A sucC mutant and its application in the fermentative production of L-valine

Abstract

The present invention relates to the field of bioengineering technology and provides a sucC mutant and its application in the fermentative production of L-valine. By performing point mutations on the sucC gene, the present invention reduces the enzyme expression activity, balances the metabolic flux problem between the TCA cycle for cell growth and product accumulation, and thus improves the valine yield. Further, through experimental screening, a recombinant strain capable of significantly increasing the valine yield is obtained. From the fermentation results, it can be seen that this method can significantly increase the valine yield, from the original 1.3 g / L to 1.61 g / L, with a 23.8% increase in yield, providing strong strain support for further industrialization.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a sucC mutant and application thereof in the fermentation production of L-valine. Background Art

[0002] Valine is a branched-chain amino acid (BCAA) with a molecular formula of C 5 H 11 NO 2 , white crystal or powder, soluble in water, density 1.316g / cm 3 The valine molecule is a chiral molecule, which can be divided into D-type and L-type according to the rotation direction of polarized light. Natural valine is L-valine. L-valine is one of the essential amino acids for the human body. It cannot be synthesized by itself and must be supplemented through dietary sources. It has multiple physiological functions and is widely used in food, medicine, cosmetics, feed and other fields.

[0003] Microbial cells can directly synthesize L-valine by mass culturing microorganisms and utilizing their metabolic reactions. Currently, most of the industrial production of L-valine in the world adopts this method, and the production strains used include Escherichia coli, Corynebacterium glutacium, Brevibacterium flavum, Corynebacterium pekinensis and other subspecies, Serratia marcescens, Bacillus, etc. Among them, Escherichia coli is often used as a chassis cell to produce a variety of different natural products because of its advantages such as clear genetic background, fast growth, and mature gene editing technology.

[0004] Although microbial cells can directly synthesize L-valine, a large number of intracellular regulatory networks such as feedback inhibition greatly limit the production capacity of wild bacteria. In order to obtain a fermentation strain that efficiently produces L-valine, it is necessary to effectively remove the self-regulatory mechanism inside the microbial cell. In recent years, with the rapid development of synthetic biology and metabolic engineering, recombinant engineering strains that can efficiently produce L-valine and are easy to culture have emerged through genetic modification and have achieved good results. Xie Xixian et al. integrated the alsS gene encoding Bacillus subtilis acetolactate synthase to remove the feedback inhibition of L-valine on the synthesis pathway, and at the same time integrated the mutant gene spoTM of Escherichia coli ppGpp3'-pyrophosphate hydrolase to enhance the supply of pyruvate and improve the level of L-valine production by shake flask fermentation of the starting strain VHY03 (ZL2020009206).

[0005] In the metabolic pathway of Escherichia coli for producing L-valine, as Figure 1 , pyruvate is a precursor of valine and is also connected to the TCA cycle essential for cell growth. Directly knocking out the key enzymes in this cycle will block the TCA cycle, severely affecting cell growth and consequently reducing the valine yield. Therefore, balancing cell growth and product accumulation has become the key to metabolic engineering. Some studies have shown that the strength of the TCA cycle is directly related to the transcriptional level of succinyl-CoA synthetase (sucCD). Thus, reasonably regulating the catalytic ability of the sucCD protein is crucial for valine engineering bacteria. Summary of the Invention

[0006] The object of the present invention is to provide a general method for balancing amino acid synthesis required for cell growth and product generation during metabolic engineering transformation. The present invention achieves carbon flux metabolic balance by performing point mutations on the sucC gene to reduce enzyme expression activity, thereby achieving the purpose of increasing the valine yield. Through experimental screening, a recombinant strain that can significantly increase the valine yield has been obtained.

[0007] The present invention provides a sucC mutant, which has a mutation at at least one of the following sites of the amino acid corresponding to the wild-type of sucC: L17, S36, G53, A125, L223, or F286.

[0008] The mutation is based on molecular docking of the sucC wild-type sequence to simulate the sequences of different mutation sites. The mutant protein will reduce the catalytic ability of the enzyme to a certain extent while retaining partial protein activity, enabling the strain to accumulate L-valine while growing normally.

