] PBMCs (10) were isolated from patients with active SLE. 7 Cells / mouse) were injected intraperitoneally into NSG mice to reconstruct the humanized immune system of NSG mice. Four weeks later, immune cells of SLE patients could effectively produce IgG anti-DNA antibodies to form DNA immune complexes, which infiltrated the kidney tissue of mice and induced the occurrence of SLE disease.
[0141] 4.2.2 Detection of human dsDNA IgG
[0142] Follow the instructions in the kit package.
[0143] 4.2.3 Detection of protein in mouse urine
[0144] Use the Bradford method for detection, following the instructions in the kit's manual.
[0145] 4.2.4 Detection of renal IgG deposition
[0146] (1) The kidneys of the two groups of mice were removed and fixed in 4% paraformaldehyde solution;
[0147] (2) After being embedded in paraffin, the sections were prepared;
[0148] (3) Soak in xylene solution for 8 minutes, repeat three times;
[0149] (4) Let stand in anhydrous ethanol solution for 2 min;
[0150] (5) Place in 95% ethanol solution for 2 minutes, repeat twice.
[0151] (6) Place in 80% ethanol solution for 2 minutes;
[0152] (7) Rinse with running water for 30 seconds;
[0153] (8) Remove endogenous enzymes: Infiltrate tissues with 3% H2O2 and leave at room temperature for 10 min;
[0154] (9) Wash with PBS 3 times, 3 min each time;
[0155] (10) Antigen retrieval: Place the tissue section in the antigen retrieval solution, 90℃, 30min, and air dry at room temperature.
[0156] (11) Blocking: 1% BSA (containing 3% Triton X-100), 37°C, block for 1 hour;
[0157] (12) Wash with PBS 3 times, 3 min each time;
[0158] (13) Incubate the antibody at 4℃ overnight;
[0159] (15) Covering
[0160] 4.2.5 Renal immune cell infiltration
[0161] The cells were detected using flow cytometry, and the experimental method was the same as in Experiment 1.
[0162] 4.3 Experimental Results
[0163] Based on the above experimental results, we successfully constructed a humanized mouse model of SLE. In this model, the application of ENPP1 inhibitors significantly reduced the levels of anti-dsDNA IgG antibodies in the mouse serum; decreased IgG deposition in the kidneys; reduced renal immune cell infiltration; and reduced urinary protein production. This suggests that ENPP1 inhibitors can effectively alleviate the disease severity in SLE mouse models and have a certain therapeutic effect. (See attached results). Figures 9 to 16 .
[0164] Figures 9 to 12 To identify a humanized mouse model of SLE, disease indicators were measured: serum IgG concentration, IgG deposition in the kidneys, renal immune cell infiltration, and urinary protein concentration. Figures 9 to 12 The results showed that all disease indicators were elevated, confirming the successful construction of the humanized mouse model of SLE.
[0165] Figures 13 to 16 In a humanized mouse model of SLE, disease markers were measured after 4 weeks of treatment with ENPP1 inhibitors; after treatment with ENPP1 inhibitors, Figures 13 to 16 The study showed a decrease in serum IgG concentration, renal immune cell infiltration, renal IgG deposition, and urinary protein production in mice.
[0166] This invention fully utilizes clinical patient samples and humanized disease models to explore the effect of mtDNA on CD4. + The study investigated the mechanism of T cell differentiation, focusing on the novel mtDNA recognition molecule ENPP1, to explore new strategies for treating SLE. A humanized SLE mouse model was established, revealing that inhibiting ENPP1 significantly alleviated the severity of SLE. This demonstrates that ENPP1 is a promising new therapeutic target for SLE with significant clinical translational value.
[0167] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or any direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.
Claims
1. The use of an ENPP1-IN-1 inhibitor targeting ENPP1 in the preparation of a therapeutic agent for systemic lupus erythematosus, wherein the systemic lupus erythematosus has CD4+ + Abnormal T cell differentiation and induction of CD4 + mtDNA from abnormally differentiated T cells, characterized by... The mtDNA contains the recognizable molecule ENPP1, and the inhibitor regulates CD4 by inhibiting the specific binding of ENPP1 to mtDNA. + T cell differentiation.
2. The application of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 1 in the preparation of a systemic lupus erythematosus treatment, characterized in that, The primer sequence for ENPP1 is: CAAAGGTCGCTGTTTCGAGAG, TGCACGTCTCCTGGTAATCTAAA.
3. The application of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 1 in the preparation of a systemic lupus erythematosus treatment, characterized in that, The mtDNA contains the recognizable molecule ENPP1, which is determined by the following method: The mtDNA was used to transfect the CD4 of healthy individuals. + T cells were subjected to RNA sequencing and cross-analysis with the molecular signature database MSigDB, which revealed that ENPP1, ENOX1 and ZNF705E were upregulated. The mtDNA was used to transfect the CD4 of healthy individuals. + T cells were analyzed, and the mRNA levels of ENPP1, ENOX1, and ZNF705E were measured. The results showed that ENPP1 plays a role in mtDNA-induced CD4+ activation. + Increased selectivity in T cells; CD4 samples extracted from patients with systemic lupus erythematosus + T cells, detecting CD4 + The expression of ENPP1 mRNA and protein in T cells showed that the levels of ENPP1 mRNA and protein were elevated.
4. The use of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 1 in the preparation of a treatment for systemic lupus erythematosus, characterized in that, The inhibitor regulates CD4 by inhibiting the specific binding of ENPP1 to mtDNA. + T cell differentiation was verified through the following methods: The test is to determine whether ENPP1 specifically binds to the mtDNA. Detection of CD4 induced by ENPP1 on the mtDNA + The impact on T cell differentiation; A humanized SLE mouse model was established, and the treatment was validated using the ENPP1 inhibitor ENPP1-IN-1.
5. The use of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 4 in the preparation of a systemic lupus erythematosus treatment, characterized in that, Detecting whether ENPP1 specifically binds to the mtDNA includes: CD4 in healthy individuals and patients with systemic lupus erythematosus + In T cells, ENPP1 effectively and specifically binds to the mtDNA, and CD4 in patients with systemic lupus erythematosus... + The binding of ENPP1 to mtDNA in T cells is higher than in healthy individuals; CD4 in healthy individuals + When mtDNA or nDNA is transfected into T cells, ENPP1 always binds effectively to the mtDNA. mtDNA was labeled with Alexa Fluor 488, and the specific binding between ENPP1 and mtDNA was further verified by immunoprecipitation assay.
6. The use of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 4 in the preparation of a systemic lupus erythematosus treatment, characterized in that, Detection of CD4 induced by ENPP1 on the mtDNA + The effects on T cell differentiation include: the mtDNA-induced CD4+ expression reduction after knocking down ENPP1 expression with ENPP1 siRNA. + The differentiation of T cells into effector T cells decreases, while the differentiation of regulatory T cells increases.
7. The use of the ENPP1-IN-1 inhibitor targeting ENPP1 according to claim 4 in the preparation of a systemic lupus erythematosus treatment, characterized in that, The establishment of the humanized SLE mouse model includes: reconstructing the immune system of NSG mice using peripheral blood mononuclear cells from systemic lupus erythematosus patients, and administering 10 via tail vein. 7 PBMCs from patients with systemic lupus erythematosus were introduced into NSG mice.
Citation Information
Patent Citations
ENPP1 inhibitors and methods of modulating immune response
CN113677350A
Application of glutamine transporter ASCT2 as target spot in preparation of medicine for treating Tfh-related autoimmune diseases
CN117230186A