Preparation and use of a nano-subunit vaccine for the prevention of chicken coccidiosis

By preparing a recombinant protein vaccine containing the giant Eimeria coccidia Treg inducer molecule EmTregIM-1 coated with PLGA nanoparticles, the problems of poor safety and immunization efficacy of existing chicken coccidiosis vaccines were solved, achieving significant immune protection and virus control effects.

CN118178627BActive Publication Date: 2026-06-02NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2024-01-30
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing chicken coccidiosis vaccines have problems such as high safety risks, unsatisfactory immune protection effects, and high costs. Furthermore, the immune evasion mechanism of chicken coccidiosis has not been fully studied, which limits the effectiveness of vaccine prevention and control.

Method used

A nano-subunit vaccine was prepared by coating the recombinant protein of EmTregIM-1, a Treg inducible molecule of Eimeria giantiformis, with PLGA nanoparticles. The biocompatibility and degradability of PLGA were utilized to enhance antigen presentation and promote immune response.

Benefits of technology

It improved the stability of the antigen and the immune response, significantly enhanced the preventive effect against Eimeria giantiformis infection, reduced the number of intestinal lesions and oocysts, and enhanced the immune protection effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118178627B_ABST
    Figure CN118178627B_ABST
Patent Text Reader

Abstract

The application relates to preparation and application of a nano-subunit vaccine for preventing chicken coccidiosis. The nano-subunit vaccine PLGA-rEmTregIM-1 is prepared by coating a giant Eimeria maxima Treg inducing molecule EmTregIM-1 recombinant protein (rEmTregIM-1) with PLGA nanoparticles. The immunoprotective effects of the subunit vaccine rEmTregIM-1 and the nano-subunit vaccine PLGA-rEmTregIM-1 are evaluated through animal immunoprotection tests, and the results show that both the vaccines can produce partial immunoprotections for the giant Eimeria maxima infection. After the recombinant protein subunit vaccine rEmTregIM-1 is coated with the PLGA nanoparticles, the nano-subunit vaccine PLGA-rEmTregIM-1 has an improved immunoprotection effect on animals compared with the subunit vaccine rEmTregIM-1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological veterinary medicine technology, and specifically to the preparation and application of a nano-subunit vaccine for the prevention of coccidiosis in chickens. Background Technology

[0002] Coccidiosis in chickens is a parasitic disease caused by coccidia that parasitize the intestinal epithelial cells of the host. Clinical manifestations include bloody diarrhea, weight loss, and reduced egg production in affected chickens, sometimes leading to death. This disease, with its high morbidity and mortality rates, severely impacts flock health and causes significant economic losses to the poultry industry. Currently, seven pathogens are recognized as causing coccidiosis in chickens: *Eimeria tenella*, *Eimeria necatrix*, *Eimeria maxima*, *Eimeria acervulina*, *Eimeria brunetti*, *Eimeria mitis*, and *Eimeria praecox*. Among these seven pathogens, *Eimeria maxima* is highly virulent and widely prevalent, making it one of the most damaging species.

[0003] Control of coccidiosis in chickens primarily relies on drug prevention. However, with the widespread use of anticoccidial drugs, drug-resistant strains have emerged, gradually weakening the effectiveness of disease control. Simultaneously, drug residues caused by anticoccidial drug use are receiving increasing attention. Currently, many countries have standardized the use of anticoccidial drugs, clearly restricting their application. Under these circumstances, vaccination has become the ideal way to control coccidiosis in chickens. Currently, the vaccines available for preventing coccidiosis in chickens are mainly live vaccines, including virulent and attenuated vaccines. Using virulent vaccines carries higher risks, with potential pathogenicity and the possibility of disease transmission, making safety difficult to guarantee; attenuated vaccines have lower immunogenicity, resulting in less than ideal immune protection for animals. Furthermore, the high production cost and limited output of live vaccines also restrict their widespread adoption.

[0004] With the rapid development of molecular biology, gene recombination technology has been increasingly applied to vaccine development, giving rise to subunit vaccines. These vaccines utilize a new technology: inserting protective antigen gene fragments into expression vectors to construct recombinant expression vectors, and then expressing and purifying the recombinant protein to prepare the vaccine. As a novel vaccine, subunit vaccines pose no risk of shedding pathogens, have no drug residue issues, and do not threaten human health or the environment, aligning with current green and environmentally friendly principles. Furthermore, subunit vaccines offer advantages such as low production costs, high yields, and scalability, making them a promising alternative strategy for disease control and attracting widespread attention from researchers both domestically and internationally. To date, the only commercially available subunit vaccine for the control of coccidiosis in chickens is the E. maxima subunit vaccine from Israel. It is a subunit vaccine prepared using E. maxima gametosome proteins. The successful development of this vaccine demonstrates the practicality of subunit vaccines and enhances researchers' confidence in developing them.