[0009] Specifically, it has a mutation at at least one of the following sites of the amino acid corresponding to the wild-type of sucC: L17S, S36P, G53A, A125D, L223P, F286S.

[0010] The present invention provides the coding nucleic acid of the sucC mutant described above.

[0011] The present invention also provides a recombinant expression vector containing the coding nucleic acid.

[0012] The present invention further provides a recombinant bacterium containing the recombinant expression vector, preferably Escherichia coli.

[0013] The present invention also provides the application of the coding nucleic acid of the sucC mutant as described above, the coding nucleic acid, the recombinant expression vector, or the recombinant bacterium in the preparation of L-valine.

[0014] The present invention particularly provides a production strain for improving the yield of L-valine, which is obtained by the following method:

[0015] S1: To achieve single-point mutations in the genome, according to the CRISPR-cas9 principle, after successful editing, the original N20 sequence corresponding to the PAM site should not exist in the genome. A general-purpose chassis strain needs to be constructed for each of the initial strains (specifically, Escherichia coli Sva1024 and wild-type Escherichia coli ATCC8739). Specifically, a 20bp specific-site mutation is performed on the sucC gene to obtain a first modified strain;

[0016] S2: The nucleic acid encoding as described in claim 3 is used to perform corresponding point mutations and 20bp specific-site reverse mutations on the sucC gene in the first modified strain to obtain a second modified L-valine production strain.

[0017] The present invention further provides a method for preparing L-valine, which includes the step of fermenting and culturing the recombinant bacterium to obtain L-valine, and optionally, further includes the step of separating the L-valine.

[0018] In a specific embodiment, it can be seen from the fermentation results that the strain modified by the present invention can significantly improve the yield of valine. For example, the initial strain Sva1024 is increased from the original 1.3 g / L to 1.61 g / L, and the yield is increased by 23.8%. The wild-type strain E. coli ATCC8739 is increased from the original 0 to 0.11 g / L, and there is obvious accumulation of L-valine, providing strong strain support for further industrialization. Description of the Drawings

[0019] Figure 1 is the metabolic pathway for Escherichia coli to synthesize L-valine;

[0020] Figure 2 is the result graph of succinyl coenzyme A production;

[0021] Figure 3 is the fermentation result of the metabolically modified Sva1024 strain;

[0022] Figure 4 is the fermentation result of the metabolically modified wild-type ATCC8739 strain. Detailed Embodiments

[0023] The present invention will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.

[0024] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0025] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods.

[0026] In the test materials used in the following examples, unless otherwise specified, they are all conventional biochemical reagents.

[0027] Composition of LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, and the solvent is deionized water. Solid medium requires adding agar with a final concentration of 20 g / L.

[0028] Seed medium: glucose 20 g / L, corn steep liquor dry powder 10 g / L, KH2PO4 8.8 g / L, (NH4)2SO4 2.5 g / L, MgSO4·7H2O 2 g / L.

[0029] Fermentation medium: The fermentation medium has the same components as the seed medium, and the only difference is that the glucose concentration is 50 g / L.

[0030] The initial valine transaminase of the present invention is from the laboratory-preserved strain Sva1024.

[0031] The strains and plasmids used in the present invention are shown in Table 1.

[0032] Table 1 shows the strains and plasmids used in the present invention

[0033]

[0034]

[0035]

[0036] All references in the examples are shown in Table 2.

[0037] Table 2 shows the primers used in the present invention

[0038] Primer Name Sequence (5’-3’) suc-F caaatgggtcgcggatccgaattcgagctcatgaacttacatgaatatca suc-R gtggtggtgctcgagtgcggccgcaagcttttatttcagaacagttttca pET28a-xian-F aagcttgcggccgcactc pET28a-xian-R gagctcgaattcggatccgc pET28a-seq-F ggtgatgtcggcgatataggc pET28a-seq-R cggatatagttcctcctttcagca sucC-N20-F taatactagtgcggcttcttctgcttcgcggttttagagctagaaatagc sucC-N20-R gctctaaaaccgcgaagcagaagaagccgcactagtattatacctaggac sucC-F1 ccgagtcggtgctttttttgaattctctagaatgcacgctatcaaagatcgt sucC-R1 ccggcaccgatttttgaagctgcctcctcggcctctcgcggagtagtacaggcataaccc sucC-F2 ggttatgcctgtactactccgcgagaggccgaggaggcagcttcaaaaatcggtgccggtcc sucC-R2 agggtaatagatctaagcttctgcaggtcgacagtggcagcaacggcttca suc-seq-F1500 gagaggccgaggaggca suc-seq-R cgatacccactttacccggt S-N20-F taatactagtgctgcctcctcggcctctcggttttagagctagaaatagc S-N20-R gctctaaaaccgagaggccgaggaggcagcactagtattatacctaggac S-seq-F1500 cgaagcagaagaagccgc

