A method for purifying a type a botulinum recombinant
By employing a combined purification method involving cell disruption, flocculation clarification, ion chromatography, thrombin digestion, hydrophobic chromatography, and molecular sieve chromatography, the problems of complex preparation processes and low purity of BoNT/A were solved, achieving efficient and safe purification of BoNT/A while maintaining the integrity of the protein.
Patent Information
- Application Number
- CN202410292943.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-14
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2044-03-14
AI Technical Summary
The existing technology for preparing BoNT/A involves complex processes, long procedures, low purity, and potential safety risks in drug use.
A novel purification method is employed, comprising steps including cell disruption, flocculation clarification, ion chromatography, thrombin digestion, hydrophobic chromatography, ultrafiltration concentration, and molecular sieve chromatography. By combining the flocculant PDADMAC, ion chromatography columns, hydrophobic chromatography columns, and molecular sieve chromatography columns, highly efficient purification of BoNT/A is achieved.
It effectively removes impurity proteins, maintains the integrity of light and heavy chains, and has 100% amino acid sequence coverage, thus improving the purity and safety of BoNT/A.
Smart Images

Figure CN118126144B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a purification method of a type A recombinant botulinum neurotoxin. BACKGROUND
[0002] Botulinum neurotoxin (BoNT) is a neurotoxin produced by anaerobic Clostridium botulinum, and is one of the most toxic substances known in the world. There are seven types of serotypes of botulinum neurotoxin (A-G), among which the most common is type A, which is referred to as Botulinum neurotoxin of type A (BoNT / A). A number of studies have shown that BoNT / A has a wide range of application prospects, and has good application in medical cosmetology, various muscle tension disorders, hyperhidrosis, pain and other difficult and miscellaneous diseases.
[0003] The structure of BoNT / A is divided into two parts: a light chain (LC, 50 kD) and a heavy chain (HC, 100 kD). The light chain and the heavy chain are linked by a pair of disulfide bonds (C430-C454) and non-amide bonds. The light chain is the active domain and has zinc-dependent metal endopeptidase activity, which is the toxic part of the toxin; the heavy chain contains two domains, a binding domain and a translocation domain. The carboxylic acid end of the heavy chain domain binds to the polysialic acid ganglioside receptor on the presynaptic membrane. BoNT / A binds to the synaptic vesicle (SV2) protein receptor, and then endocytoses BONT into the synaptic vesicle involving adenosine triphosphatase (ATPase) proton pump. After the LC enters the cytoplasm by crossing the synaptic vesicle membrane, it is released from the heavy chain and cleaves the interchain disulfide bond.
[0004] Chinese patent application CN114945582A discloses a method for purifying botulinum toxin compositions obtained from cell culture, which is based on a series of filtration and chromatographic separation steps to produce a high-purity botulinum toxin composition comprising botulinum toxin protein molecules in solution, which is free, substantially free, or essentially free of botulinum toxin complexes and animal products, and does not require the botulinum toxin protein molecules to be precipitated or lyophilized. The method is too cumbersome and requires three filtrations and four chromatographic separations.
[0005] Chinese patent application CN113056478A discloses a method for producing botulinum toxin, which comprises: (A) producing botulinum toxin from a botulinum toxin-producing bacterium in a culture medium to obtain a mixture a containing a bacterial component and a nucleic acid component derived from the botulinum toxin; (B) removing the bacterial component from the mixture a to obtain a mixture b containing the nucleic acid component and the botulinum toxin; (C) adding an endonuclease to the mixture b to obtain a mixture c containing a nucleic acid decomposer and the botulinum toxin; and (D) removing the nucleic acid decomposer from the mixture c to obtain a botulinum toxin separation solution d. This method needs to add the endonuclease multiple times, which may exist as residues, and there is a great risk of drug safety.
[0006] In the traditional method for preparing BoNT / A, there are defects such as complicated preparation process, long preparation process, low purity, and drug safety. SUMMARY
[0007] In order to avoid the safety risks caused by Clostridium botulinum and obtain BoNT / A protein without sequence heterogeneity with correct higher structure, the present application provides a new method for purifying BoNT / A protein.
[0008] In order to achieve the above technical purpose, the present application provides the following technical scheme:
[0009] In one aspect, the present application provides a method for purifying type A recombinant botulinum toxin, which comprises the following steps:
[0010] (1) collecting a fermentation broth, crushing the bacterial cells to obtain a crushed liquid;
[0011] (2) adding a flocculating agent to the crushed liquid for clarification, and then centrifuging to remove impurities to obtain a clarified liquid;
[0012] (3) adding the clarified liquid to an ion chromatography column for ion chromatography to obtain an ion chromatography liquid;
[0013] (4) adding thrombin to the ion chromatography liquid for enzymatic cutting to obtain an enzyme cutting liquid;
[0014] (5) adding the enzyme cutting liquid to a hydrophobic chromatography column for hydrophobic chromatography to obtain a hydrophobic chromatography liquid;
[0015] (6) performing ultrafiltration concentration on the hydrophobic chromatography liquid to obtain an ultrafiltration concentrated liquid;
[0016] (7) adding the ultrafiltration concentrated liquid to a molecular sieve chromatography column for molecular sieve chromatography to obtain purified type A recombinant botulinum toxin.
[0017] In some embodiments, the type A recombinant botulinum toxin can be a modified (mutated) recombinant botulinum toxin.
[0018] In some embodiments, the type A recombinant botulinum toxin has an amino acid sequence as set forth in SEQ ID NO: 1.
[0019] SEQ ID NO: 1:
[0020]
[0021] In some embodiments, the nucleotide sequence encoding the type A recombinant botulinum toxin is set forth in SEQ ID NO: 2.
[0022] SEQ ID NO: 2:
[0023]
[0024] AAGATAATTTCACCAACGATCTGAACAAAGGCGAAGAAATTACCAGCGATACCAATAT
[0025] TGAAGCAGCCGAAGAAAACATTAGCCTGGATCTGATTCAGCAGTATTATCTGACCTTC
[0026] AACTTCGATAATGAGCCGGAAAATATCAGCATTGAAAACCTGAGCAGCGATATTATTG
[0027] GCCAGCTGGAACTGATGCCGAATATTGAACGTTTTCCGAACGGCAAAAAGTACGAGCT
[0028] GGATAAATACACCATGTTCCATTATCTGCGTGCCCAAGAATTTGAACATGGTAAAAGC
[0029] CGTATTGCACTGACCAATAGCGTTAATGAAGCACTGCTGAACCCGAGCCGTGTTTATAC
[0030] CTTTTTCAGCAGCGATTATGTGAAGAAGGTTAACAAAGCAACCGAAGCAGCAATGTTT
[0031] TTAGGTTGGGTTGAACAGCTGGTGTATGATTTCACCGATGAAACCAGCGAAGTTAGCA
[0032] CCACCGATAAAATTGCAGATATTACCATCATCATCCCGTATATCGGTCCGGCACTGAAT
[0033] ATTGGCAATATGCTGTATAAAGACGATTTTGTGGGTGCCCTGATTTTTAGCGGTGCAGT
[0034] TATTCTGCTGGAATTTATTCCGGAAATTGCCATTCCGGTTCTGGGCACCTTTGCACTGGT
[0035] GAGCTATATT GCAAATAAAG TTCTGACCGT GCAGACCATC GATAATGCA CTGAGCAAAT
[0036] CGTAACGAAA AATGGGATGA AGTGTACAAG TATATCGTGA CCAATTGGCT GGCAAAAG
[0037] TTAACACCCA GATTGATCTG ATCCGTAAAA AGATGAAAGA AGCCCTGGAA AATCAGGC
[0038] AGAAGCAACC AAAGCCATTA TCAACTATCA GTATAACCAG TACACCGAGG AAGAGAA
[0039] GAATAACATC AACTTCAACA TCATGATCTG AGCAGCAAGC TGAATGAAAG CATCAAC
[0040] AAAGCCATGA TTAACATTA ACAAATTTCT GAACCAGTGC AGCGTGAGCT ATCTGATGA
[0041] ATAGCATGA TTCCGTATGG TGTGAAACGT CTGGAAGATT TTGATGCAAG CCTGAAAGA
[0042] TGCTCTGCTG AAATATATCT ATGATAATCG TGGCACCCTG ATTGGTCAGG TTGATCGTC
[0043] TGAAAGATAA GGTGAATAAT ACCCTGAGTA CCGATATTCCT TTTCAGCTGA GCAAATA
[0044] TGTGGATAAT CAGCGTCTGC TGTCAACCTT TACCGAATAC ATTAAGAACA TCATCAACA
[0045] CCAGCATTCT GAACCTGCGT TATGAAAGCA ATCATCTGAT CGATCTGTCT CGCTATGCA
[0046] AGCAAAATCA ATATAGGCAG CAAGGTCAAC TTTGACCCGA TTGACAAAAA TCAGATAC
[0047] AGCTGTTTAATCTGGAAAGCAGCAAAATCGAAGTGATCCTGAAAAACGCCATTGTGTA
[0048] TAACAGCATGTATGAGAATTTCTCGACCAGCTTTTGGATTCGCATTCCGAAATACTTTA
[0049] ATAGCATCAGCCTGAACAACGAGTACACCATTATTAACTGCATGGAAAACAATAGCGG
[0050] CTGGAAAGTTAGCCTGAATTATGGTGAGATTATTTGGACCCTGCAGGATACCCAAGAA
[0051] ATCAAACAGCGTGTGGTTTTCAAATACAGCCAGATGATTAATATCAGCGACTATATCA
[0052] ACCGCTGGATTTTTGTGACCATTACCAATAATCGCCTGAATAACAGCAAGATCTATATT
[0053] AACGGTCGCCTGATTGATCAGAAACCGATTAGTAATCTGGGCAATATTCATGCGAGCA
[0054] ACAACATCATGTTTAAACTGGATGGTTGTCGTGATACCCATCGTTATATTTGGATCAAG
[0055] TACTTCAACCTGTTCGATAAAGAGCTGAACGAAAAAGAAATTAAAGATCTGTATGATA
[0056] ACCAGAGCAACAGCGGTATTCTGAAAGACTTTTGGGGAGATTATCTGCAGTATGACAA
[0057] ACCGTATTATATGCTGAACCTGTACGACCCGAACAAATATGTTGATGTGAATAATGTG
[0058] GGCATCCGTGGCTATATGTACCTGAAAGGTCCGCGTGGCAGCGTTATGACCACAAACA
[0059] TTTATCTGAATAGCAGCCTGTATCGCGGTACGAAATTTATCATTAAAAAGTATGCCAGC
[0060] GGCAACAAAGATAACATTGTGCGTAATAATGATCGCGTGTATATCAATGTGGTGGTGA
[0061] AGAATAAAGAATATCGTCTGGCAACCAATGCAAGCCAGGCAGGCGTTGAGAAAATTCT
[0062] GAGCGCACTGGAAATTCCGGATGTGGGTAATCTGAGCCAGGTTGTTGTGATGAAAAGC
[0063] AAAAATGATCAGGGCATCACCAACAAGTGCAAAATGAATCTGCAGGACAATAACGGC
[0064] AACGATATTGGTTTTATTGGCTTCCACCAGTTCAACAATATTGCGAAACTGGTTGCAAG
[0065] CAATTGGTATAATCGTCAGATTGAACGTAGCAGTCGTACCCTGGGTTGTAGCTGGGAATTTATCCCTGTGGATGATGGTTGGGGTGAACGTCCGCTGTAA.