[0005] A significant challenge to the control of coccidiosis in chickens is the immune evasion of coccidia. When the parasite invades a host, on the one hand, the host initiates an immune response to eliminate the parasite; on the other hand, the parasite evades the immune system by suppressing the host's immune response, thus facilitating its parasitism within the host. Regulatory T cells (Tregs) play a crucial role in this suppression of the host's immune response. Tregs are a subset of T cells with the function of suppressing immune responses, playing a role in maintaining homeostasis and regulating immune responses. In chickens, CD4+... + CD25 + The cells were identified as chicken regulatory T cells. Studies have shown that parasite invasion of the host can promote Treg proliferation, thereby suppressing the host's immune response and benefiting the parasite's survival within the host. However, there is no research on which molecules in the parasite can induce Treg proliferation, and there are also no reports on developing subunit vaccines targeting chicken coccidia immune evasion. In our previous work, the E. maxima Treg inducing molecule EmTregIM-1, screened from a cDNA expression library of sporulated oocysts of E. maxima, can promote Treg proliferation. This invention develops a subunit vaccine targeting EmTregIM-1 and conducts animal protection experiments to observe its immunoprotective effect on animals.

[0006] Poly(D,L-Lactide-Co-Glycolide), or PLGA, is a nanomaterial composed of synthetic or semi-synthetic polymers that can be used as a carrier for drug coating and delivery. PLGA nanoparticles are non-toxic, possess good biocompatibility and degradability. Using them as a carrier for vaccines not only improves antigen stability but also enhances antigen presentation capabilities, enabling slow release and targeted delivery of antigens, thereby increasing immunogenicity and improving immune responses. Studies have found that coating Plasmodium vivax and Toxoplasma gondii antigens with PLGA nanoparticles can induce durable, specific antibodies and enhance immune responses, demonstrating good immunoprotective effects in animal experiments. Furthermore, in the development of chicken coccidiosis vaccines, coating antigens with PLGA nanoparticles can also enhance the body's immune response and improve immunoprotective effects. Summary of the Invention

[0007] The purpose of this invention is to provide a nanosubunit vaccine, PLGA-rEmTregIM-1, that can prevent E. maxima infection in chickens.

[0008] Another object of the present invention is to provide a method for preparing the nano-subunit vaccine.

[0009] The objective of this invention can be achieved through the following technical solutions:

[0010] The E. maxima nanosubunit vaccine is prepared by coating PLGA nanoparticles with the recombinant protein (rEmTregIM-1), an E. maxima Treg inducer. The recombinant protein rEmTregIM-1 is a Treg inducer for E. maxima. The amino acid sequence of the recombinant protein rEmTregIM-1 is shown in SEQ ID NO.2, and the encoding gene sequence is shown in SEQ ID NO.1.

[0011] As a preferred embodiment of the present invention, the recombinant protein rEmTregIM-1 is obtained by transforming the E. maxima recombinant expression plasmid pET-28a-EmTregIM-1 into BL21 Escherichia coli for induced expression, and the expressed recombinant protein rEmTregIM-1 is purified using a His protein purification kit.

[0012] As a preferred embodiment of the present invention, the recombinant expression plasmid pET-28a-EmTregIM-1 is obtained by inserting the gene sequence encoding the recombinant protein rEmTregIM-1 shown in SEQ ID NO.1 between the HindIII and Xho I restriction sites of the pET-28a vector.

[0013] As a preferred embodiment of the present invention, the nano-subunit vaccine of the present invention is an irregular sphere with a diameter of approximately 50nm-200nm.

[0014] The method for preparing E. maxima nano-subunit vaccines according to the present invention includes the following steps:

[0015] (1) Construct the recombinant expression plasmid pET-28a-EmTregIM-1;

[0016] (2) The recombinant expression plasmid pET-28a-EmTregIM-1 was transformed into BL21 Escherichia coli to obtain bacteria containing the recombinant expression plasmid pET-28a-EmTregIM-1;

[0017] (3) Bacteria containing the recombinant expression plasmid pET-28a-EmTregIM-1 were inoculated into LB liquid medium and cultured. When the bacterial culture OD 600 When the pH reached 0.4-0.6, IPTG was added to the bacterial culture to induce recombinant protein expression. After culturing for another 6 hours, the bacteria were collected, washed with PBS, and the precipitate was resuspended in an appropriate amount of PBS. The bacteria were lysed by sonication, centrifuged at 8000 rpm for 20 min, and the supernatant was collected. The recombinant protein was purified using a His-tagged protein purification kit. The recombinant protein was identified by SDS-PAGE gel electrophoresis, and the concentration of the recombinant protein was determined using a BCA protein quantification kit.

[0018] (4) The preparation method of the nano subunit vaccine is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex and mix well, sonicate under ice bath conditions, add recombinant protein rEmTregIM-1 dropwise to the mixture, vortex and mix well, sonicate under ice bath conditions, at this time the liquid is milky white, add 5% PVA, vortex and mix well, sonicate under ice bath conditions, evaporate the organic solvent, collect the liquid, centrifuge with a refrigerated ultracentrifuge, collect the supernatant and precipitate, resuspend the precipitate with deionized water, place it in a -80℃ freezer for 1 to 3 hours, and then freeze dry it with a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano subunit vaccine.

