Notoginseng sterol C-22 desaturase gene PnCYP710A and its application

Abstract

The present invention discloses a Panax notoginseng sterol C-22 desaturase gene PnCYP710A and its applications, PnCYP710A The nucleotide sequence of the gene is shown in SEQ ID NO: 1, encoding a sterol C-22 desaturase of the plant cytochrome P450 monooxygenase family. The invention has been confirmed by functional genomics related technology research. PnCYP710A The gene has the function of improving the resistance of plants to fungal infection. PnCYP710A The gene was constructed into a plant expression vector and transferred into tobacco for expression. PnCYP710A The resistance of transgenic tobacco to Fusarium solani and Curvularia solani was significantly improved.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and genetic engineering, and is particularly concerned with the gene encoding the notoginseng sterol C-22 desaturase with disease resistance. PnCYP710A and its applications. Background Art

[0002] During plant growth and development, pathogen infection poses a serious threat to plants (Wilkinson SW, Mageroy MH, et al. Surviving in a hostile world: plant strategies to resist pests and diseases. Annual Review of Phytopathology, 2019, 57: 505-529). Plant diseases can occur throughout the entire plant production chain and are one of the biggest threats to sustainable development, resulting in an annual yield loss of 13%-22% for major crops such as rice, wheat, corn, and potatoes (Savary S, Willocquet L, et al. The global burden of pathogens and pests on major food crops. Nature Ecology and Evolution, 2019; 3(3): 430-439). Fungal diseases are the most common type of plant diseases, accounting for approximately 80%-90% of all disease types. Traditional methods for controlling plant diseases primarily rely on chemical agents, improved cultivation practices, and the breeding of new resistant varieties. While these methods have achieved some success, they still cannot completely resolve the disease problem due to their long breeding cycles, poorly effective cultivation practices, and the potential for environmental pollution and food safety issues caused by chemical agents. With the rapid development of biotechnology, the use of genetic engineering to breed new disease-resistant varieties can not only overcome many of the drawbacks of these control methods, but also minimize damage to beneficial microorganisms in the soil, ultimately achieving sustainable agricultural development.

[0003] Studying plant natural resistance and applying it to plant disease prevention and control is a green and environmentally friendly approach. During plant adaptation, plants produce a series of secondary metabolites that are important components of their immune system. Phytosterols are naturally present in plant cell membranes and have anti-inflammatory, antimicrobial, antioxidant, and immune-modulating properties. Common phytosterols include ergosterol, ergosterol esters, β-sitosterol, and stigmasterol. Phytosterols are involved in plant-pathogen interactions and abiotic stresses, helping cells maintain membrane fluidity during stress (Aboobucker SI, Suza W P. Why do plants convert sitosterol to stigmasterol? Frontiers InPlant Science, 2019, 10: 354).

[0004] Stigmasterol is one of the most common phytosterols and belongs to the tetracyclic triterpenoid unsaturated compound. Currently, stigmasterol has been confirmed to have multiple biological activities in in vitro and in vivo experiments, and has pharmacological effects such as anti-inflammatory, immunomodulatory, antifungal, antibacterial and antioxidant effects (Goswami M, Priya, Jaswal S, et al. A comprehensive update onphytochemistry, analytical aspects, medicinal attributes, specifications and stability of stigmasterol. Steroids, 2023, 196: 109244). When plants encounter pathogen colonization, they will enhance their resistance to pathogens by accumulating secondary metabolites. Solanum tuberosum ) seedlings were cultured in a medium containing Beauveria bassiana ( Beauveria bassiana ) in the soil, due to oxidative stress caused by pathogen invasion, 14 days later, it was found that the content of stigmasterol in the leaves increased by 1.5 times compared with the control group. This change is consistent with the stimulation of plant growth and the enhancement of plant pathogen defense mechanism (Tyurin M, Chernyak E, et al. Thefungus Beauveria bassiana alters amounts of sterols, fatty acids, andhydroxycinnamic acids in potato Solanum tuberosum Plants (Basel), 2023, 12(23): 3938). Some studies have verified the antifungal activity of stigmasterol in vitro. Caloncoba glaucaThe antibacterial test of stigmasterol isolated from the root showed that stigmasterol had an antibacterial effect on Candida krusei ( Candida kruseic ) has bactericidal and inhibitory effects, and the minimum inhibitory concentration (MIC) value is 62.5μg / mL (Ndoumbe TC, Tsopgni W, et al. Two new30-norfriedelane triterpenes from Caloncoba glauca (P. Beauv.) Gilg(Achariaceae). Natural Product Research, 2023: 1-11). In addition, in Egyptian white wine grass ( Conyza aegyptiaca ) also showed strong antibacterial activity against bacteria. The mycelial growth of Escherichia coli and Staphylococcus aureus was significantly inhibited in the culture medium containing stigmasterol (Mbarga PE, Fouotsa H, et al. Two new secondary metabolites with antibacterial activities from Conyza aegyptiaca (Asteraceae). Natural Product Research, 2023, 37(11): 1806-1815).

