A sourdough starter and its preparation and application

Abstract

The invention belongs to the technical field of leavening agents, and specifically relates to a sourdough leavening agent and its preparation and application. The sourdough leavening agent, in parts by weight, comprises: 50-80 parts of lactic acid bacteria powder, 1-5 parts of yeast powder, 100-1000 parts of bran, 300-500 parts of yeast extract, 0.1-0.3 parts of plant extract, 0.1-0.2 parts of reduced glutathione, 500-1000 parts of flour and 500-1000 parts of water. The sourdough leavening agent is not only controllable in fermentation, but also does not require activation and expansion culture when used, is easy to use, convenient for transportation and storage, and is suitable for large-scale industrial production; and it utilizes lactic acid bacteria + yeast for synergistic fermentation, has strong acid production ability and fast fermentation speed, while retaining the flavor of traditional fermented foods, reduces the contamination of miscellaneous bacteria, and improves food safety; the sourdough leavening agent can also be applied to Chinese pastries, Western pastries, and traditional rice and flour fermented products to increase flavor, improve taste, improve texture, and extend the shelf life of products.

Description

Technical Field

[0001] The invention belongs to the technical field of leavening agents, and in particular relates to a sourdough leavening agent and a preparation method and application thereof. Background Art

[0002] Sourdough is a mixture of flour and water fermented by lactic acid bacteria and yeast. It is a traditional leavening agent for pasta worldwide and is considered one of the oldest biotechnologies. In Europe and other regions, sourdough is mainly used to make bread, especially traditional sourdough and rye bread. Sourdough is generally called "old dough" or "old yeast" in my country. It is mainly used to make traditional fermented pasta such as steamed buns, dumplings and naan, and has a history of more than a thousand years.

[0003] According to different production processes, sourdough can be roughly divided into four categories. The first category is traditional naturally fermented sourdough, in which the microorganisms come from the natural environment and are not artificially inoculated with microorganisms. After each use, a piece is left as a starter for the next time. The dough is in a solid state. This category is mainly used for family use and small workshop production. The second category is artificially inoculated fermented sourdough, that is, the so-called industrial sourdough, which is usually inoculated with a specific type of lactic acid bacteria separated from traditional sourdough (sometimes yeast is also added). The dough is in a semi-fluid state, which is convenient for pipeline transportation during industrial production. The third category is the dried product of the second category, which is usually freeze-dried and spray-dried to make it into a powdered solid, which is more convenient for storage and transportation. The fourth category is mixed sourdough, that is, the starting sourdough is prepared by inoculating specific strains (lactic acid bacteria, yeast or a mixture of the two), and then used and activated in the same way as the first category of sourdough. During this process, the microorganisms initially inoculated in the dough may be replaced by microorganisms later introduced into the environment, making the latter the dominant strain of the sourdough.

[0004] Compared with the systematic research and industrial production of sourdough abroad, the current research on the flora, auxiliary materials and related mechanisms of sourdough in China is relatively weak. At present, the first type of traditional sourdough is widely used in China, but it is mostly homemade by families and small workshops, with poor fermentation stability, and the fermentation agent products are not conducive to large-scale industrial application, low production efficiency, and low degree of continuity. On the other hand, the unstable flora composition leads to food safety risks. The second and third types of sourdough processes are still in the research stage, and there is a lack of relevant mature products on the market. Therefore, it is very important to develop scientifically proportioned and standardized sourdough starters.

[0005] A Chinese patent application with publication number CN104957217B discloses a sourdough, steamed bread and a production method thereof. The invention is to add rice wine lees powder to the production process of Lactobacillus plantarum CGMCC No.8097 sourdough to provide polysaccharide-protein complexes, oligosaccharides, amylase, etc. to improve the anti-aging quality of steamed bread. The steamed bread obtained by the inventive method not only has good anti-aging properties and flavor quality, but also has the functions of lowering blood sugar, lowering blood lipids, improving immunity, improving sleep, and enhancing memory. Moreover, its production process is energy-saving and environmentally friendly, and the added value of rice wine production by-products is increased. However, the sourdough of the invention is prepared mainly with Lactobacillus plantarum, and the sourdough does not contain yeast, which does not meet the requirements of the industry standard QB / T5756-2022.

[0006] A Chinese patent application with publication number CN102960620B discloses a direct-throw plant lactic acid bacteria sour dough starter, a preparation method and use thereof. The invention provides a direct-throw plant lactic acid bacteria sour dough starter preparation method comprising the steps of activating plant lactobacillus, preparing a direct-throw plant lactobacillus dough starter and the like. The sour dough starter mainly focuses on delaying product aging.

[0007] The Chinese patent application with publication number CN115669699A discloses a sourdough fermentation agent dry powder and a preparation method thereof. The sourdough is prepared with flour, lactic acid bacteria fermentation liquid, yeast fermentation liquid and water as the main raw materials, and the sourdough is fermented by adding enzyme preparations and emulsifiers, and then the sourdough is fermented by expanding the culture, mixing with grain flour and fermenting at room temperature, and then drying and crushing to prepare the sourdough fermentation agent dry powder. However, the strains such as Lactobacillus sanfrancisco involved in the invention have not obtained the qualification for food use, and the fermentation procedure is complicated, resulting in limited use. Summary of the invention

[0008] Technical problems solved by the present invention:

[0009] The sourdough starter in the prior art has poor fermentation stability, the starter product is not conducive to large-scale industrial application, the production efficiency is low, and the continuity is low. At the same time, the sourdough starter in the prior art has unstable flora components, which leads to hidden dangers of food safety and is difficult to be widely used in Chinese pastries, Western pastries, and traditional rice and flour fermented products.

[0010] In order to solve the above technical problems, the present invention proposes the following technical solutions:

[0011] (1) To provide a sourdough starter, which has controllable fermentation, does not require activation and expansion culture when used, is easy to use, easy to transport and store, and is suitable for large-scale industrial production;

[0012] (2) Provide a sourdough starter, which utilizes lactic acid bacteria + yeast for synergistic fermentation, has strong acid production capacity and fast fermentation speed, reduces bacterial contamination while retaining the flavor of traditional fermented foods, and improves food safety;

[0013] (3) A sourdough starter is provided, which can increase flavor, enhance taste, improve texture, and extend the shelf life of products when used in Chinese pastries, Western pastries, and traditional rice and flour fermented products.

[0014] In view of the above technical problems, the present invention provides a preparation and application of a sourdough starter.

[0015] Specifically, the present invention provides the following technical solutions:

[0016] In a first aspect, the present invention provides a sourdough starter, which comprises, by weight, 50-80 parts of lactic acid bacteria powder, 1-5 parts of yeast powder, 100-1000 parts of bran, 300-500 parts of yeast extract, 0.1-0.3 parts of plant extract, 0.1-0.2 parts of reduced glutathione, 500-1000 parts of flour and 500-1000 parts of water.

[0017] Preferably, in parts by weight, the lactic acid bacteria powder is 50-60 parts; and / or the yeast powder is 1-2 parts; and / or the bran is 200-300 parts; and / or the plant extract is 0.1-0.15 parts; and / or the reduced glutathione is 0.15-0.2 parts; and / or the yeast extract is 400-450 parts; and / or the flour is 500-600 parts; and / or the water is 500-600 parts.

[0018] Preferably, the viable count of the lactic acid bacteria powder is 5.0×10 10 -8.0×10 10 CFU / g.

[0019] Preferably, the viable count of the yeast powder is 1.0×10 10 -5.0×10 10 CFU / g; and / or, based on the weight of the yeast powder, the moisture content is 1-5% (w / w).

[0020] Preferably, the lactic acid bacteria powder is a powder made from lactic acid bacteria; more preferably, the lactic acid bacteria is Lactobacillus plantarum; most preferably, the Lactobacillus plantarum is Lactobacillus plantarum Ali.Plateau.LP.VIII, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M2022068;

[0021] And / or, the yeast powder is powder made from yeast; preferably, the yeast is Saccharomyces cerevisiae; more preferably, the Saccharomyces cerevisiae Qiongjie-SC-100, which is deposited in China Center for Type Culture Collection (CCTCC) with the deposit number: CCTCC NO: M 2024122.

[0022] Preferably, the yeast extract comprises one or more of yeast extract powder and yeast peptone.