[0019] As a preferred embodiment of the present invention, the recombinant expression plasmid pET-28a-EmTregIM-1 in step (1) is obtained by inserting the coding sequence of the giant Eimeria coccidia recombinant protein rEmTregIM-1 shown in SEQ ID NO.1 between the Hind III and Xho I restriction sites of the pET-28a vector.

[0020] As a preferred embodiment of the present invention, the preparation method of the nano-subunit vaccine in step (4) is as follows: PLGA is weighed and dissolved in dichloromethane, 5% polyvinyl alcohol is added, vortexed and mixed, and sonicated for 3-8 minutes under ice bath conditions. Recombinant protein rEmTregIM-1 is added dropwise to the mixture, vortexed and mixed, and sonicated for 3-8 minutes under ice bath conditions. At this time, the liquid is milky white. 2 mL of 5% PVA is added, vortexed and mixed, and sonicated for 3-8 minutes under ice bath conditions. The mixture is placed in a fume hood for about 4 hours to evaporate the organic solvent. The liquid is collected and centrifuged for 30 minutes using a refrigerated ultracentrifuge. Centrifuge at 25000–32000 r / min. After centrifugation, collect the supernatant and precipitate separately. Resuspend the precipitate in deionized water, place it in a -80℃ freezer for 2 hours, and then freeze-dry it for 18–22 hours using a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano-subunit vaccine. The mass-to-volume ratio of PLGA to dichloromethane is 40–100 mg:1 mL, the volume ratio of 5% polyvinyl alcohol to dichloromethane is 1–5:1, and the mass-to-volume ratio of recombinant protein rEmTregIM-1 to dichloromethane is 3–5 mg:1 mL.

[0021] As a further preferred embodiment of the present invention, the ultrasonic conditions are: ultrasonic power 40W, ultrasonic time 5s, interval 5s.

[0022] Application of the recombinant expression vector containing the gene sequence encoding the recombinant protein rEmTregIM-1 in the preparation of a vaccine to prevent infection with Eimeria giantiformis in chickens.

[0023] As a preferred embodiment of the present invention, the recombinant expression vector containing the EmTregIM-1 coding gene sequence of Eimeria giantiformis is obtained by inserting the EmTregIM-1 coding sequence of Eimeria giantiformis shown in SEQ ID NO.1 between the Hind III and Xho I restriction sites of the pET-28a vector; the vaccine is a nano-subunit vaccine.

[0024] The present invention has the following advantages and effects:

[0025] (1) There are currently no reports on the development of subunit vaccines using immune evasion-related antigen molecules as targets. In this invention, EmTregIM-1 can promote Treg proliferation and induce immune evasion. The PLGA-rEmTregIM-1 nano subunit vaccine prepared by coating recombinant protein rEmTregIM-1 with PLGA nanomaterials can improve antigen stability, enhance antigen presentation ability, enable slow release of antigen, significantly enhance immune response, and have a more significant preventive effect against Eimeria giantiformis infection.

[0026] (2) There are few studies and reports on E. maxima nanosubunit vaccines at present. This invention enriches the candidate vaccines for the prevention and control of Eimeria giant coccidiosis in chickens. Attached Figure Description

[0027] Figure 1 Screening for Treg-induced molecules.

[0028] A: In the first round of screening, the cDNA library was divided into three primary sub-libraries. After immunizing the animals, CD4 counts were detected. + CD25 + / CD4 + Cell proportion. B: Second round of screening, dividing the primary sub-library into 3 sub-libraries, followed by CD4 detection after immunizing animals. + CD25 + / CD4 + Cell proportion. C: Third round of screening, single colonies were isolated from secondary sublibraries 3-7, plasmids were extracted and animals were immunized, and CD4 counts were detected. + CD25 + / CD4 + Cell percentage. (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001)

[0029] Figure 2 PCR amplification of Treg-inducible molecule EmTregIM-1.

[0030] M: DL 2000 DNA Marker 1: PCR amplification results of EmTregIM-1

[0031] Figure 3 Double enzyme digestion identification of recombinant plasmid pET-28a-EmTregIM-1.

[0032] M: DL 5000 DNA Marker 1: pET-28a-EmTregIM-1 double enzyme digestion identification results

[0033] Figure 4 Recombinant protein rEmTregIM-1 was induced to express and purified.

[0034] M: Protein standard marker 1: pET-28a empty vector before induction 2: pET-28a empty vector after induction 3: rEmTregIM-1 before induction 4: rEmTregIM-1 after induction 5: Supernatant after sonication 6: Inclusion bodies after sonication 7: rEmTregIM-1 after purification

[0035] Figure 5 Scanning electron microscope image of the nanosubunit vaccine PLGA-rEmTregIM-1 Detailed Implementation

[0036] Basic materials:

[0037] 1. Sporulated oocysts of Eimeria giantiformis: Sporulated oocysts of Eimeria giantiformis from Jiangsu strain were preserved in the Parasitology Laboratory of the College of Veterinary Medicine, Nanjing Agricultural University. They were rejuvenated in chickens every 3 months. Oocysts were collected using the saturated saline flotation method and sporulated, with a sporulation rate of over 80%. They were then preserved in a solution containing 2.5% potassium dichromate (Suo Xun, Li Guoqing. Chicken Coccidiosis [M]. Beijing: China Agricultural University Press, 1998). The cDNA expression library of sporulated oocysts of Eimeria giantiformis was preserved in the Parasitology Laboratory of the College of Veterinary Medicine, Nanjing Agricultural University.