[0005] CYP710A Encodes a sterol C-22 desaturase in the plant cytochrome P450 monooxygenase family, which converts β-sitosterol to stigmasterol (Nelson D R. Cytochrome P450 diversity in the tree of life. Biochimical ET Biophysical ACTA: Proteins And Proteomics, 2018, 1866(1): 141-154). Arabidopsis leaves were inoculated with Pseudomonas syringae ( Pseudomonas syringae )back, AtCYP710A1 The expression level of β-sitosterol tostigmasterol was significantly induced (Griebel T, Zeier J. A role for beta-sitosterol tostigmasterol conversion in plant-pathogen interactions. Plant Journal, 2010,63(2): 254-268). AtCYP710A1The expression of stigmasterol was induced by stigmasterol (SewelamN, Jaspert N, et al. Spatial H2O2signaling specificity: H2O2from chloroplastsand peroxisomes modulates the plant transcriptome differentially. MolecularPlant, 2014, 7(7): 1191-1210). CYP710A1 In transgenic Arabidopsis thaliana, the stigmasterol content increased and was GhCYP710A1 The expression levels were positively correlated, and the overexpressing transgenic Arabidopsis plants inoculated with Verticillium dahliae were significantly better than the wild type, and the colonization rate of Verticillium dahliae was significantly reduced (Huang L, Li G, Wang Q, et al. GhCYP710A1 participates in cotton Resistance to verticillium Wilt byregulating stigmasterol synthesis and plasma membrane stability. International Journal of Molecular Sciences, 2022, 23(15)).

[0006] Panax notoginseng Panax notoginseng (Burk.) FH Chen] is an Araliaceae ( Araliaceae) Ginseng Panax ) is a perennial herb and a traditional precious medicinal material in my country. It has the effects of promoting blood circulation, removing blood stasis, and relieving inflammation and pain (Xie W, Meng X, et al. Panax notoginsengsaponins: A review of its mechanisms of antidepressant or anxiolytic effects and network analysis on phytochemistryand pharmacology. Molecules, 2018, 23(4):940). However, the warm, dark, and humid growing environment makes Panax notoginseng extremely vulnerable to soil-borne pathogens, including bacteria, fungi, and nematodes. Root rot caused by fungi such as Fusarium solani seriously reduces the yield and quality of Panax notoginseng (Fan ZY, Miao CP, et al. Diversity, distribution, and antagonistic activities of rhizobacteria of Panax notoginseng Journal of Ginseng Research, 2016, 40(2):97-104). However, there is a lack of high-disease-resistant and stable Panax notoginseng varieties in production. The present invention isolated a sterol C-22 desaturase gene from Panax notoginseng. PnCYP710A , and used reverse genetics technology to verify that it was a root rot resistance gene, and then used genetic engineering technology to cultivate new disease-resistant tobacco materials. Summary of the Invention

[0007] The present invention provides a stigmasterol synthesis pathway upstream gene cloned from Panax notoginseng, namely, sterol C-22 desaturase gene PnCYP710A , PnCYP710A The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The full-length cDNA of the gene is 1518 bp, containing a 963 bp open reading frame, encoding a protein with the amino acid sequence shown in SEQ ID NO: 2.

[0008] The notoginseng sterol C-22 desaturase gene of the present invention PnCYP710A The coding region is the nucleotide sequence shown in SEQ ID NO: 1, numbers 556 to 1518.