[0039] Example 1: Detection of enzymatic parameters of different sucCD mutants

[0040] (1) Using the wild-type sucC sequence (the nucleotide sequence of the wild-type sucC gene is shown in SEQ ID NO.1, NCBI gene number: NZ_CP043852.1:364930-366096) as the object, six sequences with different mutation sites were simulated by the molecular docking method, namely: sucCDL17S, sucCDS36P, sucCDG53A, sucCDA125, sucCDL223P, sucCDF286S. These mutant proteins will reduce the enzyme catalytic ability to a certain extent while retaining part of the protein activity. The simulated gene sequences were sent to General Biosystems for gene synthesis and constructed into the plasmid pET28a to obtain plasmids pET28a-sucCD1, pET28a-sucCD2, pET28a-sucCD3, pET28a-sucCD4, pET28a-sucCD5 and pET28a-sucCD6 respectively, where each plasmid serial number corresponds to the above-mentioned sucCD mutation site.

[0041] (2) Amplify the sucCD fragment

[0042] Obtaining the sucCD fragment: Using suc-F / suc-R as primers and Sval024 as the template, perform PCR amplification (2036bp is positive). PCR reaction system: 25 μL of KOD enzyme, 1 μL each of suc-F / suc-R, 1 μL of template DNA, 22 μL of ddH2O. PCR reaction program: 95°C for 5 min; 98°C for 10 s, 58°C for 5 s, 68°C for 20 s, 35 cycles; 72°C for 10 min. After electrophoresis verification, the positive amplicon was purified using a DNA product purification kit to obtain the fragment sucCD.

[0043] (3) Linearize the pET28a plasmid

[0044] Using pET28a-xian-F / pET28a-xian-R as primers and the pET28a plasmid as the template, perform PCR amplification (5362bp is positive). PCR reaction system: 25 μL of KOD enzyme, 1 μL each of pET28a-xian-F / pET28a-xian-R, 1 μL of the pET28a plasmid, 22 μL of ddH2O. PCR reaction program: 95°C for 5 min; 98°C for 10 s, 58°C for 5 s, 68°C for 30 s, 35 cycles; 72°C for 10 min. Use DpnⅠ enzyme to digest the original pET28a plasmid template and use a DNA product purification kit to purify the PCR product to obtain the linearized pET28a fragment.

[0045] (4) Cloning and identification of the target gene

[0046] The seamless ligation of the sucCD fragment and the linearized pET28a fragment was carried out using the Novoprotein recombination kit. 10 μL of the ligation product was transformed into DH5α competent cells and spread on a kanamycin plate, and cultured overnight at 37°C in an inverted position. Using pET28a-seq-F / pET28a-seq-R as primers and single colonies as templates, colony PCR amplification was performed (2500 bp was considered positive). PCR reaction system: 10 μL of the verification enzyme 2×Rapid Taq Master Mix, 1 μL each of pET28a-seq-F / pET28a-seq-R, and 8 μL of ddH2O. PCR reaction program: 95°C for 5 min; 95°C for 15 s, 58°C for 15 s, 72°C for 45 s, for 35 cycles; 72°C for 10 min. After electrophoresis verification, the recombinant plasmid pET28a-sucCD was obtained. The above recombinant plasmid and the gene synthesis plasmids pET28a-sucCD1, pET28a-sucCD2, pET28a-sucCD3, pET28a-sucCD4, pET28a-sucCD5, and pET28a-sucCD6 were respectively transformed into the BL21 expression strain, spread on a kanamycin-resistant plate, and cultured overnight at 37°C in an inverted position to obtain recombinant clones.