[0038] 2. Experimental animals: 0-day-old Hy-Line Brown chicks were purchased from Nanjing Tegeli Planting Professional Cooperative. From hatching to the end of the experiment, they were raised in a coccidiostat-free environment and were allowed free access to food and water without anticoccidial drugs during the experiment.

[0039] 3. Bacterial strain: The E. maxima recombinant expression plasmid pET-28a-EmTregIM-1 was transformed into BL21 Escherichia coli to obtain a strain containing the pET-28a-EmTregIM-1 recombinant expression plasmid.

[0040] 4. Tools, enzymes, and reagents: The large-scale plasmid extraction kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; lymphocyte separation medium was purchased from Tianjin Haoyang Biotechnology Co., Ltd.; Mouse Anti Chicken CD4:PE was purchased from Southern Biotech; Human Anti Chicken CD25:FITC was purchased from Bio-Rad; protein standard markers were purchased from Thermo Fisher Scientific; His protein purification kit was purchased from GE Healthcare; polyacrylamide, N,N′-methylenebisacrylamide, and Coomassie Brilliant Blue were purchased from Shanghai Chemical Reagent Packaging Plant; BCA protein quantification kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; poly(D,L-Lactide-Co-Glycolide), PLGA, and polyvinyl alcohol (PVA) were purchased from Sigma Aldrich; the remaining reagents were domestically produced analytical grade.

[0041] 5. Major Instruments and Equipment: Flow cytometer (Beckman Coulter, USA); Refrigerated benchtop centrifuge (Eppendorf centrifuge 5417R); Constant temperature shaker (THZ, Taicang Experimental Equipment Factory, Jiangsu Province); Digital display constant temperature water bath (Changzhou Nuoji Instrument Co., Ltd.); Electrophoresis apparatus (DYY-11B, Beijing Liuyi Instrument Factory); Refrigerated ultracentrifuge (Beckman Coulter, USA); Vacuum freeze dryer (LABCONCO, USA); Scanning electron microscope (JEOL JSM-IT100, Japan).

[0042] Example 1. Screening of Treg-inducible molecule EmTregIM-1

[0043] 1. cDNA library grouping and immunization

[0044] The bacterial culture of *Eimeria giantis* sporulated oocyst cDNA library was divided into three primary sub-libraries and inoculated into LB medium. The media were incubated at 37°C and 220 rpm for 14–16 h in a constant temperature shaker. The plasmids for the cDNA library were extracted using an endotoxin-free plasmid extraction kit. The cDNA library plasmids were injected into 14-day-old chicks via intramuscular injection in the leg, 100 μg / chick. Equal volumes of pVAX1 empty plasmid and sterile PBS were injected into chicks as controls, 5 chicks / group.

[0045] 2. Lymphocyte isolation and detection

[0046] Blood was collected from chicks on days 3, 7, 11, and 14 post-immunization. Lymphocytes were isolated from the blood, and CD4+ levels in the lymphocytes were detected by flow cytometry. + CD25 + / CD4 + Cell proportions. The blood lymphocyte detection method is as follows: Collect anticoagulated blood and dilute it with an equal volume of PBS. Slowly add 5 ml of the diluted blood to a 15 ml centrifuge tube containing an equal volume of lymphocyte separation medium. Centrifuge at 2200 rpm for 20 min to observe liquid separation. Carefully aspirate the milky white middle layer of lymphocytes into a new 15 ml centrifuge tube, add PBS to 10 ml, centrifuge at 1800 rpm for 10 min, and repeat this washing step twice. Adjust the cell concentration to 1x10⁻⁶. 7Cells / ml were collected, and 100 μl was transferred to a 1.5 ml centrifuge tube. 2 μl of Mouse Anti-Chicken CD4:PE and 2 μl of Human Anti-Chicken CD25:FITC were added, and the cells were incubated at 4°C in the dark for 30 min. Simultaneously, three equal aliquots of cell samples were taken as controls: the first aliquot contained only 2 μl of Mouse Anti-Chicken CD4-PE, the second contained only 2 μl of Human Anti-Chicken CD25:FITC, and the third contained no antibody. All samples were incubated under the same conditions. After incubation, 500 μl of PBS was added for washing, followed by centrifugation at 2500 rpm for 5 min. This process was repeated once. Finally, 500 μl of PBS was added to resuspend the sample, and after thorough repositioning, the cells were analyzed by flow cytometry. Results are as follows: Figure 1 As shown in Figure A, CD4 in sub-library 3 on day 11 post-immunization. + CD25 + / CD4 + The proportion of cells is showing an upward trend.