[0009] The present invention isolated and cloned a complete cDNA fragment of an antifungal-related gene of Panax notoginseng, and used Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) mediated the transfer of target genes into recipient plants for over-expression, and further experiments were conducted to verify whether the gene had antifungal function, laying the foundation for the later use of the gene to improve the ability of plants to resist fungal diseases.

[0010] Another object of the present invention is to transform the notoginseng sterol C-22 desaturase gene PnCYP710AApplication in improving tobacco resistance to Fusarium solani ( Fusarium solani )、Clavian spore ( Curvularia clavata )'s resistance.

[0011] The above-mentioned notoginseng sterol C-22 desaturase gene PnCYP710A The specific operations to improve tobacco disease resistance are as follows:

[0012] Using amplification PnCYP710A Total RNA was extracted from the roots of Panax notoginseng inoculated with Fusarium solani and amplified by reverse transcription-polymerase chain reaction (RT-PCR) using specific primers. PnCYP710A The ORF was then ligated into the pGEM-T vector and clones with the target gene were obtained by sequencing;

[0013] Use restriction enzymes Eco RI and Bam HⅠ digestion of pGEM-T- PnCYP710A Vector and plant expression vector pCAMBIA2300S, the target gene fragment and vector large fragment were obtained by gel recovery; PnCYP710A The gene fragment was connected with the pCAMBIA2300S vector fragment to construct a plant overexpression vector; the constructed recombinant vector was then transformed into tobacco for expression through Agrobacterium tumefaciens-mediated transformation;

[0014] Transformants were screened using the resistance marker on the recombinant vector T-DNA, and positive transgenic plants were obtained through PCR and qRT-PCR detection. The resistance of the transgenic plants to pathogenic fungi was analyzed, and finally transgenic plants with significantly enhanced fungal resistance were screened.

[0015] The present invention provides a new method for improving plant resistance to fungal diseases. Cultivating disease-resistant plants through genetic engineering can overcome the shortcomings of traditional breeding, shorten the breeding cycle, and is simple to operate and easy to obtain highly resistant materials. PnCYP710A The gene can enhance the resistance of plants to Fusarium solani and Curvularia solani. Nicotiana tabacum ) can produce new fungus-resistant varieties and materials. Using genetic engineering technology to cultivate resistant plant varieties and materials has obvious advantages and irreplaceable importance. It not only facilitates the large-scale production of crops, flowers, medicinal herbs, etc., reducing the use of chemical pesticides, but also saves agricultural production costs and reduces environmental pollution. Therefore, this invention has broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This invention is part ofPnCYP710A PCR test results of transgenic tobacco genomic DNA, where Marker: DL2501 DNA Marker (Shanghai Jierui); positive control: plasmid pGEM-T- PnCYP710A WT: PCR reaction using total DNA of non-transgenic tobacco (wild type) as template;

[0017] Figure 2 It is part of the positive PnCYP710A Genetically modified tobacco PnCYP710A The results of expression analysis at the transcriptional level are shown in the figure, where WT is non-transgenic tobacco (wild type), OE-1 to OE-11 are PnCYP710A genetically modified tobacco;

[0018] Figure 3 In the present invention PnCYP710A Results of disease resistance identification of transgenic tobacco; Figure A is the result of inoculation with Fusarium solani PnCYP710A Transgenic tobacco leaves; Figure B is inoculated with Curvularia spp. PnCYP710A Transgenic tobacco leaves; WT is wild-type tobacco leaves, OE-1, OE-6, OE-8, OE-11 are PnCYP710A Leaves of transgenic tobacco lines. DETAILED DESCRIPTION

[0019] The present invention is further described below by means of the accompanying drawings and examples, but the scope of protection of the present invention is not limited to the contents described. In the present embodiments, the methods are operated according to conventional methods unless otherwise specified, and the reagents used are conventional reagents or reagents prepared according to conventional methods unless otherwise specified.