[0023] Preferably, the plant extract is a plant extract with antibacterial function; preferably, the plant extract includes one or more of clove extract, cinnamon extract, dandelion extract and perilla extract.

[0024] Preferably, the flour is one or more of wheat flour, whole wheat flour and rye flour.

[0025] Preferably, the 18S rDNA gene sequence of the Saccharomyces cerevisiae is as shown in SEQ ID NO.1.

[0026] Preferably, the Saccharomyces cerevisiae has the property of producing ester substances.

[0027] Preferably, the lactic acid bacteria powder is prepared by the following steps:

[0028] (1) amplifying and culturing lactic acid bacteria;

[0029] (2) adding the product obtained in step (1) to a liquid culture medium, fermenting and culturing at 34-37° C., and then centrifuging to collect lactic acid bacteria sludge, preferably, centrifuging to collect lactic acid bacteria sludge at 0-4° C., 5000-9000 r / min, and 10-15 min;

[0030] (3) washing and freeze-drying the lactic acid bacteria mud to obtain lactic acid bacteria powder;

[0031] Among them, preferably, the lactic acid bacteria is Lactobacillus plantarum; more preferably, the lactic acid bacteria is Lactobacillus plantarum Ali. Plateau. LP. VIII.

[0032] Preferably, freeze-drying is performed by adding a freeze-drying protectant in a ratio of lactic acid bacteria mud: freeze-drying protectant = 1:2-5 (w / w), wherein the freeze-drying protectant comprises: one or more of 15-30% skim milk and 5-15% trehalose, based on the total weight percentage of the freeze-drying protectant.

[0033] Preferably, the yeast powder is prepared by the following steps:

[0034] (1) amplifying and culturing yeast;

[0035] (2) adding the product obtained in step (1) to a liquid culture medium, fermenting and culturing at 30±2° C. to obtain a yeast fermentation broth, and then centrifuging the yeast fermentation broth to collect yeast sludge; preferably, centrifuging the yeast sludge at 0-4° C., 5000-9000 r / min, and 10-15 min;

[0036] (3) washing, filtering, granulating and drying the yeast sludge to obtain yeast powder; wherein, preferably, the yeast is Saccharomyces cerevisiae; more preferably, the Saccharomyces cerevisiae is Saccharomyces cerevisiae Qiongjie-SC-100.

[0037] Preferably, in step (3), the filter pressing conditions are: the filter pressing pressure is 0.4-0.6 MPa.

[0038] Preferably, in step (3), the granulation conditions are: the aperture of the granulation screen is 1-4 mm.

[0039] Preferably, the drying conditions are: drying by using a boiling drying bed, wherein the drying temperature of the first-stage vertical drying bed is 35-42°C, and the drying temperature of the second-stage fluidized drying bed is 35-43°C.

[0040] Preferably, the ester content in the yeast fermentation broth is 5-8 g per liter of yeast fermentation broth.

[0041] Preferably, the yeast fermentation liquid has the characteristic of producing aroma; preferably, the aroma is one or more of fruity aroma, fat aroma, floral aroma, wine aroma and nutty aroma.

[0042] In a second aspect, the present invention provides a method for preparing the sourdough starter, comprising the steps of mixing, fermenting and drying components containing lactic acid bacteria powder and yeast powder.

[0043] Preferably, the method comprises the following steps:

[0044] (1) Fermentation: lactic acid bacteria powder, yeast powder, bran, yeast extract, plant extract, reduced glutathione, flour and water are mixed and fermented to obtain sour dough.

[0045] (2) Drying: Drying the sourdough slurry to obtain a sourdough starter.

[0046] Preferably, in step (1), the fermentation temperature is 30-37° C. and the fermentation time is 24-48 h.

[0047] Preferably, in step (2), the drying method is hot air-vacuum freeze-drying combined with drying.

[0048] Preferably, the hot air-vacuum freeze-drying comprises: pre-freezing the sour dough obtained in step (1) at -20 to -40 degrees Celsius, vacuum freeze-drying, and hot air drying when the moisture content of the sour dough reaches 20-30%.

[0049] Preferably, the vacuum freeze-drying conditions are main drying: -10±5°C, 1-200Pa, 5-7h; post-drying: 30±3°C, 1-100Pa, 5-9h; and the hot air drying conditions are 60±5°C, 3-5h.

[0050] Preferably, the sourdough starter or the sourdough starter prepared by the preparation method has a pH of 3.85-4.00; and / or an acidity of 20-25 g / kg based on the total amount of lactic acid produced per kilogram of the sourdough starter; and / or a viable lactic acid bacteria count of 1.0-7.0×10 8 CFU / g; and / or the number of live yeast cells of the sourdough starter is 2.0-5.0×10 6 CFU / g.

[0051] In a third aspect, the present invention provides a Chinese pastry containing the sourdough starter or the sourdough starter prepared by the preparation method; preferably, the Chinese pastry is steamed bun.

[0052] Preferably, the sourdough starter or the sourdough starter prepared by the preparation method is used in making Chinese pastries; preferably, it is used in making steamed buns.

[0053] Preferably, the Chinese pastry or the steamed bread or the application is added with 1-20% (w / w) sour dough starter based on the total weight of the raw materials of the Chinese pastry or the steamed bread.

[0054] In a fourth aspect, the present invention provides a western-style pastry containing the sourdough starter or the sourdough starter prepared by the preparation method; preferably, the western-style pastry is bread.

[0055] Preferably, the sourdough starter or the sourdough starter prepared by the preparation method is used in making western-style pastries; preferably, it is used in making bread.

[0056] Preferably, the western-style pastry or the bread or the application is added with 1-20% (w / w) sourdough starter based on the total weight of the raw materials of the western-style pastry or the bread.

[0057] In a fifth aspect, the present invention provides a rice and flour fermented product, comprising the sourdough starter or the sourdough starter prepared by the preparation method; preferably, the rice and flour fermented product is a steamed rice cake.

[0058] Preferably, the sourdough starter or the sourdough starter prepared by the preparation method is used in the production of rice and flour fermented products; preferably, it is used in the production of rice cakes.

[0059] Preferably, the fermented rice flour product or the steamed rice cake or the use comprises 1-20% (w / w) sourdough starter, based on the total weight of the raw materials of the fermented rice flour product or the steamed rice cake.

[0060] Beneficial effects of the present invention:

[0061] (1) Advantages of bacterial strain performance: Lactobacillus plantarum Ali.Plateau.LP.Ⅷ has strong acid production ability, strong antibacterial ability against Escherichia coli and Staphylococcus aureus, strong DPPH free radical scavenging ability and hydroxyl free radical scavenging ability, and high antioxidant activity; Saccharomyces cerevisiae Qiongjie-SC-100 has strong ester production ability, and the fermentation liquid has the most intense wine, fruity and fatty aroma;

[0062] (2) Advantages of the ratios of the various components in the sourdough starter: Lactic acid bacteria and yeast have the advantage of synergistic fermentation. The fermented dough has both sour and alcoholic flavors, and the flavor is richer and stronger, which can solve the problem of bland flavor caused by single-bacteria fermentation. The yeast extract and bran in the formula provide sufficient nutrition for the core fermentation flora, further promoting its growth and metabolism and shortening the dough fermentation cycle. The core flora has strong acid resistance, which can solve the problem of weakened fermentation activity and insufficient acid production in the later stage. The plant extract and reduced glutathione in the formula give the dough antibacterial and soft properties, respectively.

[0063] (3) Application advantages of sourdough starter: The prepared sourdough starter is dried using a hot air-vacuum freeze-drying technology, which not only reduces the loss of viable bacteria and acidity, but also saves energy and reduces costs. The prepared dry powder direct-throw sourdough starter does not require activation and expansion of culture when used. It is easy to use, transport and store, and is suitable for large-scale industrial production. When the sourdough starter is used in the preparation of steamed buns, bread, rice cakes and other foods, it can increase flavor, improve texture, enhance taste, preserve freshness, and extend shelf life. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The colony morphology and microscopic observation pictures of Saccharomyces cerevisiae Qiongjie-SC-100 are shown.

[0065] Figure 2 These are the results of the determination of the ester production capacity of the fermentation broth of Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263.

[0066] Figure 3 This is the aroma evaluation chart of the fermentation broth of Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263.