[0066] In some embodiments, the flocculating agent in step (2) comprises an inorganic flocculating agent, an organic flocculating agent, or a natural polymer flocculating agent.
[0067] In some embodiments, the inorganic flocculating agent comprises, but is not limited to, calcium chloride, disodium hydrogen phosphate, sodium phosphate, aluminum sulfate, potassium aluminum sulfate, aluminum ammonium sulfate, polyaluminum chloride, ferrous sulfate, polyferric sulfate, or ferric chloride.
[0068] In some embodiments, the natural polymer flocculating agent comprises, but is not limited to, chitosan, sodium alginate, guar gum, or natural xanthan gum.
[0069] In some embodiments, the organic flocculating agent comprises, but is not limited to, polyacrylamide, sodium polyacrylate, sulfomethylated polyacrylamide, polyethylene oxide, condensed urea-formaldehyde resin, or polydimethyl diallyl ammonium chloride (PDADMAC).
[0070] In some preferred embodiments, the flocculant is PDADMAC.
[0071] The present application found that PDADMAC has better flocculation effect, is easy to remove by centrifugation, and the turbidity of the supernatant after centrifugation is less than 100 NTU, through screening of flocculants.
[0072] In some embodiments, the ion exchange column in step (3) includes, but is not limited to, GE Capto SP, Cytiva Capto Phenyl ImpRes, MaXtar SP HR (from Biaolink), Diamond SP Mustang (Borglun), IexCap SP 6FF (Tianreirenhe), etc.
[0073] The person skilled in the art can select ion exchange columns or ion exchange fillers with similar properties or materials as needed.
[0074] In some embodiments, the ion exchange in step (3) further includes the following steps:
[0075] NaCl solution is added to the clarified liquid until the concentration of NaCl in the clarified liquid is 0.07-0.10 mol / L, preferably 0.08 mol / L.
[0076] The present application unexpectedly found that adding an appropriate amount of NaCl to the feed liquid for purification will result in fewer impurities in the eluted sample, resulting in a higher purity of the sample.
[0077] In some embodiments, the buffer for ion exchange in step (3) is 20 mM Tris-HCl, pH 8.0;
[0078] and / or, the eluent for ion exchange in step (3) is 20 mM Tris-HCl, 1 mol / L NaCl, pH 8.0.
[0079] In some embodiments, the hydrophobic chromatography column in step (5) includes, but is not limited to, Phenyl Chromstar HP (Biaolink), GE Capto Phenyl ImpRes, Phenyl Bestarose HP (Biaolink), Phenyl Bestarose HP (Borglun), Phenyl Beads 6FF (High Sub) (Tianreirenhe), etc.
[0080] The person skilled in the art can select hydrophobic chromatography columns or hydrophobic chromatography fillers with similar properties or materials as needed.
[0081] In some embodiments, the hydrophobic chromatography in step (5) further comprises the following steps:
[0082] After adding (NH4)2SO4 to 1 mol / L to the enzyme-digested solution, the pH is adjusted to 7.0.
[0083] In some embodiments, the equilibration buffer for the hydrophobic chromatography in step (5) is 20 mM Tris-HCl, 1 mol (NH4)2SO4, pH 7.0;
[0084] and / or 20 mM Tris-HCl, pH 7.0.
[0085] In some embodiments, the ultrafiltration and concentration in step (6) uses an ultrafiltration membrane package, preferably a 30 KD ultrafiltration membrane package.
[0086] In some embodiments, the protein concentration of the ultrafiltration and concentration solution is 0.8-1.2 mg / mL.
[0087] In some embodiments, the molecular sieve chromatography column in step (7) includes, but is not limited to, HiLoad Superdex 200 pg, HiLoad Superdex 75 pg, HiLoad Superdex 6 pg, Superdex TM 30 prep grade or HiPrep Sephacryl S-100HR.
[0088] The molecular sieve chromatography column or the molecular sieve chromatography filler with similar performance or material can be selected by those skilled in the art as needed.
[0089] In some preferred embodiments, the molecular sieve chromatography column in step (7) is HiLoad Superdex 200 pg.
[0090] In some embodiments, the eluent for the molecular sieve chromatography in step (7) is PBS, pH 7.4.
[0091] In another aspect, the present application provides a type A recombinant botulinum toxin purified by any of the foregoing methods.
[0092] The botulinum toxin of the present application can be used in the form of a salt, preferably, in the form of a pharmaceutically acceptable salt. Preferably, the salt is an acid addition salt formed by a pharmaceutically acceptable free acid, which can use an organic acid and an inorganic acid. The organic acid includes citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanosulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, and aspartic acid, but is not limited thereto. Also, the inorganic acid includes hydrochloric acid, bromic acid, sulfuric acid, and phosphoric acid, but is not limited thereto.
[0093] In still another aspect, the present application provides use of the aforementioned botulinum toxin of type A in the preparation of a medicament for preventing and / or treating a neurological disease.
[0094] The neurological condition of the present application can be a cranial nerve disorder, blepharospasm, strabismus, hyperhidrosis, torticollis, neck pain, infantile paralysis, facial spasm, epigenetic neuropathic pain, diabetic neuropathic pain, complex regional pain syndrome, trigeminal neuralgia, phantom limb pain, spinal cord injury-induced neuropathic pain, and post-central stroke pain, and can also be a veterinary neurological condition.
[0095] In some embodiments, the neurological disease includes, but is not limited to, blepharospasm, hemifacial spasm, or dystonia.
[0096] In some embodiments, the medicament further includes at least one pharmaceutically acceptable excipient.
[0097] In some embodiments, the pharmaceutically acceptable excipient includes, but is not limited to, a solvent, a diluent, a disintegrant, a precipitation inhibitor, a surfactant, a glidant, a binder, a lubricant, a dispersant, a suspending agent, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, a stabilizer, a hydrating agent, an emulsification accelerator, a buffer, an absorbent, a coloring agent, a flavoring agent, a sweetening agent, an ion exchanger, a release agent, a coating agent, a flavoring agent, or an antioxidant.
[0098] In the present application, unless otherwise specified, the administration method of the medicament or the pharmaceutical composition is not particularly limited, and can be administered by subcutaneous injection, intravenous injection, oral administration, application, respiratory inhalation, topical administration, sublingual administration, etc., and the administration method can be selected by a physician according to the clinical actual needs.
[0099] In some embodiments, the dosage form of the medicament includes a needle injection, an oral solution, a tablet, a capsule, a dripping pill, a spray, an inhalant, etc.
[0100] Those skilled in the art should know that the selection of the dosage form of the medicament should be matched with the administration method.
[0101] In yet another aspect, the present application provides use of the aforementioned botulinum toxin type A in the preparation of a medical aesthetic product.
[0102] In some embodiments, the medical aesthetic product can be an injectable medical aesthetic product.
[0103] In some embodiments, the medical aesthetic product further comprises at least one physiologically acceptable carrier or excipient.
[0104] In some embodiments, the physiologically acceptable carrier or excipient includes, but is not limited to, a pH adjusting agent, a surfactant, an adjuvant, an ionic strength enhancer, a diluent, an agent to maintain osmotic pressure, an agent to delay absorption, a preservative. For example, the pH adjusting agent includes, but is not limited to, a phosphate buffer. The surfactant includes, but is not limited to, a cationic, anionic or non-ionic surfactant, such as Tween-80. The ionic strength enhancer includes, but is not limited to, sodium chloride. The preservative includes, but is not limited to, various antibacterial agents and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. The agent to maintain osmotic pressure includes, but is not limited to, sugars, NaCl and the like. The agent to delay absorption includes, but is not limited to, monostearate and gelatin. The diluent includes, but is not limited to, water, aqueous buffer (such as buffered saline), alcohol and polyhydric alcohol (such as glycerol), etc. The preservative includes, but is not limited to, various antibacterial agents and antifungal agents, such as thiomersal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, sorbic acid, etc. The stabilizer has the meaning commonly understood by those skilled in the art, which is capable of stabilizing the desired activity of the active ingredient in the drug, including but not limited to sodium glutamate, gelatin, SPGA, sugars (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid, glycine), proteins (such as dried whey, albumin or casein) or their degradation products (such as lactalbumin hydrolysate), etc.
[0105] In yet another aspect, the present application provides a method for preventing and / or treating a neurological disease, the method comprising:
[0106] administering to a subject in need thereof a therapeutically effective amount of any of the aforementioned botulinum toxin type A.