[0020] Example 1: PnCYP710A Full-length cDNA cloning and sequence analysis

[0021] The roots of Panax notoginseng were inoculated with Fusarium solani. The main roots and fibrous roots of Panax notoginseng plants were collected 24 hours after inoculation, ground into powder with liquid nitrogen, transferred into a centrifuge tube, and then centrifuged according to the Eastep method. ® Super Total RNA Extraction Kit Operating Instructions Extract total RNA. Using GoScript TMThe Reverse Transcriptase System synthesizes first-strand cDNA using total RNA as a template. The reaction system and operation procedures are as follows: 5 μg of total RNA is added sequentially to 1 μL of Oligo dT15 primer and 1 μL of Random primer, and the reaction volume is filled to 10 μL with Nuclease-Free Water. The reaction mixture is mixed, denatured by heating at 70°C for 5 min, and quickly cooled on ice for 5 min. Then, 4 μL of 5× Reaction Buffer, 4 μL of MgCl2 (25 mM), 1 μL of PCR Nucleotide Mix, 0.4 μL of Recombinant RNasin® Ribonuclease Inhibitor, 0.4 μL of Reverse Transcriptase, and 1.2 μL of Nuclease-Free Water are added sequentially. The mixture is mixed and briefly centrifuged. The mixture is allowed to stand at 25°C for 5 min, incubated at 42°C for 1.5 h, and then removed and heated at 70°C for 10 min to terminate the reaction. After first-strand cDNA synthesis, the reaction mixture is stored at -20°C until use.

[0022] Amplify the target gene using the synthesized first-strand cDNA as a template PnCYP710A The upstream and downstream primer sequences used were 5'ATGGAGACAATTTGGGGCATTAT3' and 5'GAAAGACGGAAATCTAGTGCACCT3', respectively. The target gene was amplified using TAKARA Ex Taq®. PCR reaction conditions were: 95°C for 5 min; 30 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min; and 72°C for 5 min. The reaction system (50 μL) consisted of 2 μL cDNA, 5 μL 10× Ex Taq Buffer (containing MgCl2). 2+ 20mM), 4μL dNTPMix (2.5mM each), 1μL upstream primer (5μM), 1μL downstream primer (5μM), 0.25μL TaKaRa Ex Taq (5U / μL), and 36.75μL ddH2O. After PCR, aspirate 8μL for 1.2% agarose gel electrophoresis to verify the specificity and size of the amplified product.

[0023] The PCR product obtained had only one DNA band. The PCR amplification product was recovered by gel excision using the SanPrep column PCR product purification kit (Shanghai Bioengineering). TA cloning was performed using the pGEM-T Vector SystemⅠ (TaKaRa) reagent. The reaction system and operation process were as follows: 4 μL of PCR product was added in sequence to 0.7 μL of pGEM-T vector, 0.9 μL of T4 DNALigase, and 5 μL of 2×Rapid Ligation Buffer. After mixing, the reaction was allowed to proceed at 16°C overnight. The ligation product was transformed into the competent Escherichia coli DH5α by the heat shock transformation method. Positive clones were screened using LB solid culture medium containing ampicillin (Amp). Several single colonies were selected and placed in LB liquid culture medium containing Amp. After the bacterial solution became turbid, the amplification PnCYP710A Specific primers for detecting multiple cloning site insertion PnCYP710A The positive clones were sequenced and the final PnCYP710A The full-length cDNA is 1518 bp, and analysis by NCBI ORF finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) revealed that it contains an open reading frame of 963 bp. PnCYP710A The protein PnCYP710A, encoding 320 amino acids, has a conserved C-22 sterol desaturase domain. The protein was analyzed using the bioinformatics software SignalP 4.1. PnCYP710A The protein sequence encoded by α-amino acid ... PnCYP710A There is no signal peptide, and subcellular localization predicts that it is localized in the cytoplasm.