[0067] Figure 4 This is a comparison chart of the antiseptic test of steamed bread in Application Example 2.

[0068] Figure 5 This is a morphological comparison diagram of the sugar-free sourdough bread in Application Example 3.

[0069] Strain deposit information

[0070] The present invention provides Lactobacillus plantarum Ali.Plateau.LP.VIII, which was deposited in China Center for Type Culture Collection (CCTCC) on January 13, 2022, with a deposit number of CCTCC NO: M2022068, and a deposit address of Wuhan University, Wuhan, China, with a postal code of 430072 and a telephone number of 027-68754052. In addition, it has been recorded in a Chinese patent application with application number 202210895628.7 and publication number CN115838654A.

[0071] The brewer's yeast Qiongjie-SC-100 (Saccharomyces cerevisiae Qiongjie-SC-100) provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on January 16, 2024, with a deposit number of CCTCC NO: M 2024122, a deposit address of Wuhan University, Wuhan, China, postal code: 430072; telephone: 027-68754052. DETAILED DESCRIPTION

[0072] The sourdough starter in the prior art has the problems of poor fermentation stability, the starter product is not conducive to large-scale industrial application, low production efficiency and potential product safety hazards.

[0073] In order to solve the above technical problems, the present invention provides the following specific solutions:

[0074] A sourdough starter, characterized in that, measured in parts by weight, the sourdough starter comprises: 50-80 parts of lactic acid bacteria powder, 1-5 parts of yeast powder, 100-1000 parts of bran, 300-500 parts of yeast extract, 0.1-0.3 parts of plant extract, 0.1-0.2 parts of reduced glutathione, 500-1000 parts of flour and 500-1000 parts of water.

[0075] In order to solve the above technical problems, the present invention also provides the following technical solutions.

[0076] A strain of Saccharomyces cerevisiae is Saccharomyces cerevisiae Qiongjie-SC-100, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 2024122.

[0077] Preferably, the 18S rDNA gene sequence of the Saccharomyces cerevisiae is as shown in SEQ ID NO.1.

[0078] Preferably, it has the property of generating ester species.

[0079] In a specific embodiment of the present invention, the present invention provides a fermentation preparation method of yeast fermentation broth, and the fermentation preparation method comprises the following steps:

[0080] (1) amplifying and culturing yeast;

[0081] (2) adding the product obtained in step (1) to a liquid culture medium and fermenting at 30±2° C.;

[0082] Among them, preferably, the yeast is Saccharomyces cerevisiae; more preferably, the Saccharomyces cerevisiae is Saccharomyces cerevisiae Qiongjie-SC-100.

[0083] In another specific embodiment of the present invention, a yeast fermentation broth is provided, which is prepared according to the fermentation preparation method of the yeast fermentation broth.

[0084] Preferably, the ester content in the yeast fermentation broth is 5-8 g per liter of yeast fermentation broth.

[0085] Preferably, the yeast fermentation liquid has the characteristic of producing aroma; preferably, the aroma is one or more of fruity aroma, fat aroma, floral aroma, wine aroma and nutty aroma.

[0086] In another specific embodiment of the present invention, a method for preparing yeast powder is provided, characterized in that it comprises the following steps:

[0087] (1) amplifying and culturing the yeast strain;

[0088] (2) adding the product obtained in step (1) to a liquid culture medium, fermenting and culturing at 30±2° C. to obtain a yeast fermentation broth, and then centrifuging the yeast fermentation broth to collect yeast sludge; preferably, centrifuging the yeast sludge at 0-4° C., 5000-9000 r / min, and 10-15 min;

[0089] (3) washing, filtering, granulating and drying the yeast sludge to obtain yeast powder; wherein, preferably, the yeast is Saccharomyces cerevisiae; more preferably, the yeast is Saccharomyces cerevisiae Qiongjie-SC-100.

[0090] Preferably, in step (3), the filter pressing conditions are: the filter pressing pressure is 0.4-0.6 MPa.

[0091] Preferably, in step (3), the granulation conditions are: the aperture of the granulation screen is 1-4 mm.

[0092] Preferably, the drying conditions are: drying by using a boiling drying bed, wherein the drying temperature of the first-stage vertical drying bed is 35-42°C, and the drying temperature of the second-stage fluidized drying bed is 35-43°C.

[0093] In a specific embodiment of the present invention, a yeast powder is provided, characterized in that it is prepared by the brewing Saccharomyces cerevisiae.

[0094] Preferably, it is prepared by the yeast powder preparation method.

[0095] Preferably, the moisture content of the yeast powder is 1-5% (w / w) based on the weight of the yeast powder.

[0096] Preferably, the viable count of the yeast powder is 1.0×10 10 -5.0×10 10 CFU / g.

[0097] Preferably, the brewer's yeast or the yeast powder is used in preparing a sourdough starter.

[0098] In the present invention, the yeast extract includes one or more of yeast extract powder and yeast peptone.

[0099] The plant extract is a plant extract with antibacterial function; preferably, the plant extract includes one or more of clove extract, cinnamon extract, dandelion extract and perilla extract.

[0100] The flour is one or more of wheat flour, whole wheat flour and rye flour.

[0101] Among them, the role of the lactic acid bacteria powder is to reduce pH, provide flavor, inhibit bacteria and preserve freshness. The role of the yeast powder is to provide flavor. The role of the bran and yeast extract is to supplement the nitrogen source for the sourdough starter, so that the starter ferments more stably and quickly, thereby supplementing sufficient nutrition for the core fermentation flora, further promoting its growth and metabolism, and shortening the dough fermentation cycle. The role of the plant extract is to have an antibacterial effect. The role of the reduced glutathione (GSH) is to effectively improve the rheological properties of the dough, reduce the strength of the dough, weaken the formation of gluten, and make the dough soft and loose.

[0102] In another specific embodiment of the present invention, a method for preparing a sourdough starter is provided.

[0103] The preparation method of the sourdough starter comprises the following steps:

[0104] (1) Fermentation: lactic acid bacteria powder, yeast powder, bran, yeast extract, plant extract, reduced glutathione (GSH), flour and water are mixed evenly, and fermented in an incubator at 30-37° C. for 24-48 hours to obtain sour dough.

[0105] (2) Drying: The sourdough paste is dried by hot air-vacuum freeze combined drying technology. The sourdough paste is placed on a plate and pre-frozen at -20°C, and then vacuum freeze-dried. After the moisture content is 20-30%, hot air drying is performed to obtain the sourdough starter. The vacuum freeze drying conditions are: main drying at -10±5°C, 121Pa, 5-7h; post-drying at 30±3°C, 77Pa, 5-9h; hot air drying conditions are 60±5°C, 3-5h.

[0106] In another specific embodiment of the present invention, a method for preparing lactic acid bacteria powder is provided.

[0107] The preparation method of the lactic acid bacteria powder comprises the following steps: inoculating the activated lactic acid bacteria into an MRS liquid culture medium at an inoculation rate of 2% by volume, and culturing at 34-37°C for 24 hours; collecting the lactic acid bacteria mud by centrifugation (0-4°C, 5000-9000r / min, 10-15min), washing the lactic acid bacteria mud with sterile physiological saline, and then adding a lyophilization protective agent to freeze-dry at a ratio of lactic acid bacteria mud: lyophilization protective agent = 1:2-5 (w / w) to obtain lactic acid bacteria powder. The number of live bacteria in the lactic acid bacteria powder is 5.0-8.0×10 10CFU / g; the freeze-dried protective agent comprises: based on the total weight percentage of the freeze-dried protective agent, 15-30% skim milk and 5-15% trehalose.

[0108] Among them, the lactic acid bacteria is preferably Lactobacillus plantarum Ali.Plateau.LP.Ⅷ, which has the functional advantages of acid production, strong antibacterial ability and high antioxidant activity.

[0109] The plant lactobacillus Ali.Plateau.LP.Ⅷ strain provided by the present invention is isolated from yak milk of herders at an altitude of about 5000m in Ali, Tibet. It belongs to a natural wild strain and is included in the "List of Probiotics that Can Be Used for Health Foods". It has food safety attributes. The strain was identified as plant lactobacillus by 16S rDNA and named plant lactobacillus Ali.Plateau.LP.Ⅷ strain. The strain has been deposited in the China Center for Type Culture Collection (CCTCC) on January 13, 2022, with a deposit number of CCTCC NO:M 2022068. In addition, it has been recorded in a Chinese patent application with application number 202210895628.7 and publication number CN115838654A.