[0107] The present application, through screening of purification steps and specific reagents, provides a method for purifying botulinum toxin type A, which can effectively remove impurity proteins compared with the prior art, and does not affect the integrity of the light chain and the heavy chain, with an amino acid sequence coverage of 100%. BRIEF DESCRIPTION OF DRAWINGS
[0108] Figure 1 The figure shows the profile of cation exchange chromatography.
[0109] Figure 2SDS PAGE results of the sample before cation exchange chromatography are shown.
[0110] Figure 3 SDS PAGE results of the sample after cation exchange chromatography are shown.
[0111] Figure 4 SDS PAGE results of the sample during thrombin digestion, and the sample after DTT addition during thrombin digestion are shown.
[0112] Figure 5 SDS PAGE results of the sample after hydrophobic chromatography are shown.
[0113] Figure 6 SDS PAGE results of the sample after molecular sieve chromatography, and the sample after DTT addition after molecular sieve chromatography are shown.
[0114] Figure 7 SEC-HPLC detection results of the sample before and after enzyme digestion are shown.
[0115] Figure 8 Capillary isoelectric focusing electrophoresis detection results of different batches of botulinum toxin type A are shown.
[0116] Figure 9 TIC spectrum of disulfide bond pairing analysis of the sample before and after enzyme digestion is shown.
[0117] Figure 10 N-terminal primary mass spectrum identification diagram (M1-K6) is shown.
[0118] Figure 11 N-terminal primary mass spectrum identification diagram of unmodified M Loss peptide segment is shown.
[0119] Figures 12-14 N-terminal primary mass spectrum identification diagram (Q7-K34) is shown.
[0120] Figure 15 N-terminal secondary mass spectrum identification diagram (M1-K6) is shown.
[0121] Figure 16 N-terminal secondary mass spectrum identification diagram of unmodified M Loss peptide segment is shown.
[0122] Figures 17-19 N-terminal secondary mass spectrum identification diagram (Q7-K34) is shown.
[0123] Figure 20 Three-channel peak range of the sample before enzyme digestion is shown.
[0124] Figure 21 Local magnification of the three-channel peak of the sample before enzyme digestion is shown.
[0125] Figure 22 Three channel peak molecular weight distribution plot of sample before enzyme digestion is shown.
[0126] Figure 23 Three channel peak cut-off range of sample after enzyme digestion is shown.
[0127] Figure 24 Three channel peak local zoom-in of sample after enzyme digestion is shown.
[0128] Figure 25 Three channel peak molecular weight distribution plot of sample after enzyme digestion is shown.
[0129] Figure 26 TUV / TIC zoom-in plot of purified botulinum toxin type A sample (full molecular weight detection) is shown.
[0130] Figure 27 Mass spectra plot of purified botulinum toxin type A sample (retention time 5.88 min) is shown.
[0131] Figure 28 Deconvoluted mass profile and stick plot of purified botulinum toxin type A sample (retention time 5.88 min) is shown.
[0132] Figure 29 TUV / TIC zoom-in plot of purified botulinum toxin type A sample (reduced molecular weight detection) is shown.
[0133] Figure 30 Mass spectra plot of purified botulinum toxin type A sample (retention time 5.28 min) is shown.
[0134] Figure 31 Mass spectra plot of purified botulinum toxin type A sample (retention time 6.05 min) is shown.
[0135] Figure 32 Deconvoluted mass profile and stick plot of purified botulinum toxin type A sample (retention time 5.28 min) is shown.
[0136] Figure 33 Deconvoluted mass profile and stick plot of purified botulinum toxin type A sample (retention time 6.05 min) is shown.
[0137] Figure 34 TIC plot of purified botulinum toxin type A sample after Trypsin digestion (peptides from light chain are labeled in red, peptides from heavy chain are labeled in green) is shown.
[0138] Figure 35 A TIC plot of a purified botulinum toxin type A sample after Trypsin digestion is shown.
[0139] Figure 36 A TIC plot of a purified botulinum toxin type A sample after Chymotrypsin digestion is shown.
[0140] Figure 37 A TIC plot of a purified botulinum toxin type A sample after Glu-C digestion is shown.
[0141] Figure 38 and Figure 39 A flocculation effect of PDADMAC solutions with different volume ratios is shown.
[0142] Figure 40 An effect of NaCl addition on cation exchange purification is shown.
[0143] Figure 41 An effect of elution concentration on hydrophobic interaction chromatography purification is shown. DETAILED DESCRIPTION
[0144] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The following definitions are applied to the descriptions and claims herein, and apply equally when used in the singular or plural forms, and also apply equally to any hyphenated versions of the terms.
[0145] As used herein, the recitation of one or more instances of a genus of elements shall be understood as including multiple instances of the genus, unless the context clearly indicates otherwise. For example, reference to “a cell” includes a plurality of such cells, and equivalents thereof as would be understood by those skilled in the art, and the like.
[0146] As used herein, the term “about” means a range of ±20% of the value that follows. In some embodiments, the term “about” means a range of ±10% of the value that follows. In some embodiments, the term “about” means a range of ±5% of the value that follows.
[0147] Numerical ranges as used herein are intended to include all numbers and ranges within the range. For example, a range of 1 to 20 is intended to include any number, combination, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0148] The terms "comprises" or "comprising" as used herein are meant to be open-ended, i.e., to include both the stated features and optional features. The terms "comprises" or "comprising" are meant to be interpreted not as "consists of and / or "consisting of and / or "consists essentially of and / or "consisting essentially of. In one embodiment, the term "comprising" as used throughout the specification and in claims, can be replaced by the term "consisting of.
[0149] The terms "optional", "any", "any of", or "any one of" as used herein means that the event or circumstance subsequently described can or can not occur, and the description includes instances where the event or circumstance occurs and instances where it does not. As used herein in the specification and in the claims, "a" and "an" can mean one or more than one.
[0150] The term "and / or", as used herein, should be understood to mean either one of the items in the list or any combination of the items in the list.
[0151] As used herein, "botulinum toxin" or "botulinum toxin" refers to a neurotoxin produced by Clostridium botulinum, as well as botulinum toxin (or light or heavy chain thereof) made recombinantly from non-Clostridial species. As used herein, "botulinum toxin" includes botulinum toxin serotypes A, B, C, D, E, F, and G. "Botulinum toxin" also encompasses "modified botulinum toxin".
[0152] As used herein, "modified botulinum toxin" or "mutated botulinum toxin" means a botulinum toxin in which at least one of the amino acids has been deleted, modified, or replaced as compared to a native botulinum toxin. In addition, a modified botulinum toxin can be a neurotoxin produced recombinantly, or a derivative or fragment of a neurotoxin made recombinantly. A modified botulinum toxin retains at least one biological activity of a native botulinum toxin, such as the ability to bind to a botulinum toxin receptor, or the ability to inhibit the release of a neurotransmitter from a neuron. One example of a modified botulinum toxin is a botulinum toxin having a light chain from one botulinum toxin serotype (e.g., serotype A) and a heavy chain from a different botulinum toxin serotype (e.g., serotype B). Thus, a modified botulinum toxin can include a light chain and a heavy chain from two different serotypes selected from any of serotypes A, B, C, D, E, F, or G. Another example of a modified botulinum toxin is a botulinum toxin conjugated to a neurotransmitter.
[0153] As used herein, "ultrafiltration" refers to a class of filtration that typically uses membrane pore sizes of about 0.1 pm to about 0.01 pm or smaller. Alternatively, nominal membrane pore sizes can be expressed in terms of molecular weight, for example, about 30 kDa and below to about 750 kDa and below, preferably 50 kDa and below or 30 kDa and below. It can refer to any technique in which a solution or suspension is subjected to a semipermeable membrane that retains macromolecules while allowing solvent and small solute molecules to pass. Ultrafiltration can be used to concentrate macromolecules (e.g., proteins such as BoNT / A) in a solution or suspension.
[0154] As used herein, "ion exchange chromatography" or "IEX" refers to a chromatographic separation technique that separates molecules based on their polarity and charge size (e.g., +2, +1, neutral, -1, -2, etc.). IEX retains analyte molecules (e.g., proteins) on a stationary phase according to the extent of coulombic interaction of the analyte molecules (e.g., proteins) with the stationary phase. The stationary phase surface displays ionic functional groups that ionically interact with oppositely charged analytes (e.g., botulinum toxins). To achieve electrical neutrality, these stationary phase charges interact with exchangeable counterions in the mobile phase. Analyte molecules compete for binding with these exchangeable counterions. Analyte molecules are retained or "eluted" according to their charge. Initially, molecules that do not bind or bind weakly to the stationary phase are washed away first.
[0155] As used herein, "elution" refers to the desorption of molecules bound to a stationary phase by changing the solution conditions within the chromatographic column. The concentration of exchangeable counterions can be increased, or the pH can be changed to affect analyte binding affinity. Molecules that lose affinity for the stationary phase and enter the mobile phase are "eluted" from the chromatographic column.
[0156] As used herein, "eluent" or "wash solution" refers to an agent, typically a solution, used to change the adsorption of analytes (e.g., botulinum toxin molecules) to a stationary phase and / or remove unbound material from the stationary phase. The elution properties of the eluent can depend on factors such as pH, ionic strength, and detergent strength.
[0157] As used herein, "eluate" or "elution" refers to a solution (e.g., a wash solution or buffer solution) containing unbound material, including "eluted" or desorbed analyte molecules (e.g., botulinum toxin molecules), that travels through a stationary phase and exits a column during a chromatographic separation.
[0158] As used herein, "gel filtration chromatography," "gel filtration," "molecular sieve," or "molecular sieve chromatography" means a size exclusion chromatography that can be used to separate a sample (e.g., proteins, protein complexes, polysaccharides, nucleic acids, small molecules, etc.) into fractions each having a specific size range. Alternatively, "gel filtration" can remove from a sample all molecules larger than a particular cutoff size. In a gel filtration chromatography column, the stationary phase includes a porous matrix (e.g., beads), and the mobile phase is a solution (e.g., a buffer solution) that flows around the matrix. The matrix can have a defined pore size range, referred to as the "fractionation range." Molecules and complexes that are too large to enter the pores are retained in the mobile phase and travel through the column with the buffer solution. Smaller molecules and complexes that can enter the pores enter the stationary phase and move through the gel filtration column with a longer path (i.e., through the pores, rather than around the beads). Molecules that can enter the stationary phase are fractionated by size. Smaller molecules will migrate through the pores and will be slower than larger molecules that cannot easily enter the pores. Thus, larger molecules elute more quickly. Thus, sample components above the fractionation range will elute before components within the fractionation range.