[0047] 3. Screening of Treg-inducible molecules

[0048] A second round of screening will be conducted based on the test results (e.g.) Figure 1 As shown in B), the sub-library was divided into three sub-libraries, and plasmids were extracted to immunize 14-day-old chicks. Blood was collected from the chicks on day 11 post-immunization, and CD4 counts in lymphocytes were detected. + CD25 + / CD4 + The proportion of cells, and the results showed that CD4 in secondary sublibraries 3-7 and 3-8 + CD25 + / CD4 + The proportion of cells increased significantly in the second round of screening. CD4 cells were observed in this second round of screening. + CD25 + / CD4 + Single colonies were isolated from secondary sub-libraries 3-7, where the cell proportion increased significantly, for a third round of screening. Plasmids were extracted and used to immunize 14-day-old chicks. Blood was collected from the chicks on day 11 post-immunization, and CD4 counts in lymphocytes were detected. + CD25 + / CD4 + The proportion of cells, the results are as follows Figure 1 As shown in C, CD4 after immunization with plasmid 373 + CD25 + / CD4 + The proportion of cells increased significantly, which is the Treg-inducing molecule that can induce Treg proliferation.

[0049] 4. Identification of Treg-inducible molecules

[0050] The screened inducer molecule was sent to Sangon Biotech for sequencing, and the obtained sequence was compared using online software (https: / / blast.ncbi.nlm.nih.gov). The results showed that the inducer molecule sequence had 99.18% similarity to the Eimeria maxima hypothetical protein (sequence ID: XM_013478684.1). In this study, it was identified as a Treg inducer molecule and named EmTregIM-1.

[0051] Example 2. Induced expression and purification of recombinant protein rEmTregIM-1 from Eimeria giantiformis.

[0052] 1. Construction of pET-28a-EmTregIM-1 recombinant plasmid

[0053] Primers were designed based on the EmTregIM-1 sequence. The primer sequences are: EmTregIM-1-F: CCCAAGCTTGCATGACAGGAGTTGTGCTGG, EmTregIM-1-R: CCGCTCGAGTCATGCTGTCGGGGCTGCTATT , The EmTregIM-1 sequence was amplified by PCR. The PCR reaction program was as follows: 95℃ denaturation for 5 min, followed by 95℃ denaturation for 50 s, 55℃ annealing for 50 s, and 72℃ extension for 1 min, for 35 cycles, with a final extension at 72℃ for 5 min. The results were observed by 2% agarose gel electrophoresis after the reaction. Figure 2 As shown, the EmTregIM-1 amplified the target band, which was 291 bp in size, consistent with the expected result. The target fragment was recovered after double enzyme digestion and ligated into the linearized vector pET-28a to construct the pET-28a-EmTregIM-1 recombinant plasmid. The constructed recombinant plasmid was validated using restriction enzymes, and the results are shown below. Figure 3 As shown, after double enzyme digestion, the plasmids showed two bands, namely the pET-28a vector and the inserted gene EmTregIM-1, indicating that the plasmids were successfully constructed.

[0054] 2. Preparation of genetically engineered bacteria

[0055] The E. maxima recombinant expression plasmid pET-28a-EmTregIM-1 was transformed into BL21 Escherichia coli and cultured and identified to obtain strains containing the pET-28a-EmTregIM-1 recombinant expression plasmid.

[0056] 3. Induction and purification of rEmTregIM-1 recombinant protein

[0057] Bacteria containing the recombinant expression plasmid pET-28a-EmTregIM-1 were inoculated into LB liquid medium and cultured in a constant temperature shaker at 37°C and 200 rpm. When the bacterial culture OD... 600 When the concentration reached 0.4-0.6, IPTG was added to the bacterial culture to induce recombinant protein expression. After culturing for another 6 hours, the bacteria were collected, washed three times with PBS to remove the surface culture medium, and then the precipitate was resuspended in an appropriate amount of PBS. The bacteria were lysed by sonication, centrifuged at 8000 rpm for 20 min, and the supernatant and precipitate were collected for recombinant protein solubility analysis. The recombinant protein was purified using a His-tagged protein purification kit, identified by SDS-PAGE gel electrophoresis, and its concentration was determined using a BCA protein quantification kit. This constitutes the recombinant protein subunit vaccine for *Eimeria tenella*. Results (attached) Figure 4 The results showed that the recombinant protein rEmTregIM-1 was approximately 14.67 kDa, consistent with the expected result. The purified band was single, indicating that the recombinant protein was purified effectively.