[0024] Example 2: Construction of plant overexpression vector

[0025] The insert was extracted using the SanPrep column-based plasmid DNA miniprep kit (Shanghai Biotechnology Co., Ltd.) PnCYP710A E. coli plasmid pGEM-T- PnCYP710A And the plant expression vector pCAMBIA2300S plasmid, take 1 μL for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Bam HⅠ(TaKaRa) and Eco RI (TaKaRa) were used to treat plasmid pGEM-T- PnCYP710A and pCAMBIA2300S for double enzyme digestion (50 μL system). The reaction system and operation process are as follows: take 15 μL pGEM-T- PnPRPL1and pCAMBIA2300S plasmid, 7.5 μL 10× K buffer, 2.5 μL Bam HI, 2.5 μL Eco RI, 17.5 μL ddH2O, mixed well and centrifuged briefly, then placed in a 37°C water bath for 3 hours. All digestion products were subjected to agarose gel electrophoresis and then purified using the SanPrep column DNA gel recovery kit (Shanghai Biotech). PnCYP710A The fragment and the large fragment of pCAMBIA2300S vector were recovered by gel respectively, and 1 μL of the recovered product was used to detect the size and concentration of the recovered fragment by agarose gel electrophoresis and stored at -20°C for future use.

[0026] The recovered PnCYP710A The DNA fragment and the pCAMBIA2300S vector fragment were connected. The reaction system (20 μL) and the operation process were as follows: take 10 μL PnCYP710A The DNA fragment was added to 2μL pCAMBIA2300S vector DNA, 2μL 10×T4 DNA Ligase Buffer, 1μL T4 DNA Ligase, and 5μL ddH2O in sequence. After mixing, the mixture was centrifuged briefly and then reacted in a 16°C water bath overnight. The ligation product was then transformed into E. coli DH5α using the heat shock method and positive clones were screened using solid culture medium containing 50mg / L kanamycin (Kana). Single colonies were selected and cultured in LB liquid culture medium containing 50mg / L Kana with shaking. The bacterial liquid was used as a template for amplification. PnCYP710A PCR was performed using specific primers to select PnCYP710A The clones successfully connected with pCAMBIA2300S were cloned, and glycerol was added to the positive strains obtained by detection and stored at -80 °C for future use.

[0027] Extract and purify the pCAMBIA2300S- PnCYP710A The plant expression vector pCAMBIA2300S- was then constructed using the liquid nitrogen freeze-thaw method. PnCYP710A The steps are as follows: take 5 μL of pCAMBIA2300S- PnCYP710AThe plasmid was added to a centrifuge tube containing 50 μL competent cells, mixed gently and placed in an ice bath for 30 minutes, then transferred to liquid nitrogen and frozen for 2 minutes, then quickly placed in a 37°C water bath for 5 minutes, and then placed in an ice bath for 2 minutes. After that, 500 μL of LB liquid culture medium was added and cultured at 28°C with shaking for 4 hours. The activated Agrobacterium was spread on LB solid medium containing 50 mg / L Kana and 25 mg / L Rif and inverted at 28°C. Several single colonies were selected and cultured in LB liquid medium containing 50 mg / L Kana and 25 mg / L Rif with shaking, and the bacterial liquid was used as a template for amplification. PnCYP710A PCR reaction was performed with specific primers to detect pCAMBIA2300S- PnCYP710A Whether it has been transformed into Agrobacterium; for positive clones, add glycerol and store at -80℃ for later use.

[0028] Example 3: Agrobacterium-mediated plant genetic transformation and transgenic plant screening

[0029] The transgenic recipient in this experiment was tobacco. Tobacco seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, and then soaked in 0.1% HgCl₂ for 8 minutes. Washed several times with sterile water, the seeds were sown on 1 / 2 MS medium and incubated in the dark at 28°C for 5-8 days. After germination, the seeds were transferred to a light incubator (25°C, 16 h / d light). Subcultured monthly using MS medium was performed.

[0030] Take out the pCAMBIA2300S- PnCYP710A For the plasmid, 20 μL of Agrobacterium tumefaciens strain LBA4404 was inoculated into 5 mL of LB liquid medium supplemented with 50 mg / L Kana and 25 mg / L Rif and cultured at 28°C until the culture became turbid. Then, 1 mL of the turbid culture was transferred to LB solid medium supplemented with 50 mg / L Kana and 25 mg / L Rif and cultured at 28°C for 48 hours. Subsequently, an appropriate amount of Agrobacterium was scraped from the LB solid medium and inoculated into MGL liquid medium supplemented with 20 mg / L acetosyringone (AS). The culture was shaken at 28°C for 4 hours to activate the Agrobacterium.