[0047] (5) Recombinant plasmid expression

[0048] The recombinant clones obtained in (4) were inoculated into 5 mL of LB medium containing kanamycin and cultured overnight at 37°C with 200 rpm. Then, they were inoculated into 100 mL of LB medium at an inoculation amount of 1%, supplemented with kanamycin antibiotic at a final concentration of 50 mg / L, and cultured at 37°C until the OD600 of the bacteria reached 0.6 - 1.0. IPTG was added at a final concentration of 0.4 mM, and induction was carried out at 18°C for 16 - 20 h.

[0049] (6) Recombinant protein purification

[0050] The induced bacterial liquid in (5) was centrifuged (centrifugation temperature: 4°C, rotation speed: 10000 rpm, time: 5 min) to collect the bacteria. Then, the collected bacterial precipitate was resuspended in Lysis Buffer at a ratio of 40:3 and supplemented with phenylmethylsulfonyl fluoride solution (PMSF) to a final concentration of 1 mM (adding 100 mM PMSF isopropanol mother liquor). Subsequently, an ultrasonic cell disruptor was used to break the cells on ice. The cell lysate was centrifuged at 4°C and 10000 rpm for 30 min to obtain the supernatant and precipitate of the cell lysate.

[0051] The nickel column (Cytiva, 5 mL) was loaded onto an AKTA protein purifier and equilibrated with Lysis Buffer at a flow rate of 2 mL / min. After the nickel column was equilibrated (about 10 column volumes), the supernatant of the cell lysate was passed through the nickel column at a flow rate of 1 mL / min using the AKTA system, and His-sucCD, His-sucCD1, His-sucCD2, His-sucCD3, His-sucCD4, His-sucCD5, and His-sucCD6 were captured by the nickel column. After all the supernatant had entered the AKTA system, the nickel column was rinsed with Washing Buffer until the UV absorption recorded by AKTA was roughly stable. Subsequently, the target proteins in the nickel column were eluted with Elution Buffer to obtain 7 purified proteins - His-sucCD, His-sucCD1, His-sucCD2, His-sucCD3, His-sucCD4, His-sucCD5, and His-sucCD6.

[0052] Table 3 Formulas of Reagents Required for Protein Purification

[0053] Reagent Name Lysis Buffer Washing Buffer Elution Buffer Tris-HCl 25 mM 25 mM 25 mM NaCl 500 mM 500 mM 150 mM Imidazole 10 mM 25 mM 300 mM pH 8.0 8.0 8.0

[0054] (7) SDS-PAGE Verification

[0055] 40 μL of the supernatant, precipitate (resuspended in 10% Lysis Buffer), and purified product after centrifugation were taken respectively, 10 μL of 5× protein electrophoresis buffer was added, mixed well, and boiled in a water bath for 5 min. 10 μL of the sample was subjected to 12% SDS-PAGE, and there were protein bands near 41.4 kDa and 29.8 kDa respectively.

[0056] (8) Enzyme Activity Detection

[0057] The thioester bond of succinyl coenzyme A has an absorption peak at 230 nm. Based on this principle, the activity of the recombinant protein was determined. First, 4 kinds of protein reaction substrate stock solutions were prepared, 10 g / L succinic acid, 0.1 g / L coenzyme A, 0.1 g / L ATP-tris (pH 7.2), and 10 g / L magnesium chloride solution. 10 mL of the reaction solution included 5 mg of the recombinant protein, 50 μL of sodium succinate, 50 μL of coenzyme A, 50 μL of ATP-tris (pH 7.2), 50 μL of magnesium chloride, and the rest was made up to 10 mL with Lysis Buffer. After mixing, the reaction was carried out at 25 °C. 2, 5, 10, 15, and 30 minutes of the reaction solution were taken respectively and detected with a UV spectrophotometer at a measurement wavelength of 230 nm. Lysis Buffer was used to replace the enzyme solution as a blank control. The results of the generation of succinyl coenzyme A over time are as Figure 2 shown.