[0058] 4. Preparation of the nano-subunit vaccine PLGA-rEmTregIM-1

[0059] Weigh 50 mg of PLGA and dissolve it in 1 mL of dichloromethane. Add 2 mL of 5% polyvinyl alcohol, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). Add 4 mg of recombinant protein rEmTregIM-1 dropwise to the mixture, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). The liquid will be milky white at this point. Slowly add 2 mL of 5% PVA to the liquid, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). Place the mixture in a fume hood for about 4 h to evaporate the organic solvent, and centrifuge for 30 min in a refrigerated ultracentrifuge at 30,000 rpm. After centrifugation, the supernatant and precipitate were collected. The total volume of the supernatant was measured, and the protein concentration in the supernatant was determined using a BCA protein quantification kit. The embedding efficiency of the PLGA-coated recombinant protein was calculated (embedding efficiency = (total amount of added protein - total amount of protein in the supernatant) / total amount of added protein × 100%). The precipitate was resuspended in deionized water, placed in a -80℃ freezer for 2 hours, and then freeze-dried in a vacuum freeze dryer for approximately 20 hours. The freeze-dried sample was then removed; this is the PLGA-coated nanosubunit vaccine. A small amount of the nanosubunit vaccine was observed using a scanning electron microscope, while the remainder was stored at 4℃ for later use. Calculations showed that the embedding efficiency of the PLGA-coated recombinant protein was 81.3%. Scanning electron microscopy revealed that the nanosubunit vaccine was irregularly spherical (see attached image). Figure 5 The diameter is approximately 50nm-200nm.

[0060] Example 3. Observation on the immunoprotective effect of Eimeria giant subunit vaccine and nano subunit vaccine

[0061] 1. Experimental Design

[0062] Hy-Line Brown chicks aged 0 days were raised under coccidiosis-free conditions until 14 days of age, at which point they were weighed and grouped. Individuals with significant weight differences were removed, and the chicks were randomly divided into 5 groups of 20 each: a rEmTregIM-1 subunit vaccine immunization group, a PLGA-rEmTregIM-1 nanosubunit vaccine immunization group, and a PLGA immunization group. The control group consisted of an uninfected and unimmunized group and an infected and unimmunized group. The immunized groups received an intramuscular injection of 200 μg of the corresponding subunit vaccine or nanosubunit vaccine via the leg, respectively. The PLGA immunization group received the same dose of PLGA, and the control group received the same volume of sterile PBS. A booster immunization was administered at 21 days of age, with the same dose as the first immunization. At 28 days of age, the chicks were weighed again. Except for the uninfected and unimmunized group, all other groups were orally infected with Eimeria giantiformis sporulated oocysts, 1 x 10 mm per chick. 5 All chicks were euthanized after being raised for 35 days. The anticoccidial index was calculated by statistically analyzing the weight gain, survival rate, lesion score, and oocyst production of each group.

[0063] 2. Observation of immune protection effect

[0064] 2.1 Weight Changes

[0065] Chicks at 14 days old (at first vaccination), 28 days old (at infection), and 35 days old (at euthanasia) were weighed and their weights recorded. The weight changes of the chicks in different groups were observed, and the average weight gain and relative weight gain rate were calculated. The weight changes are shown in Table 1.

[0066] Average weight gain = weight at the time of dissection - weight at the time of insect attack

[0067] Relative weight gain rate (%) = (Average weight gain of the experimental group / Average weight gain of the non-infected and non-immunized group) × 100

[0068] Table 1. Weight changes of chickens at different days in the experiment.

[0069]

[0070] Note: Different lowercase letters in the same column of the table indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

[0071] 2.2 Intestinal lesion scoring

[0072] After necropsy, the intestines of the animals were cut open to observe the lesions. Intestinal lesions were scored according to the lesion scoring method of Johnson et al. (Suo Xun, Li Guoqing. Chicken Coccidiosis [M]. Beijing: China Agricultural University Press, 1998, 297-298). The specific criteria were: 0 points, no lesions; +1 point, a few faint hemorrhages are visible on the serosa of the mid-section of the small intestine, a small amount of orange-yellow mucus is visible in the intestinal lumen, and the shape of the intestinal tube is normal; +2 points, numerous hemorrhages are visible on the serosa of the mid-section of the small intestine, a large amount of orange-yellow mucus is visible in the intestinal lumen, and the intestinal wall is thickened; +3 points, the small intestine is distended with gas, the intestinal wall is thickened, the mucosa is rough, and the contents of the small intestine contain small blood clots and mucus; +4 points, the small intestine is significantly distended with gas, the intestinal wall is thickened, and the intestinal contents contain a large number of blood clots and reddish-brown blood; dead chickens were scored 4 points.

[0073] Lesion score = average lesion score × 10.

[0074] 2.3 Oocyte count

[0075] Intestinal contents were collected, and the McMaster method was used to count the number of oocysts in the intestine. The specific procedure was as follows: 2g of the intestinal contents was mixed and placed in a small beaker. 10ml of saturated saline was added and gently stirred. Then, saturated saline was added to bring the volume to 60ml. After mixing, the mixture was filtered, and the filtrate was poured into both counting chambers of a McMaster counting chamber. After standing for 2 minutes, the oocysts were counted under a microscope. The number of oocysts per gram of intestinal contents (OPG) = the average number of oocysts in the two counting chambers × 200.