[0110] In order to better understand the technical solution of the present invention, the technical solution of the present invention is described in detail below in conjunction with specific embodiments.

[0111] Unless otherwise specified, the various reagents / instruments used in the examples and comparative examples of the present invention are conventional commercially available products. The experimental materials and instrument information used in the present invention are shown in Table 1 below:

[0112] Table 1 Experimental materials / instruments and manufacturers

[0113]

[0114]

[0115] 1. Determination of moisture content in the examples and comparative examples: Determination was performed according to the national standard test method: GB 5009.3-2016 determination process.

[0116] 2. The plant lactobacillus Ali.Plateau.LP.Ⅷ used in the present invention is isolated from yak milk from herders' homes at an altitude of about 5000m in Ali, Tibet. It is a natural wild strain and is included in the "List of Probiotics that Can Be Used for Health Foods". It has food safety attributes. The strain was identified as plant lactobacillus by 16S rDNA and named plant lactobacillus Ali.Plateau.LP.Ⅷ. The strain was deposited in the China Center for Type Culture Collection (CCTCC) on January 13, 2022, with a deposit number of CCTCC NO:M 2022068. In addition, it has been recorded in the Chinese patent application with application number 202210895628.7.

[0117] 3. The screening and identification methods and identification results of the Saccharomyces cerevisiae Qiongjie-SC-100 strain used in the present invention are as follows:

[0118] Take 5 ml of highland barley wine from Qiongjie County, Shannan City, Tibet and mix with 45 ml of sterile saline. Dilute the sample solution 10 times in a gradient manner and spread it on a red Bengal medium plate, culture it at 28°C for 72 hours, pick typical colonies with different morphologies and separate them by streaking on the red Bengal medium plate, streak twice continuously until a single colony grows to observe the colony morphology, pick the colony on a slide, and magnify it 100 times under an optical microscope to observe the bacterial morphology.

[0119] A strain of bacteria was obtained, the colony texture of which was pink, round and raised, with neat edges, and the microscopic morphology was round or oval, and budding reproduction, such as Figure 1 As shown. The genome of the strain was extracted, and NS1 (GTAGTCATATGCTTGTCTC) and NS8 (TCCGCAGGTTCACCTACGGA) were used as primers. The PCR program was: pre-denaturation at 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, and 72°C for 1 min 30 s for a total of 35 cycles; annealing and extension at 72°C for 10 min. The PCR product was subjected to 1% gel electrophoresis detection and sequencing, and the 18S rDNA sequence of the strain was measured. SEQ ID NO.1 is shown below:

[0120] CCTGCGGAAGGATCATTATTGTTAAATCTTTTTTACTCGACTATGGTGACTCTTCTCTTGGATTAATTAACCTGCGCTTAACTGCGCGGTTACCTTGAGAAGGTTCTATAGGAGATTAAAAAAAAAACTTATACACATTGTTTTTTCTTATCATAATTTTGGAGAGGGGAAAAAGAACGAAAAAAAAAAGA CTGTAAGAGGGGGAGTTTAATTACTCTTTCTTTTCCGTTTTTGTTTTGTTTCCTTTTTCTTTTCTTTCGAAATTATGGTTAATATTATTAAAACCCATTCTCAATTTTTATTGAGGAATGTATATTTTTTAAATACAAATTTTGTCATTTTAAAACTTTTATAAGTTTAATAACTTTTAAAACTTTCAGC AACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCATATTGCACTCTATAGTATTCTGTAGAGTATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCATTAGGTTTAGTATTGGAAGCTGTGTTATATA ATATATAACTCTTCTGAAATGACTTGGCAATTAGTTGTTAAAACTTCTTTTTCAAAGGCTTTATTATTAGGTTTTACCAATTTAATAAAATGTCCTTTTAGGATTTTTAAGGGAAGTTTTACTAGTACTAAGGCCTTATAACTACTCATTAATTTTGACCTCAAATCACGTAAGGATACCCGCTGAACTTAA

[0121] Combined with morphological analysis and molecular identification, the strain is Saccharomyces cerevisiae Qiongjie-SC-100, which was deposited in the China Center for Type Culture Collection (CCTCC) on January 16, 2024, with the deposit number: CCTCC NO: M 2024122. Figure 1 (A) shows the colony morphology of Saccharomyces cerevisiae Qiongjie-SC-100. Figure 1(B) shows a microscopic observation image of Saccharomyces cerevisiae Qiongjie-SC-100.

[0122] Preliminary experiment 1 Study on the characteristics of Lactobacillus plantarum

[0123] 1. Determination of acid production capacity

[0124] The activated Lactobacillus plantarum Ali.Plateau.LP.Ⅷ and Lactobacillus plantarum CICC 22134 were inoculated into the MRS liquid medium with a pH of 6.60 after sterilization, cultured at 37°C for 24h under anaerobic conditions, centrifuged at 10000r / min for 10min at 4°C, and the pH of the fermentation supernatant was directly measured with a pH acidity meter. At the same time, the titrated acidity was determined according to the method of the national standard GB / T5413.34-2010, and the acidity of the lactic acid bacteria fermentation broth was expressed in Girner degrees (°T), that is, 1 mL of NaOH solution with a concentration of 0.1 mol / L per 100 mL of fermentation broth was equivalent to 1°T. The results of the acid production capacity determination of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ and Lactobacillus plantarum CICC22134 are shown in Table 2.

[0125] Table 2 Acid production capacity determination results

[0126]

[0127] Lactobacillus plantarum produces acid during its growth, causing the pH of the fermentation liquid to decrease and the acidity to increase. As shown in Table 2, compared with the control strain Lactobacillus plantarum CICC 22134, the fermentation supernatant pH of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ was significantly lower and the acidity was higher. The results showed that Lactobacillus plantarum Ali.Plateau.LP.Ⅷ had a stronger acid production ability.

[0128] 2. Determination of antibacterial ability

[0129] The antibacterial activity of the strains was determined using the double-layer agar diffusion method. Two foodborne pathogens, Escherichia coli and Staphylococcus aureus, were used as indicator bacteria. 10 mL of 2 g / 100 mL water agar medium was added to the sterilized plate and placed in a sterilized Oxford cup after the water agar medium solidified. 10 mL of LB agar medium was added. 6 CFU / mL indicator bacteria, fully mixed and poured into the plate, after the culture medium solidified, the Oxford cup was taken out, and 100 μL of plant lactobacillus Ali.Plateau.LP.Ⅷ bacterial suspension and plant lactobacillus CICC 22134 bacterial suspension were added into the wells respectively, and cultured at 37°C for 24 hours, and the diameter of the inhibition zone was observed and measured (mm). The results of the antibacterial ability test of plant lactobacillus Ali.Plateau.LP.Ⅷ and plant lactobacillus CICC 22134 are shown in Table 3.

[0130] Table 3 Antibacterial ability test results

[0131]

[0132] As shown in Table 3, the antibacterial effect of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ on Escherichia coli and Staphylococcus aureus was better than that of Lactobacillus plantarum CICC 22134, which showed that Lactobacillus plantarum Ali.Plateau.LP.Ⅷ had a strong antibacterial ability.

[0133] 3. Determination of Antioxidant Capacity

[0134] (1) DPPH free radical scavenging activity assay:

[0135] Sample group: 2 mL OD 595 The lactic acid bacteria suspension with nm of 0.9 was mixed with 1 mL of 0.2 mmol / L DPPH-anhydrous ethanol solution, reacted at 37°C in the dark for 30 min, centrifuged at 6000 r / min for 10 min, and the supernatant was taken to measure the absorbance at a wavelength of 517 nm.

[0136] Blank group: 2 mL OD 595 The lactic acid bacteria suspension with a nm value of 0.9 was mixed with 1 mL of anhydrous ethanol, incubated at 37°C in the dark for 30 min, centrifuged at 6000 r / min for 10 min, and the supernatant was taken to measure the absorbance at a wavelength of 517 nm.

[0137] Control group: 2 mL of distilled water was mixed with 1 mL of 0.2 mmol / L DPPH-anhydrous ethanol solution, reacted at 37°C in the dark for 30 min, centrifuged at 6000 r / min for 10 min, the supernatant was taken, and the absorbance was measured at a wavelength of 517 nm.