[0159] As used herein, the term "pH" refers to a numerical value that indicates the degree of acidity or alkalinity of a solution and is an indicator of the concentration of hydrogen ions. Within the range of pH 0 to pH 14, a solution with a pH of 7 is neutral, a solution with a pH less than 7 is acidic, and a solution with a pH greater than 7 is basic. The pH can be measured using a pH meter, and the pH of a buffer can be adjusted using an acid or a base such as HC1 or NaOH.
[0160] As used herein, the term "conductivity" refers to the ability of an aqueous solution to conduct an electric current between two electrodes and can be controlled by varying the amount of ions present in the aqueous solution since the current flows due to the transport of ions in the solution. For example, the concentration of a buffer and / or a salt (e.g., sodium chloride, sodium acetate, or potassium chloride) in the solution can be varied to obtain a desired conductivity. Preferably, the concentration of a salt in various types of buffers can be varied to obtain a desired conductivity.
[0161] "Physiologically acceptable," as used herein, means that these structures, materials, compositions, and / or dosage forms are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio.
[0162] As used herein, the terms "treatment," "treat," and the like, refer to administering an agent or performing a procedure in order to effect an outcome. The outcome can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. "Treatment," as used herein, can include treatment of a disease or condition (e.g., cancer) in a mammal, particularly in a human, and includes: (a) preventing the disease or symptom of the disease (e.g., including possible recurrence of the disease) in a subject predisposed to the disease but not yet diagnosed with the disease; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease. Treatment can refer to any indicia of success in the treatment or amelioration or prevention of cancer, including any objective or subjective parameter, such as elimination; diminution; reduction in severity; or amelioration of a disease or condition; slowing in rate of disease progression; or improvement in a disease endpoint. Treatment or amelioration of a symptom can be based on one or more objective or subjective parameters; including physician examination and / or self- examination. Thus, the term "treatment" includes the administration of an antibody or composition or conjugate disclosed herein to prevent or delay, alleviate or ameliorate a symptom or condition associated with the disease.
[0163] As used herein, the term "purification" refers to the process of increasing purity by removing coexisting impurities from a certain substance.
[0164] As used herein, the term "purification" refers to the process of increasing purity by removing coexisting impurities from a certain substance.
[0165] As used herein, the term "therapeutically effective amount" can vary depending on factors such as the method of administration, target site, state of the patient, etc. Thus, the amount of administration for humans should be determined in consideration of safety and effectiveness to determine an appropriate amount. The amount used in humans can also be estimated from the effective amount determined through animal experiments. For example, the above matters to be considered in determining an effective amount are described in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E. W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
[0166] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the examples. If the specific conditions are not specified in the examples, the conventional conditions or the conditions suggested by the manufacturers are used. If the manufacturers of all reagents or instruments are not specified, the conventional products available in the market are used. In order to better illustrate the present application, numerous specific details are given in the following detailed description of the embodiments. The specific examples described herein are intended for the purpose of illustration only and are not intended to constitute any limitation of the present application. In addition, in the following description, the description of the well-known structures and techniques is omitted to avoid unnecessary confusion of the concept of the present application. Such structures and techniques are also described in many publications, such as Molecular Cloning: A Laboratory Manual (Fourth Edition) (Cold Spring Harbor Laboratory Press), Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience.
[0167] Example 1 Expression of recombinant botulinum toxin type A
[0168] After cloning the nucleotide sequence described in SEQ ID NO: 2 into the pET28a vector, a recombinant plasmid was obtained.
[0169] The host cell used for expression of the recombinant botulinum toxin type A was E. coli BL21(DE3). The recombinant plasmid was transformed into the host cell, and after kanamycin selection, a monoclonal recombinant cell was obtained, which was then expanded and cultured in LB medium to obtain seed cells.
[0170] The seed cells were inoculated into a fermenter at an inoculation amount of 2%-4%, the liquid volume of the fermenter was 50%-60%, the dissolved oxygen was maintained at 15%-50%, the aeration amount was 50 L / min, the tank pressure was 0.05 MPa, the culture temperature was 37±1℃, the rotation speed was 150-700 rpm, the pH was 6.9±0.5, and if the dissolved oxygen was limited, the temperature could be lowered by 5-8℃ in advance. When the culture dissolved oxygen rebounded to more than 45%, the feed medium was started to be added. When the OD600 of the bacterial cells rose to 55-65, the temperature was lowered to 18-25℃, and the feed was stopped. After the dissolved oxygen rapidly rose, the final concentration of 0.4 mM IPTG was added for induction, and the fermentation was ended after 10-15 h of induction, and the bacterial cells were collected by centrifugation.
[0171] Example 2 Purification of recombinant botulinum toxin type A
[0172] 2.1 Cell dispersion and homogenization
[0173] Add lysis buffer (20 mM Tris-HCl, pH 8.0) to the collected bacterial culture, with the volume of the lysis buffer being approximately 10 times that of the bacterial culture. Add EDTA-2Na and PMSF to a concentration of 1 mmol / L, disperse using an emulsifier at 2500 rpm for 10 min, and homogenize twice using a high-pressure homogenizer at 800 bar.
[0174] Samples were taken from the original sample, the first homogenized sample, and the second homogenized sample. Microscopic examination was performed. If the number of intact bacterial cells in five different fields of view did not exceed 50, it indicated that the bacteria were completely broken.
[0175] 2.2 Clarification Process
[0176] A PDADMAC solution with a mass-to-volume ratio of 40% was dissolved and diluted with purified water at a ratio of 1:50, and then added to the homogenized fragmentation liquid for flocculation.
[0177] Add 0.1% PDADMAC solution by volume to the breaking fluid, stir, and let stand for 10 minutes.
[0178] 2.3 Centrifugation
[0179] The flocculated bacterial solution was slowly stirred until homogeneous, and then centrifuged using a tubular centrifuge at 13000 RPM with a feed rate of 1 L / min. The supernatant was collected to obtain the clarified liquid.
[0180] 2.4 Cation Exchange Chromatography
[0181] The SP column was flushed with 0.5 mol / L NaOH for 30 min, followed by flushing with purified water until neutral. NaCl solution was added to the clarified feed solution until the NaCl concentration was 0.08 mol / L. The pH of the feed solution was adjusted to 8.0 using 2 mol / L hydrochloric acid and 6 mol / L NaOH.
[0182] Clarifying liquid
[0183] The sample was loaded onto an SP column (MaXtar SP HR, Bainco), and equilibrated for 3 CVs using SP buffer (20 mM Tris-HCl, pH 8.0). The sample was loaded, and the column was equilibrated for another 3 CVs until the baseline leveled out. Elution buffer (20 mM Tris-HCl, 1 mol / L NaCl, pH 8.0) was used, followed by washing with 10% (SP buffer to elution buffer volume ratio) and elution with 15% (SP buffer to elution buffer volume ratio) to obtain the cation exchange buffer. The flow rate throughout the process was 150 cm / h.
[0184] 2 mol / L NaCl regeneration column.
[0185] 2.5 Enzyme digestion
[0186] Incubate the enzyme cleavage at room temperature with a ratio of thrombin to target protein of 6U: 1 mg.
[0187] 2.6 Hydrophobic chromatography
[0188] Use 0.5 mol / L NaOH to flush the SP column (Bio-Rad, MaXtar SP HR) for 30 min, and flush to neutral with purified water.
[0189] Add (NH4)2SO4 to the sample to 1 mol / L, and use 2 mol / L hydrochloric acid and 6 mol / L NaOH to adjust the pH of the sample solution to 7.0. Column the sample to the hydrophobic column (Bio-Rad Phenyl Chromstar HP), equilibrate the hydrophobic column with the equilibration buffer (20 mM Tris-HCl, 1 mol / L (NH4)2SO4, pH 7.0) for 3 CV, load, and then equilibrate for 3 CV to the baseline. Elute with the elution buffer (20 mM Tris-HCl, pH 7.0), wash impurities at 50% (volume ratio of equilibration buffer to elution buffer), and elute the target protein at 60% (volume ratio of equilibration buffer to elution buffer), and finally wash with water to obtain the hydrophobic chromatography solution. The flow rate throughout the process is 100 cm / h.
[0190] 2.7 Ultrafiltration and concentration
[0191] Use 0.5 mol / L NaOH to flush the 30KD ultrafiltration membrane package for 30 min, and flush to neutral with purified water.
[0192] Ultrafiltrate and concentrate the hydrophobic chromatography solution, with a transmembrane pressure of 0.3 bar, to a target protein concentration of 0.8-1.2 mg / mL.
[0193] 2.8 Size exclusion chromatography
[0194] Use 0.5 mol / L NaOH to flush the HiLoad Superdex 200 pg (Cytiva, item number: 28989336) size exclusion column for 30 min, and flush to neutral with purified water.
[0195] Use PBS, pH 7.4 solution to flush 3 CV, and column the ultrafiltration and concentration solution to the HiLoad Superdex 200 pg, elute with the elution buffer (PBS, pH 7.4), and the flow rate is 30 cm / h, with a loading amount of no less than 2% and no more than 4% each time.
[0196] Test Example 1: Cation exchange chromatography effect test
[0197] Collect the sample after cation exchange chromatography in Example 1, and determine the protein chromatogram and protein SDS PAGE.
[0198] The cation exchange chromatography results are as follows Figure 1 As shown, the peak begins at 13% (volume ratio of SP buffer to elution buffer) and peaks at 15% (volume ratio of SP buffer to elution buffer).