[0058] From the perspective of succinyl-CoA production, the catalytic abilities of all 6 mutant enzymes were reduced, but not completely inhibited, which was consistent with the results required by the present invention. The reduction in enzyme activity would promote more carbon flux to flow towards the direction of L-valine production, and partial catalytic ability was retained to ensure the normal growth of the strain.

[0059] Example 2. Obtaining of recombinant strains

[0060] (1) Construction of recombinant strains SS0 and AS0

[0061] In order to perform point mutations in the genome subsequently, a general chassis strain SS0 and AS0 were first constructed, that is, the mutant N20-1 was introduced into the genomes of chassis bacteria Sva1024 and ATCC 8739, and the integration method was the CRISPR-cas9 gene editing method. The specific operation method was as follows:

[0062] The first step was to construct the pTarget-sucC-N20 plasmid.

[0063] sucC N20 was designed using the CHOPCHOP online website, and the sequence was shown in Sequence 2. Using the pTarget (Li Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai). 2021 Apr 15; 53(5): 620-627. doi: 10.1093 / abbs / gmab036. PMID: 33764372.) vector as a template and sucC-N20-F / sucC-N20-R as primers, PCR amplification was carried out. The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 1.5 min, repeated for 35 cycles; continue to extend at 72°C for 10 min. After treating the PCR product with DpnI at 37°C for 1 h, it was transformed into E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, cultured at 37°C for 12 h, randomly picked single colonies were transferred to an LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, cultured at 37°C for 12 h, the bacterial cells were collected and the plasmid was extracted to obtain the pTarget-sucC-N20 vector.

[0064] The second step was to construct the overlapping fragment UsucC-sucC N20-1-DsucC.

[0065] Using the Sva1024 genome as a template, primers sucC-F1 / primer sucC-R1 and primer sucC-F2 / primer sucC-R2 were used respectively for PCR amplification. The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 1 min, repeated for 35 cycles; continued extension at 72°C for 10 min. The PCR products were subjected to gel recovery to obtain fragment UsucC (555 bp as positive) and fragment sucCN20-1-DsucC (1254 bp as positive).

[0066] Primers sucC-F1 and primer sucC-R2 were used for fusion PCR of the above fragments UsucC and sucCN20-1-DsucC. The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 1.5 min, repeated for 30 cycles; continued extension at 72°C for 10 min. The PCR products were subjected to gel recovery to obtain the overlapping fragment UsucC-sucCN20-1-DsucC (1809 bp as positive).

[0067] Step 3: Construct the pTarget-sucC vector

[0068] The above pTarget-sucC-N20 vector and the overlapping fragment UsucC-sucCN20-1-DsucC were subjected to one-step cloning. The reaction program was: 37°C for 30 min. The cloning products were transformed into E. coli DH5α recipient bacteria and spread on an LB solid plate containing 50 mg / L spectinomycin hydrochloride resistance at 37°C for 12 h. Single colonies were randomly picked and transferred to an LB liquid medium containing 50 mg / L spectinomycin hydrochloride resistance at 37°C for 12 h. The bacterial cells were collected and plasmids were extracted to obtain the pTarget-sucC vector.

[0069] Step 4: Obtain recombinant strains SS0 and AS0

[0070] The above pTarget-sucC vector was electrotransformed into Sva1024 and ATCC 8739 strains containing the pEccas vector (Li Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai). 2021 Apr 15;53(5):620-627. doi: 10.1093 / abbs / gmab036. PMID: 33764372.), and the operating steps are as follows:

[0071] Electroporation: The Sva1024 and ATCC 8739 strains transformed with the pEccas vector were cultured in LB medium containing 50 mg / L kanamycin and 10 mM L-arabinose at 37 °C until the OD600 reached 0.6, and the bacterial solution was centrifuged to obtain the bacterial cells. The bacterial cells were washed twice with 10% glycerol for use. Electroporation was carried out at 2.5 KV.