[0138] An equal volume of distilled water-anhydrous ethanol mixture was used for blank zero adjustment. The DPPH free radical scavenging rate was calculated according to formula (1):

[0139]

[0140] Where A0 represents the absorbance of the blank group; A1 represents the absorbance of the sample group; A2 represents the absorbance of the control group.

[0141] (2) Determination of hydroxyl radical scavenging activity:

[0142] Sample group: Take 1 mL each of 5 mmol / L ferrous sulfate solution, 5 mmol / L salicylic acid ethanol solution, and 3 mmol / L hydrogen peroxide solution and add them to a 10 mL stoppered test tube. Add 2 mL OD 595The lactic acid bacteria suspension with a nm value of 0.9 was filled up to the scale with distilled water, reacted in a 37°C water bath for 15 min, centrifuged at 6000 r / min for 10 min, and the supernatant was taken to measure the absorbance at a wavelength of 510 nm.

[0143] Blank group: Take distilled water and measure the absorbance at a wavelength of 510nm, which is the absorbance of the blank group. The hydroxyl free radical scavenging rate is calculated according to formula (2):

[0144]

[0145] Where A0 represents the absorbance of the blank group; A1 represents the absorbance of the sample group.

[0146] Table 4 Antioxidant activity test results

[0147]

[0148] As shown in Table 4, Lactobacillus plantarum Ali.Plateau.LP.Ⅷ has strong DPPH free radical scavenging ability and hydroxyl free radical scavenging ability, and has high antioxidant activity. When applied to dough, it can improve the antioxidant property of the dough, help preserve the dough, and extend the shelf life.

[0149] 4. Preparation of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ powder

[0150] The activated Lactobacillus plantarum Ali.Plateau.LP.Ⅷ was inoculated into M RS liquid culture medium at an inoculum volume of 2%, and cultured at 34°C for 24 h. The bacterial liquid of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ was centrifuged (4°C, 7000 r / min, 10 min) to collect bacterial mud, which was washed three times with sterile saline, and then freeze-dried with a freeze-dried protective agent at a ratio of bacterial mud: freeze-dried protective agent = 1:4 (w / w) to obtain Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, the number of viable bacteria of which was 6.3×10 10 The freeze-drying protective agent is 25% skim milk, 10% trehalose and 65% deionized water.

[0151] Preliminary experiment 2 Study on the aroma production characteristics of yeast

[0152] 1. Determination of ester production capacity

[0153] Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263 were inoculated in 100 mL YPD liquid culture medium at an inoculum rate of 2% by volume, respectively, and cultured in a shaking incubator at 28°C and 180 r / min for 2 days. 10 mL of fermentation broth of Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263 were taken in 100 mL conical flasks, 10 mL of distilled water was added, phenolphthalein was added dropwise, and the mixture was titrated with 0.1 mol / L NaOH standard solution until color was developed. The mixture was then transferred to a round-bottom flask containing 10 mL of 0.1 mol / L NaOH solution, heated in a water bath for saponification and reflux, removed and cooled to room temperature, and titrated with 0.1 mol / L HCl standard solution until the red color disappeared. The volume of HCl consumed was recorded, and the fermentation broth of each strain was measured in parallel for 3 times to obtain the average value, and the total ester content (g / L) of the fermentation broth of each strain was calculated. The results of the ester production capacity test of the fermentation broth of Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263 are as follows Figure 2 shown.

[0154] like Figure 2 The results show that yeast with strong ester production ability can modify and improve the sensory quality of dough. Compared with the control standard strain, the ester production ability of Saccharomyces cerevisiae Qiongjie-SC-100 is strong.

[0155] 2. Sensory evaluation of the aroma of yeast fermentation broth

[0156] The quantitative descriptive analysis (QDA) method was used to evaluate the aroma characteristics of yeast fermentation broth. The sensory evaluation panel consisted of 10 well-trained tasters (5 males and 5 females, aged 23-40 years old). The experiment was conducted in a food sensory laboratory and samples were presented randomly. The aroma characteristics were described as fruity, floral, wine, fat, nutty and overall aroma. The intensity was divided into 10 levels, with 0 to 9 representing the smell from none to weak, medium, strong and very strong.

[0157] Figure 3 This is the aroma evaluation chart of the fermentation broth of Saccharomyces cerevisiae Qiongjie-SC-100 and Saccharomyces cerevisiae CICC 1263.

[0158] like Figure 3 As shown in the figure, the results show that the aroma characteristics of the two yeasts are significantly different. Compared with Saccharomyces cerevisiae CICC 1263, the overall aroma of Saccharomyces cerevisiae Qiongjie-SC-100 is evaluated higher, among which the wine aroma, fruity aroma, fat aroma and floral aroma are the most intense. The nutty aroma of Saccharomyces cerevisiae CICC 1263 is evaluated higher.

[0159] 3. Preparation of Saccharomyces cerevisiae Qiongjie-SC-100 powder

[0160] The brewer's yeast Qiongji ie-SC-100 was inoculated into a YPD liquid medium at an inoculum volume of 2%, and cultured at 30°C for 36 hours to obtain a brewer's yeast Qiongji ie-SC-100 fermentation liquid. The brewer's yeast Qiongji ie-SC-100 fermentation liquid was centrifuged at 4°C, 8000r / min for 10 minutes to collect the bacterial mud. The bacterial mud was washed with sterile physiological saline 3 times, filtered (the filtration pressure was 0.5MPa), and then granulated by a granulator, the mesh aperture of the granulator was 2 mm; the granulated brewer's yeast Qiongji ie-SC-100 material entered a boiling dryer to obtain brewer's yeast Qiongji ie-SC-100 bacterial powder, wherein the first-level vertical drying bed of the boiling dryer had a drying temperature of 37°C, and the second-level fluidized drying bed had a drying temperature of 40°C. The moisture content of the obtained yeast powder Qiongjie-SC-100 was 4%, and the number of viable bacteria was 2.0×10 10 CFU / g.

[0161] Based on the results of the above research on the characteristics of Lactobacillus plantarum and the research on the aroma-producing characteristics of Saccharomyces cerevisiae, the following embodiments and comparative examples of the present invention use Lactobacillus plantarum Ali. Plateau. LP. VIII powder and Saccharomyces cerevisiae Qiongjie-SC-100 powder to prepare sourdough starter.

[0162] Example 1

[0163] The sourdough starter provided in Example 1 comprises: 55 g of plant lactobacillus Ali.Plateau.LP.Ⅷ bacterial powder, 1 g of saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which are added 200 g of bran, 425 g of yeast peptone, 0.1 g of clove extract, 0.2 g of reduced glutathione (GSH), 500 g of wheat flour and 500 g of water.

[0164] The sourdough starter provided in Example 1 is obtained by a preparation method comprising the following steps:

[0165] (1) Fermentation: The sourdough starter components were mixed evenly and fermented in an incubator at 37° C. for 24 h to obtain a sourdough slurry.

[0166] (2) Drying: The sourdough paste is dried by hot air-vacuum freeze combined drying technology. The sourdough paste is placed on a plate and pre-frozen at -20°C, and then vacuum freeze-dried. After the moisture content is 30%, hot air drying is performed to obtain the sourdough starter. The vacuum freeze drying conditions are: main drying at -10°C, 121Pa for 5h; post-drying at 30°C, 77Pa for 8h; hot air drying conditions are 60°C, drying for 3h.

[0167] (3) Determination of pH and acidity: 10 g of the sourdough starter was weighed and added to 100 ml of deionized water, and stirred evenly on a magnetic stirrer. The pH and acidity were measured using a pH meter and a potentiometric titrator, respectively.

[0168] (4) Determination of viable bacteria count: The viable bacteria were diluted in a gradient manner. 3-4 appropriate continuous dilution gradients were selected and samples were spread on MRS medium modified with actinomycin to determine the viable bacteria count of lactic acid bacteria, and samples were spread on red Bengal medium to determine the viable bacteria count of yeast.

[0169] Example 2

[0170] The sourdough starter provided in Example 2 comprises: 80 g of plant lactobacillus Ali.Plateau.LP.Ⅷ bacterial powder, 5 g of saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which are added 150 g of bran, 300 g of yeast peptone, 0.15 g of clove extract, 0.15 g of reduced glutathione (GSH), 500 g of wheat flour and 500 g of water.