[0199] The protein SDS-PAGE results showed that the purity of the target protein was extremely low before elution, and the bands were weak. Figure 2 After elution, the target protein band was clearly visible, and the purity was significantly improved. Figure 3 ).
[0200] Test Example 2: Enzyme Digestion Efficacy Test
[0201] Thrombin was incubated at room temperature with the cation exchange chromatography solution collected in Example 1 at a ratio of 6 U: 1 mg for enzyme digestion.
[0202] The protein was digested continuously for 6 hours. After each 1 hour of digestion, the reducing agent DTT was added and heated to open the disulfide bonds in the target protein, thus separating the light chain from the heavy chain.
[0203] The results showed that thrombin cleavage resulted in the loss of some fragments, thus the target protein size was approximately 150 kDa. After the addition of DTT, the disulfide bonds in the protein were broken, and the 150 kDa single-chain bond gradually weakened with increasing cleavage time, while the 100 kDa heavy chain and 50 kDa light chain gradually increased, indicating that cleavage was approaching complete. Figure 4 ).
[0204] Test Example 3: Hydrophobic Chromatography Effect Test
[0205] The hydrophobic chromatography solution from Example 1 was subjected to SDS-PAGE analysis.
[0206] The results showed that the target protein was approximately 150 kDa in size, with almost no impurity proteins, and the band was relatively simple. Figure 5 This indicates that the hydrophobic chromatography of the present invention can successfully separate and purify the target protein, remove impurity proteins, and effectively improve the purity of the target protein.
[0207] Test Example 4: Molecular Sieve Chromatography Performance Test
[0208] The molecular sieve chromatography solution from Example 1 was subjected to SDS-PAGE analysis.
[0209] The results showed that the target protein was approximately 150 kDa in size, with almost no impurity proteins, and the bands were relatively uniform. After adding the reducing agent DTT and heating to break the disulfide bonds in the target protein, separating the light and heavy chains, the band of approximately 100 kDa was the heavy chain, and the band of approximately 50 kDa was the light chain, both sizes meeting expectations. This indicates that molecular sieve chromatography (and hydrophobic chromatography) does not affect the integrity of the light and heavy chains. Figure 6 ).
[0210] Test Example 1 SEC-HPLC purity test
[0211] SEC-HPLC purity test was performed on the A-type recombinant botulinum toxin before and after enzyme digestion.
[0212] According to the "Standard Operating Procedure for Purity Test of Protein Products (SEC-HPLC Method)" (SOP-RD-00085), an appropriate amount of test sample was mixed, centrifuged at 6000 rpm for 1 min, and the supernatant was taken for testing; the instrument parameters are shown in Table 1.
[0213] Table 1
[0214]
[0215] The SEC-HPLC results showed that the monomer purity of the sample before enzyme digestion was 97.6%, and the monomer purity of the sample after enzyme digestion was 98.7%, with significantly reduced polymers and fragments. Figure 7 The change in the ratio of monomers, polymers and fragments is shown in Table 2.
[0216] Table 2
[0217]
[0218] Test Example 2 Capillary isoelectric focusing electrophoresis test of isoelectric point
[0219] During the production and storage of recombinant protein drugs, a large amount of modifications such as oxidation, deamidation, glycosylation, C-terminal lysine truncation, N-terminal pyroglutamic acid cyclization, etc. may occur, and the charge properties of the protein surface may change due to various modifications, resulting in so-called charge isoforms. Charge isoforms have an important influence on the stability, solubility, immunogenicity, in vitro and in vivo biological activity, and pharmacokinetic function of recombinant protein drugs. Capillary isoelectric focusing electrophoresis technology (icIEF) is a new type of electrophoresis system that combines capillary isoelectric focusing electrophoresis with full-column imaging technology. Due to its simple method development, high throughput, good reproducibility of isoelectric point (pI) determination and quantification, etc., it has been widely used in the field of biopharmaceuticals for the determination of charge heterogeneity.
[0220] According to the "Standard Operating Procedure for Determination of Isoelectric Point of Protein Products (iCIEF Method)" (SOP-RD-00086), an appropriate amount of test sample was mixed and centrifuged at 12000 rpm for 5 min, 15 μL supernatant was mixed with 85 μL matrix (35 μL 1% MC + 4 μL amphoteric electrolyte + 2 μL 500 mmol / L arginine + 43 μL ultrapure water + 1 μL Marker), the mixed sample was centrifuged at 10000 rpm for 10 min, 80 μL of the centrifuged sample was slowly and carefully added to a 96-well plate, and centrifuged at 3000 rpm for 10 min; the instrument parameters are shown in Table 3.
[0221] Table 3
[0222] Parameter Settings Separation (min) 1.0 min 1500 volts, 8 min 3000 volts Detection (min) 5 Exposures Sample Load (s) (min) 55 pI Marker (min) pI 5.12, pI 9.6 Ampholytes (mmol / L) 3-10,4% Additives (mmol / L) 10 mmol / L Arg Cartridge Temperature (°C) 28℃ Sample Tray Temperature (°C) 15℃ Detection Wavelength (nm) 280 nm
[0223] The results show that the theoretical value and the actual value of the isoelectric point of the recombinant A-type protein are quite close. Figure 8
[0224] Test Example 3 Disulfide Bond Pairing Analysis
[0225] A disulfide bond is a chemical bond that connects the thiol groups of two different cysteine residues in different peptide chains or the same peptide chain. Disulfide bonds are relatively stable covalent bonds that play a role in stabilizing the spatial structure of a protein molecule. The more disulfide bonds there are, the greater the stability of the protein molecule against external factors. In chemistry, a disulfide bond refers to a functional group with the structure R-S-S-R'. Disulfide bonds are usually formed by coupling two thiol groups. In biology, the disulfide bond formed between the thiol groups of two cysteine residues is an important component of protein secondary and tertiary structures. This bond plays a certain important role in the formation of the three-dimensional structure of a protein molecule.
[0226] The three-dimensional structure of a protein is formed through non-covalent binding (electrostatic force, van der Waals force, hydrogen bond and hydrophobic interaction) and chemical bonds (disulfide bond). Cysteine is the only amino acid that can form a disulfide bond. The free thiol group of cysteine is dehydrated by oxidation to form a disulfide bond. Disulfide bonds are found in all proteins formed from simple single-celled prokaryotes to complex multicellular eukaryotes. Disulfide bonds can reduce the conformational entropy of proteins in the unfolded state, maintain the thermodynamic effects between molecules and between molecules and solution, thereby effectively maintaining a stable protein three-dimensional structure. Therefore, disulfide bonds are not only a type of post-translational modification, but also a primary condition for ensuring the active conformation of a protein.
[0227] The samples before and after enzyme digestion in Example 1 were collected for disulfide bond pairing analysis.
[0228] The samples before enzyme digestion were prepared according to the Standard Operation Procedure for Disulfide Bond Detection of Protein Products (Mass Spectrometry) (SOP-RD-00082), non-reduced: 20 μL of sample was added to 75 μL of 8 mol / L guanidine hydrochloride, 4 μL of Tris-HCl, 2 μL of H2O, and 2.5 μL of IAM, mixed, and incubated at 37°C in a water bath (avoiding light) for 1 hour; reduced: 20 μL of sample was added to 75 μL of 8 mol / L guanidine hydrochloride, 4 μL of Tris-HCl, 2 μL of DTT, and 2.5 μL of IAM, mixed, and incubated at 37°C in a water bath (avoiding light) for 1 hour. 900 μL of enzyme digestion buffer was added to the samples after denaturation and alkylation, mixed, and then replaced with a 10 KD ultrafiltration tube to make the final volume about 100 μL; 100 μL of the replaced sample was taken, 0.8 μL of mix was added, and enzyme digestion was performed at 37°C overnight.
[0229] The denaturation and alkylation process of the samples after enzyme digestion was adjusted as follows: 100 μL of sample was added to 400 μL of denaturation solution (8 mol / L guanidine hydrochloride + 0.5 mol / L Tris + 0.65 mmol / L EDTA), incubated at 70°C in a water bath for 45 minutes, 25 μL of 1 mol / L IAM was added after cooling, and alkylation was performed at room temperature for one hour in the dark. After alkylation was completed, the determination was performed according to the Standard Operation Procedure for Disulfide Bond Detection of Protein Products (Mass Spectrometry) (SOP-RD-00082).
[0230] The data were analyzed by using Thermo BioPharma Finder software, and the results showed that two pairs of theoretical disulfide bonds "1:C431 / 1:C455" and "1:C1236 / 1:C1281" could be detected in the samples before and after enzyme digestion. This also indicated that the disulfide bonds of the botulinum toxin type A protein were correctly formed. Figure 9
[0231] Each botulinum toxin molecule contains 9 cysteines, in which C430 of the light chain and C454 of the heavy chain form an inter-chain disulfide bond to ensure the correct pairing of the light chain and the heavy chain; C1235 and C1280 of the heavy chain form an intra-chain disulfide bond, which may be related to the structural stability of the botulinum toxin molecule and the function of the ganglioside binding domain. Therefore, theoretically, each correctly configured botulinum toxin molecule contains 5 unpaired cysteines. The experimentally determined free thiol molar content of the botulinum toxin molecule after enzyme digestion was about 4.77 (mol / mol), which was close to the theoretical value, indicating that the botulinum toxin molecule after thrombin enzyme digestion presented correct disulfide bond connection and correct configuration.
[0232] Mass spectrometric analysis of N-terminal complete sequence
[0233] The N-terminal sequence is closely related to the function and stability of the protein. The N-terminal sequencing analysis of the protein can determine the starting point of the protein, which is helpful for analyzing the higher structure of the protein and revealing the biological function of the protein.
[0234] The samples before and after the enzyme digestion of Example 1 were analyzed by mass spectrometry.
[0235] The data were analyzed by Thermo BioPharma Finder software, and 3 N-terminal peptides "MPFVNK", "QFNYK" and "DPVNGVDIAYIK" with a total of 24 amino acids were found in the samples before and after the enzyme digestion, which were confirmed by the primary mass spectrum and the secondary mass spectrum, and were consistent with the theoretical amino acid sequence ( Figures 10-19 ).