[0072] Plasmid curing: The electrotransformed bacterial solution was spread on an LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and cultured overnight at 37 °C. Single colonies were picked as templates, and PCR amplification was performed with primer suc-seq-F1500 and primer suc-seq-R (1500 bp was positive). The strains with correct verification were inoculated in LB medium containing 50 mg / L kanamycin and 10 mM rhamnose, and cultured overnight at 37 °C to remove the pTarget-sucC vector. Then the strains with the pTarget-sucC vector removed were inoculated in LB medium containing 10 g / L sucrose to remove the pEccas vector, and the recombinant strains SS0 and AS0 could be obtained.

[0073] (2) Construction of recombinant strains SS1, SS2, SS3, SS4, SS5, SS6, AS1, AS2, AS3, AS4, AS5, AS6

[0074] First step, construction of the pTarget-S-N20-1 vector

[0075] Using the pTarget vector as a template, PCR amplification was performed with primer S-N20-F and primer S-N20-R. After treating the PCR product with Dpn I at 37°C for 1 h, it was transformed into E. coli DH5α recipient bacteria and spread on an LB solid plate containing 50 mg / L spectinomycin hydrochloride resistance at a final concentration. The plate was incubated at 37°C for 12 h. Single colonies were randomly picked and transferred to an LB liquid medium containing 50 mg / L spectinomycin hydrochloride resistance at a final concentration, and cultured at 37°C for 12 h. The bacteria were collected and plasmids were extracted to obtain the pTarget-S-N20-1 vector.

[0076] Step 2: Construct the pTarget-S vector

[0077] Using plasmids pET28a-sucCD1, pET28a-sucCD2, pET28a-sucCD3, pET28a-sucCD4, pET28a-sucCD5, and pET28a-sucCD6 as templates respectively, PCR amplification was carried out with primer sucC-F1 and primer sucC-R2. The products were gel-extracted to obtain S1, S2, S3, S4, S5, and S6 fragments (1809 bp was positive). The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 2 min, repeated for 35 cycles; continued extension at 72°C for 10 min.

[0078] The pTarget-S-N20-1 vector and fragments S1, S2, S3, S4, S5, and S6 were respectively subjected to one-step cloning, and the reaction program was: 37°C for 30 min. The cloning products were transformed into E. coli DH5α recipient bacteria and spread on an LB solid plate containing 50 mg / L spectinomycin hydrochloride resistance at a final concentration. The plate was incubated at 37°C for 12 h. Single colonies were randomly picked and transferred to an LB liquid medium containing 50 mg / L spectinomycin hydrochloride resistance at a final concentration, and cultured at 37°C for 12 h. The bacteria were collected and plasmids were extracted to obtain pTarget-S1, pTarget-S2, pTarget-S3, pTarget-S4, pTarget-S5, and pTarget-S6 vectors.

[0079] Step 3: Obtain recombinant strains SS1, SS2, SS3, SS4, SS5, SS6, AS1, AS2, AS3, AS4, AS5, and AS6

[0080] The pTarget-S1, pTarget-S2, pTarget-S3, pTarget-S4, pTarget-S5, and pTarget-S6 vectors were respectively electrotransformed into SS0 and AS0 strains containing the pEccas vector, and the electrotransformation steps were the same as those described in (1).

[0081] The electro-transformed bacterial solution was spread onto an LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and cultured overnight at 37°C. Single colonies were picked as templates, and PCR amplification was performed using primer S-seq-F1500 and primer suc-seq-R (1500 bp was positive). Subsequently, plasmid elimination was carried out as described in (1), and recombinant strains SS1, SS2, SS3, SS4, SS5, SS6, AS1, AS2, AS3, AS4, AS5, and AS6 could be obtained.

[0082] Example 3. Fermentation detection of 12 mutant strains, the original strain Sva1024, and the wild-type strain ATCC 8739

[0083] Fermentation experiments were conducted on the chassis bacterium Sva1024, the wild-type bacterium ATCC 8739, and the strains constructed in Example 2 above (SS1, SS2, SS3, SS4, SS5, SS6, AS1, AS2, AS3, AS4, AS5, AS6) in a fermenter to compare the effects of different mutation sites of the sucC gene on the ability to produce L-valine. The fermentation experiment was carried out according to the following protocol:

[0084] (1) Seed culture: Fresh clones on the LB plate were inoculated into a test tube containing 4 mL of seed medium and cultured overnight at 37°C with shaking at 250 rpm. Then, the culture was transferred to a 250 mL Erlenmeyer flask containing 30 mL of seed medium at an inoculation amount of 2% (V / V) and cultured with shaking at 37°C and 250 rpm for 12 hours to obtain a seed culture solution for inoculating the fermentation medium.