[0171] The sourdough starter provided in Example 2 is obtained by a preparation method comprising the following steps:

[0172] Steps (1) to (4) are the same as in Example 1.

[0173] Example 3

[0174] The sourdough starter provided in Example 3 comprises: 65 g of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, 3 g of Saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which 100 g of bran, 400 g of yeast peptone, 0.3 g of clove extract, 0.2 g of reduced glutathione (GSH), 500 g of wheat flour and 500 g of water are added.

[0175] The sourdough starter provided in Example 3 is obtained by a preparation method comprising the following steps:

[0176] Steps (1) to (4) are the same as in Example 1.

[0177] Example 4

[0178] The sourdough starter provided in Example 4 comprises: 50 g of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, 1 g of Saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which are added 200 g of bran, 400 g of yeast peptone, 0.1 g of clove extract, 0.15 g of reduced glutathione (GSH), 500 g of wheat flour and 500 g of water.

[0179] The sourdough starter provided in Example 4 is obtained by a preparation method comprising the following steps:

[0180] Steps (1) to (4) are the same as in Example 1.

[0181] Example 5

[0182] The sourdough starter provided in Example 5 comprises: 60 g of plant lactobacillus Ali.Plateau.LP.Ⅷ bacterial powder, 2 g of saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which are added 300 g of bran, 450 g of yeast peptone, 0.15 g of clove extract, 0.2 g of reduced glutathione (GSH), 600 g of wheat flour and 600 g of water.

[0183] The sourdough starter provided in Example 5 is obtained by a preparation method comprising the following steps:

[0184] Steps (1) to (4) are the same as in Example 1.

[0185] Comparative Example 1

[0186] Comparative Example 1 provides a sourdough starter, which comprises: 55g of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, 1g of Saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which 200g of bran, 425g of yeast peptone, 0.1g of clove extract, 0.2g of reduced glutathione (GSH), 500g of wheat flour and 500g of water are added.

[0187] The sourdough starter provided in Comparative Example 1 is obtained by a preparation method comprising the following steps:

[0188] (1) Fermentation: The sourdough starter components were mixed evenly and fermented in an incubator at 37° C. for 24 h to obtain a sourdough slurry.

[0189] (2) Drying: The sourdough paste is dried using vacuum freeze drying technology. The sourdough paste is placed on a plate and pre-frozen overnight at -20°C. The sourdough paste is broken into small pieces and freeze-dried in a vacuum freeze dryer. The vacuum freeze drying conditions are: drying time 48 hours.

[0190] Steps (3)-(4) are the same as in Example 1.

[0191] Comparative Example 2

[0192] Comparative Example 2 provides a sourdough starter, which comprises: 55g of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, 1g of Saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which 200g of bran, 425g of yeast peptone, 0.1g of clove extract, 0.2g of reduced glutathione (GSH), 500g of wheat flour and 500g of water are added.

[0193] The sourdough starter provided in Comparative Example 2 is obtained by a preparation method comprising the following steps:

[0194] (1) Fermentation: The sourdough starter components were mixed evenly and fermented in an incubator at 37° C. for 24 h to obtain a sourdough slurry.

[0195] (2) Drying: The sour dough is dried using hot air drying technology, wherein the hot air drying conditions are 60° C. and the drying time is 48 hours.

[0196] Steps (3)-(4) are the same as in Example 1.

[0197] Comparative Example 3

[0198] Comparative Example 3 provides a sourdough starter, which comprises: 100g of Lactobacillus plantarum Ali.Plateau.LP.Ⅷ bacterial powder, 10g of Saccharomyces cerevisiae Qiongjie-SC-100 bacterial powder, to which 200g of bran, 425g of yeast peptone, 0.1g of clove extract, 0.2g of reduced glutathione (GSH), 500g of wheat flour and 500g of water are added.

[0199] The sourdough starter provided in Comparative Example 3 is obtained by a preparation method comprising the following steps:

[0200] Steps (1) to (4) are the same as in Example 1.

[0201] Table 5 The results of pH, acidity and viable bacteria count and the statistical results of drying time

[0202]

[0203]

[0204] As shown in Table 5, the sourdough starter formula obtained in Example 5 is the most preferred sourdough starter of the present invention, and the use of hot air-vacuum freeze-drying combined technology not only reduces the loss of viable bacteria and acidity during the drying process, but also has obvious advantages in total energy consumption and drying time, which is reduced by more than 50% compared with single vacuum freeze-drying.

[0205] Based on the above measurement results of pH, acidity and viable bacteria count, it is shown that the sourdough starter obtained in Example 5 is the most preferred sourdough starter of the present invention. Therefore, the sourdough starter used in the following application examples is obtained by the component ratio and preparation method of Example 5.

[0206] Application Example 1: Effect of adding sourdough starter or bacterial powder to dough

[0207] Yeast group: weigh 500g flour and 250g water, add 0.3wt% of Qiongjie-SC-100 yeast powder based on the weight of flour, mix well and ferment for 48h, measure pH and observe the dough state.

[0208] Lactic acid bacteria group: weigh 500g flour and 250g water, add 0.3wt% Lactobacillus plantarum Ali. Plateau. LP. VIII powder based on the weight of flour, mix well and ferment for 48h, measure pH and observe the dough state.

[0209] Lactic acid bacteria + yeast group: weigh 500g flour and 250g water, add 0.15wt% Lactobacillus plantarum Ali.Plateau.LP.Ⅷ powder + 0.15wt% Saccharomyces cerevisiae Qiongjie-SC-100 powder based on the weight of flour, mix well and ferment for 48h, measure pH and observe the dough state.

[0210] Sourdough starter group: weigh 500g flour and 250g water, add 0.3wt% sourdough starter, mix well and ferment for 48h, measure pH and observe dough state.

[0211] Table 6 pH and state of different doughs

[0212]

[0213]

[0214] As shown in Table 6, compared with the yeast group and the lactic acid bacteria group, the lactic acid bacteria + yeast group has the advantage of synergistic fermentation. The dough has both sour and wine flavors, and the flavor is richer and more intense. Compared with the lactic acid bacteria + yeast group, the sourdough starter ferments faster, and it only takes 24 hours to reach pH 3.8. The addition of bran and yeast extract to the sourdough starter supplements the nitrogen source for the sourdough starter, making the starter ferment more stable and fast. At the same time, after 24 hours of fermentation, the pH of the other groups did not fluctuate much, while the pH of the sourdough starter group was still declining sharply, which shows that the core flora has strong acid resistance and can solve the problem of weak fermentation activity and insufficient acid production in the late fermentation period.

[0215] Application Example 2: Sourdough starter is used to make steamed bread

[0216] 1. Make steamed buns

[0217] Sourdough Starter Kit:

[0218] (1) Pour 10 g of sourdough starter, 90 g of water, and 250 g of wheat flour into a blender and stir to obtain a mixture; take 10 g of yeast, pour it into the weighed water, stir evenly, then pour it into the blender and mix with the mixture; stir at level 1 for 5 min to form a dough; take out the dough and press it with a dough press for 7-8 times to make it smooth and fine; roll the pressed dough into long strips and cut it into 8 pieces / group evenly with a knife.

[0219] (2) Place the cut dough in a proofing box at 35°C and 85% humidity to allow it to rise to 1.5 times its volume.

[0220] (3) Steam the proofed dough in a steamer at 100°C for about 15 minutes. After steaming, take it out and cool it for about 30 minutes (cool it to a center temperature of about 25°C).

[0221] Chemical preservative group: 10 g sourdough starter was replaced with 125 mg calcium propionate, and the other conditions and preparation process were the same as the sourdough starter group.

[0222] Blank group: no sourdough starter was added, and the other conditions and preparation process were the same as those of the sourdough starter group.

[0223] 2. Flavor experiment of steamed buns

[0224] Extraction of volatile components: Weigh 3 g of steamed bread sample from the sourdough starter group into a 15 mL sample bottle, place the sample bottle in a 75°C water bath, balance for 30 min, insert the aged CAR / PDMS extraction head into the air above the sample bottle, extract the headspace in a 75°C water bath for 30 min, and then inject the sample. Before each extraction, elute the extraction head at 250°C for 10 min.