[0236] Test Example 5 SEC-MALS molecular weight analysis
[0237] Polypeptide and protein molecules may aggregate into a multimeric state for various reasons, affecting the action of the drug. Therefore, the detection of the multimeric state and the proportion of polypeptide and protein molecules becomes very important. The multi-angle laser light scattering instrument (Multi-Angle Laser Light Scattering, MALS) is combined with SEC, which can not only separate different fractions, but also measure the molecular weight and its distribution of different fractions.
[0238] The calculation of SEC-MALS molecular weight is mainly based on the laser and differential signals, which can provide signals of multi-angle laser detector LS, ultraviolet detector UV and differential refractive detector dRI.
[0239] The samples before and after the enzyme digestion of Example 1 were analyzed by SEC-MALS molecular weight.
[0240] The three-channel peak interception range, local magnification and molecular weight distribution of the samples before and after the enzyme digestion are shown in Figures 20-25
[0241] The sample before enzyme digestion detected 6 main chromatographic peaks (Peak 1-Peak 6), and the differential and MALS detection fitting molecular weight of each chromatographic peak is shown in Table 4, wherein Peak 4-Peak 6 is a fragment peak, Peak 2 and Peak 3 are polymer peaks, Peak 2 is mainly a undecamer, and Peak 3 is mainly a thirty-fourmer; the sample after enzyme digestion detected 4 main chromatographic peaks (Peak 1-Peak 4), and the differential and MALS detection fitting molecular weight of each chromatographic peak is shown in Table 4, wherein Peak 4 is a fragment peak, Peak 2 and Peak 3 are polymer peaks, Peak 2 is mainly a nonamer, and Peak 3 is mainly a fifty-nine mer. Wherein monomer refers to monomeric form of A-type recombinant botulinum toxin; polymer, dimer refers to a complex formed by aggregation between A-type recombinant botulinum toxin molecules; fragment 1, fragment 2, fragment 3 refer to recombinant botulinum toxin light chain molecules, heavy chain molecules and the like produced by the possible light chain-heavy chain disulfide bond breakage between A-type recombinant botulinum toxin molecules. Wherein monomer is a correctly configured complete A-type recombinant botulinum toxin molecule, and the higher the proportion, the higher the purity and quality of the A-type recombinant botulinum toxin obtained after purification.
[0242] Table 4
[0243]
[0244] Effect Example 1 Analysis of Molecular Weight of Purified A-type Recombinant Botulinum Toxin
[0245] The primary structure of a protein is the basis of its higher structure, mechanism of action and biological function, so the amino acid sequence of the protein needs to be detected and confirmed, and the molecular weight of the protein is confirmed to be consistent with the theory. Whether the molecular weight is correct often represents whether the structure of the determined organic compound and biological macromolecule is correct.
[0246] Molecular weight is divided into complete molecular weight and reduced molecular weight. The whole protein macromolecule is characterized, and whether the protein macromolecule has fragment loss or mismatch is confirmed.
[0247] The experimental materials and equipment are as follows:
[0248] Acetonitrile (ACN) was purchased from Honeywell, item number: UN1648, batch number: 22040013;
[0249] Formic acid (FA) was purchased from Aladdin, item number: F301957, batch number: B2307725;
[0250] Dithiothreitol (DTT) was purchased from Macklin, item number: D806827-5g, batch number: C13890106;
[0251] Guandinium hydrochloride was purchased from Aladdin, Cat# F1918055, Lot# C2130215;
[0252] Liquid chromatography quadrupole time-of-flight mass spectrometry ACQuity H-class Plus Xevo G2-XS Qtof was purchased from Waters.
[0253] Ultra-pure water instrument Unique-R20 was purchased from Xiamen Rishijie;
[0254] Dry thermostat DB1-100 was purchased from Titan.
[0255] Chromatography; ACQUITY UPLC Protein BEH C4 Column (1.7 μm, 2.1 mm x 50 mm) was purchased from Waters.
[0256] 1.1 Complete molecular weight analysis
[0257] After dilution of the test sample (purified type A recombinant botulinum toxin, purification method same as Example 2), the sample was separated by ultra-high performance liquid chromatography, detected by ultraviolet detector and high resolution mass spectrometer. The test sample was detected by ACQuity H-class Plus Xevo G2-XS Qtof, and analyzed by UNIFI software to analyze the complete molecular weight of the test sample.
[0258] (1) Sample processing
[0259] Mobile phase A (0.1% FA aqueous solution): take 0.5 mL of FA and add to 500 mL of purified water, mix well.
[0260] Mobile phase B (0.1% FA acetonitrile solution): take 0.5 mL of FA and add to 500 mL of acetonitrile, mix well.
[0261] Take 100 μL of purified type A botulinum toxin sample with a concentration of 0.3 mg / mL and transfer it into the inner tube for detection, the injection amount is 8 μL.
[0262] (2) Experimental parameters
[0263] Liquid phase parameters: the test sample was separated by ultra-high performance liquid chromatography system, mobile phase A was 0.1% FA aqueous solution, mobile phase B was 0.1% FA acetonitrile solution. The chromatographic column was equilibrated with the initial gradient of mobile phase A. The test sample was injected by automatic sampler, then separated by gradient chromatography, the flow rate was 0.3 mL / min, the detection wavelength was 280 nm, and the column temperature was 80℃. The related liquid phase gradient is shown in Table 5.
[0264] Table 5
[0265] Time (min) Mobile Phase A (%) Mobile Phase B (%) 0.00 90.0 10.0 1.00 90.0 10.0 8.00 10.0 90.0 11.00 10.0 90.0 11.10 90.0 10.0 15.00 90.0 10.0
[0266] Mass spectrometry parameters: The test sample was subjected to mass spectrometry analysis by using Xevo G2-XS QTof mass spectrometer, and the specific parameters are shown in Table 6:
[0267] Table 6
[0268]
[0269]
[0270] Processing parameters: The analysis was performed by UNIFI (1.9.4, Waters) software, the method processing type was Intact Protein (MS-RT Window Based), and the parameters are shown in Table 7.
[0271] Table 7
[0272] Item Parameter Settings / Type Input Mass 500-2000 Output Mass 120000-160000;30000-50000 Tof Resolution 10000 Peak Width Model Tof
[0273] The TUV / TIC amplified spectrum of the purified botulinum toxin type A sample is shown in Figure 26 , the mass spectra is shown in Figure 27 , and the deconvoluted mass profile and bar chart are shown in Figure 28 .
[0274] The molecular weight of the small peak of the purified botulinum toxin type A sample at the TUV retention time of 5.08 min was 45448 Da, and the molecular weight detection results of the main peak at 5.81 min are shown in Table 8.
[0275] Table 8
[0276]
[0277] Among them, the missing modification refers to the missing amino acid site / sequence of the recombinant botulinum toxin type A protein sample compared with the theoretical amino acid sequence; the modification type proportion in the table refers to the proportion of the recombinant botulinum toxin type A protein of different missing modification types.
[0278] 1.2 Reduced molecular weight analysis
[0279] 1) Sample processing
[0280] Mobile phase A (0.1% FA aqueous solution): Take 0.5 mL of FA and add it to 500 mL of purified water, mix well.
[0281] Mobile phase B (0.1% FA acetonitrile solution): Take 0.5 mL of FA and add it to 500 mL of acetonitrile, mix well.
[0282] 8 mol / L guanidine hydrochloride solution: weigh guanidine hydrochloride 9.90665 g, add purified water to about 12.96 mL, mix well.
[0283] 0.5 mol / L DTT solution: weigh DTT 25.565 mg, add 331.5 μL of purified water, mix well.
[0284] Take 100 μL of sample with a concentration of 0.3 mg / mL (purified type A recombinant botulinum toxin, the purification method is the same as that in Example 2), add 360 μL of 8 mol / L guanidine hydrochloride, mix well, then add 20 μL of 0.5 mol / L DTT, react at 37°C for 30 min, after the reaction is completed, transfer into an inner tube for machine detection, the injection amount is 30 μL.
[0285] Liquid phase parameters: the test sample is separated by an ultra-high performance liquid chromatography system, the mobile phase A is 0.1% FA aqueous solution, and the mobile phase B is 0.1% FA acetonitrile solution. The chromatographic column is equilibrated with the initial gradient of the mobile phase A. The test sample is injected by an automatic sampler, then separated by gradient chromatography, the flow rate is 0.3 mL / min, the detection wavelength is 280 nm, and the column temperature is 80°C. The related liquid phase gradient is shown in Table 5.
[0286] Mass spectrometry parameters: the test sample is analyzed by Xevo G2-XS QTof mass spectrometer, and the specific parameters are shown in Table 6.
[0287] Processing parameters, analyzed by UNIFI (1.9.4, Waters) software, the method processing type is Intact Protein (MS-RT Window Based). The parameters are shown in Table 9.
[0288] Table 9
[0289] Item Parameter Settings / Type Input Mass 800-2000 Output Mass 90000-160000;40000-70000 Tof Resolution 10000 Peak Width Model Tof
[0290] The results of the reduced molecular weight detection of the purified type A botulinum toxin sample are shown in Table 10. The TIC / TUV amplified spectrum is shown in Figure 29 , the Massspectra spectrum is shown in Figures 30-31 . The Deconvoluted mass profile and bar chart after deconvolution are shown in Figures 32-33 .
[0291] Table 10
[0292]
[0293]
[0294] The molecular weight of the light chain and heavy chain of the A-type recombinant botulinum toxin sample was detected by a reducing method. The deletion modification refers to the amino acid sites / sequences that are deleted from the light chain and heavy chain of the A-type recombinant botulinum toxin protein sample compared with the theoretical amino acid sequence. The specific deletion sites / sequences are shown in Table 10. The heavy chain is not detected for deletion modification, which is marked as N / A. The modification type ratio in the table refers to the proportion of the light chain and heavy chain molecules of different deletion modification types.