[0076] The oocyst ratio was calculated based on the OPG values ​​of each group, and then converted into an oocyst value. If the oocyst ratio was 0%-1%, the oocyst value was 0; if it was 1%-25%, the oocyst value was 5; if it was 26%-50%, the oocyst value was 10; if it was 51%-75%, the oocyst value was 20; and if it was 76%-100%, the oocyst value was 40. Oocyst ratio (%) = OPG of experimental group / OPG of infected / unimmunized group × 100.

[0077] 2.4 Anticoccidial Index (ACI)

[0078] Based on the above statistical results, the relative weight gain rate, lesion count, oocyst count, and survival rate of each group were obtained. The anticoccidial index (ACI) was calculated for each group to evaluate the protective efficacy of the subunit vaccine rEmTregIM-1 and the nanosubunit vaccine PLGA-rEmTregIM-1 against E. maxima infection. The formula for calculating ACI is: ACI = (Survival rate + Relative weight gain rate) - (Lesion count + Oocyst count)

[0079] Survival rate (%) = (Number of surviving chickens in the group / Total number of chickens in the group) × 100

[0080] Relative weight gain rate (%) = (Average weight gain of the experimental group / Average weight gain of the non-infected and non-immunized group) × 100

[0081] Lesion score = average lesion score × 10.

[0082] The criteria for determining ACI are as follows: an ACI of 180 or above indicates excellent protection, 160-180 indicates good protection, 120-160 indicates poor protection, and below 120 indicates ineffective protection.

[0083] 3. Analysis of immune protection effect

[0084] Data from different groups were analyzed using one-way ANOVA in GraphPad Prism 8 statistical analysis software. Table 1 shows that at 14 days of age (first immunization), there was no significant difference in body weight among the groups (P>0.05), indicating reasonable grouping and laying a good foundation for subsequent animal immunization and challenge experiments. Animals were immunized with subunit vaccine rEmTregIM-1 and nanosubunit vaccine PLGA-rEmTregIM-1 at 14 and 21 days of age, respectively. At 28 days of age, except for the uninfected and unimmunized group, all other groups were orally infected with sporulated oocysts of *Eimeria giantiformis*. After treatment with the parasite, the animals were raised until 35 days of age. Significant differences were observed in body weight and relative weight gain among the different groups. Compared with the unvaccinated group, the subunit vaccine rEmTregIM-1 and the nano subunit vaccine PLGA-rEmTregIM-1 immunized groups showed significant differences in body weight (P<0.05) and significantly increased relative weight gain (P<0.05), indicating that the subunit vaccine rEmTregIM-1 and the nano subunit vaccine PLGA-rEmTregIM-1 can resist the weight loss in chickens caused by Eimeria giantiformis infection.

[0085] As shown in Table 2, intestinal lesion scores and oocyst counts revealed that lesions appeared in the intestines of chickens in all groups after E. maxima infection, but the severity of the lesions varied. Compared with the unimmunized group, the intestinal lesions in the subunit vaccine rEmTregIM-1 and nano subunit vaccine PLGA-rEmTregIM-1 immunized groups were significantly milder (P<0.05), and the number of oocysts was significantly reduced (P<0.05). This indicates that immunization with the subunit vaccine rEmTregIM-1 and the nano subunit vaccine PLGA-rEmTregIM-1 can reduce the intestinal lesions and the number of oocysts excreted in E. maxima-infected animals to varying degrees, mitigating the harm caused by E. maxima infection and reducing the risk of disease transmission. The ACI values ​​of the subunit vaccine rEmTregIM-1 and the nanosubunit vaccine PLGA-rEmTregIM-1 were 139.35 and 142.15, respectively, indicating that these vaccines provided poor immunoprotective efficacy against E. maxima infection. To improve the immunoprotective efficacy of the vaccines, experiments can be conducted on the route of immunization, dosage, and number of immunizations to optimize the immunization schedule and enhance the vaccine's protective effect on animals.

[0086] Table 2 Evaluation of the immunoprotective efficacy of subunit and nanosubunit vaccines against E. maxima infection.

[0087]

[0088] Note: Different lowercase letters in the same column of the table indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

Claims

1. A method for preventing Eimeria giantis coccidia ( E. maxima The nano-subunit vaccine for coccidiosis in chickens caused by [the virus] is characterized by, The aforementioned method for preventing Eimeria giantis coccidioidomyelitis ( E. maxima The nano-subunit vaccine for chicken coccidiosis caused by Eimeria giantiformis is prepared by coating recombinant protein rEmTregIM-1 with PLGA nanoparticles. The recombinant protein rEmTregIM-1 is a Treg inducer of Eimeria giantiformis, and its encoding gene sequence is shown in SEQ ID NO.

1.

2. The method for preventing Eimeria giantis (as described in claim 1) E. maxima The nano-subunit vaccine for coccidiosis in chickens caused by [the virus] is characterized by, The recombinant protein rEmTregIM-1 was obtained by transforming the recombinant expression plasmid pET-28a-EmTregIM-1 into BL21 Escherichia coli for induced expression, and the expressed recombinant protein rEmTregIM-1 was purified using a His protein purification kit.