[0085] (2) Fermentation culture: The volume of the fermentation medium in a 500 mL anaerobic jar was 250 mL. The seed culture solution was inoculated into the fermentation medium at an inoculation amount with a final OD550 of 0.1, and fermented at 37°C and 150 rpm for 4 days to obtain a fermentation broth. The neutralizing agent was 5 M ammonia water to control the pH of the fermenter at 7.0, and no gas was introduced during the culture process.

[0086] 1 mL of the fermentation broth was taken from the fermenter, centrifuged at 12000 rpm for 1 min, and the supernatant was taken. After passing through a filter membrane (pore size 0.22 μm), the content of L-valine in the fermentation broth was analyzed by HPLC, and finally the amount of L-valine obtained by each strain was compared. The results are as Figure 3 shown.

[0087] Detection was performed using an Agilent high performance liquid chromatograph: The chromatographic column was Welch Ultimate HILIC Amphion II, and the mobile phase: organic phase was pure acetonitrile; the aqueous phase was 0.05 M potassium dihydrogen phosphate with pH 3.0 (preparation method: weigh the corresponding mass of potassium dihydrogen phosphate at 0.05 M concentration and dissolve it in ultrapure water, adjust the pH to 3.0 with phosphoric acid, after filtration, add the corresponding volume of acetonitrile according to the ratio of acetonitrile: 0.05 M potassium dihydrogen phosphate = 75:25, mix well and ultrasonically remove bubbles). The set parameters were detection wavelength 206 nm, injection volume 10 μL, flow rate 1 mL / min, and detection time 20 min.

[0088] It can be seen from Figure 3 and Figure 4 that mutations at 6 different sites all increased the L-valine production. After 4 days of fermentation by the initial strain Sva1024, the valine production reached 1.3 g / L. After point mutation, the highest production increase was in the SS3 strain, reaching 1.61 g / L, an increase of 23.8%. The same improvement effect was observed for the genetic modification of the wild strain, with the L-valine accumulation increasing from 0 to 0.11 g / L. The fermentation results show that this method has wide applicability and effectiveness for metabolites in a competitive relationship with the TCA cycle, laying a certain foundation for subsequent related metabolic engineering.

[0089] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A sucC mutant, characterized in that The amino acid corresponding to the wild type of sucC is subjected to L17S mutation; the amino acid sequence of the wild type of sucC is encoded by the nucleotide sequence shown in SEQ ID NO.

1.

2. The nucleic acid encoding the sucC mutant according to claim 1.

3. A recombinant expression vector containing the encoding nucleic acid as claimed in claim 2.

4. A recombinant bacterium containing the recombinant expression vector according to claim 3, wherein the wild-type sucC in the recombinant bacterium is replaced by the sucC mutant according to claim 1, and the recombinant bacterium is Escherichia coli.

5. Use of the sucC mutant according to claim 1, the encoding nucleic acid according to claim 2, the recombinant expression vector according to claim 3 or the recombinant bacterium according to claim 4 in the preparation of L-valine.

6. An L-valine producing strain, characterized in that Obtained by the following method: S1: constructing a universal chassis strain for each of the initial Escherichia coli, specifically performing a 20 bp specific site mutation on the sucC gene to obtain the first modified strain; S2: using the encoding nucleic acid as described in claim 2 to perform corresponding point mutation and 20 bp specific site reversion mutation on the sucC gene in the first transformed strain, to obtain a second transformed L-valine producing strain.

7. The L-valine producing strain according to claim 6, characterized in that The initial Escherichia coli is wild Escherichia coli, or Escherichia coli capable of producing L-valine.

8. A method for preparing L-valine, characterized in that, The method comprises the step of fermenting and culturing the recombinant bacteria as claimed in claim 6 to obtain L-valine.

9. The method according to claim 8, characterized in that The fermentation culture is anaerobic fermentation culture.

Images