[0225] GC conditions: the chromatographic column was DB-5MS (60m×0.32mm×1μm), the carrier gas was 99.9999% high-purity He, and the injection mode was splitless; the column box heating program was optimized as follows: initial oven temperature 50°C, maintained for 2 min, increased to 220°C at 5°C / min, maintained for 3 min, then increased to 250°C at 3°C / min, maintained for 5 min.

[0226] MS conditions: interface temperature 280°C; connecting rod temperature 150°C; electron ionization source, electron energy 70 eV, ion source temperature 230°C, acquisition mode full scan, mass scan range m / z 40-550.

[0227] Qualitative and quantitative analysis of volatile components: The GC-MS graph was matched with NIST08.Library and Wiley Library by computer and manual search to determine the chemical composition of volatile substances. The peak area represents the relative content of the substance. The test results are shown in Table 7.

[0228] Table 7 Detection results of volatile flavor substances in steamed bread

[0229]

[0230]

[0231]

[0232] As shown in Table 7, a total of 34 compounds were detected, including 8 alcohols (23.5%), 8 esters (23.5%), 4 acids (11.8%), 4 alkanes (11.8%), and 4 ketones (11.8%). 2-Pentylfuran, as an unsaturated alcohol, has the aroma of mushrooms, lavender, and hay. Ethyl caproate has a low threshold and can give steamed bread a sweet aroma. Most lactones (γ-caprolactone) have creamy, fruity, and coconut aromas, and have a low threshold. It is an important flavor compound. Phenylethanol is mostly found in natural plants such as apples, strawberries, and honey. It has the aroma of roses and is an important aroma substance for steamed bread. A certain amount of alkanes and alkenes were also detected, but due to the large threshold of alkenes, they do not contribute much to flavor enhancement.

[0233] 3. Antiseptic test of steamed bread

[0234] The steamed breads in the sourdough starter group, chemical preservative group and blank group were placed in sealed bags and placed at room temperature. The mold growth was observed and marked and experimental records were made. The experimental results are shown in Table 8 and Figure 4 shown.

[0235] Table 8 Anticorrosion test of steamed bread

[0236]

[0237] As shown in Table 8 and Figure 4 As shown in the figure, the mold growth time of steamed bread with sourdough starter was 3 days longer than that of the blank group. It has a certain antiseptic effect, can extend the shelf life of steamed bread, and can equally replace chemical preservatives.

[0238] Application Example 3: Sourdough starter is used to make sugar-free sourdough bread

[0239] 1. Dough preparation:

[0240] Sourdough starter group: Mix 400g high-gluten flour, 100g low-gluten flour, 100g sourdough starter, 5g yeast, 5g salt and 300g water, slow speed (35HZ) for 4min, and fast speed (40HZ) until the dough is formed and the dough bowl and dough are smooth, and the dough film is smooth without obvious serrations.

[0241] Blank group: No sourdough starter was added. 400g high-gluten flour, 100g low-gluten flour, 5g yeast, 5g salt and 300g water were mixed, slow speed (35HZ) for 4min, and fast speed (40HZ) until the dough was formed and the dough cylinder and dough were smooth, and the dough film was smooth without obvious jagged edges.

[0242] 2. Dough division and shaping:

[0243] The dough of the sourdough starter group and the blank group was divided into 400 g pieces and rolled into balls; the dough was relaxed for 15 minutes and then formed by machine.

[0244] 3. Proofing and baking:

[0245] The relaxed dough of the sourdough starter group and the blank group was placed in a proofing box at 38±1℃, with humidity controlled at 85-90%, and proofed until the top of the dough was at the same height as the edge of the mold. The proofed dough was baked in an oven at 210℃ for 28min.

[0246] 4. Sensory evaluation of sugar-free sourdough bread:

[0247] The sensory evaluation panel consisted of 10 well-trained bread quality assessors and 10 people (5 men and 5 women, aged 23 to 40 years old); the experiment was conducted in a food sensory laboratory, and the samples were presented randomly. The sensory evaluation of sugar-free sourdough bread in the blank group and sourdough starter group was conducted. The morphological diagram and sensory evaluation of sugar-free sourdough bread are shown in Figure 1. Figure 5 and as shown in Table 9.

[0248] Table 9 Sensory evaluation of sugar-free sourdough bread

[0249]

[0250] As shown in Table 9, the evaluation panel consisting of ten bread quality assessors and ten members of the public generally believed that, compared with the blank group, the bread in the sourdough starter group had a richer fermentation taste and aroma, with sourness and wine flavors that could be tasted when chewing, a richer taste, and the bread was chewier.

[0251] Application Example 4: Sourdough starter is used to make rice cake

[0252] 1. Preparation of Rice Cake

[0253] Sourdough starter group: Wash the rice to remove impurities, soak it at 30℃ for 21h, drain it and grind it into rice flour and pass it through a 60-mesh sieve. Mix the obtained rice flour with water at a mass ratio of 8:2 to obtain rice slurry. Based on the weight of the rice slurry, add 5% (w / w) sourdough starter and 6% (w / w) white sugar and stir well. Ferment at 35℃ for 12h. After the fermentation is completed, add 14g / 100mL white sugar for seasoning to obtain fermented rice slurry. Pour the rice slurry into a mold in a certain amount, steam it in boiling water for 20min, and let it cool to obtain rice cake.

[0254] Blank group: the sourdough starter was replaced with an equal amount of yeast, and the other conditions were the same as those of the sourdough starter group.

[0255] 2. Evaluation of rice cake

[0256] The whole texture determination of rice cake was carried out using a P / 36R probe, and the measurement parameters were: the speed before and after the measurement was 5 mm / s, the measurement speed was 2 mm / s, the strain displacement was 60%, and the triggering force was 5 g.

[0257] Determination of specific volume: Take the steamed rice cake that has been cooled at room temperature for nearly 1 hour as the test sample, weigh the mass of the rice cake, measure the volume of the rice cake, and calculate the specific volume of the rice cake according to the following formula.

[0258] S=V / W (3)

[0259] Wherein, S represents the specific volume of the rice cake (mL / g); V represents the volume of the rice cake (mL); W represents the mass of the rice cake (g).

[0260] Table 10 Texture characteristics of rice cake

[0261]

[0262] As shown in Table 10, the rice cakes in the sourdough starter group were white and translucent, with uniform and dense pores inside, low hardness, large specific volume, soft and fluffy appearance, chewy, elastic, non-sticky, strong palatability, soft taste, and soft fermented aroma. Compared with the blank group, the addition of sourdough starter can improve the texture of rice cakes and enhance the taste.

[0263] Although the above describes the specific implementation methods of the present invention, it does not limit the scope of protection of the present invention. Based on the technical solution of the present invention, various modifications or variations that can be made by those skilled in the art without creative work are still within the scope of protection of the present invention.

Claims

1. A sourdough starter, characterized in that The sourdough starter comprises, by weight: 50-80 parts of lactic acid bacteria powder, 1-5 parts of yeast powder, 100-1000 parts of bran, 300-500 parts of yeast extract, 0.1-0.3 parts of plant extract, 0.1-0.2 parts of reduced glutathione, 500-1000 parts of flour and 500-1000 parts of water, wherein: The lactic acid bacteria powder is obtained by Lactobacillus plantarum )The bacterial powder made from Ali.Plateau.LP.Ⅷ, the preservation number is: CCTCC NO: M 2022068; The yeast powder is prepared by Saccharomyces cerevisiae Qiongjie-SC-100 ( Saccharomyces cerevisiae ) prepared from the fungus powder, the preservation number is: CCTCC NO: M 2024122, The plant extract is a plant extract with antibacterial function, and the plant extract with antibacterial function includes one or more of clove extract, cinnamon extract, dandelion extract and perilla extract.

2. The sourdough starter according to claim 1, characterized in that In parts by weight, the lactic acid bacteria powder is 50-60 parts; and / or the yeast powder is 1-2 parts; and / or the bran is 200-300 parts; and / or the plant extract is 0.1-0.15 parts; and / or the reduced glutathione is 0.15-0.2 parts; and / or the yeast extract is 400-450 parts; and / or the flour is 500-600 parts; and / or the water is 500-600 parts.

3. The sourdough starter according to claim 1, characterized in that The viable count of the lactic acid bacteria powder is 5.0×10 10 -8.0×10 10 CFU / g.