[0031] Take the young leaves of sterile tobacco and cut them into pieces about 1cm 2 Completely immerse the leaf disc in the MGL liquid medium containing activated Agrobacterium at 25°C for 15 minutes. Blot the surface of the leaf disc with sterile filter paper and place it on a co-culture medium. Incubate at 22°C in the dark for two days. The co-culture medium for tobacco transformation consists of MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar.

[0032] After co-cultivation, leaf discs were transferred to MS selection medium supplemented with antibiotics to differentiate into seedlings, and transgenic plants were screened simultaneously. The tobacco selection medium consisted of MS + 0.5 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar + 50 mg / L Kana + 200 mg / L cefotaxime sodium salt (Cef). During the selection process, the culture flasks were transferred to a light incubator (25°C, 16 h / d light, 8 h / d dark). After budding, the tobacco plants were subcultured in MS medium supplemented with 50 mg / L Kana and 200 mg / L Cef. Regenerated tobacco seedlings were transferred to MS medium supplemented with 50 mg / L Kana to allow rooting. Regenerated seedlings with good rooting were selected for PCR analysis.

[0033] The genomic DNA of the transgenic tobacco plant leaves was extracted by CTAB method, and 1 μL of the obtained genomic DNA was subjected to agarose gel electrophoresis to detect its integrity and concentration. PnCYP710A After the PCR was completed, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are shown in Figure 2. Figure 1 As shown, PnCYP710A A total of 21 positive transgenic plants were screened from transgenic tobacco.

[0034] Example 4: Transgenic tobacco PnCYP710A Expression analysis of β-catenin and functional analysis of fungal resistance in transgenic plants

[0035] Total RNA was extracted from the young leaves of positive transgenic plants and non-transgenic tobacco (wild type), and reverse transcribed to generate the first chain of cDNA, which was used as a template for amplification. PnCYP710A Real-time fluorescence quantitative PCR (qPCR) was performed using specific primers, and the expression of 5-mercaptoethanol in each transgenic plant was analyzed based on the qPCR results. PnCYP710A Transcriptional expression levels; total RNA extraction and reverse transcription methods were the same as in Example 1; the qPCR system consisted of 1.0 μL cDNA, 10 μL 2× Go Taq® qPCR Master Mix, 0.2 μL CXR Reference Dye, 7.6 μL RNase-Free ddH2O, 0.6 μL Primer QF (10 mM), and 0.6 μL Primer QR (10 mM). qPCR reactions were performed using the following parameters: 95°C for 3 min; 60°C for 60 s (40 cycles). qPCR reactions were repeated three times for each sample. PnCYP710A The expression level was 2 -ΔΔCtThe test results of some individual plants are as follows Figure 2 shown.

[0036] Fusarium solani and Curvularia solani preserved in the laboratory were inoculated on PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose) and cultured in the dark at 28°C for 7 days. PnCYP710A Transgenic tobacco leaves were cut from the petiole with surgical scissors. A sterile plastic pipette tip was used to create wounds of uniform size at approximately the same location on the leaves. Equal-sized mycelial blocks of Fusarium solani and Curvularia oleracea were inoculated. The treated leaves were placed on a plate covered with filter paper soaked in sterile water and cultured in a 28°C light incubator, with water added daily to keep them moist. After 7 days of culture, the leaves were collected and the disease status of the leaves of each strain was observed; the results are shown in the figure below. Figure 3 As shown in the figure, after being inoculated with Fusarium solani and Curvularia solani, the leaves of wild-type tobacco formed larger lesions, and the leaves turned yellow and rotted, while the symptoms of transgenic tobacco leaves were very mild, and the area of ​​lesions formed was much smaller than that of wild-type tobacco. Obviously, PnCYP710A Transgenic tobacco has a high level of resistance to Fusarium solani and Curvularia solani.

Claims

1. A Panax notoginseng sterol C-22 desaturase gene PnCYP710A , whose nucleotide sequence is shown in SEQ ID NO:

1.

2. The notoginseng sterol C-22 desaturase gene according to claim 1 PnCYP710A In improving tobacco resistance to Fusarium solani ( Fusarium solani )、Clavian spore ( Curvularia clavata ) application in resistance.

Images