[0295] In combination with the results of the complete molecular weight, it is found that part of the light chain C-terminal TKSLVPR is lost, part of the light chain N-terminal M is deleted, part of the light chain C-terminal KSLVPR is lost, and part of the light chain C-terminal SLVPR is lost.
[0296] The detection result of the heavy chain is 98423.9736 Da. The actual value of the light and heavy chains of the sample is consistent with the theoretical value.
[0297] The amino acid sequence at positions 443-448 between the light chain and the heavy chain of the A-type recombinant botulinum toxin protein used in the application is replaced by the thrombin cleavage site LVPRGS. Thrombin can recognize this sequence and cut between R / G. According to the results of the reducing molecular weight and the peptide map, it is speculated that the separation position of the light and heavy chains of the sample is between R446 / G447, which is consistent with the theoretical thrombin cleavage site. In addition, the sample also has the conditions that part of the light chain C-terminal TKSLVPR is lost, part of the light chain N-terminal M is deleted, part of the light chain C-terminal KSLVPR is lost, and part of the light chain C-terminal SLVPR is lost. Among them, the deletion of the light chain C-terminal may be caused by the instability of the exposed end after the thrombin cutting. The production of A-type botulinum toxin by Clostridium botulinum in nature also has a post-translational modification process of cutting between the light chain and the heavy chain, which can improve the biological activity of botulinum toxin. And the natural A-type botulinum toxin also has the phenomenon of partial amino acid loss near the cutting site. Therefore, the thrombin cleavage site designed in the application sufficiently simulates the post-translational modification phenomenon of botulinum toxin in nature.
[0298] Effect Example 2 Peptide map analysis of purified A-type botulinum toxin protein
[0299] Peptide map analysis is based on the molecular weight and amino acid composition characteristics of proteins and polypeptides. A specific proteolytic enzyme (usually a peptide endopeptidase) is used to act on a specific peptide site to cleave the polypeptide into small fragments, and a characteristic fingerprint map is formed through certain separation and detection means.
[0300] There is no peptide map analysis of A-type botulinum toxin protein in the field at present. This is the first publication of the mass peptide map of the known A-type botulinum toxin.
[0301] The experimental materials and equipment are as follows:
[0302] Acetonitrile (ACN) was purchased from Honeywell, item number: UN1648, batch number: 22040013;
[0303] Formic acid (FA) was purchased from Aladdin, item number: F301957, batch number: B2307725;
[0304] Guandinium hydrochloride was purchased from Aladdin, item number: F1918055, batch number: C2130215;
[0305] 1 mol / L Tris-HCl was purchased from Adamas life, item number: E8029, batch number: P2317886;
[0306] 10 kD ultrafiltration centrifuge tube was purchased from Millipore, item number: UFC5010BK, batch number: R0AB79806;
[0307] Calcium chloride was purchased from Shanghai Reagent, item number: 10005861, batch number: 20220218;
[0308] Trypsin was purchased from Promega, item number: V511A, batch number: V511A;
[0309] Dithiothreitol (DTT) was purchased from National Pharmaceutical Group, item number: 63002632, batch number: 20200326;
[0310] Iodoacetamide (IAM) was purchased from Sigma, item number: I1149-5G, batch number: SLCL5599;
[0311] NAP-5 column was purchased from Citiva, item number: 17085302, batch number: 17582933;
[0312] Ultra-high performance liquid chromatography-mass spectrometry instrument Thermo Vanquish-Q Exactive Plus was purchased from Thermo Fisher;
[0313] Ultra-pure water instrument Unique-R20 was purchased from Xiamen Aisijie;
[0314] Dry thermostat DB1-100 was purchased from Titan;
[0315] Chromatography; ACQUITY UPLC Protein BEH C18 Column (1.7 μm, 2.1 mm x 150 mm) was purchased from Waters.
[0316] The test sample (purification method as in Example 2) was subjected to denaturation reduction, alkylation protection, enzyme digestion, and then separated by ultra-high performance liquid chromatography, detected by a UV detector and high-resolution mass spectrometer. The experiment was detected by ThermoVanquish-Q Exactive Plus, and the mass peptide map of the test sample was analyzed by Biopharma Finder software.
[0317] 2.1 Preparation of reagents and sample treatment
[0318] Mobile phase A (0.1% FA aqueous solution): Take 0.8 mL of FA and add to 800 mL of purified water, mix well.
[0319] Mobile phase B (0.1% FA acetonitrile solution): Take 0.8 mL of FA and add to 800 mL of acetonitrile, mix well.
[0320] 1 mol / L IAM solution: weigh 20.805 mg of IAM and add 112.4 μL of purified water, mix well in the dark.
[0321] 1 mol / L DTT solution: weigh 17.335 mg of DTT and add 112.6 μL of purified water, mix well.
[0322] 8 mol / L guanidine hydrochloride solution: weigh 9.945940 g of guanidine hydrochloride, add purified water to about 13 mL, mix well.
[0323] Enzymatic digestion buffer: weigh 0.488285 g of calcium chloride, add 22 mL of 1 M Tris-HCl pH 8.0 solution, and then add purified water to about 440 mL, mix well by ultrasonic, to obtain the enzyme digestion buffer (50 mmol / L Tris-HCl, 10 mmol / L CaCl2, pH 8.0).
[0324] 20% formic acid solution: take 20 μL of formic acid and add to 80 μL of purified water, mix well.
[0325] 100 mM Tris-HCl solution: weigh 1 mL of 1 mol / L Tris-HCl and add to 9 mL of purified water, mix well.
[0326] Take 500 μg sample, use 10 kD ultrafiltration centrifuge tube to replace the solution with 100 μL 100 mM Tris-HCl, add 360 μL 8 M guanidine hydrochloride and 25 μL 1 M Tris-HCl, shake well after adding 5 μL 1 M DTT, react at 37 °C for 30 min, then add 10 μL 1 M IAM, react for 40 min in the dark. Use NAP-5 column to replace the solution with 1 mL enzyme digestion buffer. Take 100 μL of the replaced solution and add 4 μL of 0.5 mg / mL Trypsin enzyme, react at 37 °C for 4 h, then add 2 μL of 20% formic acid to terminate the reaction, and then detect after termination.
[0327] 2) Experimental parameters
[0328] Liquid phase parameters: The test sample is separated by an ultra-high performance liquid chromatography system, the mobile phase A is 0.1% FA aqueous solution, and the mobile phase B is 0.1% FA acetonitrile solution. The chromatographic column is equilibrated with the initial gradient of mobile phase A. The test sample is loaded by an automatic sampler, then separated by gradient chromatography, and the flow rate is 0.25 mL / min. The detection wavelength is 214 nm, the column temperature is 60 °C, and the injection amount is 25 μL. The relevant liquid phase gradient is shown in Table 11.
[0329] Table 11
[0330] Time (min) Mobile Phase A (%) Mobile Phase B (%) 0 99 1 2 99 1 82 62 38 83 30 70 84 10 90 88 90 10 92 10 90 95 50 50 96 50 50 98 99 1 110 99 1
[0331] The test sample is denatured, reduced, alkylated, and digested, then separated by ultra-high performance liquid chromatography, detected by a UV detector and a high-resolution mass spectrometer. This experiment uses Thermo Vanquish-Q Exactive Plus for detection, and analyzes the test sample by Biopharma Finder software to analyze the mass peptide map.
[0332] Mass spectrometry parameters: The test sample is analyzed by mass spectrometry using Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography mass spectrometer.
[0333] Processing parameters: The method processing type is Peptide Mapping Analysis by Biopharma Finder software analysis. The parameter processing is shown in Table 12.
[0334] Table 12
[0335]
[0336]
[0337] The results show that, combined with the enzyme digestion results, by comparing the measured peptide primary mass spectrum and secondary mass spectrum data with the theoretical peptide information, the amino acid sequences of the enzyme digestion peptides of the sample are detected, and are consistent with the theoretical sequences, and the amino acid sequence coverage rate of the purified botulinum toxin type A protein of the application is 100% Figure 34 ).
[0338] Effect example 3 coverage analysis of purified botulinum toxin type A protein
[0339] The peptide coverage refers to the consistency matching degree of the protein amino acid sequence and the theoretical sequence, and is mainly for confirming the primary sequence of the protein. This information can help researchers quickly understand the structure of the protein, and determine whether the protein is correctly expressed.
[0340] The experimental related materials and equipment are as follows:
[0341] Acetonitrile (ACN) is purchased from Honeywell, item number: UN1648, batch number: 22040013;
[0342] Formic acid (FA) is purchased from Aladdin, item number: F301957, batch number: B2307725;
[0343] GuHCl is purchased from Aladdin, item number: F1918055, batch number: C2130215;
[0344] 1 mol / L Tris-HCl is purchased from Adamas life, item number: E8029, batch number: P2317886;
[0345] 10kD ultrafiltration centrifuge tube is purchased from Millipore, item number: UFC5010BK, batch number: R0AB79806;
[0346] Calcium chloride is purchased from Shanghai Test, item number: 10005861, batch number: 20220218;
[0347] Trypsin is purchased from Promega, item number: V511A, batch number: V511A;
[0348] Chymotrypsin is purchased from Adamas, item number: Adamas, batch number: ENI20220701;
[0349] Glu-C endoproteinase is purchased from Sigma, item number: P6181-50UG, batch number: SLCL1060;
[0350] Dithiothreitol (DTT) is purchased from China National Pharmaceutical Group, item number: 63002632, batch number: 20200326;
[0351] Iodoacetamide (IAM) was purchased from Sigma, item number: I1149-5G, batch number: SLCL5599;
[0352] NAP-5 column was purchased from Citiva, item number: 17085302, batch number: 17582933;
[0353] Ultra-high performance liquid chromatography-mass spectrometry instrument Thermo Vanquish-Q Exactive Plus was purchased from Thermo Fisher;
[0354] Ultra-pure water instrument Unique-R20 was purchased from Xiamen Rishijie;
[0355] Dry thermostat DB1-100 was purchased from Titan;
[0356] Chromatography; ACQUITY UPLC Protein BEH C18 Column (1.7 μm, 2.1 mm x 150 mm) was purchased from Waters.