3. The method for preventing Eimeria giantis as described in claim 1 ( E. maxima The nano-subunit vaccine for coccidiosis in chickens caused by [the virus] is characterized by, The recombinant expression plasmid pET-28a-EmTregIM-1 is prepared by inserting the gene sequence encoding the recombinant protein rEmTregIM-1 shown in SEQ ID NO.1 into the pET-28a vector. Hind III and Xho Obtained between I restriction sites.

4. The method for preventing Eimeria giantis coccidia according to claim 1 ( E. maxima The nano-subunit vaccine for coccidiosis in chickens caused by [the virus] is characterized by, The nano-subunit vaccine is irregularly spherical with a diameter of 50 nm to 200 nm.

5. The method for preventing Eimeria giantis coccidia as described in claim 1 (… E. maxima A method for preparing a nano-subunit vaccine against coccidiosis in chickens caused by [a specific disease], characterized in that, Includes the following steps: (1) Construct the recombinant expression plasmid pET-28a-EmTregIM-1; (2) Transform BL21 Escherichia coli with the recombinant expression plasmid pET-28a-EmTregIM-1 to obtain bacteria containing the recombinant expression plasmid pET-28a-EmTregIM-1; (3) Bacteria containing the recombinant expression plasmid pET-28a-EmTregIM-1 were inoculated into LB liquid medium and cultured. When the bacterial culture OD 600 When the value reaches 0.4-0.6, IPTG is added to the bacterial culture to induce the expression of recombinant protein. After culturing for another 6 h, the bacteria are collected, washed with PBS, and then the precipitate is resuspended in an appropriate amount of PBS. The bacteria are lysed by sonication, centrifuged at 8000 rpm for 20 min, and the supernatant is collected. The recombinant protein is purified using a His-tagged protein purification kit. The recombinant protein is identified by SDS-PAGE gel electrophoresis, and the concentration of the recombinant protein is determined by a BCA protein quantification kit. (4) The preparation method of the nano subunit vaccine is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex mix, sonicate under ice bath conditions, add recombinant protein rEmTregIM-1 dropwise to the mixture, vortex mix, sonicate under ice bath conditions, at this time the liquid is milky white, add 5% PVA, vortex mix, sonicate under ice bath conditions, evaporate the organic solvent, collect the liquid, centrifuge with a refrigerated ultracentrifuge, collect the supernatant and precipitate, resuspend the precipitate with deionized water, place it in a -80 ℃ freezer for 1~3 h, and then freeze dry it with a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano subunit vaccine.

6. The preparation method according to claim 5, characterized in that, The recombinant expression plasmid pET-28a-EmTregIM-1 described in step (1) is formed by inserting the coding sequence of the recombinant protein rEmTregIM-1 from *Eimeria tenella* (SEQ ID NO. 1) into the pET-28a vector. Hind III and Xho Obtained between I restriction sites.

7. The preparation method according to claim 5, characterized in that, Step (4) Preparation of the nano-subunit vaccine: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex to mix, and sonicate for 3-8 min under ice bath conditions. Add recombinant protein rEmTregIM-1 dropwise to the mixture, vortex to mix, and sonicate for 3-8 min under ice bath conditions. At this time, the liquid is milky white. Add 2 mL of 5% PVA, vortex to mix, and sonicate for 3-8 min under ice bath conditions. Place it in a fume hood for about 4 hours to evaporate the organic solvent. Collect the liquid and centrifuge it for 30 min using a refrigerated ultracentrifuge at a speed of 25000-32000 r / min. After centrifugation, collect the supernatant and precipitate separately. Resuspend the precipitate in deionized water, place it in a -80 ℃ refrigerator for 2 hours, and then freeze-dry it for 18-22 minutes using a vacuum freeze dryer. h, take out the lyophilized sample, which is the prepared nano-subunit vaccine; wherein the mass-volume ratio of PLGA to dichloromethane is 40~100mg:1mL, the volume ratio of 5% polyvinyl alcohol to dichloromethane is 1~5:1, and the mass-volume ratio of recombinant protein rEmTregIM-1 to dichloromethane is 3~5mg:1mL.

8. The preparation method according to claim 6, characterized in that, The ultrasound conditions were as follows: ultrasound power 40W, ultrasound duration 5 seconds, interval 5 seconds.

9. The use of a recombinant expression vector containing the gene sequence encoding the recombinant protein rEmTregIM-1 as described in claim 1 in the preparation of a vaccine to prevent infection with Eimeria giantiformis in chickens.

10. The application according to claim 9, characterized in that, The recombinant expression vector containing the Eimeria giant coccidia lysophospholipase coding gene sequence is constructed by inserting the Eimeria giant coccidia lysophospholipase coding sequence shown in SEQ ID NO.1 into the pET-28a vector. Hind III and Xho The vaccine is obtained between the I restriction enzyme sites; the vaccine described is a nano-subunit vaccine.

Citation Information

Patent Citations

  • CN110559432A

  • CN113289010A