4. The sourdough starter according to claim 2, characterized in that The viable count of the lactic acid bacteria powder is 5.0×10 10 -8.0×10 10 CFU / g.

5. The sourdough starter according to claim 1, characterized in that The viable count of the yeast powder is 1.0×10 10 -5.0×10 10 CFU / g; and / or, based on the weight of the yeast powder, the moisture content is 1-5% (w / w).

6. The sourdough starter according to claim 2, characterized in that The viable count of the yeast powder is 1.0×10 10 -5.0×10 10 CFU / g; and / or, based on the weight of the yeast powder, the moisture content is 1-5% (w / w).

7. The sourdough starter according to claim 1, characterized in that The yeast extract includes one or more of yeast extract powder and yeast peptone.

8. The sourdough starter according to claim 1, characterized in that The flour is one or more of wheat flour, whole wheat flour and rye flour.

9. The sourdough starter according to any one of claims 1 to 8, characterized in that The 18S rDNA gene sequence of the Saccharomyces cerevisiae is shown in SEQ ID NO.

1.

10. The sourdough starter according to any one of claims 1 to 8, characterized in that The brewer's yeast has the characteristic of producing ester substances.

11. The sourdough starter according to claim 9, characterized in that The brewer's yeast has the characteristic of producing ester substances.

12. The sourdough starter according to any one of claims 1 to 4, characterized in that The lactic acid bacteria powder is prepared by the following steps: (1) Proliferating and culturing lactic acid bacteria; (2) adding the product obtained in step (1) to a liquid culture medium, fermenting and culturing at 34-37° C., and then centrifuging to collect the lactic acid bacteria sludge; (3) Washing and freeze-drying the lactic acid bacteria slurry to obtain lactic acid bacteria powder.

13. The sourdough starter according to claim 12, characterized in that In step (2), the lactic acid bacteria sludge is collected by centrifugation at 0-4°C, 5000-9000 r / min, and 10-15 min.

14. The sourdough starter according to claim 12, characterized in that A freeze-drying protective agent is added in a ratio of lactic acid bacteria mud: freeze-drying protective agent = 1:2-5 (w / w) for freeze-drying, wherein the freeze-drying protective agent comprises: one or more of 15-30% skim milk and 5-15% trehalose, based on the total weight percentage of the freeze-drying protective agent.

15. The sourdough starter according to any one of claims 1 to 8, characterized in that The yeast powder is prepared by the following steps: (1) Proliferating and culturing yeast; (2) adding the product obtained in step (1) to a liquid culture medium, fermenting and culturing at 30±2° C. to obtain a yeast fermentation broth, and then centrifuging the yeast fermentation broth to collect yeast sludge; (3) Washing, filtering, granulating and drying the yeast sludge to obtain yeast powder.

16. The sourdough starter according to claim 15, characterized in that In step (2), the yeast sludge is collected by centrifugation at 0-4°C, 5000-9000 r / min, and 10-15 min.

17. The sourdough starter according to claim 15, characterized in that In step (3), the filter pressing conditions are: the filter pressing pressure is 0.4-0.6 MPa.

18. The sourdough starter according to claim 15, characterized in that In step (3), the granulation conditions are: the granulation screen aperture is 1-4 mm.

19. The sourdough starter of claim 15, wherein: The drying conditions are: drying by using a boiling drying bed, wherein the drying temperature of the first-stage vertical drying bed is 35-42°C, and the drying temperature of the second-stage fluidized drying bed is 35-43°C.

20. The sourdough starter of claim 15, wherein: The ester content in the yeast fermentation liquid is 5-8g per liter of yeast fermentation liquid.

21. The sourdough starter of claim 15, wherein: The yeast fermentation liquid has the characteristic of producing aroma.

22. The sourdough starter of claim 21, wherein: The aroma is one or more of fruit aroma, fat aroma, flower aroma, wine aroma and nut aroma.

23. The sourdough starter according to any one of claims 1 to 8, characterized in that The pH of the sourdough starter is 3.85-4.00; and / or the acidity of the sourdough starter is 20-25 g / kg based on the total amount of lactic acid produced per kilogram of the sourdough starter; and / or the number of viable lactic acid bacteria in the sourdough starter is 1.0-7.0×10 8 CFU / g; and / or the number of live yeast cells of the sourdough starter is 2.0-5.0×10 6 CFU / g.

24. A method for preparing a sourdough starter according to any one of claims 1 to 23, characterized in that: The method comprises the following steps: mixing, fermenting and drying components containing lactic acid bacteria powder and yeast powder, wherein the lactic acid bacteria powder is prepared by Lactobacillus plantarum ( Lactobacillus plantarum )The bacterial powder made from Ali.Plateau.LP.Ⅷ, the preservation number is: CCTCC NO: M 2022068; The yeast powder is prepared by Saccharomyces cerevisiae Qiongjie-SC-100 ( Saccharomyces cerevisiae ) and the deposit number is: CCTCC NO: M 2024122.

25. The preparation method according to claim 24, characterized in that: The steps include: (1) Fermentation: mixing lactic acid bacteria powder, yeast powder, bran, yeast extract, plant extract, reduced glutathione, flour and water and fermenting them to obtain sour dough; (2) Drying: Drying the sourdough slurry to obtain a sourdough starter.

26. The preparation method according to claim 25, characterized in that: In step (1), the fermentation temperature is 30-37°C and the fermentation time is 24-48 hours.

27. The preparation method according to claim 25, characterized in that: In step (2), the drying method is hot air-vacuum freeze-drying combined with drying.

28. The preparation method according to claim 25, characterized in that: The hot air-vacuum freeze-drying method comprises: pre-freezing the sour dough obtained in step (1) at -20°C to -40°C, and then performing vacuum freeze-drying; when the moisture content of the sour dough reaches 20-30%, performing hot air drying.

29. The preparation method according to claim 28, characterized in that: The vacuum freeze drying conditions are as follows: main drying: -10±5°C, 1-200Pa, 5-7h; post-drying: 30±3°C, 1-100Pa, 5-9h; the hot air drying conditions are 60±5°C, 3-5h.

30. The sourdough starter prepared by the method according to any one of claims 24 to 29, characterized in that: The pH of the sourdough starter is 3.85-4.00; and / or the acidity of the sourdough starter is 20-25 g / kg based on the total amount of lactic acid produced per kilogram of the sourdough starter; and / or the number of viable lactic acid bacteria in the sourdough starter is 1.0-7.0×10 8 CFU / g; and / or the number of live yeast cells of the sourdough starter is 2.0-5.0×10 6 CFU / g.

31. A Chinese pastry, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

32. Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in making Chinese pastries.

33. A steamed bun, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

34. Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in preparing steamed bread.

35. The Chinese pastry according to claim 31 or the use according to claim 32, characterized in that: Based on the total weight of the raw materials of the Chinese pastry, 1-20% (w / w) of sour dough starter is added.

36. The steamed bread according to claim 33 or the use according to claim 34, characterized in that: Based on the total weight of the raw materials of the steamed bread, 1-20% (w / w) of sourdough starter is added.

37. A Western-style pastry, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

38. Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in making western-style pastries.

39. A bread, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

40. Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in making bread.

41. The Western-style pastry according to claim 37 or the use according to claim 38, characterized in that: Based on the total weight of the raw materials of the western-style pastry, 1-20% (w / w) of sourdough starter is added.

42. The bread according to claim 39 or the use according to claim 40, characterized in that Based on the total weight of the raw materials of the bread, 1-20% (w / w) of sourdough starter is added.

43. A rice and flour fermented product, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

44. Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in the preparation of fermented rice and flour products.

45. A rice cake, characterized in that: A sourdough starter comprising the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30.

46. ​​Use of the sourdough starter according to any one of claims 1 to 23 or the sourdough starter prepared by the preparation method according to any one of claims 24 to 30 in making steamed rice cake.

47. The fermented rice and flour product according to claim 43 or the use according to claim 44, characterized in that: Based on the total weight of the raw materials of the fermented rice and flour product, 1-20% (w / w) of the sourdough starter.

48. The rice cake according to claim 45 or the use according to claim 46, characterized in that: Based on the total weight of the raw materials of the rice cake, 1-20% (w / w) of the sour dough leavening agent is added.

Images