[0357] In this experiment, Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography-mass spectrometry instrument was used for detection, and Biopharma Finder software was used for analysis. The sequence coverage of the sample (purification method is the same as Example 2) was analyzed.
[0358] 2.1 Preparation of reagents and sample treatment
[0359] Mobile phase A (0.1% FA aqueous solution): Take 0.8 mL of FA and add it to 800 mL of purified water, mix well.
[0360] Mobile phase B (0.1% FA acetonitrile solution): Take 0.8 mL of FA and add it to 800 mL of acetonitrile, mix well.
[0361] 1 mol / L IAM solution: weigh 20.805 mg of IAM, add 112.4 μL of purified water, mix well in the dark.
[0362] 1 mol / L DTT solution: weigh 17.335 mg of DTT, add 112.6 μL of purified water, mix well.
[0363] 8 mol / L guanidine hydrochloride solution: weigh 9.945940 g of guanidine hydrochloride, add purified water to about 13 mL, mix well.
[0364] Enzymatic buffer: 0.488285 g of calcium chloride was weighed, 22 mL of 1 M Tris-HCl pH 8.0 solution was added, and purified water was added to about 440 mL, and then ultrasonic mixing was performed to obtain an enzyme digestion buffer (50 mmol / L Tris-HCl, 10 mmol / L CaCl2, pH 8.0).
[0365] 20% formic acid solution: 20 μL of formic acid was taken, 80 μL of purified water was added, and mixing was performed.
[0366] 100 mM Tris-HCl solution: 1 mL of 1 mol / L Tris-HCl was measured, and 9 mL of purified water was added, and mixing was performed.
[0367] 500 μg of sample was taken, and the solution was replaced with 100 μL of 100 mM Tris-HCl using a 10 kD ultrafiltration centrifuge tube, 360 μL of 8 M guanidine hydrochloride and 25 μL of 1 M Tris-HCl were added, 5 μL of 1 M DTT was added after oscillation and mixing, and reaction was performed at 37°C for 30 min, and then 10 μL of 1 M IAM was added, and reaction was performed in the dark for 40 min. The solution was replaced with 1 mL of enzyme digestion buffer using a NAP-5 column. 100 μL of the replaced solution was added with 4 μL of 0.5 mg / mL Trypsin enzyme; 100 μL of the replaced solution was added with 4 μL of 0.5 mg / mL Chymotrypsin enzyme, and reaction was performed at room temperature for 2 h; 100 μL of the replaced solution was added with 4 μL of 0.5 mg / mL Glu-C enzyme, and reaction was performed at 37°C for 16 h. After the above enzyme digestion, 2 μL of 20% formic acid was added to terminate the reaction, and after termination, detection was performed.
[0368] 2) Experimental parameters
[0369] Liquid phase parameters: The test sample was separated by an ultra-high performance liquid chromatography system, the mobile phase A was 0.1% FA aqueous solution, and the mobile phase B was 0.1% FA acetonitrile solution. The chromatographic column was equilibrated with the initial gradient of the mobile phase A. The test sample was loaded by an automatic sampler, and then gradient separation was performed by the chromatographic column, the flow rate of the Trypsin enzyme digestion sample and the Glu-C enzyme digestion sample was 0.25 mL / min, and the flow rate of the Chymotrypsin enzyme digestion sample was 0.3 mL / min. The detection wavelength was 214 nm, the column temperature was 60°C, and the injection amount was 25 μL. The related liquid phase gradient is shown in Table 11.
[0370] Mass spectrometry parameters: The test sample was analyzed by mass spectrometry using a Thermo Vanquish-Q Exactive Plus ultra-high performance liquid chromatography mass spectrometer.
[0371] Processing parameters: The method processing type is Peptide Mapping Analysis by Biopharma Finder software analysis. The parameter processing is shown in Table 12.
[0372] The results show that the amino acid sequence coverage of the purified botulinum toxin type A protein of the application is 100% after Trypsin, Chymotrypsin and Glu-C enzyme digestion, respectively, combined with the results of three enzyme digestion. Figures 35-37 and Table 13.
[0373] Table 13
[0374]
[0375]
[0376]
[0377]
[0378]
[0379] The peptide segment marked with * is the peptide segment obtained by chymotrypsin enzyme digestion, and the rest are trypsin enzyme digestion peptides;
[0380] All peptide segments and modifications are confirmed by secondary mapping;
[0381] Carbamidomethylation: cysteine alkylation modification introduced by sample pretreatment.
[0382] Comparative Example 1
[0383] The cell dispersion and homogenization steps are the same as those of Example 2.
[0384] 0.01%, 0.03%, 0.05% and 0.1% of PDADMAC solution by volume ratio were added to the broken liquid, stirred and stood for 10 min. The turbidity was observed before and after centrifugation.
[0385] The results show that the flocculation effect of 0.1% PDADMAC (w / v) before and after centrifugation is better, and the turbidity of the supernatant after centrifugation is less than 100 NTU, which meets the subsequent process requirements Figure 38 and Figure 39 ).
[0386] Comparative Example 2
[0387] The cell dispersion and homogenization, clarification and centrifugation steps are the same as those of Example 2.
[0388] NaCl was added to the feed solution to make the final concentration of NaCl in the feed solution 80 mM, and the feed solution without NaCl was loaded on the SP column (Biolin Scientific, MaXtar SP HR) at the same time, and the loading amount was the same. After cation exchange chromatography, SDS page was used to detect the purification effect.
[0389] The results show that the addition of an appropriate amount of NaCl to the feed solution for purification will result in fewer impurities in the eluted sample, and the purity of the sample will be higher Figure 40 ).
[0390] Comparative Example 3
[0391] The cell dispersion and homogenization, clarification, centrifugation, cation exchange chromatography, and enzyme cutting steps were the same as in Example 2.
[0392] (NH4)2SO4 was added to the enzyme-cut sample to 1 mol / L, and the sample was loaded on the hydrophobic column (Biolin Scientific Phenyl Chromstar HP), the equilibrium solution was (20 mM Tris-HCl, 1 mol / L (NH4)2SO4, pH 7.0), the elution solution was (20 mM Tris-HCl, pH 7.0), and 20%, 30%, 40%, 50%, 60%, 70%, and 100% (volume ratio of elution solution and equilibrium solution) were eluted, respectively. After hydrophobic chromatography, SDS page was used to detect the purification effect.
[0393] (NH4)2SO4 was added to the enzyme-cut sample to 1 mol / L, and the sample was loaded on the hydrophobic column, the equilibrium solution was (20 mM Tris-HCl, 1 mol / L (NH4)2SO4, pH 7.0), the elution solution was (20 mM Tris-HCl, pH 7.0), 50% (volume ratio of elution solution and equilibrium solution) was used to remove impurities, and 60% (volume ratio of elution solution and equilibrium solution) was eluted to obtain the target protein, which was the optimal hydrophobic chromatography process Figure 41 ).
[0394] Finally, it should be noted that the above content is only used to illustrate the technical solutions of the present application, and is not a limitation on the protection scope of the present application. Simple modifications or equivalent replacements of the technical solutions of the present application made by ordinary skilled persons in the art do not deviate from the essence and scope of the technical solutions of the present application.
Claims
1. A method for purifying a recombinant botulinum toxin type A, characterized by, The A-type recombinant botulinum toxin is expressed by E. coli BL21 (DE3); the nucleotide sequence encoding the A-type recombinant botulinum toxin is shown as SEQ ID NO: 2; The purification method comprises the following steps: (1) collecting the fermentation broth, crushing the bacterial cells to obtain a crushing liquid; (2) adding a flocculating agent to the crushing liquid for clarification, and then centrifuging to remove impurities to obtain a clarified liquid; the flocculating agent is 0.1% (v / v) PDADMAC; (3) adding a NaCl solution to the clarified liquid until the concentration of NaCl in the clarified liquid is 0.07-0.10 mol / L, adjusting the pH to 8.0, and then adding to a cation exchange column for cation exchange chromatography to obtain an ion chromatography liquid; the cation exchange column is an SP column, the SP column is MaXtar SP HR, and the buffer solution for ion chromatography is 20 mM Tris-HCl, pH 8.0, and the eluent is 20 mM Tris-HCl, 1 mol / L NaCl, pH 8.0; (4) adding thrombin to the ion chromatography liquid for enzyme cutting to obtain an enzyme cutting liquid; (5) after adding (NH4)2SO4 to 1 mol / L to the enzyme cutting liquid, adjusting the pH to 7.0, and then adding to a hydrophobic chromatography column for hydrophobic chromatography, the equilibration buffer is 20 mM Tris-HCl, 1 mol / L (NH4)2SO4, pH 7.0; the eluent is 20 mM Tris-HCl, pH 7.0, the volume ratio of the equilibration buffer to the eluent is 50% for impurity removal, and the volume ratio of the equilibration buffer to the eluent is 60% for elution to obtain a hydrophobic chromatography liquid; the hydrophobic chromatography column is a Phenyl Chromstar HP; (6) performing ultrafiltration concentration on the hydrophobic chromatography liquid to obtain an ultrafiltration concentrated liquid; the ultrafiltration concentration uses a 30KD ultrafiltration membrane bag; (7) adding the ultrafiltration concentrated liquid to a molecular sieve chromatography column for molecular sieve chromatography to obtain the purified A-type recombinant botulinum toxin; the molecular sieve chromatography column is a HiLoad Superdex 200pg.
2. The purification method according to claim 1, characterized in that, The concentration of NaCl in step (3) is 0.08 mol / L.
Citation Information
Patent Citations
Botulinum toxin producing method
CN113056478A
Method for purifying botulinum toxin
CN114945582A
Method for preparing anti-A type botulinus toxin immunoglobulin antibody
CN101497909A
Manufacture of recombinant clostridium botulinum neurotoxins
CN106414759A
Preparation method and application of botulinum toxin A
CN116813727A